From www.bloodjournal.org by guest on July 12, 2017. For personal use only.
Involvement of Transcription Factor Encoded by the mi Locus in the
Expression of c-kit Receptor Tyrosine Kinase in Cultured Mast Cells of Mice
By Tohru Tsujimura, Eiichi Morii, Masami Nozaki, Koji Hashimoto, Yasuhiro Moriyama, Kimiko Takebayashi,
Taizo Kondo, Yuzuru Kanakura, and Yukihiko Kitamura
The mi locus of mice encodes a member of thebasic-helixloop-helix-leucine zipper (bHLH-Zip) protein family of transcription factors(hereafter called MITF). Cultured mast cells
of mi/mi genotype (mi/mi CMCs) did not normallyrespond
t o stem cellfactor (SCF), a ligand for the c-kit
receptor tyrosine kinase. The poor response of mi/mi CMCs t o SCF was
attributed t o t h e defrcient expression of c-kit in both the
mRNA and proteinlevels. The purpose of the present study
i s t o investigate the effect of MlTF on the transcription of
the c-kitgene. First, we introduced cDNA encoding normal
(+) MlTF or mutant (mi) MITF into mi/mi CMCs using the
retroviral vector. Overexpression of +-MITF but not mCMITF
normalized the expression of the c-kit and the poorresponse
af +-MITF
of mi/miCMCs t o SCF, indicating the involvement
in the c-kit gene transactivation. Second, we analyzed the
promoter of the c-kit gene. Three CANNTG motifs recognized by bHLH-Zip-type transcription factors were conserved
between the mouse and human c-kit promoters. Among
these three CANNTG motifs, only the CACCTG motif (nt
-356 t o -351) was specifically bound by +-MITF. When the
luciferase gene under the controlof the c-kit promoterwas
cotransfected into NIH/3T3 fibroblasts with cDNA encoding
+-MITF or mi-MITF, the luciferase activity significantly increased only when +-MITF cDNA was cotransfected. The
deletion of the promoterregion containingthe CACCTG motif or the mutation of the CACCTG t o CTCCAG abolished
the transactivation effect of +-MITF, indicating that+-MITF
transactivated the c-kit gene through the CACCTG motif.
When the luciferase gene under the controlof the c-kit promoter wasintroduced into the
FMAB mastocytoma and FDCP1 myeloid cell lines, remarkable luciferase activity was observed only in FMAB cells. Thus, the involvement of +-MITF
in the c-kit transactivation appeared t o be specific to the
mast cell lineage.
0 1996 b y The American Society of Hematology.
T
mast cells. We introduced +-MITF cDNA into mi/mi CMCs
and found that the overexpression of +-MITF but not miMITF normalized c-kit transcription and the poor response
of mi/mi CMCs to SCF. Moreover, we showed that the interaction betweenthe +-MITF and the CACCTG motif in the 5'
flanking regionof the c-kit gene mediated the transactivation
effect and that the involvement of +-MITF in the c-kit expression was specific to the mast cell lineage.
HE mi LOCUS OF MICE on chromosome 6 encodes a
member of the basic-helix-loop-helix leucine zipper
(bHLH-Zip) protein family of transcription factors (hereafter
called MITF).1.2More than 10 mutants at the mi locus are
known, andhalf of them have been characterized at the
molecular
The mutant mi allele encodes MITF carrying the deletion of 1 of 4 consecutive arginine residues in
the basic d ~ m a i n . "Mutant
~
mice of rni/tni genotype exhibit
microphthalmia, depletion of pigment in both hair and eyes,
and osteopetro~is.~.~
In addition, depletion of mast cells has
been reported in mi/mi mice?-9
Despite mast cell deficiencyin mi/mi mice,mast cells
developed when spleen cells of mi/mi mice were cultured in
the presence of T-cell-derived growth factors.' The proliferative response of cultured mast cells derived from mi/mi
mice (mi/mi CMCs) to interleukin-3 (IL-3) was comparable
to that of normal (+/+) CMCs, but mi/mi CMCs did not
respond normally to stem cell factor (SCF), the ligand for
the c-kit receptor tyrosine kinase." The poor response of mi/
mi CMCs to SCF was attributed to the reduced expression
of c-kit at both the mRNA and protein levels." The expression of c-kit was also deficient in the skin of mi/mi mice." In
contrast, c-kit is normally expressed by erythroid precursors,
testicular germ cells, and some types of neurons ofmi/mi
mice." These results suggest that MITF is indispensable for
transcription of the c-kit gene in mast cells, but not in erythroid precursors, testicular germ cells, and neurons.
Transcription factors of the bHLH-Zip protein family, including MITF, recognize a consensus sequence of CANNTG
motif (any nucleotides are compatible with position N).12
We have recently shown the binding of the normal MITF
(hereafter called +-MITF) to a CACATG motifin the 5'
flanking region of the mouse mast cell protease (MMCP)-6
gene,13 whose expression was greatly reduced in both mi/mi
CMCs and mVmi skin mast ~ e 1 l s . l We
~ ~ ' also
~ showed the
loss of DNA binding ability of the mutant MITF encoded
by the mi mutant allele (hereafter called mi-MITF).I3 In the
present study, we have examined whether MITF might be
involved in the transactivation of c-kit gene expression in
Blood, Vol 88,No 4 (August 15). 1996: pp 1225-1233
MATERIALS AND METHODS
Mice. The original stock of C57BL/6-mi/+(mi/+) mice was
purchased from the Jackson Laboratory (Bar Harbor, ME) and was
maintained in our laboratory by consecutive backcrosses to our own
inbred C57BL16 colony (more than 12 generations atthe time of
the present experiment). Female mi/+ mice were crossed with male
mi/+ mice, and the resulting mi/mi mice were selected by their white
coat
Cells. Pokeweed mitogen-stimulated spleen cell conditioned
medium (PWM-SCM) was prepared according tothemethod described by Nakahata et
Mice of mumi genotype and their normal
(+I+)littermates were used at 2 to 3 weeks of age to obtain CMCs.
Mice were killed by decapitation after ether anesthesia and spleens
From the Departments of Pathology and Internal Medicine U ,
Medical School and the Research Institute for Microbial Diseases,
Osaka University, Suita, Japan.
Submitted December 6, 1995; accepted April 3, 1996.
Supported by grants from the Japanese Ministry of Education,
Science and Culture and the Japanese Ministry of Health and Welfare, and by the Medical Research Award from the Japan Medical
Association.
Address reprint requests to Yukihiko Kitamura, MD, Department
of Pathology, Osaka University Medical School, Yamada-oka 2-2,
Suita 565, Japan.
The publication costsof this article were defrayedin part by page
chargepayment. This article must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. section 1734 solely to
indicate this fact.
0 I996 by The American Society of Hematology.
0006-4971/96/8804-0005$3.00/0
1225
From www.bloodjournal.org by guest on July 12, 2017. For personal use only.
1226
were removed. Spleen cells derived from m i h i or +/+ mice were
cultured with a-minimal essential medium (a-MEM; ICN Biomedicals,CostaMesa,CA)supplementedwith10%PWM-SCMand
10%fetal calf serum (FCS; Nippon Bio-Supp Center, Tokyo, Japan).
