Int.J.Curr.Microbiol.App.Sci (2014) 3(4): 53-64
ISSN: 2319-7706 Volume 3 Number 4 (2014) pp. 53-64
http://www.ijcmas.com
Original Research Article
Light influences Pigment, Biomass and Morphology in
Chaetomium cupreum - SS02 - A Photoresponse Study
K.Soumya, L.Swathi, G.L.Sreelatha and T.Sharmila*
Department of Microbiology and Biotechnology, Jnanbharthi Campus, Bangalore University,
Bangalore 560 056, Karnataka, India
*Corresponding author
ABSTRACT
Keywords
Chaetomium
cupreum;
pigment;
photoresponse;
quantification.
Increasing consumer awareness on toxic synthetic dyes has invoked interest in
study and production of natural colors. Fungi are known to be potential source for
natural colors due to their easy culturing and downstream production. Pigments
produced by these organisms are influenced by many environmental factors; one of
them being light. The present work focuses on the photoresponse in Chaetomium
cupreum to different wavelengths of light. The organism was isolated from soil and
selected for the studies owing for its ability to produce extracellular pigment. The
present work aims to study the influence of different wavelengths of visible
spectrum on pigment and biomass production in Chaetomium cupreum. The study
observes that green light incubation induced maximum pigmentation whereas
yellow and white light incubation recorded low intensity and reduced pigment
yield. In contrast, white and blue wavelength exhibited increased biomass
production and red wavelength showed least biomass yield. There was a significant
difference in the radial growth of the mycelia on solid media although the
morphology showed less variation. This infers that photoreceptors are active as in
other fungi and play a major role in pigment and biomass production. These
findings are important and would likely assist in providing clue to the further
research in Chaetomium cupreum.
Introduction
Light has a crucial influence on
microorganisms due to its capability of
inducing morphological and behavioral
changes (Casas-Flores et al., 2006). It
induces varied response in nearly all forms
of life including filamentous fungi. Fungal
Photobiology shows the existence of
greater convolution in responses for
visible spectrum of light (Herrera-Estrella
et al., 2007). Several types of
photoreceptors (Molecules that receive
and transduce the photon energy to
promote a cell response) have been
described in fungi (Corrochano 2007;
Herrera-Estrella et al., 2007). Many
physiological processes such as growth,
53
Int.J.Curr.Microbiol.App.Sci (2014) 3(4): 53-64
the direction of growth, asexual and sexual
reproduction, and pigment formation, all
of which are very crucial aspects of
survival and dissemination of fungi are
regulated by light (Idnurm et al., 2005). It
is best studied and understood in
Neurospora crassa, where in blue light is
the type of light most associated with
fungal photomorphogenesis, metabolic
pathways (Liu et al., 2003) and regulates
circadian rhythms and other processes
such as the synthesis of photo-protective
pigments and spore formation (Miyake et
al., 2005).
developed from this species, and is widely
used as broad spectrum bio- fungicide for
the disease control in various plants
(Soytong et al 2001). It is also known to
biodegrade catechin, a well-known
recalcitrant compound and a related
enzyme catechin oxygenase (Arunachalam
et al., 2007), Azaphilones, a novel bicyclic
anthraquinone has been successfully
isolated from it. The red oosporein, from
C. cupreum is known to have antifungal
effects against Rhizoctonia solani, Botrytis
cinerea, Pytium ultimum and many
pathogenic fungi. It has also shown
antitumor activity against HL-60 and
A549 and acute toxicity against Artemia
salina (Kanokmedhakul et al., 2007). Its
antifungal activity is being exploited for
natural medicines (Kanokmedhakul et al.,
2006). Four compounds, rotiorinols A, C,
stereoisomer (-) -rotiorin and rubrorotiorin
isolated from C. cupreum is known to
exhibit antifungal activity against Candida
albicans (Vengurlekar et al., 2012), the
halogenated compound rubrorotiorin being
the most active (Saleem et al., 2010).
