From www.bloodjournal.org by guest on July 12, 2017. For personal use only.
TEL/AML-1 Dimerizes and Is Associated With a Favorable Outcome in
Childhood Acute Lymphoblastic Leukemia
By Thomas W. McLean, Sarah Ringold, Donna Neuberg, Kimberly Stegmaier, Ramana Tantravahi, Jerome Ritz,
H. Phillip Koeffler, Seisho Takeuchi, Johannes W.G. Janssen, Taku Seriu, Claus R. Bartram, Stephen E. Sallan,
D. Gary Gilliland, and Todd R. Golub
Polymerase chain reaction-based screening of childhood
acute lymphoblastic leukemia (ALL) samples showed that a
T€L/AMLI fusion transcript was detected in 27% of all cases,
representing the most common known gene rearrangement
in childhood cancer. The T€L/AMLI fusion results from a
t(12;21)(p13;q22) chromosomal translocation, but was undetectable at the routine cytogenetic level. T€L/AML l-positive patients had exclusively B-lineage ALL, and most patients were between the ages of 2 and 9 years at diagnosis.
Only 3/89 (3.4%) adult ALL patients were T€L/AMLI-posi-
tive. Most importantly, TEL/AMLl-positive children had a
significantly lower rate of relapse compared with T€L/AML 1negative patients (0/22 v 16/54, P = .004). Co-immunoprecipitation experiments demonstrated that TEL/AML-1 formed
homodimers in vitro, and heterodimerired with the normal
TEL protein when the two proteins were expressed together.
The elucidation of the precise mechanism of transformation
by TEL/AMLI and the role of T€L/AMLl testing in the treatment of childhood ALL will require additional studies.
0 1996 by The American Society of Hematology.
A
translocations disrupting the TEL gene have been recently
reported in a wide variety of hematologic malignancies."'-'4
p27 functions as a negative regulator of the GUS transition
of the cell cycle, so loss of p27 function could conceivably
result in accelerated hematopoietic cell growth."' To fulfull
Knudson's two-hit hypothesis, mutations in the remaining
allele of a tumor suppressor gene should be detectable in
tumors with deletions at that 10cus.'~However, we and others
recently found that in childhood ALL samples with 12p
LOH, no point mutations were detectable within the coding
sequence of either TEL or CDKNIB, suggesting that these
genes do not encode classical tumor suppres~ors.'~.''
A link between TEL deletions and childhood ALL was
nevertheless suggested by the cloning of the t( 12;2 1)
(p 13;q22) chromosomal translocation which fuses the amino
terminus of TEL to the transcription factor AML- 1
Surprisingly, all four of the initially reported cases of TEU
AMLl fusion were accompanied by deletion of the other
(nontranslocated) TEL allele. In addition, all four of the cases
had t(12;21) translocations which were not evident at the
routine cytogenetic level. Because the t( 12;21) is not among
the known recurrent cytogenetically detectable chromosomal
abnormalities in leukemia," the TEUAMLl fusion was presumed to be rare in childhood ALL.
In the current report, we tested the hypothesis that the
frequency of TEUAMLl fusion as a result of cryptic t( 12;21)
translocations might be much higher than previously suspected in childhood ALL. We show that indeed TEUAMLI
fusion transcripts are detected in 27% of childhood ALL.
representing the most frequent gene rearrangement in childhood cancer. We also explore the ability of the TELIAML1 fusion protein to dimerize, a phenomenon which may be
important in TEUAML- 1 function. Finally, we demonstrate
that TEUAMLI-positive patients have distinct clinical characteristics and have a more favorable outcome compared to
TEUAMLI-negative patients.
CUTE LYMPHOBLASTIC leukemia (ALL) is the most
common malignancy of childhood, afflicting approximately four per 100,000 children under 15 years of age in
the United States each year.' While cure of many of these
children is now
individual responses to chemotherapy are difficult to predict. It is likely that this clinical
heterogeneity reflects a diverse pathogenesis of leukemia,
but the molecular basis of childhood ALL is largely unknown. Furthermore, it is likely that significant advances in
the treatment of childhood ALL will be dependent on a better
understanding of the molecular events that cause the disease.
We recently identified a region on the short arm of chromosome 12 ( 1 2 ~ 1 3which
)
is frequently deleted in childhood
ALL, suggesting that deletion of a tumor suppressor gene in
this region might be critical in the development of leukemia.4
Other investigators have similarly detected loss of heterozygosity (LOH) at 1 2 ~ 1 3in 25% to 30% of all cases of childhood ALL.5.6Fine mapping in this region showed that two
known genes were located within the critically deleted region: TEL, encoding a new member of the ETS family of
transcription factors, and CDKNIB (KIPI), encoding the
cyclin-dependent kinase inhibitor ~ 2 7 . ~ .Chromosomal
"~
From the Division of Hematology/Oncology, Brigham and Women's Hospital, Harvard Medical School; Dana-Farber Cancer Institute, Harvard Medical School, Boston, MA; rhe Division of Hematology/Oncology, Cedars-Sinai Research Institute, UCLA School of
Medicine, Los Angeles, CA; and Institute of Human Genetics. University of Heidelberg, Heidelberg, Germany.
Submitted January 31, 1996; accepted July 20, 1996.
Supported in part by The Howard Hughes Medical Institute Medical Student Fellowship Program (K.S.), National Institutes of Health
Grant No. CA 57261 (D.G.G.), and the Deutsche Forschungsgemeinschaft and Deutsche Krebshilfe (C.R.B.). D.G.G. is the Stephen
Birnbaum Scholar of the Leukemia Society of America; T.R.G. is
a recipient of a Burroughs- Wellcome Fund Career Award in the
Biomedical Sciences.