Half of the medium was replaced every 7 days, and more than 95%
of cells were CMCs 4 weeks after the initiation
of the culture.16
The helper virus-free packaging cell line (92)’’ was maintained
in
Dulbecco’s modification of Eagle’s medium (DMEM; ICN Biomedicals) supplemented with 10% FCS. The NIW3T3 fibroblast cell line
wasgenerouslyprovided
by Dr S.A. Aaronson(NationalCancer
Institute, Bethesda, MD) and maintained in DMEM supplemented
with10%FCS.TheFMA3mousemastocytomacellline’”was
generously given by Dr H. Hasegawa (The Nishi-Tokyo University,
Yamanashi, Japan). FMA3 cells were adapted to grow
in a-MEM
supplemented with 10% FCS. The FDC-PI mouse IL-3-dependent
myeloid cell line” was maintained
in a-MEM supplemented with
10% PWM-SCM and 10% FCS.
Construction of retrovirusvectorandits
infection. Bluescript
KS (-) plasmids(pBS;Stratagene,LaJolla,CA)containing
the
whole coding regions of +-MITF or mi-MITF (pBS-+-MITF and
pBS-mi-MITF,respectively)hadbeenconstructed
in ourlaboratory.” A retroviral vectorpM5Gneo,2” a derivative of myeloproliferative sarcoma virus vector, was a kind gift of Dr W. Ostertag (Universitat Hamburg, Hamburg, Germany). The purified Sma I-HincII
fragment from pBS-+-MITF or pBS-mi-MITF was introduced into
the bluntedEcoRIsite of pM5Gneo. The resulting pM5Gneo-+MITF and pMSGneo-mi-MITF were transfected into the packaging
cell line (92) by the calcium phosphate method,” and neomycinresistant 9 2 cell clones were selectedby culturing in DMEM supplemented with 10% FCS and G418 (0.8 mg/mL; GlBCO BRL, Grand
Island, NY). For gene transfer, either spleen cells obtained frommi/
mi mice or FDC-P1cellswereincubatedonirradiated(30
Cy)
subconfluent monolayer of virus-producing $2 cells for 72 hours in
a-MEM supplemented with 10% PWM-SCM and 10% FCS. Neomycin-resistant CMCsor FDC-P1 cells were obtained by continuing
the culture in a-MEM containing 10% PWM-SCM, IO% FCS, and
G418 (0.8 mg/mL) for 4 weeks.
Northern blotting analysis. Total RNAs
of cells were prepared
by lithium chloride-urea method,** and poly(A)+ RNAs were
purified
by Oligotex-dT30 (Japan Synthetic RubberNippon Roche, Tokyo,
Japan).Thefragments of mouse +-MITF(nucleotide[nt]433to
Il76).’and0-actid4cDNAswere
used as probesafterbeing
labeledwitha-[’*P]-deoxycytidinetriphosphate(dCTP;DuPont/
I O mCi/mL) by random oligoNEN Research Products, Boston, MA:
nucleotide priming. After hybridization at 42°C blots were washed
to a final stringency of 0.2X SSC (IX SSC is 150 mmol/L
NaCl
and 15 mmol/L trisodium citrate, pH 7.4) at 50°C and subjected to
autoradiography.
Immunocytochemistry by anti-MITFantibody.ArabbitantiMITF antibody was preparedin our lab~ratory.*~
Immunocytochemistry
was
performed
as described
by
Takebayashi
et
with a
minor modification. Briefly,cellswerecytocentrifugedand
fixed
with 4% paraformaldehyde for 30 minutes at 4°C. After microwave
treatment (H2500 Microwave Processor; Bio-Rad Laboratories, Hercules,CA)in
0.01 m o l L citratebuffer(pH6.0)for
3 minutes,
specimens were stained with the rabbit anti-MITF antibody.”
Flow cytometry. Cells were incubated first with rat antimouse ca gift of DrS.I. Nishikawa
kit (ACK2) monoclonal antibody (MoAb),
(Kyoto University, Kyoto, Japan) at 4°C for 30 minutes, rinsed, and
then stained with fluoresceinisothiocyanate-conjugated rabbit antirat
Ig antibody(DAKO A / S , Glostrup,Denmark).Cellswererinsed
and analyzed on a FACScan (Becton Dickinson, Los Angeles, CA).
[ZH]-thymidine incorporation. Proliferation of CMCs was quantified by [’HI-thymidine incorporation as previously described.” The
exponentially growing cells were washed twice with
a-MEM, and
triplicatealiquots of cells (5 X IO4) suspended in 200 pL of
TSUJIMURA ET AL
Cosmedium-001 (Cosmo Bio CO, Tokyo. Japan)
were cultured in
96-well microtiter plates for
48 hours at37°C with various concentrations of recombinant mouse IL-3 (rmIL-3)
or rmSCF. rmIL-3 and
rmSCF were generous gifts
of Kirin Brewery COLtd (Tokyo, Japan).
At 48 hours after initiation of the culture, 0.5 pCi [’HI-thymidine
(specific activity, 5 Ci/mmol;Amersham,ArlingtonHeights,
1L)
was added to each well. Five hours after the additionof [’Hi-thymidine, the cells were harvested
with a semiautomatic cell harvester
(Pharmacia LKB Biotechnology, Uppsala, Sweden) and the incorporation of [’HI-thymidine wasmeasuredwitha
liquid scintillation
counter. Three independent experiments were performed.
1.solation of genomic clones and sequencing. The hEMBL3 genomic library prepared from a partial Sau3A digest of 129/Sv strain
m o u ~ liver
e
DNA was used for
~creening.~’ The
272-bp Sac I-RamHI
fragment representing the 5‘ sequence of the c-kit cDNA was prepared from the full-length c-kit cDNA kindly provided by Dr S.I.
Nishikawa (Kyoto University).In total, 8 X 10’ clones were screened
by plaque hybridization using the
Sac I-BamHI fragment ofc-kif
cDNAlabeledwitha-[”PJ-dCTPasa
probe. DNAs of positive
clones were purified after three sequential rounds of screening. Inserts were subcloned into the plasmid pUC19 for further analysis.
Nucleotidesequence was determined by Model373ADNAsequencer (Applied Biosystems, Foster City, CA) using Taq dye deoxyterminator cycles sequencing kit (Applied Biosystems).’x
Electrophoretic gel mobility shifi assay (EGMSAJ. The productionand purification of glutathione-S-transferase(GST)-+-MITF
and GST-mi-MITF fusion proteins were described previously.’’ Oligonucleotides were labeled with a-[’*P]-dCTP by tilling S’-overhangs and used as probes of EGMSA. DNA-binding assays were
performed in a 20 pL reaction mixture containing I O mmol/L TrisHCI (pH 8.0), l mmol/L EDTA, 75 mmol/L KCI, I mmol/L dithiothreitol, 4% Ficoll type 400, 50 ng of poly (dI-dC), 25 ng of the
labeled DNA probe, and 3.5 mg of GST-+-MITF or GST-mi-MITF
fusion proteins. Aftertheincubationat
room temperaturefor 15
minutes, the reaction mixture was subjected to electrophoresis at 14
V/cm at 4°C on a 5 8 polyacrylamide gel in 0.25X TBE buffer ( I X
TBE is 90 mmol/L Tris-HCI, 64.6 mmol/L boric acid, and
2.5 mmol/
L EDTA, pH 8.3). The polyacrylamide gels were driedon Whatman
3MM chromatography paper (Whatman, Maidstone, UK) and subjectedtoautoradiography.CompetitiveDNA-bindingassays
were
performed as described above, except that the unlabeled competitive
DNA was added to the reaction mixture before the additiono f GST+-MITF fusion proteins.