Some species of C. cupreum are very good
cellulase, laccase (Ankudimova et al.,
1999; Mimura et al., 1999), and chitinase
producers (Inglis et al., 2002) and are
implicated in biotechnological industry.
Earlier the focus was on production of
pigments from Monascus spp in various
media. Its light-dependent growth and
food industry applications were ornately
studied by Pandey et al., Carvalho et al.,
and Babitha et al., (1994, 2003; 2008).
However, very little has been known about
the influence of different colors of light on
the growth and pigment production of
Chaetomium cupreum. To overcome this
lacuna, in this study, we have made an
effort to examine the effect of different
colors of light for the production of
pigments and biomass by growing the
fungus in submerged fermentation.
A number of natural colorants though
present, only a few are available in
adequate quantity and are of industrial
importance, as they are straightly extracted
from different parts of the plants (Lauro
1991). Microbial pigments are interesting
as potential alternative, owing to their
nature, medicinal properties, nutritive
value, expected yield, easy handling,
safety, production being independent of
season and geographical conditions [Latha
et al., 2010]. Increased consumer
awareness of the safer natural colors has
led producers to move on to the natural
and non-synthetic colorants in textile
industry (Nagia et al., 2007), foods and
cosmetics (Chiba et al., 2006). It is
therefore beneficial to produce colors from
natural sources such as microbes. Some of
the pigments successfully produced are
from Monascus (Wong et al.,1983;
Yoshimura et al.,1975) and Serratia (Trias
et
al.,
1988),
however
many
microorganisms are yet to be explored for
pigments.
C. cupreum is a widely distributed and
abundantly found soil fungus that exhibits
antagonism
against
numerous
phytopathogens (Mao et al., 2010). A
commercial product Ketomium® has been
54
Int.J.Curr.Microbiol.App.Sci (2014) 3(4): 53-64
Materials and Methods
to get the final yield.
Isolation and Identification
Color stability at varying pH
Chaetomium cupreum was isolated from a
litter sample collected from the GKVK
campus, Bangalore. Isolation was carried
out by the serial dilution method (Aneja
2003) on Potato Dextrose Agar (PDA)
medium. The colony was subjected to
morphological
and
microscopic
observations. The morphological identity
was confirmed by NFCCI, Agharkar
Research Institute, Pune, India. To
confirm the species, sequence analysis of
the ITS region using universal primers
(Forward
primer,
ITS
1
TCCGTAGGTGAACCTGCGG
and
Reverse
primer,
ITS
4
TCCTCCGCTTATTGATATGC)
was
performed. Nucleotide Blast to the
obtained sequence was performed in NCBI
(www.ncbi.nlm.nih.gov/) using blastn
suite. The sequence was deposited in
NCBI Genbank.
The color sensitivity of the pigment in
aqueous state was determined by changing
the pH of the extract to 1, 3, 5, 7, 9, 11, 12
and 14 individually and quantifying the
extract as discussed above. Absorbance
maximum was noted to confirm the
change in color of the pigment at varying
pH.
Effect of Visible Spectrum of Light
The organism was cultured in 100ml of
Potato Dextrose Broth (PDB) to study the
effect of different wavelengths of light on
biomass and pigment production. For the
studies on cultural morphology, the
organism was cultured on PDA in
petriplates. Five millimeter mycelial discs
bored out from the periphery of six days
old culture were used for inoculation. The
flasks and plates were wrapped in color
glass papers of red, blue, green and yellow
colors. A set of flasks and plates were
covered with black art paper to completely
cut off the light and hence incubated in
darkness. Another set of flasks and plates
were exposed completely to light source to
record the effect of white light. The
Principle behind the use of colored glass
papers was that a colored glass paper
allows only its particular color of light to
pass through it whereas it filters out the
other colors of the spectrum. All the flasks
(Fig. 1a) and plates (Fig. 1b) were placed
at equidistant (15cm) from the illuminated
light source (Philips CFL 50 watts). After
seven days of incubation, the pigment was
quantified and extracted. The extract was
concentrated in rotary vacuum evaporator
and the concentrated extract was dried in a
pre-weighed beaker to estimate dry solid.