Address reprint requests to Todd R. Golub, MD, Pediatric Oncology, Dana-Farber Cancer Institute, 44 Binney St, Boston, MA 02115.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked
"advertisement" in accordance with I8 U.S.C. section 1734 solely to
indicate this fact.
0 I996 by The American Society of Hemato1og.v.
0006-4971/96/8811-003/$3.00/0
4252
MATERIALS AND METHODS
Sample accrual. Childhood ALL samples were chosen based on
the following criteria: ( I ) age less than or equal to 18 years at
diagnosis; (2) treatment on one of four consecutive Dana-Farber
Cancer Institute (DFCI) childhood ALL protocols (80-001, 81-001.
85-001, or 87-001); (3) a minimum potential follow-up of 4 years
from diagnosis; and (4)diagnostic bone marrow (BM) or peripheral
Blood, Vol 88, No 11 (December 11, 1996 pp 4252-4258
From www.bloodjournal.org by guest on July 12, 2017. For personal use only.
4253
TEUAML 7 IN CHILDHOOD ALL
blood (PB) availability in the DFCI leukemia cell bank. Samples
were selected without knowledge of age, sex. race. immunophenotype, cytogenetics. or disease status. A total of 98 samples met the
above criteria, and were processed for further analysis. Informed
consent for the use of all samples was obtained in accordance with
the Helsinki Declaration. Adult ALL samples were obtained from
patients treated on the German multicenter intensified trial GM-ALL
05/93,”’.” The adult samples available for analysis were B-lineage
leukemias previously determined to be RCWARL [t(9:22)] and M L U
AF4 [t(4: 1 I ) ] negative by polymerase chain reaction (PCR) analysis.
RNA extraction nnd RNA-based PCR. Total RNA was extracted
from cryopreserved BM or PB mononuclear cells using guanidiniuml
acid phenol (RNAzol: Tel-Test. Friendwood, TX) according to the
manufacturer‘s instructions. For the childhood ALL specimens, 4
pg of total RNA was used in a reverse transcriptase reaction as
previously described.” An aliquot of the cDNA was then used in a
control PCR reaction to assess the integrity of the RNA sample.
TEL-specific primers 458 (5’ AGGTCATACTGCATCAGAAC 3’)
and 750R (5’ ATTATTCTCCATGGGAGACA 3’) were used in the
control PCR to amplify a 292-bp TEL fragment spanning TEL exons
4 and S.“’.’’ Forty cycles of PCR (94°C X 1 minute: 56°C X 1
minute: 72°C X I minute) were performed using a programmable
thermal cycler (MJ Research. Watertown, MA). as previously described.” Samples that were negative in this control PCR were excluded from further analysis. The integrity of the adult cDNA samples was verified by amplifying a portion of the normal c-ABL gene.
as previously described.”
cDNA samples were thcn assayed in duplicate for the presence
of TEUAMLl using TEL primer 969 (5’ GAACCACATCATGGTCTCTG 3’) and AMLI primer Z3R (5‘ AACGCCTCGCTCATCTTGCCTG 3’) in 40 cycles of PCR (94°C X 1 minute: 60°C X 1
minute: 72°C X I minute). Twelve microliters of the PCR product
was electrophoresed through 1 % agarose/3% NuSieve (Pharmacia.
Piscataway, NJ) gels. Specificity of the TEUAMLI PCR products
was confirmed by Southern blotting of PCR products with the internal TEL primer 1033R (5’ CTGCTATTCTCCCAATGGGCAT 3’)
and the internal AMLl primer Z2R (5’ GTGGACGTCTCTAGAAGGAT 3’) using standard methods.” PCR analysis of the reciprocal
AMLlflEL fusion transcript was performed under the above conditions using the AMLl exon I primer W (5’ TTCGTACCCACAGTGCTTCA 3’) and the TEL exon 6 primer 1150R (5’ TTTCCCCACAGTCGAGCCAG 3’).
Direct seqrrencing. The DNA sequence of the variant 134-bp
TEUAMLl PCR product was determined by direct sequencing of
the PCR product using a United States Biochemical kit according
to the manufacturer’s instructions.
Protein-proteiri intermtions. The full-length TEUAMLl cDNA
was reconstructed using a wild-type TEL cDNA clone,“’ a wild-type
AMLlR clone’5 (kindly provided by S. Hiebert. St Jude Children‘s
Research Hospital, Memphis, TN). and a junction fragment generated by PCR from a TEUAMLI positive patient. The HA epitope
tags”’ were inserted in frame into the Eco47111 site of TEL. following
TEL amino acid 39. The non-HA tagged TEL constructs begin at
TEL amino acid 43. to permit size discrimination by electrophoresis.
In vitro transcription and translation was performed in the presence
of ” S methionine using a TNT kit (Promega, Madison, WI) according to the manufacturer’s directions. Programmed reticulocyte
lysates were diluted 30-fold in 1% NP-40 lysis buffer and immunoprecipited as previously described” using either antibody directed
against the runt homology domain of AML-I (provided by S. Hiebert), or anti-HA monoclonal antibody I2CA5 (Boehringer Mannheim. Indianapolis. IN). Proteins were resolved on sodium dodecyl
sulfate (SDS) polyacrylamide gels and visualized by fluorography.