Construction vf eflector and reporter plasmids. pEF-BOSexpression vector’y was kindly provided by Dr S. Nagata (Osaka Bioscience Institute, Osaka, Japan).The Sma I-Hind1 fragment of pBS+-MITF or pBS-mi-MITF was introduced into the blunted
Xba I
site of pEF-BOS. The resulting pEF-+-MITF and pEF-mi-MITF
expression vectors were used as effectors. The luciferase gene subcloned into pSP72 (pSPLuc)”’ was generously provided
by Dr K.
Nakajima(OsakaUniversityMedicalSchool,Osaka,Japan).
TO
construct reporter plasmids, a 655-bp (nt -622 to
+33, + I shows
transcription initiation site)” Pvu 11-Sac I or a 251-bp (nt -21 8 to
+33) BarnHI-Sac 1 fragment of the c-kit gene was introduced into
upstream of the luciferase gene in pSPLuc.
Transientcoexpression assay. NIH/3T3(5 X IO5) cellswere
plated in a 10-cm dish I day before the procedure. Cotransfection
with 10 pg of areporter,100 ng of aneffector,and2
p g ofan
expressionvectorcontaining
the &galactosidasegene
was performed by the calcium phosphate precipitation
method.” The expressionvectorcontainingthe0-galactosidasegenewas
used asan
internal control. The cells were harvested 48 hours after the transfection and lysed with 0.1 moVL potassium phosphate buffer (pH 7.4)
containing 1% Triton X-100. Extracts were then used to assay the
luciferase activity with a luminometer LB96P (Berthold GmbH. Wildbad, Germany) and the P-galactosidase activity. The luciferaseac-
From www.bloodjournal.org by guest on July 12, 2017. For personal use only.
mi TRANSCRIPTION FACTOR
tivity was normalized by the 8-galactosidase activity and total protein concentration according to the method described by Yasumoto
et al." The normalized value was divided by thevalue obtained
from the cotransfection with a reporter and pEF-BOS and was expressed as the relative luciferase activity.
Transfection of luciferase gene into hematopoietic cell lines. Reporter plasmids, a 655-bp (nt -622 to +33) PIJN11-Sac I fragment
containing either the CACCTG motif or the mutation at the CACCTG motif (to CTCCAG). were digested with Sca 1. The linearized
plasmids ( 1 0 0 pg) and pSTneoB ( I pg) were added to cell suspension ( I X 10') in 0.7 mL phosphate-buffered saline (PBS), mixed
gently, and incubated on ice for 10 minutes. For gene transfer, FMA3
and FDC-PI cells were electroporated by a single pulse (975 pF,
350 V) from Gene Pulser I1 (Bio-Rad Laboratories). After incubation
on ice for 10 minutes, the cells were suspended in 10 mL complete
culture medium. Two days after the electroporation, 800 pglmL of
G418 was added to thecomplete culture medium toselect neomycinresistant cells. When neomycin-resistant cells proliferated, the cells
( I X 10') were harvested and lysed with 0.1 moln potassium phosphate buffer (pH 7.4) containing 1 8 Triton X-100. Extracts were
then used to assay the luciferase activity with a luminometer LB96P.
Rever.se transcriptase modification of polymerase chain reaction
(RT-PCR). Various amounts of total RNA (5.0.0.5, 0.05, and 0.005
p g ) obtained from FMA3 and FDC-PI cells were reverse transcribed
in 20 pL of the reaction mixture containing 20 U of avian myeloblastosis virus reverse transcriptase (Boehringer Mannheim GmbH
Biochemica) and random hexamer. One microliter of each reaction
product was amplified in 25 pL ofPCR mixture containing 0.125
U of Tuq DNA polymerase (Takara Shuzou, Kyoto. Japan) and 12.5
nt 1051
pmol each of sense (S'-CTGATCTGGTGAATCGGATC-3',
to 1070)' and antisense (5"TCCTGA AGAAGAGAGGGAGC-3'.
nt 1422 to 1 4 4 1 ) ' primers for MITF gene by 30 cycles of 1 minute
2
of denaturation at94°C. 2 minutes of annealing at55°C.and
minutes of synthesis at 72°C. Ten microliters of the PCR products
was electrophoresed in 1.0% agarose gel containing ethidium bromide.
Statistical analysis. The Student's t-testwasused
to evaluate
the significance of the ['HI-tymidine incorporation and the luciferase
activity.
1227
A
MITF
c- kit
B
'
Effect of introduction of MITF cDNA. The expression
of c-kit was significantly lower in m i h i CMCs than in +/
+ CMCs.'" We examined whether the introduction of +MITF cDNA into m i h i CMCs normalized the c-kit expression. Northern blotting analysis showed that the expression
of introduced +-MITF or mi-MITF cDNA was apparent in
m i h i CMCs, whereas the mRNA expression of the endogenous mi gene was hardly detectable in either +/+ CMCs or
mi/mi CMCs (Fig 1A). To know the proportion of CMCs
that were infected with the retrovirus, we stained various
CMCs withthe anti-MITF antibody. Althoughintact +/+
and m i h i CMCs were not stained with the antibody due to
the low content of +-MITF or mi-MITF, practically all mi/
mi CMCs treatedwiththe retrovirus containing either +MITF or mi-MITF cDNA were stained with the antibody
(data not shown).
Overexpression of +-MITF in mi/mi CMCs resulted in
the normalization of both c-kit mRNA and protein
expression
(Fig 1A and B). In contrast, the introduction of mi-MITF
cDNA did not affect c-kit expression in m i h i CMCs. Proliferative responses to rmIL-3 or rmSCF of +/+ CMCs, mi/
mi CMCs, mi/mi CMCs overexpressing +-MITF, and mi/
.
m i h i CMCs
-
0 - l
RESULTS
+/+ CMCs
m i h i CMCs overexpressing +-MITF
m i h i CMCs overexpressing mi-MlTF
'1
1
Relative Log Fluorescence
Fig 1. Normalization of the c-kit expression in m i h i CMCsby
introduction of +-MITF cDNA. (AI Northern blot. The blot was hybridized with 32P-labeled cDNA probe of MITF, c-kit, or p-actin. The pactin probe was used to verifv that an equal amount was loaded in
each lane. (B) Flow cytometry to demonstrate the surface binding of
the anti-c-kit ACK2 MoAb to various CMCs. CMCs were incubated
with either ACK2 MoAb (-) or negative control antibody (---).
mi CMCs overexpressing mi-MITF were measured by the
incorporation of ["]-thymidine. The proliferative response
of m i h i CMCs to rmIL-3 was comparable to that of +/+
CMCs, and the overexpression of +-MITF did not affect the
proliferative response of rni/rni CMCs to rmlL-3 (Fig 2A).