The final yield was recorded as mg l-1.
Extracellular Pigment Extraction and
Quantification
For the extraction of the pigment, the
culture was grown in Potato Dextrose
Broth (PDB) at 30oC. The flasks were
incubated for 7 days for maximum
pigment production. The pigmented
culture broth was filtered and was directly
quantified (Dhale et al., 2009), at 530nm
in a UV-Visible spectrophotometer
(Schimadzu UV 1700, pharmaspec) to
determine the absorption maxima ( max).
The units were expressed as units of
absorbance ml-1 of the broth (Lee et al.,
2001). The uninoculated Potato Dextrose
Broth was used as blank. The pigment
was extracted to ethyl acetate, according to
the protocol of Cho et al., [Cho et al.,
2002] from the fermented broth. The
extract was vacuum evaporated to dryness
55
Int.J.Curr.Microbiol.App.Sci (2014) 3(4): 53-64
by National Fungal culture collection of
India and Fungal Identification Service
(NFCCI & FIS), Agharkar Research
Institute, Pune. The Culture was deposited
in the National Fungal Culture Collection
of India (NFCCI), with accession Number
NFCCI 3117. BLAST search performed
for the sequence of ITS analysis, showed
99% homology with other strains of
Chaetomium cupreum available in Gen
bank. The sequence was deposited in
NCBI Genbank with accession Number
KF668034.
Pigment Hue/ color
The final crude pigment was visually
compared for color and texture variability.
Biomass estimation
Mycelium was separated from the broth by
centrifugation and filtration after seven
days of incubation. The separated mycelial
mass was washed thrice with distilled
water and dried overnight at 105oC in hot
air oven. The dry weight was recorded as g
l-1. The radial growth (colony diameter) of
the organism cultured on PDA plates was
measured after incubation.
Quantification
The pigment showed absorption maxima
( max) at 530 nm indicating that it is a red
pigment. The absorbance was expressed as
Units of Absorbance ml-1 (Fig. 3).
Cultural Morphology
The morphology of the culture was
compared with respect to the hyphae,
pigmentation and texture of the colonies
after 7 days of incubation in PDA plates.
Color stability at varying pH
The pigment color at varying pH varied
significantly. As the pH of the aqueous
solution shifted to alkaline, the maximum
absorption
wavelength
increased,
associated with a variation in color. It
turned yellow at acidic pH and deep
orange at alkaline pH, though it remained
deep red from pH 6 to 9 (Fig. 4).
Statistical Analysis
All the results were analyzed by means of
Multivariate ANOVA using SPSS for
windows (SPSS Inc.) 11.5 version. Post
Hoc analysis was performed using Scheffe
test with significance p < 0.05.
Effect of Visible Spectrum of Light on
pigment and biomass production
Results and Discussion
Isolation and Identification
The results in this study indicated that
pigment and biomass production varied
significantly depending on the different
wavelengths of light. Here, the culture
under submerged condition was exposed
to different colors and thus different
wavelengths of light (Blue 492 455 nm,
Green 577 492 nm, Yellow 597 577 nm,
Red 780 622 nm, White and Darkness).
Maximum pigment production was
observed in green light incubation (Fig. 5),
The isolated fungus was identified as
Chaetomium
cupreum
based
on
morphological (Fig. 2a & 2b) and
microscopic characteristics (Fig. 2c & 2d).
Diffusion of deep red pigment into the
media was observed around the colony on
PDA plate, which suggested that it is
water soluble.
The identification was further confirmed
56
Int.J.Curr.Microbiol.App.Sci (2014) 3(4): 53-64
followed by blue light and dark
incubation. Though yellow and white light
incubation led to least pigment production,
they did not completely inhibit the
synthesis of pigment. Increased pigment
production was observed in total dark
incubation as compared to the flasks
completely exposed to white light.
analyzed by comparing the visible
phenotypic characters observed on the
PDA plates after 7 days of incubation (Fig.