Stritisticrrl rnethocls. The associations between patient characteristics and outcomes were assessed using the Fisher exact test.:’ Nom-
1 2 3
196 bp125 -
Fig 1. PCR amplification of the T€L/AMLl fusion. cDNA prepared
from ALL diagnostic samples was subjected t o PCR using the TELand AML1-specific primers 969 and Z3R, respectively. PCR products
were electrophoresed through agarose gels and visualized by ethidium bromide staining. Shown is an example of a T€L/AMLl-negative
patient (lane 11, a T.EL/AMLI-positive patient (lane 2). and a patient
exhibiting the 7EL/AMLl variant that lacks AMLl exon 2 (lane 3).
inal P values are presented, without correction for multiple comparisons. Clinical characteristics were categorized for analyses of
association with TEUAMLI. Age was coded as under 2 years, 2 to
9 years, or over 9 years; white blood cell (WBC) count at diagnosis
was coded as <2O,OOO/pL or ~20,0001pL.The method used to
assign clinical risk groups on DFCI ALL protocols has been previously reported.’.” I ’ Time to relapse and overall survival were
calculated according to the method of Kaplan and Meier.” Median
follow-up was calculated as the median survival from time of study
entry for those patients who remained alive and disease-free. Relapse
status was the primary outcome variable in this investigation. The
absence of relapses among TEUAMLI-positive patients limits the
ability to perform multivariate statistical analyses.
RESULTS
Determining the frequency of TELIAMLI fusion in ALL.
To determine the frequency of the TEUAMLI fusion in
childhood ALL, we evaluated patients treated on consecutive
DFCI protocols. The therapeutic regimens used in these
highly similar protocols have been previously reported.'^''.''
Ninety-eight patients had cryopreserved cells available for
analysis. Of these, 17 were negative in the control PCR
reaction. These samples were therefore excluded from further analysis, since the integrity of the RNA could not be
assured.
The remaining 8 1 samples were subjected to reverse transcriptase PCR using TEL and A M L l specific primers. Sixteen
samples yielded a 173-bp PCR product corresponding to that
predicted from the reported sequence”.” of the TEUAMLI
fusion transcript (Fig I). The specificity of the PCR product
-
From www.bloodjournal.org by guest on July 12, 2017. For personal use only.
4254
TEL
AMLl
McLEAN ET AL
DNA
>
RHD
TRANSACT
1
TEL-A ML 1
TEL-AML 1
varianf
Fig 2. Schematic representation of the T€L/AMLl fusion. The
functional domains of TEL and AML-1 are shown, including the helixloop-helix (HLH) domain and DNA binding ETS domain of TEL, and
the DNA-binding runt homology domain IRHD) and transactivation
domain (TRANSACT) of AML-1. The 39-bp AMLT exon 2 is indicated
by the hatched box. 969 and Z3R are T€L- and AMLl-specific oligonucleotide primers used in PCR. The T€L/AMLl chimera results in fusion
of the first 336 amino of TEL including the HLH domain to the DNAbinding and transactivation domains of AML-1. In the T€L/AMLl variant, AMLl exon 2 is excluded from the chimera.
for TEUAMLI was confirmed by Southern hybridization using internal TEL and AMLI oligonucleotide probes (not
shown). An additional 6 patient samples yielded a 134-bp
fragment. Direct sequence analysis of this 134-bp fragment
showed that it represented a TEUAMLI fusion that lacked
the 39 nucleotide exon 2 of the AMLI gene," as illustrated
in Fig 2. In total, 22 of 81 (27%: 90% confidence interval
19% to 36%) childhood ALL patients showed evidence of
TEUAMLI fusion. Only 10/22 (45%) TEUAMLI-positive
patients also expressed the reciprocal AMLIflEL fusion transcript (not shown). Diagnostic BM cytogenetic analyses
were available on 38 of the 81 patients studied, including
1 I TEUAMLI-positive patients. None of these 38 patients
had cytogenetic evidence of a t( 12:2 I)(pl3;q22) translocation.
To determine whether this high frequency of TEUAMLI
fusion was also found in adult ALL, 89 adult ALL samples
were tested. Three of 89 (3.4%) were positive for the 173bp TEUAMLI fragment by PCR. No patients had the 134bp variant.
TEUAML- I protein-protein iriternctioris. The mechanism of transformation by TEL/AML-I is not known. In
particular, the function of the TEL portion of the chimera is
not evident. When we initially identified the TEL gene as
the fusion partner for the platelet-derived growth factor
receptor gene ( P D G F P R ) in chronic myelomonocytic leukemia (CMML) with t(5; 12), we hypothesized that one potential function of the TEL amino terminus might be to facilitate
dimerization. since dimerizaton of PDGFPR is known to be
essential for its activation."' Therefore, it was of interest to
determine whether the fusion of TEL to AML-I would result
in homodimerization of the TEL/AML- I chimeric protein.
To test this possibility, a hemaglutinin (HA) epitope-tagged
TELIAML- 1 (TEL/AML-I -HA) was co-translated in vitro
with TEWAML- I . Immunoprecipitation with anti-HA antibody resulted in recovery of TEL/AML-I in addition to TEL/
AMLl -HA. indicating that TEL/AML- I forms homodimers
in vitro (Fig 3). The anti-HA antibody did not immunoprecipitate TEL/AML- I when translated alone, demonstrating
the specificity of this antibody. In addition, TEL/AML-I did
not interact with normal AML-I. suggesting that dimerization is principally mediated through the TEL portion of the
chimera. Consistent with this was the observation that the
normal TEL protein also homodimerized in vitro (Fig 3).