From www.bloodjournal.org by guest on July 12, 2017. For personal use only.
1228
TSUJIMURA ET AL
A
2.0-
1.5h
p
S
1.0-
X
E
8
v
C
0
.-c
E
0.5-
OlM
E
h\
0
0
2
.-
E,
1.5-
=
1.0-
e
c3
I
I
I
l
0.1
1
10
100
Concentration of rmlL-3 (nglmL)
Y
I
0.5
r~
0
0
0
0
W
1
.
~
1
l0
l00
Id00
Concentration of rmSCF (ng/mL)
1
+/+CMCs
mi/miCMCs
mVmi CMCs overexpressing +-MITF
mymi CMCs overexpressing miMlTF
Fig 2. Normalization of the poorresponse of m i h i CMCs to
rmSCF by the overexpression of +-MITF. Proliferative response to
various concentrations of rmlL-3 (AI or rmSCF (B) was measured by
the incorporationof [‘HI-thymidine. Three independent assays were
performed with comparable results, and the values of a representative experiment are shown. Eachpoint represents the mean of triplicate samples. Barsare standard errors. In some points, the standard
error was too small to be shown by bars. Asterisksindicatethe presence of the statistical significance ( P < ,011.
In contrast, the overexpression of +-MITF but not mi-MITF
normalized the poor responseof m i h i CMCs to rmSCF(Fig
2B).
Sequencing of S’ junking region of c-kit. A mouse genomic DNA library was screened for clones containing the 5’
flanking region of the c-kit gene by using the Sac I-BamHI
fragment of c-kit cDNA. Two overlapping clones (KIT-l0
and KIT-12) that hybridized to thec-kit exon 1 and four
overlapping clones (KIT-13, KIT-14,KIT-19, and KIT-l 8)
that hybridized to the c-kit exon 2 were isolated, and KITI2 was used for the furtheranalysis. The length of the cellular DNA inserted in KIT-l2 was approximately 30 kb. By
restriction mapping and hybridization analysis, the upstream
DNA sequence of the c-kit exon 1 was found to be located in
the 6%-bp Pvu 11-Sac I fragment of KIT-12. The nucleotide
sequence of the 5‘ flanking region of the mouse c-kit gene
is shown in Fig 3. Although six CANNTGmotifs were found
in the S ’ flanking region of the mouse c-kit gene, only three
CANNTG motifswere conserved betweenthe mouse and
human c-kit genes,” ie, CACCTG motif (nt -356 to -35 I
of thec-kit gene, + I shows transcriptioninitiation site).
CAGGTG motif(nt -349 to -344),
and CACTTG motif
(nt +2 to +7; Fig3). In addition to theconservation of
CANNTG motifs, the surrounding sequence
of the CACCTG
andCAGGTGmotifs (nt -374to -334) and that of the
18) werehighly conserved
CACTTG motif(nt -32to
between the human and mouse c-kit genes (93% and 98%’.
respectively).
Binding qf MITF. EGMSAwas performedwith each
oligonucleotide probe containing the CANNTG motif(s) to
examine whether +-MITF practically bound the CANNTG
motif(s) in the c-kit promoter. The S’-AGGGAGCCACCTGCCAGGTGGCTGGC oligonucleotide containingtwo hexameric motifs (probe 1 ; the hexameric motifs are shown by
theunderlines) and the S‘-GCTCGGTGCACTTGGGCGAGAGC oligonucleotide
containing
hexameric
a
motif
(probe 2) were synthesized and labeled. EGMSA was performed using GST-+-MITF or GST-mi-MITFfusion protein
and each probe (Fig 4). No retarded band was observed in
the sample that contained no proteins (probe only; data not
shown). A retarded band was observed in the sample containing the probe 1 and GST-+-MITF but not in the sample
containing the probe 1 and GST-mi-MITF (Fig 4). In contrast
by neither GST-+to the probe I , the probe 2 was bound
MITF nor GST-mi-MITF (Fig 4).
To examine the specificity of the binding of the GST-+MITF to probe 1, we added unlabeled oligonucleotide 1 that
had theidentical sequence with probe 1 (oligo 1; Fig 5A)
to thereactionmixturecontainingthe
GST-+-MITF and
probe 1. The binding of the GST-+-MITF to probe 1 was
completely inhibited (Fig 5B). We then performed competition binding with oligonucleotide 5 in which both hexameric
motifs in the probe 1 were mutated (oligo 5 of Fig 5A). The
addition of unlabeled oligo 5 did not affect the binding of
GST-+-MITF to probe 1 (Fig SB). Becauseprobe I contained two hexameric motifs, we investigated which hexameric motif was necessary for thebinding of the GST+-MITF.
Two probesweresynthesized
andlabeled;theCAGGTG
motif wasmutated toCTGGAG in the probe 3, andthe
CACCTG motif was mutated to CTCCAG in the probe 4
(FigSA). In the lanecontainingthe GST-+-MITF fusion
protein and the probe 3, a retarded band was observed (Fig
SB). To examine the specificity of binding, we added unlabeled oligonucleotide 3 that had the identical sequence with
reactionmixture
theprobe 3 (oligo 3 of FigSA)tothe
containing the GST-+-MITF and the probe 3. The binding
of the GST-+-MITF to the probe 3 was completely inhibited
(Fig 5B). In contrast, the addition of the unlabeled oligo S
did not inhibit the binding of the GST-+-MITF to the probe
+
From www.bloodjournal.org by guest on July 12, 2017. For personal use only.
mi TRANSCRIPTION
1229
pvul I
(HHHHW
(HHHHW
.. .. .. .. .. .. .. ..
.. .. ..
.. .. .. .. .. .. ..
.. .. ..
Mouse -625 cagctgtattcttacaggtttcgcagcaggt~agaaactgagcatgaaaaattacttaaaacgtgggctcggtc
Hunan
gcggaggccacgccgaccaataggaacccectgtgttcctacaggttacgaagcaggtggagaaattgagcagaa
iHHHHHt
..
.. .. .. ..
.. .. .. .. .. .. .. .. .. .. .. ..
t taccgcggtgccaggagctcctaacaggcctggaggggaatgtcgggg
Mouse -550 t t t t a c t g a g g t c a g g g g t g a c g a t c c g t c c t c c t c t a a g t
Humn
acaatta&aaaccgggctcagt
.. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. ..
Youse -475 ttcctaatcccttcgcccggcaatcccgactagtaacacctccaccataagcaatatattctccccgctccgg
ctcaatttcctaacgctcccctccccatccccatgccacctccacgagcagcggcgtccagcctcctcccgcccg
Hunan
...........
...........
Mouse -400 agcttgctggagggaccggtggttgtcctttattatctaaaQ
gctwcccotacc-
Hunan
"XX:
..................................
..................................
aacgtgctcgaggggcgggcagtcgacctttattgtctgggggg
iHHHHHt
....................................................