8). The colonies grown under blue and
white showed profuse growth of mycelia,
denser and pigmented towards the center.
The colonies grown under red, yellow and
green light showed denser mycelial growth
at the center and scanty growth towards
the outer circle, whereas the colonies
under dark incubation showed very dense
mycelia growth at the center and
completely hyaline and scanty growth at
the periphery. This observation showed
that the incubation in white light and
darkness increased the biomass production
and also exhibited variation in cultural
morphology.
The visual comparison of the extracted
pigment exhibited varied hue (shades of
color) to different wavelengths of light
(Fig. 6). The white light incubation
yielded a deep red colored pigment
whereas yellow light incubation yielded a
light red to orange colored pigment. The
texture of the pigment also varied largely,
yellow light incubated pigment was
completely amorphous and the pigment
from white light incubation was semi
crystalline. Overall, as the shade of the
pigment grew darker, the texture turned
towards crystalline and the lighter shaded
pigments exhibited amorphous nature.
Regulation of fungal growth and behavior
is a prominent example of the effect of
light on fungi (Corrochano et al., 2006). In
several model fungal species the effect of
light has been studied. While the
morphological effects and spectral
analyses of light have been well
characterized
in
basidiomycetes
(Coprinus)
and
zygomycetes
(Phycomyces), it is best understood based
on the functions of the white collar genes
(WC-1 and WC-2) in light sensing. (Kues
2000; Cerda Olmedo 2001; Liu et al.,
2003). Despite the importance of the light
in fungal development and metabolism,
there is a lot left unexplored to explain the
mechanisms and its influence on pigment
production in C. cupreum.
On the contrary to the above observation,
white and blue light, as well as dark
incubation favored biomass production
whereas red light incubation reduced the
biomass yield (Fig. 7). The growth was
also measured on solid media in terms of
colony diameter. White light incubated
colony exhibited highest radial growth and
red light incubated colony showed the
least colony diameter on the solid media.
However, green and white light incubation
did not have much effect on biomass
production. This observation suggests that
white light induced the biomass
production in this organism, unlike in
pigment synthesis where it reduced the
pigment yield.
The color of the pigment was found to be
sensitive to pH. Similar variation in the
color of red pigment isolated from
Paecilomyces sinclairii and Isaria
farinosa was also observed by Cho et al.,
(2002) and Velmurugan et al., (2010)
respectively. This shows that this pigment
Cultural morphology
The effects of different wavelength of the
visible spectrum on the cultures were
57
Int.J.Curr.Microbiol.App.Sci (2014) 3(4): 53-64
Figure.1 (a) Experimental set up to study the effect of light on pigment production and
growth in Chaetomium cupreum in submerged fermentation (b) On Solid Media.
Figure.2(a) Morphology and Pigmentation of Chaetomium cupreum on PDA plate. (b)
Reverse side of the plate. (c) Microscopic view of the ascocarp and (d) ascospores of
Chaetomium cupreum.
58
Int.J.Curr.Microbiol.App.Sci (2014) 3(4): 53-64
Figure.3 Spectrphotometrical Quantification of the pigment of Chaetomium cupreum
Figure.4 Sensitivity of the pigment of Chaetomium cupreum to varying pH
Figure.5 Effect of different wavelengths of Light and darkness on pigment production of
Chaetomium cupreum: Scheffe post hoc test: Means sharing different superscripts are
significantly different (P<0.05)
59
Int.J.Curr.Microbiol.App.Sci (2014) 3(4): 53-64
Figure.6 Effect of different wavelengths of Light and darkness on pigment hue of
Chaetomium cupreum
Figure.7 Effect of different wavelengths of Light and darkness on growth and biomass
production of Chaetomium cupreum: Scheffe post hoc test: Means sharing different
superscripts are significantly different (P<0.05).