Based on our observation that TEL/AML- I homodimerized through the TEL portion of the chimera. we predicted
that TEL/AML-I might also be capable of interacting with
the normal TEL protein. To test the hypothesis that TEL/
AML-I and normal TEL interact with each other. the two
proteins were cotranslated in vitro. Immunoprecipitation
with anti-AML-1 antibody resulted in recovery not only of
TEWAML-I, but also of normal TEL. whereas this antibody
did not immunoprecipitate normal TEL when translated
alone (Fig 3). These experiments indicate that TEL/AML- 1
and normal TEL heterodimerize in vitro.
TEL/AML 1-positive potierirs represetit n distinct clinicrrl
entit?.. The clinical characteristics of the childhood ALL
patients studied are shown in Table I . Using the Fisher exact
test, no significant association between TEUAMLI positivity
and treatment protocol. peripheral WBC count, sex. or central nervous system disease was detected. In contrast. the
presence of the TEUAMLI fusion was significantly associated with age ( P = .00007) and immunophenotype ( P =
.02). All but one of the TEUAMLI-positive patients were 2
to 9 years of age. TEUAMLI-positive patients also had a
consistent cell surface immunophenotype. consistent with Blineage ALL (CDIO'. CD19-. HLA class 11-. CD2-.
CD33-) (Table 2). None of the 13 patients with T-cell disease were TEUAMLI-positive.
Of particular interest was the role of the TEUAMLI fusion
as a predictor of relapse. Five children did not achieve a
complete remission after induction chemotherapy and were
excluded from the analysis of relapse. All five patients lacked
the TEUAMLI fusion. Of the 76 patients who achieved a
complete remission. 16 have relapsed. All relapses occurred
among the 54 patients who lacked the TEUAMLI fusion
(16/54, 30%); none of the 22 TEUAMLI-positive patients
relapsed (0/22, 0%). The association between TEUAMLI
status and rate of relapse was highly significant (Fisher exact
test. P = .004). The Kaplan-Meier curve for time to relapse
in the 76 patients analyzed is shown in Fig 4.Median followup from diagnosis of surviving patients is 8.3 years. with a
range of 2.8 to 15.2 years. The presence of the TEUAMLI
fusion was also significantly associated with overall survival
status in a univariate analysis ( P = .02). Given the low
frequency of TEUAMLI in the adult ALL patients studied
(3.4%), clinical correlative statistical analysis of these patients was not performed.
DISCUSSION
In this report we demonstrate that the frequency of T E U
AMLI fusion is 27% in the 8 1 childhood ALL patients evaluated, representing the single most common gene rearrangement known in childhood cancer. This finding is particularly
surprising because the t( 12;21)(p13;q22) translocation is not
among the recurrent cytogenetic abnormalities reported in
ALL.t'l.34 Until now, the most frequent gene rearrangement
in childhood B-lineage ALL was the E2A/PBXI fusion resulting from the t( 1; I9)(q23:pl3) translocation, detectable
in 5% to 6% of patients."." It is likely that the cryptic nature
of the t( 12;21) reflects the similar appearing banding patterns
From www.bloodjournal.org by guest on July 12, 2017. For personal use only.
TEUAML 7 IN CHILDHOOD ALL
4255
r:rl
r[p]!rl TEL/AML-1
TEL
l p r e post1
A
B
TEL
TEL/AML-1 -HA
TEL/AML-l
TEL/AML-1
lpre post1
-202
kD
-133
T E L / A M TEL+
L-l+
- ~ ~ ' ' -4L $2 $ ~ > ~ ~ ~ ~
4
-4
-7
anti-AML-1
IP:
IP:
2
1
anti-HA
TEL/AML-1 -HA
C
TELIAML-1
AML-1
TEL-HA
TEL
l p r e post1
TEL/AML-1
TEL/AML-1
-HA
.
+
)
AML-1.)
--
D
TEL
l p r e post1 Ipre post1
TEL/AML-1 -HA
-202
-133
-
-
IP:
-
-
AML-1
71
TEL
2
4 T EL- HA
I
4TEL
7
TEL-HA
I
"
42
anti-HA
Fig 3. TELIAML-1 dimerization. Co-immunoprecipitation of "S-labeled in vitro translated proteins was used t o detect protein-protein
interactions in vitro. (AI TELIAML-1 and normal TEL were cotranslated and immunoprecipitated with anti-AML-1 antibody. Both proteins
were seen before immunoprecipitation in the lane marked "pre." The lane marked "post" indicates that both proteins were recovered after
immunoprecipitation. TEL was not immunoprecipitated by this antibody when translated alone. (6) The epitope tagged TELIAML-1-HA was
cotranslated with TELIAML-1. TELIAML-1 could be immunoprecipitated with anti-HA antibody only when the two proteins were cotranslated.
The additional low-molecular-weight bands seen in (6) and (C) represent proteins resulting from downstream initiation of translation. (C)
Normal AMLl was highly expressed, but did not associate with TEL/AML-1. Coexpression of TELIAML-1-HA and TELIAML-1 in this experiment
served as an internal control for dimerization. Normal TEL and an epitope-tagged TEL (TEL-HA) similarly co-immunoprecipitated, indicating
that TEL forms homodimers in vitro. (D) Schematic representation of the cDNA constructs used t o generate in vitro translated proteins.
of the portions of chromosomes 12 and 21 that are involved
in the translocation. A similarly high incidence of TEUAMLI
fusion in childhood ALL has been recently observed by other
investigators.'".'X We detected the TEUAMLI fusion in only
3.4% of adult ALL patients treated on European BFM clinical trials. Although it is likely that this difference in T E U
AMLI frequency reflects a distinct pathogenesis of childhood
versus adult ALL, it is conceivable that the observed difference reflects geographic differences between the two study
populations.