....................................................
taacgtgtgcgtggtgaxagcttcacaaagcgagqggcagtccttggtccgggaa~tcagcctgg
Mouse -330 taatgcgctcgtggcgctgggcttcacaaagcg-cgggcagcacctgcgtgg-ccagccagccgcctggactga
HuMn
&m HI
Youse -258 aggaccaccgatgg"agggaga-gtgctaggaggaagaggatcc"-------agggtga-agggcctgt
...................
.................
....
....
Hunan
...........
...........
ccgtccacatcccaggggtggaaaggtggagagagaaaagg
tattgcagcccgagagccqggcactaggc
.................................
.. .. .. .. .. .. .. .. .. .. ..
.................................
~tcctcct~~acagc~attaacacgtcgaa-wgca-
Mouse -200 gggggctcctggtct tagagggcac-atcagct
Fig 3. Comparison of 5' promoter
region
between
the
mouse and human c-kit genes.
CANNTGmotifsareshownby
asterisks. Two highly conserved
regions
are
underlined,
and
three
completely
conserved
CANNTG motifs are boxed. The
major
tranrcription
initiation
siteisindicatedbyanarrowhead, and the translation initiation codonsareindicated
by
dots. The sites of representative
restriction
enzymes
(Aru II,
BamHI, and Sac I) ara shown.
Verticallineswereintroduced
for optimal alignment.
Hunan
.............................
.............................
Youse -125 a g c g g g a g g g a g t g c g a c c c g g g c - - - - - g g g a g a a g - g g a
..................
..................
Hunan
Mouse
gccgggaagaagcgagacccgggcgggcgcgagggaggggt-gMa
-65 IWgc-tggaggaggggctgtcgcgcgcogctagtm
- tct
Hunan
G
C
ic
G
w
I
You.Se
Hunan
7+MH)
L
................................................................
................................................................
gggcgctgggaggaggggctgctgctcgccgctcgc
W
- tct
+7
Sec1
GGCGAGAGCTGTAGCAGAGAGAGGACCTCAGAGTCTAGCGCAGCCACC~~
s ........................................
........................................
GCTGGGGATCCCATCGCAGCTACCGCGAA~
sac I
3 (Fig 5B). No retarded band was detectable in the lane
containing the GST-+-MITF fusion protein and the probe 4
(Fig 5B). Taken together, although there were three conserved CANNTG motifs (CACCTG, CAGGTG, and CACTTG motifs) in 5' flanking region of the c-kit, +-MITF
bound only the CACCTG motif.
Transactivation effect of MITF on the c-kit promoter.
We performed the transient coexpression assay to examine
whether the CACCTG motif of the c-kit 5' flanking region
mediated the transactivation ability of MITF. The promoter
region and the first exon of c-kit gene (nt -622 to +33)
was cloned upstream from the luciferase gene. The cDNA
encoding +-MITF or mi-MITF was cotransfected into NIW
3T3 fibroblasts with the luciferase gene under the control of
the intact c-kit promoter containing the CACCTG motif.
The coexpression of +-MITF but not mi-MITF significantly
increased the luciferase activity (Fig 6). A part of the pro-
moter containing the CACCTG motif(nt -622 to -219)
was then deleted. The deletion abolished the transactivation
ability of +-MITF (Fig 6). Moreover, the mutation of the
CACCTG motif to CTCCAG also abolished the transactivation ability of + - M m (Fig 6).
Specificity of mast cell lineage. We examined whether
the transactivation of the c-kit gene induced by the +-MITF
was specific to the mast cell lineage. Although mast cells
proliferate even after the morphological differentiation, hematopoietic cells belonging to other lineages die after the
differentiati~n.~~
Therefore, weused the FDC-P1 myeloid
cell line instead of primary myeloid cell cultures. As a control, the FMA3 mastocytoma cell line was used. We introduced the luciferase gene under the control of the c-kit
promoter containing the CACCTG motif into FMA3 and
FDC-P1 cells with electroporation. The luciferase activity
was significantly higher in FMA3 cells than in FDC-P1 cells
From www.bloodjournal.org by guest on July 12, 2017. For personal use only.
TSUJIMURA ET AL
1230
-338
-362
t
t
A
Probe 1 5'-AGGGAG CACCTGCCAGGTG GCTGGC-3'
-7
+l6
Probes
-356
-362
probe 1
5"AGGGAGCACCTGCCAGGTGGCTGGC-3'
Probe 2 S-GCTCGGTGCACTTGGGCGAGAGC-3'
probe 35"AGGGAGCACCTGCCSGGZGGCTGGC-3'
t
t
probe 4
-338
t
r l
5"AGGGAG CkCzGCCAGGTG GCTGGC-3'
Competitors
oligo 1
t
1
I
F
1
5"AGGGAG
CACCTGCCAGGTG
GCTGGC-3'
oligo 35'-AGGGAGCACCTGCCTGGAG
oligo 5
5-AGGGAG
GCTGGC-3'
CSC
GCTGGCJ'
CIGC
B
Probe
1
3
I
I
i
4
n
Fig 4. EGMSA using GST-+-MITF and GST-mCMITF fusion proteins. The 5'-AGGGAGCACCTGCCAGGTGGCTGGC oligonucleotide
containing two hexameric motifs (probe 1, n t -362 t o -338, the
numbers refer t o the sequence shown in Fig 31 and the 5"GCTCGGTGCAClTGGGCGAGAGC oligonucleotidecontaining a hexameric
motif (probe2, n t -7 t o +16) were used (hexameric motifs are shown
by the underlining). The DNA-protein complex is indicated by an
arrowhead.
(Fig 7A). The mutation at the CACCTG motif to CTCCAG
in the c-kif promoter abolished the luciferase activity in
FMA3 cells (Fig 7A).
There is a possibility that FDC-PI cells did not express
the +-MITF. The expression of +-MITF mRNA in FMA3
and FDC-pI cells was examined by RT-pCR. The +"ITF
signal was detected in F M A ~c e ~ l s when 0.005 yg of tota~
RNA was Used as the starting material, whereas 0.05 pg Of
total RNA from FDC-PI Cells was necessary to detect the
+-MITF signal. The magnitude of +-MITF signal after
app~ying 0.05 l.lg of total RNA from FMA3 cells was cornparable with that Of the signal after app1ying 0'5 p6 Of total
RNA fl'om FDC-PI cells (Fig 7B). The introduction of the
luciferase gene did not affect the expression of +-MITF in
FMA3 and FDC-pI cells (data not shown), Because the
magnitude of +-MITF expression
in FDC-PI c e l ~ s was
smaller than that of FMA3 cells, we introduced the +-MITF
cDNA into FDC-PI cells using the retroviral vector and
examined whether the overexpression of +-MITF upregu-
Fig 5. The binding of +-MITF t o the CACCTG motif in 5' flanking
region Of the c-kit gene. (A) Probes and competitors. The probe 1
containedthe CACCTG and CAGGTG motifs; theprobe3 had the
mutation at the CAGGTG motif (to CTGGAG); and the probe4 had
the mutation at the CACCTG motif (to CTCCAG; the numbers refer
to the sequence shown in Fig 3). Three competitors were synthesized. The oligo 1 was identicalt o the probe1; the oligo 3 is identical
t o the probe 3; and the oligo 5 had two mutations. ie. the CACCTG
motif (toCTCCAG) and the CAGGTG motif (toCTGGAG). The regions
containing two hexameric motifs are boxed. The hexameric motifs
are shown by the underlining, and mutated nucleotides are shown
by the asterisks. (B)The competitive DNA-binding assay with GST+-MITF. Probes and competitors in each reaction mixture are shown.