Figure.8 Effect of different different wavelengths of Light and darkness on morphology of
Chaetomium cupreum
60
Int.J.Curr.Microbiol.App.Sci (2014) 3(4): 53-64
is sensitive to pH. This property of the
pigment can be exploited for various
industrial demands.
(from
the
growth
responses
to
phototropism) studied in the fungi
(Kumagai 1988; Lauter 1996). Other
classes of photoreceptors are also being
identified recently. Blumenstein et al.,
(2005)have reported a red light sensing via
phytochrome in the model fungus
Aspergillus nidulans, Hoff et al., (2010)
have reported two components of a velvetlike complex that control hyphal
morphogenesis
in
Penicillium
chrysogenum. Hurley et al., (2012) have
worked
on
the
light
inducible
photoreceptor system for tunable protein
expression in N. crassa. Retinalreconstituted Nop-1 is a green-absorbing
pigment while Neurospora responds to
blue light; Saranak and Foster (1997)
concluded that in the chytrid Allomyces
reticulates, a rhodopsin is responsible for
zoospore phototaxis.
WCC complex,
Opsin and velvet photoreceptors have been
identified in Chaetomium globosum
(Rodriguez-Romero et al., 2012). Very
recently a Poly Ketide Synthetase (PKS)
gene
pks-1 has been identified to be
involved in chaetoglobosin biosynthesis,
pigmentation
and
sporulation
in
Chaetomium globosum (Hu et al., 2012),
but the photoresponse studies in C.
cupreum have not yet been reported. The
phytochromes were thought to be found in
photosynthetic organisms only, but
recently it has been discovered even in the
fungi and heterotrophic bacteria, where
little is known about their functions.
The results of effect of visible spectrum of
Light on pigment and biomass production,
agrees with that of (Babitha et al., 2008)
and is significant as it is in contradiction to
the postulated photo-protective role of
pigments according to (Yong et al., 1991;
Salih et al., 2000; Seagle et al., 2005). In
N. crassa, blue light induces the
carotenoid pigment production.
The significant variation of pigment and
biomass production in white light and
darkness could be explained by the
hypothesis
of
the
existence
of
photoreceptors responsive to darkness and
the presence of light in this fungus
(Velmurugan et al., 2010). Understanding
the role of environmental stimuli in fungal
development is very important to increase
the benefits and reduce the costs that fungi
present (Idnurm et al., 2005). The pigment
hue produced by the fungi varies by strain,
medium
composition,
and
growth
Condition and is greatly affected by the
medium composition [Jung et al., 2003]. It
is evidenced in Trichoderma atroviride,
that the blue-light perception system
establishes a cross-talk with that involved
in red light perception, which is reflected
at the level of mycelial growth. Although
the blue region of the spectrum provides
the dominant signal, the green and red
photoresponses
have
often
been
overlooked (Herrera-Estrella et al., 2007).
The wavelengths of light from UV to farred can induce responses in the members
of the fungal kingdom. However, of late
only one photoreceptor class (blue light
sensors) had been identified in the fungi.
Photoresponses
mediated
by
the
photoreceptors that absorb blue light
constitute the majority of photoresponses
The experiments on the effect of different
wavelengths of visible spectrum in this
study revealed that the incubation in green
light was most effective followed by
darkness and blue light, in inducing the
pigment production. The hue and texture
of the pigment also varied greatly with
white light incubation producing the
darkest shade of the pigment. The colonies
61
Int.J.Curr.Microbiol.App.Sci (2014) 3(4): 53-64
grown under the direct white light
exhibited reduced pigment production;
thus, postulating the existence of
photoreceptors in this fungus, responsive
to darkness and light. This photoresponse
on pigment production, when compared
with the other reported photoresponses in
fungi, is quite different. The operation of
the phytochrome type of system in this
fungus is shown by the physiological and
morphological
responses.
Varying
pigment concentrations suggested the loss
of pigments which is unexplainable as a
change in pigment location. One possible
explanation for degradation in pigments
might be because of an enzymatic
pathway, which may be induced by
nutrient
exhaustion.