The TEL gene encodes a member of the ETS family of
transcription factors,'" and is rearranged in a wide variety of
hematologic malignancies. In particular, TEL is fused to the
platelet-derived growth factor 0 receptor in CMML," to the
ABL tyrosine kinase in acute myeloid leukemia and ALL,''.'9
and to the product of the MNI gene in myeloproliferative
disorders." AML-I is the DNA-binding subunit of the transcription factor complex core binding factor (CBF).'" The
AMLI gene is frequently rearranged in myeloid malignancy
either through fusion to E T 0 as a result of t(8;21)
(q22;q22)4'.42or to EVII, MDSI, or EAP as a result of
t(3;21)(q26;q22).4'"' Interestingly, the 0 subunit of CBF,
CBF-0, is also rearranged in the majority of acute myelomonocytic leukemias with e~sinophilia.'~
In the current study,
only 45% of TEUAMLI-positive patients also expressed the
reciprocal AMLI/TEL fusion transcript, suggesting that the
TEUAML-I chimeric protein is likely to be the more biologically relevant protein. The frequent involvement of TEL
and AMLI in chromosomal translocations suggests that these
genes play important roles in the pathogenesis of human
leukemias.
Our initial cloning of the t(12;21) fusion in two patients
showed that in addition to the TEUAMLI fusion involving
one TEL allele, the residual TEL allele was also deleted."
Concommitant TEUAMLI fusion and TEL deletion was similarly detected in the two patients originally studied by Romana et d.'*Recent FISH studies have shown that deletion
of the other TEL allele accompanies TEUAMLI fusion in
From www.bloodjournal.org by guest on July 12, 2017. For personal use only.
4256
McLEAN ET AL
Table 1. Clinical Characteristics of Patients Studied
TEUAMLl Positive
TEUAML1
Protocol
Negative
Positive
Total
80-001
81-001
85-001
87-001
Total
4
20
14
21
59
1
10
8
3
22
5
30
22
24
81
<2 yr
2-9 yr
>9 yr
9
26
24
0
21
1
9
47
25
4
0
lmmunophenotype
B-cell
T-cell
46
13
22
0
Standard
High
6
53
11
11
17
64
WBC
<20,000/pL
2=20,000/~L
<50,00O/pL
~50,OOO/pL
22
37
31
28
12
10
15
7
34
47
46
35
No
Yes
54
5
21
1
75
6
Male
Female
40
19
13
9
53
28
Sex
2
68
13
Risk category
C N S involvement
TEUAMLl Negative
~
I
,
I
I
I
1
4
6
8
10
12
14
16
Years
Fig 4. Kaplan-Meierrelapse curve. The Kaplan-Meiercurve showing the probability of being free from relapse is shown for the 76
childhood ALL patients who achieved a complete remission. Years
refers to number of years after diagnosis.
Clinical characteristics at the time of diagnosis of the 81 childhood
ALL patients studied are shown. Patients were enrolled on one of four
consecutive Dana-Farber Cancer Institute childhood ALL protocols, as
indicated.
Abbreviations: WBC, white blood cell count; CNS, central nervous
system.
the majority of cases.37These observations raised the possibility that TEL/AML-1 and the normal TEL protein might
interact with each other if the normal TEL allele was present.
In the current report, we demonstrate that TEL/AML-1 forms
homodimers in vitro, but can heterodimerize with the normal
TEL protein if the two proteins are expressed together. We
further show that the normal TEL protein homodimerizes, a
phenomenon not previously observed among members of
the ETS family. We have mapped the TEL dimerization
domain to a highly conserved helix-loop-helix (HLH) region,
also referred to as the pointed domain4’ (T.R.G., D.G.G.,
personal observation, December 1995). Although these experiments do not prove that dimerization is critical for transformation by TEL/AML- 1, it is noteworthy that TEL/AML1 constructs which lack the TEL dimerization domain have
decreased biological activity in assays of transcriptional activatiom4*Heterodimerization with the normal TEL protein
might abrogate the transforming potential of TEL/AML- 1 ;
such heterodimerization would be eliminated by deletion of
the normal TEL allele. These experiments support a model
in which deletion of the residual TEL allele in TEUAMLl positive patients represents a permissive or potentiating
event which unmasks TEUAML- 1 biologic activity. More
extensive experiments will be required to further elucidate
the role of dimerization in the function of TEL and TEL/
AML- 1.
Perhaps the most striking finding in this study was the
association between TEUAMLl positivity and lack of relapse
in patients with childhood ALL. With a median follow-up
of 8.3 years, none of the 22 TEUAMLI-positive children
relapsed, whereas 16 of the 54 TEUAMLl-negative children
who achieved a complete remission have relapsed ( P =
.004). Even when the 12 patients with T-cell ALL who
achieved a complete remission are excluded from the analysis, the association between TEUAMLl status and relapse
remains statistically significant. The prognostic significance
of the TEUAMLI fusion in childhood ALL was also recently
addressed by Shurtleff et al.’* While they did not show a
statistically significant difference in event-free survival be-
Table 2. Cell-Surface lmmunophenotypingof EL/AMLI-Positive Leukemic Samples
Antigen
CD9
CDlO
CD19
MHC Class I1
CD20
CD2
CD33
No. of patients positive
14/16
22/22
19/19
22/22
6/20
0/18
0/19
Diagnostic leukemic samples were examined for expression of various cell-surface antigens by immunofluorescent flow cytometry before
initiation of chemotherapy. Numbers shown reflect samples in which the cells analyzed were positive for each antigen tested. Immunophenotyping for each antigen was not available for all patients. The expression of the B-lymphoid markers CDlO and CD19, together with the lack of
expression of the T-cell marker CD2 and the myeloid marker CD33, is consistent with B-lineage derivation of the leukemic cells.