The DNA-protein complexs are indicated by an arw-had.
From www.bloodjournal.org by guest on July 12, 2017. For personal use only.
1231
mi TRANSCRIPTIONFACTOR
c-kit Promoter
Relative Luciferase Activity
CACCTG
0
1
2
3
I
I
I
I
I
Fig 6. The effect of coexpression of +-MITF or mi"ITF cDNA on
the luciferase activity under the control of the normal, deleted, or
mutated c-kit promoter. The effect of the deletion containing the
CACCTG motif (nt -622 t o -219) and the mutation at theCACCTG
motif (to CTCCAG) on the luciferase activity was measured. Bars
indicate the standard
error of three assays. In some cases, the standard error was too small to be shown by bars. * P < .01 by t-test
when compared with the values obtained from the cotransfection
with the luciferase gene under the control of the normal c-kif promoter andpEF-BOS.
lated the expression of the c-kit gene. Evenwhen the +MITF was overexpressed, thec-kit expression washardly
detectable in FDC-PI cells (data not shown).
DISCUSSION
The expression of the c-kit was significantly lower in mi/
mi CMCs than in +/+ CMCs."' The poor proliferative response of m i h i CMCs to SCF was attributable to the deficient expression of the c-kit. Moreover, the c-kit expression
was also deficient in m i h i skin mast cells." In the present
study, we introduced cDNA encoding +-MITF or mi-MITF
into m i h i CMCs with retroviral vector and found that the
overexpression of +-MITF but not mi-MITF normalized the
c-kit gene transcription and the poor response of m i h i
CMCs to SCF. This clearly indicated that the deficiency of
c-kit expression in m i h i CMCs was due to an abnormality
of the MITF.
We sequenced the 5' flanking region of mouse c-kit gene
to analyze the transactivation mechanism of the +-MITF.
Although six CANNTG motifs were present in the 5' flanking region (nt -625 to +62) of the mouse c-kit gene, only
three CANNTG motifs were conserved between the mouse
and human c-kitgenes. Among these three CANNTG motifs,
only the CACCTG motif (nt -356 to -351) was specifically
bound by +-MITF. In contrast to +-MITF, mi-MITF did not
bind this CACCTG motif. The luciferase gene underthe
control of the c-kit promoter was cotransfected into NIH/
3T3 fibroblasts with cDNA encoding +-MITF or mi-MITF.
The luciferase activity significantly increased onlywhen
cDNA encoding +-MITF was cotransfected. This suggested
that +-MITF but not mi-MITF transactivated the c-kit gene
through the promoter region. Furthermore, either the deletion
of the region containing the CACCTG motif or its mutation
abolished the transactivation of +-MITF. Therefore, the +MITF appeared to transactivate thec-kit gene by direct
binding to the CACCTG motif. However, there is another
possibility that may explain the present result. The enhanced
c-kitmRNA expression in the m i h i CMCs that overexpressed +-MITF may be attributable to the increase in the
half-life of the c-kit mRNA.
Yasuda et al" characterized the c-kit promoter ofmice
and showed three short regulatory regions (nt + I to -44,
nt -44 to -81, and nt -81 to - 105) that functioned in ckit-positive cell lines, the HEL human erythroleukemia cell
line, and the IL-3-independent Cl .MC/CS7.1 mouse mast
cell line. The deletion of Pvu 11-BomHI region (nt -622 to
-2 19) containing the CACCTG motif did not influence the
transactivation of the reporter gene in the HEL and Cl.MC/
CS7. I cell lines?' This is inconsistent with the present result
thatthe deletion apparently abolished the transactivation
ability of +-MITF. The HEL cell line is derived from erythroleukemia cells. and the c-kit was normally expressed by
erythroid precursors of m i h i mice." Therefore, thec-kit
expression may not be regulated by +-MITF in HEL cells.
Because Cl .MC/CS7.1 cells proliferate without IL-3.'5 there
is a possibility that several genes have been alteredfor taking
the growth advantage. The MITF does not appear tobe
involved in the expression of c-kitgene in CI.MC/C57.1
cells despite the mast cell origin.
The W'" is a mutant allele at the W (c-kit) locus of mice.'
but no significant abnormalities were found within the c-kit
coding region of the W'" allele.'" The W'" mutation is sup-
A
Luciferase Activity ( x l0'4 )
c-kit Promoter
CACCTG
*
FMAB
IJ FDC-P1
B
M
1
2
3
4
5
6
7
8
I
4
MlTF
Fig 7 . Luciferase activity and MlTF expression in FMAB and FDCP1 cells. Equimolar amounts of the luciferase genes under the control
of the c-kit promoter containing
either the normalCACCTG motif or
the mutation at the
CACCTG motif t o CTCCAG were introduced into
the FMA3 mastocytoma and FDC-P1 myeloid cell lines with electroporation. (A) Luciferase reporter gene promoter assay. The luciferase
activity, from which the
background value obtained fromparent cells
had been subtracted, is shown. The data represent the mean k SE
of three experiments. * P < .01 when compared with the value of
FDC-P1 cells by t-test. (B) RT-PCR analysis for theexpression of MITF
mRNA. PCR products from RNAs of FMAB cells (lanes 1 through 41
and from RNAs of FDC-P1 cells (lanes 5 through 8 ) were electrophoresed in 1.0% agarose gel containing ethidium bromide with Haellldigested Bluescript KS (-1 plasmid DNAas a size marker (M).
Amounts of RNA used for thereverse transcription were5.0 p g (lanes
l and 51, 0.5 p g (lanes 2 and 6). 0.05 p g (lanes 3 and 71, and 0.005
p g (lanes 4 and 81, respectively.
From www.bloodjournal.org by guest on July 12, 2017. For personal use only.
1232
TSUJIMURA ET AL
posed to locate in the region regulating the c-kit expression.36.37 Mice of Wh/Whgenotype have a nearlynormal
number of erythrocytes and germ cells, buttheyshow
a
remarkable depletion of mast
The magnitude of the
mast cell deficiency was more severe in W”/Whmice than
in mumi mice.9s3h
The number of mast cells in the skin correlates with the magnitude of c-kit gene expression. Undetectable c-kit transcripts were observed in W h W hCMCs even
by using RT-PCR.3hOn the other hand, a weak but apparent
band representing the c-kit mRNA was detectable by Northern blot analysis of mUmi CMCs (Fig 1). Recently, the molecular legion associated with the W” allele wasroughly
ider~tified.~’
The W” mutant allele possesses an inversion of
a small segment of chromosome 5 , whose break points lay
very far from the c-kit coding region.” However, the mechanism of defective c-kit expression as a result of the W”
mutation has not been examined in detail, and it is not clear
whether MITF is involved.