A
common
phenomenon observed in fungi is that the
secondary metabolites are degraded by
enzymes (Johns et al., 1982). The pigment
of Chaetomium cupreum, in the present
study is extracellular and hence significant
as it is water soluble and possesses simpler
and cheaper downstream processing.
Probably the induction and reduction of
pigment synthesis could be due to the
varied light intensities (intensity of the
green light usually lower than white light).
Therefore, to gain comprehensive insight
into the regulation of pigment biosynthesis
induced by light, many parameters need to
be explored and we expect that the present
study provides a strong approach towards
attaining this goal. The study also assures
the possibility of establishing a relation
between
the
photoreceptors,
light
regulated genes and the photoresponse in
Chaetomium cupreum and may probably
unravel the possible functions interplaying
between the different light control
systems. Furthermore, these studies may
also help in significant commercial
applications pertaining to the use of
pigments.
Acknowledgment
Soumya K is grateful to University Grants
Commission, Government of India, New
Delhi, India, for awarding Rajiv Gandhi
National
Fellowship.
The
authors
acknowledge Bangalore University for
funding this project under young research
brigade programme - YRB- BUIRF: 2010
-11 and Fungal Identification Service,
Agharkar Research Institute, Pune and
Geneombio Technologies, Pune for their
support in the identification of the
organism.
References
Aneja,
K.R.
2003.
Experiments
in
microbiology plant pathology and
biotechnology New Age International (P)
Limited New Delhi India.
Ankudimova, N.V., Baraznenok, V.A.,
Becker, E.G., Okunev, O.N. 1999.
Cellulase complex from Chaetomium
cellulolyticum: isolation and properties of
major components. Biochem. 64, 10681073.
Arunachalam, M., Mohan Raj, M., Mohan, N.,
Mahadevan, A. 2003. Biodegradation of
catechin. Proc Indian natn. Sci. Acad. B.
69(4), 353-370.
Babitha, S., Carvahlo, J.C., Soccol, C.R.,
Pandey, A. 2008. Effect of light on
growth, pigment production and culture
morphology of Monascus purpureus in
solid-state
fermentation.
World
J.
Microbiol. Biotechnol. 24,2671 2675.
Blumenstein, A., Vienken, K., Tasle,r R.,
Purschwitz, J. et al., 2005. The
phytochrome FphA controls development
in the filamentous fungus Aspergillus
nidulans. Curr. Biol. 15, 1833 1838.
Carvalho, J.C., Pandey, A., Babitha, S.,
Soccol, C.R. 2003. Production of
Monascus biopigments: an overview Agro
Food Ind. Hi Tec. 14, 37 42.
Casas-Flores S, Rios-Momberg M, RosalesSaavedra T, Martinez-Hernandez P. et al.,
62
Int.J.Curr.Microbiol.App.Sci (2014) 3(4): 53-64
2006. Cross talk between a fungal bluelight perception system and the cyclic
AMP signaling pathway. Eukaryot Cell.
5,499 506
Cerda Olmedo, E. 2001. Phycomyces and the
biology of light and color. FEMS.
Microbiol. Rev. 25,503 512.
Chiba, S., Tsuyoshi, N., Fudou, R., Ojika, M.
et al., 2006. Magenta pigment produced
by fungus. J. Gen. Appl. Microbiol.
52,201 207.
Cho, Y.J., Park, J.P., Hwang, H.J., Kim, S.W.
et al., 2002. Production of red pigment by
submerged culture of Paecilomyces
sinclairii. Lett. Appl. Microbiol. 35,195
202.
Corrochano,
L.M.
2007.
Fungal
photoreceptors: sensory molecules for
fungal development and behaviour.
Photochemical
&
photobiological
sciences : Official journal of the
European Photochemistry Association and
the European Society for Photobiology.
6,725 36.
Corrochano, L.M., Galland, P. 2006.
Photomorphogenesis and gravitropism in
fungi. In The Mycota Vol I. Growth
differentiation and sexuality. 233 259.
Berlin Springer-Verlag.