From www.bloodjournal.org by guest on July 12, 2017. For personal use only.
TEUAML 7 IN CHILDHOOD ALL
tween TEUAMLI-positive and TEUAMLI -negative patients,
this result may reflect the relatively short duration of followup in their study (median 2.5 years). The patients analyzed
in our study were chosen based on the availability of cryopreserved leukemic cells following clinical diagnostic studies.
Conceivably, selection occurred against patients with low
cell counts or patients requiring extensive diagnostic tests.
The patients were not selected, however, with respect to
immunophenotype, cytogenetic analysis, or outcome. It is
intriguing to speculate that TEUAMLl positivity may represent the genetic basis of the clinical observation that children
between the ages of 2 and 9, for example, have a more
favorable prognosis compared to infants or older children.*
Even among the patients within this favorable age range,
however, there is a strong suggestion of an association between TEUAMLl positivity and freedom from relapse ( P =
.07). The high rate of cure of TEUAML1-positive patients
suggests that this subgroup may represent a population in
which, in conjunction with minimal residual disease detection, a less intensive or shorter treatment regimen could be
studied. Large, prospective clinical trials will be required to
firmly establish whether TEUAMLl status is a completely
independent prognostic indicator, and to determine how to
best integrate TEUAMLl testing into routine patient care.
ACKNOWLEDGMENT
We thank S. Hiebert for the AMLl cDNA anti-AML1 antibody,
members of the DFCI Clinical Immunology and Cytogenetic Laboratories for technical assistance, G. Dalton for data analysis, and members of the Gilliland laboratory for helpful discussions.
REFERENCES
I . Young JL, Ries LG, Silverberg E, Horm JW, Miller RW:
Cancer incidence, survival, and mortality for children younger than
age 15 years. Cancer 58598, 1986
2. Schorin MA, Blattner S, Gelber RD, Tarbell NJ, Donnelly
M, Dalton V, Cohen HJ, Sallan SE: Treatment of childhood acute
lymphoblastic leukemia: Results of Dana-Farber Cancer Institute/
Children's Hospital acute lymphoblastic leukemia consortium protocol 85-01. J Clin Oncol 12:740, 1994
3. Pui C-H, Simone JV, Hancock ML, Evans EV, Williams DL,
Bowman WP, Dah1 GV, Dodge RK, Ochs J, Abromowitch M, Rivera
GK: Impact of three methods of treatment intensification on acute
lymphoblastic leukemia in children: Long-term results of St. Jude
Total Therapy Study X. Leukemia 6:150, 1992
4. Stegmaier K, Pendse S, Barker GF, Bray-Ward P, Ward DC,
Montgomery KT, Krauter KS, Reynolds C, Sklar J, Donnelly M,
Bohlander SK, Rowley JD, Sallan SE, Gilliland DG, Golub TR:
Frequent loss of heterozygosity at the TEL gene locus in acute
lymphoblastic leukemia of childhood. Blood 86:38, 1995
5 . Takeuchi S, Bartram C, Miller C, Reiter A, Seriu T, Zimmerman M, Schrappe M, Mori N, Slater J, Miyoshi I, Koeffler HP:
Acute lymphoblastic leukemia of childhood: Identification of two
distinct regions of deletion on the short arm of chromosome 12 in
the region of TEL and KIPI. Blood 87:3368, 1996
6. Cave H, Gerard B, Martin E, Guidal C, Devaux I, Weissenbach
J, Elion J, Vilmer E, Grandchamp B: Loss of heterozygosity in the
chromosomal region 12~12-13is very common in childhood acute
lymphoblastic leukemia and permits the precise localization of a
tumor-suppressor gene distinct from ~ 2 7 ~ ' ' 'Blood
.
86:3869, 1995
7. Sato Y, Suto Y, Pietenpol J, Golub TR, Gilliland DG, Roberts
JM, Trask BJ, Le Beau MM, Vogelstein B, Rowley JD, Bohlander
4257
SK: TEL and KIP1 define the smallest region of deletions in 1 2 ~ 1 3
in hematopoietic malignancies. Blood 86: 1525, 1995
8. Polyak K, Lee M, Erdjument-Bromage H, Koff A, Roberts J,
Tempst P, Massague J: Cloning of p27Kip1, a cyclin-dependent
kinase inhibitor and a potential mediator of extracellular antimitogenic signals. Cell 7859, 1994
9. Toyoshima H, Hunter T: p27, a novel inhibitor of GI cyclincdk protein kinase activity, is related to p21. Cell 78:67, 1994
IO. Golub TR, Barker GF, Lovett M, Gilliland DG: Fusion of
PDGF receptor p to a novel ets-like gene, tel, in chronic myelomonocytic leukemia with t(5; 12) chromosomal translocation. Cell 77:307,
1994
11. Golub TR, Barker GF, Bohlander SK, Hiebert S, Ward DC,
Bray-Ward P, Morgan E, Raimondi SC, Rowley JD, Gilliland DG:
Fusion of the TEL gene on 1 2 ~ 1 3to the AMLl gene on 21q22 in
acute lymphoblastic leukemia. Proc Natl Acad Sci USA 92:4917,
1995
12. Buijs A, Sherr S, van Baal S, van Bezouw S, van der Plas
D, van Kessel A, Riegman P, Deprez R, Zwarhoff E, Hagemeijer A,