Hematopoietic stem cells also express kit."^'^ When
stem cells differentiate into mast cells, the expression of ckit appears to increa~e.~’
Even mature mast cells strongly
express c-kit on the ~ u r f a c e . ~On
’ , ~the
~ other hand, c-kit
expression appears to decrease when stem cells differentiate
into cell lineages other than mast cell^."^^^^^' We introduced
the luciferase gene under the control of the c-kit promoter
into the FMA3 mastocytoma and FDC-PI myeloid cell lines
to examine whether the transactivation of the c-kit gene induced by the +-MITF was specific to the mast cell lineage.
Although the +-MITF was apparently expressed not only in
FMA3 but also in FDC-P1 cells, the luciferase activity was
much greater in FMA3 cells than in FDC-P1 cells. Moreover,
even if the +-MITF was overexpressed in FDC-P1 cells,
the expression of c-kit was hardly detectable. These results
suggested that the involvement of the +-MITF in the transcription of the c-kit gene was specific to the mast cell lineage. The regulation of c-kit expression may be different
between the mast cell lineage and other blood cell lineages.
We speculate that MITF may play a role in regulating c-kit
expression when stem cells differentiate into the mast cell
lineage.
Taken together, the present results have shown an essential
role of MITF in the expression of the c-kit gene in mast
cells. MITF appears to transactivate the c-kit gene through
the CACCTG motif in the c-kit promoter.
ACKNOWLEDGMENT
The authors thank Dr S.I. Nishikawa of Kyoto University for
ACK2 and c-kit cDNA, Dr S. Nagata of Osaka Bioscience Institute,
Dr K. Nakajima of Osaka University for pSPLuc, and Kirin Brewery
Company Ltd for rmSCF and rmIL-3.
REFERENCES
1. Hodgkinson CA, Moore KJ, Nakayama A, Steingrimsson E,
Copeland NG, Jenkins NA, Arnheiter H: Mutations at the mouse
microphthalmia locus are associated with defects in a gene encoding
a novel basic-helix-loop-helix-zipper protein. Cell 74:395, 1993
2. Hughes JJ, Lingrel JB, Krakowsky JM, Anderson KP: A helixloop-helix transcription factor-like gene is located at the mi locus.
J Biol Chem 268:20687, 1993
3. Steingrimsson E, Moore KJ, Lamoreux ML, Feme-D’Amare
AR, Burley SK, Zimring DCS, Skow LC, Hodgikinson CA, Arn-
heiter H, Copeland NG, Jenkins NA: Molecular basis of mouse
microphthalmia (mi) mutations helps explain their developmental
and phenotypic consequences. Nat Genet 8:256, 1994
4. Hemesath TJ, Streingrimsson E, McGill G, Hansen MJ, Vaught
J , Hodgikinson CA, Arnheiter H, Copeland NG, Jenkins NA, Fisher
DE: rnicrophrhalmia, a critical factor in melanocyte development,
defines a discrete transcription factor family. Genes Dev 8:2770.
1994
5. Silvers WK: The Coat Colors of Mice: A Model for Mammalian Gene Action and Interaction. New York, NY, Springer-Verlag,
1979
6. Green MC: Catalog of mutant genes and polymorphic loci, in
Lyon MF, Searle AG (ed): Genetic Variants and Strains of the
Laboratory Mouse. Stuttgart, Germany, Gustav Fischer Verlag,
1981, p 158
7. Stevens J, Loutit J F Mast cells in spotted mutant mice (W,
Ph, mi). Proc R Soc Lond 215:405, 1982
8. Stechschulte DJR, Sharma KN, Dileepan KM, Simpson N,
Aggarwal J, Clancy JR, Jilka RL: Effect of the mi allele on mast
cells, basophils, natural killer cells, and osteoclasts in C57BW6J
mice. J Cell Physiol 132:565, 1987
9. Ebi Y, Kasugai T, Seino Y, Onoue H, Kanemoto T, Kitamura
Y: Mechanism ofmast cell deficiency in mutant mice of m i h i
genotype: An analysis by co-culture of mast cells and fibroblasts.
Blood 75:1247, 1990
10. Ebi Y, Kanakura Y, Jippo-Kanemoto T, Tsujimura T, Furitsu
T, Ikeda H, Adachi S, Kasugai T, Nomura S, Kanayama Y, Yamatodani A, Nishikawa SI, Kitamura Y: Low c-kir expression of cultured
mast cells of mi/mi genotype may be involved in their defective
responses to fibroblasts that express the ligand for c-kif. Blood
80: 1454, 1992
11. Isozalu K, Tsujimura T, Nomura S, Morii E, Koshimizu U,
Nishimune Y, Kitamura Y: Cell type-specific deficiency of c-kit
gene expression in mutant mice of m i h i genotype. Am J Pathol
145:827, 1994
12. Ephrussi A, Church GM, Tonegawa S, Gilbert W: B lineagespecific interactions ofan immunoglobulin enhancer with cellular
factors in vivo. Science 227:134, 1985
13. Morii E, Takebayashi K, Motohashi H, Yamamoto M, Nomura S, Kitamura Y: Loss of DNA binding ability of the transcription factor encoded by the mutant mi locus. Biochem Biophys Res
Commun 205:1299, 1994
14. Kasugai T, Oguri K, Jippo-Kanemoto T, Morimoto M, Yamatodani A, Yoshida K, Ebi Y, Isozaki K, Tei H, Tsujimura T, Nomura
S, Okayamd M, Kitamura Y: Deficient differentiation of mast cells
in the skin ofmi/mi mice: Usefulness of in situ hybridization for
evaluation of mast cell phenotype. Am J Pathol 143:1337, 1993
15. Nakahata T, Spicer SS, Cantey JR, Ogawa M: Clonal assay
of mouse mast cell colonies in methylcellulose culture. Blood
60:352, 1982
16. Nakano T, Sonoda T, Hayashi C, Yamatodani A, Kanayama
Y, Asai H, Yonezawa T, Kitamura Y, Galli SJ: Fate of bone marrowderived cultured mast cells after intracutaneous, intraperitoneal, and
intravenous transfer into genetically mast cell deficient W W mice:
Evidence that cultured mast cells can give rise to both “connective
tissue-type” and “mucosal” mast cells. J Exp Med 162:1025, 1985
17. Mann R, Mulligan RC, Baltimore D: Construction of a retrovirus packaging mutant and its use to produce helper-free defective
retrovirus. Cell 33:153, 1983
18. Tsujimura T, Morimoto M, Hashimoto K, Moriyama Y, Kitayama H, Matsuzawa Y, Kitamura Y, Kanakura Y: Constitutive
activation of c-kirin FMA3 murine mastocytoma cells caused by
deletion of seven amino acids at the juxtamembrane domain. Blood
87:273, 1996
19. Kitayama H, Kanakura Y, Furitsu T, Tsujimura T, Oritani K,
Ikeda H, Sugahara H, Mitsui H, Kanayama Y, Kitamura Y, Matsu-
From www.bloodjournal.org by guest on July 12, 2017. For personal use only.