Dhale, M.A., Vijay-Raj, A.S. 2009. Pigment
and amylase production in Penicillium sp
NIOM-02 and its radical scavenging
activity. Int. J. Food Sci. Technol. 44
(12), 2424-2430.
Herrera-Estrella A, Horwitz, B. 2007. Looking
through the eyes of fungi: molecular
genetics
of
photoreception.
Mol
Microbiol. 64, 5 15.
Hoff, B., Kamerewerd, J., Sigl, C., Rudolf,
Mitterbauer, Zadra. I. et al., 2010. Two
components of velvet-like complex
control
hyphal
morphogenesis,
conidiophore development, and penicillin
biosynthesis in Penicillium chrysogenum.
Eukaryot. Cell. 9, 1236 1250.
Hu, Y., Hao, X., Lou, J., Zhang, P. et al.,
2012. A PKS gene, pks-1, is involved in
chaetoglobosin biosynthesis, pigmentation
and sporulation in Chaetomium globosum.
Sci. China Life Sci. 55(12), 1100 1108.
Hurley, J.M., Chen-Hui, Chen, Loros, J.J.,
Dunlap, J.C. 2012. Light-inducible system
for tunable protein expression in
Neurospora crassa. G3 (Bethesda). 12071212.
Idnurm, A., Heitman, J. 2005. Light controls
growth and development via a conserved
pathway in the fungal kingdom. PLOS
Biology.
3,
1 12.
doi:
10.1371/journal.pbio.0030095.
Inglis, G.D., Kawchuk, L.M. 2002.
Comparative degradation of oomycete and
basidiomycete cell walls by mycoparasitic
& biocontrol fungi. Can. J. Microbiol. 48,
60 70.
Johns, M.R., Chong, R., Maddox, I.S. 1982.
Hydrolysis of some natural and synthetic
bile acid conjugates by Cerospora
melonis. Can. J. Microbiol. 28,457 461.
Jung, H., Kim, C., Kim, K., Shin, C.S. 2003.
Color characteristics of Monascus
pigments derived by fermentation with
various amino acids. J. Agric. Food.
Chem. 51, 1302- 1306.
Kannokmedhakul, S., Kanokmedhakul, K.,
Nasomjai, P., Louangsysouphanh, S.,
Soytong, et al., 2006. Antifungal
azaphilones from the fungus Chaetomium
cupreum CC3003. J. Nat. Prod. 69,891
895.
Kanokmedhakul, S., Kanokmedhakul, K.,
Soytong, K., Suksamrarn, A. 2007.
Bioactive compounds from Chaetomium
cupreum, C. globosum and Trichoderma
harzianum. International Conference on
Integration of Science & Technology for
Sustainable Development. Bangkok. 166169
Kues, U. 2000. Life history and development
processes in the basidiomycete Coprinus
cinereus. Microbiol. Mol. Bio. Rev. 64
(2), 316-353.
Kumagai, T. 1988. Photocontrol of fungal
development. Photochem.
Photobiol.
47,889 896.
Latha, B.V., Jeevaratnam, K. 2010.
Purification and characterization of the
pigments from Rhodotorula glutinis DFRPDY isolated from natural source. Glob. J.
Biotechnol. Biochem. 5(3), 166-174
Lauro, G.J. 1991. A primer on natural colors.
Cereal Food World. 36,949-953
63
Int.J.Curr.Microbiol.App.Sci (2014) 3(4): 53-64
Lauter, F. 1996. Molecular genetics of fungal
photobiology. J. Genetics. 75,375 386.
Lee, B.K., Park, N.H., Piao, H.Y., Chung,
W.J. 2001. Production of red pigments by
Monascus
purpureus in
submerged
culture.
Biotechno. Bioprocess Eng.
6,341-346.
Liu, Y., He, Q., Cheng, P. 2003.
Photoreception in Neurospora: A tale of
two White Collar proteins. Cell Mol. Life
Sci. 60, 2131 2138.