Grosfeld G: Translocation (12;22)(p13;qll) in myeloproliferative
disorders results in fusion of the ETS-like TEL gene on 1 2 ~ 1 3to
the MNI gene on 22qll. Oncogene 10:1511, 1995
13. Papadopoulos P, Ridge SA, Boucher CA, Stocking C, Wiedemann LM: The novel activation of ABL by fusion to an ets-related
gene, TEL. Cancer Res 55:34, 1995
14. Wlodarska I, Mecucci C, Marynen P, Guo C, Franckx R, La
Starza R, Aventin A, Bosley A, Martelli MF, Cassiman JJ, Van den
Berghe H: TEL gene is involved in myelodysplastic syndromes with
either the typical t(5; 12)(q33;pl3) translocation or its variant
t(10; 12)(q24;p13). Blood 85:2848, 1995
15. Knudson AG: Mutation and cancer: Statistical study of retinoblastoma. Proc Natl Acad Sci USA 68:820, 1971
16. Stegmaier K, Takeuchi S, Golub TR, Bohlander SK, Bartram
CR, Koeffler HP, Gilliland DG: Mutational analysis of the candidate
tumor suppressor genes TEL and KIPI in childhood acute lymphoblastic leukemia. Cancer Res 56: 1413, 1996
17. Pietenpol JA, Bohlander SK, Sat0 Y, Papadopoulos N, Liu
B, Friedman C, Trask BJ, Roberts JM, Kinzler KW, Rowley JD,
Vogelstein B: Assignment of the human p27Kipl gene to 1 2 ~ 1 3
and its analysis in leukemias. Cancer Res 55: 1206, 1995
18. Romana SP, Mauchauffe M, Le Coniat M, Chumakov I, Le
Paslier D, Berger R, Bernard OA: The t( 12;21) of acute lymphoblastic leukemia results in a TEL-AMLI gene fusion. Blood 85:3662,
1995
19. Mitelman F Catalog of Chromosome Aberrations in Cancer.
New York, NY, Liss, 1994
20. Hoelzer D, Thiel E, Loffler H, Buchner T, Ganser A, Heil G,
Koch P, Freund M, Diedrich H, Ruhl H, Maschmeyer G, Lipp T,
Nowrousian MR, Burkert M, Gerecke D, Pralle H, Muller U, Lunscken C, Fulle H, Ho R, Kuchler R, Busch FW,Schneider W, Gorg
C, Emmerich B, Braumann D, Vaupel HA, von Paleske A, Bartels
H, Neiss A, Messerer D: Prognostic factors in a multicenter study
for treatment of acute lymphoblastic leukemia in adults. Blood
71:123, 1988
21. Maurer J, Janssen JWG, Thiel E, van Denderen J, Ludwig
WD, Aydemir U, Heinze B, Fonatsch C, Harbott J, Reiter A, Riehm
H, Hoelzer D, Bartram CR: Detection of chimeric BCR-ABL genes
in acute lymphoblastic leukemia by the polymerase chain reaction.
Lancet 337:1055, 1991
22. Sambrook J, Fritsch EF, Maniatis T: Molecular Cloning: A
Laboratory Manual (ed 2). Cold Spring Harbor, NY, Cold Spring
Harbor Laboratory Press, 1989
23. Gilliland DG, Blanchard KL, Levy J. Perrin S, Bunn HF:
Clonality in myeloproliferative disorders: Analysis by means of the
polymerase chain reaction. Proc Natl Acad Sci USA 88:6848, 1991
From www.bloodjournal.org by guest on July 12, 2017. For personal use only.
4258
24. Janssen JWG, Fonatsch C, Ludwig W-D, Rieder H, Maurer
J, Bartram CR: Polymerase chain reaction analysis of BCR-ABL
sequences in adult Philadelphia chromosome-negative acute lymphoblastic leukemia patients. Leukemia 6:463, 1992
25. Meyers S, Lenny N, Hiebert S: The t(8;21) fusion protein
interferes with AML-1B-dependent transcriptional activation. Mol
Cell Biol 15:1974, 1995
26. Field J, Nikawa J, Broek D, MacDonald B, Rodgers L, Wilson
IA, Lemer RA, Wigler M: Purification of a RAS-responsive adenylyl
cyclase complex from Saccharomyces cerevisiue by use of an epitope addition method. Mol Cell Biol 8:2159, 1988
27. Ravichandran KS, Burakoff SJ: The adapter protein shc interacts with the interleukin-2 (IL-2) receptor upon IL-2 stimulation. J
Biol Chem 269:1599, 1994
28. Rosner B: Fundamentals of Biostatistics. Boston, MA. PWS
Kent, 1991
29. Sallan SE, Clavell JR, Gelber R, Hitchcock-Bryan S, Cassady
JR: Intensive chemotherapy in childhood acute lymphoblastic leukemia, in Wehinger J (ed): Current Therapy of Leukemia in Childhood,
An International Symposium at Bad Karlshafen, Friedrichsdorf, Germany, 1984, p 34
30. Niemeyer CM, Gelber RD, Tarbell NJ, Donnelly M, Clavell
LA, Blattner SR, Donahue K, Cohen HJ, Sallan SE: Low-dose versus
high-dose methotrexate during remission induction in childhood
acute lymphoblastic leukemia (Protocol 81-01 update). Blood
78:2514, 1991
31. Billett AL, Gelber RD, Tarbell NJ, Barr R, Blattner S, Clavell
L, LeClerc JM, Lipton J, Schwenn M, Schorin M, Cohen HJ, Sallan
S E Sex differences in the risk of central nervous system relapse in
childhood acute lymphoblastic leukemia. Proc Amer SOCClin Oncol
12:317, 1993 (abstr)
32. Kaplan EL, Meier P: Nonparametric estimation from incomplete observations. J Am Stat Assoc 53:457, 1958
33. Miyoshi H, Ohira M, Shimizu S, Mitani K, Hirai H, Imai T,
Yokoyama K, Soeda E, Ohki M: Alternative splicing and genomic
structure of the AMLl gene involved in acute myeloid leukemia.