mi TRANSCRIPTIONFACTOR
zawa Y: Constitutively activating mutations of c-kit receptor tyrosine
kinase confer factor-independent growth and tumorigenicity of factor-dependent hematopoietic cell lines. Blood 85:790, 1995
20. Laker C, Stocking C, Bergholz U, Hess N, DeLamarter JF,
Ostertag W: Autocrine stimulation after transfer of the granulocyte/
macrophage colony-stimulating factor gene and autonomous growth
are distinct but interdependent steps in the oncogenic pathway. Proc
Natl Acad Sci USA 84:8458, 1987
21. Wigler M, Pellicer A, Silverstein S, Axel R, Urlaub G, Chasin
L: DNA-mediated transfer if the adenine phosphoribosyltransferase
locus into mammalian cells. Proc Natl Acad Sci USA 76: 1373, 1979
22. Auffray C, Rougenon F: Purification of mouse immunoglobulin heavy-chain messenger RNAs from total myeloma tumor RNA.
Eur J Biochem 107:303, 1980
23. Qiu F, Ray P, Brown K, Barker PE, Jhanwar S, Ruddle FH,
Besmer P: Primary structure of c-kit: Relationship with the CSF-l/
PDGF receptor kinase family-oncogenic activation of v-kit involves
deletion of extracellular domain and C terminus. EMBO J 7:1003,
1988
24. Tokunaga K, Taniguchi H, Yoda K, Shimizu M, Sakiyama
S: Nucleotide sequence of a full-length cDNA for mouse cytoskeletal
beta-actin mRNA. Nucleic Acids Res 142829, 1986
25. Takebayashi K, Chida K, Tsukamoto I, Morii E, Munakata H,
Arnheiter H, Kuroki T, Kitamura Y, Nomura S: Recessive phenotype
displayed by a dominant negative microphthalmia-associated transcription factor mutant is a result of impaired nuclear localization
potential. Mol Cell Biol 16:1203, 1996
26. Sugahara H, Kanakura Y, Furitsu T, Ishihara K, Oritani K,
Ikeda H, Kitayama H, Ishikawa J, Hashimoto K, Kanayama Y, Matsuzawa Y: Induction of programmed cell death in human leukemia
cell lines by fibronectin via its interaction with very late antigen 5.
J Exp Med 79:1757, 1994
27. Nozaki M, Mori M, Matsushiro A: The complete sequence
of the gene encoding mouse cytokeratin 15. Gene 138:197, 1994
28. Sanger F, Nicklen S, Coulson AR: DNA sequencing with
chain-terminating inhibitors. Proc Natl Acad Sci USA 74:5463, 1977
29. Mizushima S, Nagata S: pEF-BOS, a powerful mammalian
expression vector. Nucleic Acids Res 18:5322, 1990
30. Nakajima K, Kusafuka T, Takeda T, Fujitani Y, Nakae K,
Hirano T: Identification of a novel IL-6 response element containing
an Ets-binding site and a CRE-like sites in the junB promoter. Mol
Cell Biol 13:3027, 1993
31. Yasuda H, Galli SJ, Geissler EN: Cloning and functional
analysis of the mouse c-kit promoter. Biochem Biophys Res Commun 191:893, 1993
32. Yasumoto KI, Yokoyama K, Shibata K, Tomita Y, Shibahara
1233
S: Microphthalmia-associated transcription factor as a regulator for
melanocyte-specific transcription of the human tyrosinase gene. Mol
Cell Biol 1423058, 1994
33. Yamamoto K, Tojo A, Aoki N, Shibuya M: Characterization
of the prompter region of the human c-kit proto-oncogene. Jpn J
Cancer Res 84:1136, 1993
34. Kitamura Y: Heterogeneity of mast cells and phenotypic
change between subpopulations. Annu Rev Immunol 7:59, 1989
35. Young JD-E, Liu C-C, Butler G, Cohn Z, Galli SJ: Identification, purification, and characterization of a mast cell-associated cytolytic factor related to tumor necrosis factor. Proc Natl Acad Sci USA
84:9175, 1987
36. Tono T, Tsujimura T, KoshimizuU,Kasugai T, Adachi S,
Isozaki K, Nishikawa S-I, Morimoto M, Nishimune Y, Nomura S,
Kitamura Y: c-kit gene was not transcribed in cultured mast cells
of mast cell-deficient W h N kmice that have a normal number of
erythrocytes and a normal c-kit coding region. Blood 80:1448, 1992
37. Duttlinger R, Manova K, Berrozpe G, Chu T-Y, Deleon V,
Timokhina I, Chaganti RSK, Zelenetz AD, Bachvarova RF, Besmer
P The W hand Ph mutations affect the c-kif expression profile: ckit misexpression in embryogenesis impairs melanogenesis in W h
and Ph mutant mice. Proc Natl Acad Sci USA 92:3754, 1995
38. Ogawa M, Matsuzaki Y, Nishikawa S, Hayashi S, Kunisada
T, Nakauchi H, Nishikawa S: Expression and function ofc-kifin
hemopoietic progenitor. J Exp Med 174:63, 1991
39. Okada S, Nakauchi H, Nagayoshi K, Nishikawa S, Nishikawa
S-I, Miura Y, Suda T: Enrichment and characterization of murine
hematopoietic stem cells that express c-kit molecule. Blood 78:1706,
1991
40. Katayama N, Shih JP, Nishikawa S, Kita T, Clark SC, Ogawa
M: Stage-specific expression of c-kit protein by murine hematopoietic progenitors. Blood 822353, 1993
41. Nocka K, Tan JC, Chiu E, Chu TY, RayP, Traktman P,
Besmer P: Molecular bases of dominant negative and loss of function
mutations at the murine c-kitlwhite spotting locus: W-", W", W" and
W. EMBO J 9:1805, 1990
42. Tsujimura T, Furitsu T, Morimoto M, Kanayama Y, Nomura
S, Matsuzawa Y, Kitamura Y, Kanakura Y: Substitution of an aspartic acid results in constitutive activation of c-kit receptor tyrosine
kinase in a rat tumor mast cell line RBL-2H3. Int ArchAllergy
Immunol 106:377, 1995
43. Ogawa M, Nishikawa S, Yoshinaga K, Hayashi S-I, Kunisada
T, Nakao J, Kina T, Sudo T, Kodama H, Nishikawa S-I: Expression
and function of c-Kit in fetal hemopoietic progenitor cells: transition
from the early c-Kit-independent to the late c-Kit-dependent wave
of hemopoiesis in the murine embyo. Development 117:1089, 1993
From www.bloodjournal.org by guest on July 12, 2017. For personal use only.
1996 88: 1225-1233
Involvement of transcription factor encoded by the mi locus in the
expression of c-kit receptor tyrosine kinase in cultured mast cells of
mice
T Tsujimura, E Morii, M Nozaki, K Hashimoto, Y Moriyama, K Takebayashi, T Kondo, Y Kanakura
and Y Kitamura
Updated information and services can be found at:
http://www.bloodjournal.org/content/88/4/1225.full.html
Articles on similar topics can be found in the following Blood collections
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American
Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.