Mao, B. Z., Huang, C., Yang, G.M., Chen,
Y.Z. et al., 2010. Separation and
determination of the bioactivity of
oosporein from Chaetomium cupreum.
Afr. J. Biotechnol. 9(36), 5955-5961.
Mimura, S., Rao, U., Yoshino, S., Kato, M. et
al., 1999. Depression of the xylanaseencoding cgxA gene of Chaetomium
gracile in Aspergillus nidulans. Microbiol.
Res. 153, 369-376.
Miyake,
T., Mori,
A., Kii,
T., Okuno,
T., Usui, Y. et al., 2005. Light effects on
cell
development
and
secondary
metabolism in Monascus. J. Ind.
Microbiol. Biotechnol. 32,103 8.
Nagia, F.A., EL-Mohamedy, R.S.R. 2007.
Dyeing
of
wool
with
natural
anthraquinone dyes from Fusarium
oxysporum. Dyes. Pigm. 75,550 555.
Pandey, A. 1994. Solid-state fermentation: an
over view, Solid State Fermentation Wiley
New Delhi India. 3 10
Rodriguez-Romero, J, Hedtke, M., Kastner,
C., Muller, S. et al., 2010. Fungi, hidden
in soil or up in the air: light makes a
difference. Annu. Rev. Microbiol. 64,585
610
Saleem, M., Nazir, M., Ali, MS., Hussain, H.
et al., 2010. Antimicrobial natural
products: an update on future antibiotic
drug candidates. Nat. Prod. Rep. 27,
238 254.
Salih, A., Larkum, A., Cox, G., Kuhl, M. et
al., 2000. Fluorescent pigments in corals
are photoprotective Nature. 408 (6814),
850 853
Saranak, J., Foster, K.W. 1997. Rhodopsin
guides
fungal
phototaxis.
Nature.
387,465 466.
Seagle Brandon-Luke, L., Rezai, K.A.,
Kobori, Y., Gasyna, E.M. et al., 2005.
Melanin photoprotection in the human
retinal pigment epithelium and its
correlation with light-induced cell
apoptosis. Proc. Natl. Acad. Sci. USA
102(25), 8978 8983.
Soytong,
K.,
Kanokmedhakuf,
S.,
Kukongviriyapa, V., Isobe, M. 2001.
Application of Chaetomium species
(Ketomium) as a new broad spectrum
biological fungicide for plant disease
control: A review article. Fungal Divers.
7, 1-15.
Trias, J., Vinas, M., Guinea, J., Loren, J.G.
1988. Induction of yellow pigmentation in
Serratia marcescens. Appl Environ.
Microbiol. 54, 3138-3141.
Velmurugan, P., Lee, Y.H., Nanthakumar, K.,
Kamala Kannan, S. et al., 2010.
Water soluble red pigments from Isaria
farinosa and structural characterization of
the main colored component. J. Basic
Microbiol. 50 (6), 581-590.
Velmurugan, P., Lee, Y.H., Venil, C.K.,
Lakshmanaperumalsamy, P. et al., 2010.
Effect of light on growth intracellular and
extracellular pigment production by five
pigment-producing filamentous fungi in
synthetic medium. J. Biosci. Bioeng.
109(4), 346-50.
Vengurlekar, S., Sharma, R., Trivedi, P. 2012.
Efficacy of some natural compounds as
antifungal agents; Pharmacogn. Rev.
6(12), 91 99.
Wong, H.C., Koeheler, P.E. 1983. Production
of red water soluble Monascus pigments.
J. Food Sci. 48, 1200-1203.
Yong, Y.Y.R., Lee, Y.K. 1991. Do
carotenoids play a photoprotective role in
the cytoplasm of Haematococcus lacustris
(Chlorophyta)? Phycologia. 30(3), 257261.
Yoshimura, M.S., Yamanaka, K., Mitsugi,
Hirose, Y. 1975. Production of Monascus
pigment in a submerged culture. Agricult.
Biol. Chem. 39, 1789-1795.
64