Nucleic Acids Res 23:2762, 1995
34. Raimondi SC: Current status of cytogenetic research in childhood acute lymphoblastic leukemia. Blood 81:2237, 1993
35. Nourse J, Mellentin J, Galili N, Wilkinson J, Stanbridge E,
Smith S , Cleary M: Chromosomal translocation t(1; 19) results in
synthesis of a homeobox fusion mRNA that codes for a potential
chimeric transcription factor. Cell 60535, 1990
36. Romana SP, Poirel H, Leconiat M, Flexor M-A, Machauffe
M, Jonveaux P, Macintyre EA, Berger R, Bernard OA: High frequency of the t(12;21) in childhood B-lineage acute lymphoblastic
leukemia. Blood 86:4263, 1995
37. Raynaud S, Cave H, Baens M, Bastard C. Cacheux V, Grosgeorge J, Guidal-Giroux C, Guo C, Vilmer E, Marynen P,
MclEAN ET A 1
Grandchamp B: The 12;21 translocation involving TEL and deletion
of the other TEL allele: Two frequently associated alterations found
in childhood acute lymphoblastic leukemia. Blood 87:2891, 1996
38. Shurtleff SA, Buijs A, Behm FG, Rubnitz JE, Raimondi SC,
Hancock ML, Chan GC, Pui C, Grosveld G, Downing JR: TEL/
AMLl fusion resulting from a cryptic t(12;21) is the most common
genetic lesion in pediatric ALL and defines a subgroup of patients
with an excellent prognosis. Leukemia 9:1985, 1995
39. Golub TR, Goga A, Barker GF, Afar DEH, McLaughlin J,
Bohlander SK, Rowley JD, Witte ON, Gilliland DG: Oligomerization of the ABL tyrosine kinase by the Ets protein TEL in human
leukemia. Mol Cell Biol 16:4107, 1996
40. Wang S, Wang Q, Crute BE, Melnikova IN, Keller SR, Speck
NA: Cloning and characterization of subunits of the T-cell receptor
and murine leukemia virus enhancer core-binding factor. Mol Cell
Biol 13:3324, 1993
41. Miyoshi H, Shimizu K, Kozu T, Maseki N, Kaneko Y, Ohki
M: t(8;21) breakpoints on chromosome 21 in acute myeloid leukemia are clustered within a limited region of a single gene, AMLI.
Proc Natl Acad Sci USA 88:10431, 1991
42. Nisson PE, Watkins PC, Sacchi N: Transcriptionally active
chimeric gene derived from the fusion of the AMLl gene and a
novel gene on chromosome 8 in t(8;21) leukemic cells. Cancer Genet
Cytogenet 63:81, 1992
43. Nucifora G, Begy CR, Erickson P, Drabkin HA, Rowley JD:
The 3;21 translocation in myelodysplasia results in a fusion transcript between the AMLl gene and the gene for EAP, a highly
conserved protein associated with the Epstein-Barr virus small RNA
EBER 1. Proc Natl Acad Sci USA 90:7784, 1993
44. Nucifora G, Begy C, Kobayashi H, Roulston D, Claxton D,
Pedersen-Bjergaard J, Parganas E, Ihle J, Rowley J: Consistent intergenic splicing and production of multiple transcripts between
AMLl at 21q22 and unrelated genes at 3q26 in (3;21)(q26;q22)
translocations. Proc Natl Acad Sci USA 91:4004, 1994
45. Mitani K, Ogawa S , Tanaka T, Miyoshi H, Kurokawa M,
Mano H, Yazalu Y, Ohki M, Hirai H: Generation of the AML1EVI-1 fusion gene in the t(3;21)(q26;q22) causes blastic crisis in
chronic myelocytic leukemia. EMBO J 13504, 1994
46. Liu P, Tarle SA, Hajra A, Claxton DF, Marlton P, Freedman
M, Siciliano MJ, Collins FS: Fusion between transcription factor
CBFBIPEBP2B and a myosin heavy chain in acute myeloid leukemia. Science 26 1 :1041, 1993
47. Klambt C: The Drosophila gene pointed encodes two ETSlike proteins which are involved in the development of the midline
glial cells. Development 1 17:163, 1993
48. Hiebert SW, Sun W-H, Davis N, Golub TR, Shurtleff S, Buijs
A, Downing JR, Grosveld G, Roussel M, Gilliland DG, Lenny N.
Meyers S: The t(12;21) converts AML-IB from an activator to a
repressor of transcription. Mol Cell Biol 16:1349, 1996
From www.bloodjournal.org by guest on July 12, 2017. For personal use only.
1996 88: 4252-4258
TEL/AML-1 dimerizes and is associated with a favorable outcome in
childhood acute lymphoblastic leukemia
TW McLean, S Ringold, D Neuberg, K Stegmaier, R Tantravahi, J Ritz, HP Koeffler, S Takeuchi,
JW Janssen, T Seriu, CR Bartram, SE Sallan, DG Gilliland and TR Golub
Updated information and services can be found at:
http://www.bloodjournal.org/content/88/11/4252.full.html
Articles on similar topics can be found in the following Blood collections
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American
Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.