Development 143: doi:10.1242/dev.129478: Supplementary information
Supplementary Materials and Methods
Immunohistochemistry
For immunohistochemistry experiments, E11.5 embryos were collected, fixed in 4%
paraformaldehyde (PFA) in PBS overnight at 4º C, and then rinsed extensively in PBS. The
embryos were then immersed sequentially in 30% sucrose, 30% sucrose/50% OCT at 4º C,
and finally embedded in 100% OCT at -20º C. After cutting the tissue into 25 μm sections
and collecting the sections on slides, the slides were rinsed in PBS and blocked (10% horse
serum and 0.3% TritonX-100 in PBS) for 1 hour at room temperature. The slides were then
incubated with a primary antibody overnight at 4º C, washed three times in PBS for 5
minutes each. Finally, the slides were incubated with a suitable secondary antibody for 2
hours at room temperature and then washed in PBS prior to mounting with Hoechst (Life
technology) in Vectashield (Vector Laboratory). For immunohistochemistry using Fc-fusion
proteins, sections were fixed at -20º C for 5 min each with methanol and acetone, washed
three times in PBS, and then immersed in a blocking buffer (10% horse serum and 2% BSA
in PBS) for 30 min at room temperature. The sections were then incubated with EphrinA5-Fc
(R&D Systems) (5 μg/ml) in blocking buffer for 90 min at room temperature. After two gentle
and blocked (2% BSA, 10% horse serum, and 0.1% Triton X-100 in PBS) for 30 min at room
temperature. After washing with PBS, the sections were incubated with a Texas Redconjugated goat anti-human IgG secondary antibody overnight at 4º C and mounted.
EdU labeling
For EdU labeling, pregnant female mice were IP-injected with a single pulse of EdU (50 mg
per kg body weight) and euthanised after 30 min. Embryos were fixed overnight in 4% PFA,
dehydrated in ethanol, cleared in Histoclear, embedded in paraffin, and cut into 10 μm
sections. The paraffin sections were rehydrated with distilled water, and antigen retrieval was
Development • Supplementary information
washes with PBS, the sections were fixed with 4% PFA in PBS for 15 min, rinsed with PBS
Development 143: doi:10.1242/dev.129478: Supplementary information
performed using an antigen unmasking solution (Vector). EdU imaging was performed using
the Click-iT EdU imaging Kit (Invitrogen). The ratio of EdU-positive cells (as compared to
DAPI-positive cells) was measured with the ZEN software package (Zeiss).
The primer sets for RT-PCR analysis
For ephrin-A1, a 272 bp was amplified with primers 5′-ATCCCAAGTTCCGTGAGGAGG-3’
and 5′-CTCCTTGCCCAAGATAAAAGGC-3’. For ephrin-A2, a 195 bp was amplified with
primers
5’-GACGTTGTCGGTTTATTTCTGTAAA-3’
and
5’-
GAGTTTATTGCAAAGTGTTGCTTCT-3’. For ephrin-A3, a 295 bp was amplified with primers
5’-TCGCCTTCTTCCTCATGACG-3’ and 5’-CTGAGCACTGCCTTTATAGCC-3’. For ephrinA4, a 210 bp was amplified with primers 5’-TTATACATGGTGGACTGGTC-3’ and 5’AGGACTCTCCGGAGTCGGCACC-3’. For ephrin-A5, a 162 bp was amplified with primers
5’- TCTGTACTTTGGTTTGGTTTTCTGT -3’ and 5’- CAGGTACTGTGACTCTTCCTTTCAC 3’. For ephrin-B1, a 370 bp was amplified with primers 5’-GGCTGCTTGCAGCACTGTGC-3’
and 5’-CTCATGCTTGCCGTCAGAGTC-3’. For ephrin-B2, a 330 bp was amplified with
primers 5’-ACCACTAAGGACTGCAGACAG-3’ and 5’-GTCCAAGTGGGGATCTCCTAG-3’.
For ephrin-B3, a 217 bp was amplified with primers 5’-GCTCACAGCGCGGAACCTGG-3’
Development • Supplementary information
and 5’-CAGGGTGGCGACTCTCCGAAG-3’.
Development 143: doi:10.1242/dev.129478: Supplementary information
Fig. S1. Expression of ephrin-A5 in early murine eye development. (A-C) Horizontal
sections showing GFP expression under the control of the ephrin-A5 promoter at various
al., 2011). Up, temporal; Down, nasal; Left, lateral; Right, medial. Horizontal sections were
aligned in the same way in the remaining figures. OV, optic vesicle; OC, optic cup; NR,
neural retina. The graded expression of ephrin-A5 in Fig. 1B was analyzed using ZEN
software (Zeiss) in (C’). The boxed area in (C) is magnified in (D). The arrows mark naturally
occurring cell death in the proximal optic cup. (E) TUNEL staining of horizontal sections from
E11.5 embryos. AQ, cerebral aqueduct; IIIV, third ventricle; LV, lateral ventricle. The boxed
areas in (E) are magnified in (F) and (G). LE, lens; N, nasal; T, temporal. (H) Co-localization
of GFP with activated caspase-3 protein in horizontal sections of eA5-GFP BAC transgenic
embryos at E11.5. The boxed area in (H) is magnified in (I-K).
Development • Supplementary information
developmental stages. This EphrinA5-GFP BAC transgenic was previously reported(Yoo et
Development 143: doi:10.1242/dev.129478: Supplementary information
Fig. S2. Binding of ephrinA5-Fc to the proximoventral optic cup. (A and B) Horizontal
ephrinA5-Fc fusion protein followed by Fc-specific secondary antibody as described in Fig
2A-D. Note that ephrinA5-Fc is specifically bound to the proximoventral optic cup as marked
by the arrows in (B). (C) The graded expression of EphB2 in Fig. 3J was analyzed using
ZEN software.
Development • Supplementary information
sections from the medial to the ventral level of a wild type optic cup at E11.5 treated with the
Development 143: doi:10.1242/dev.129478: Supplementary information
Fig. S3. EphB2-dC acts as a dominant negative against wild type EphB2. (A) EphB2-dC
efficiently blocks the tyrosine phosphorylation of wild type EphB2 in HEK293 cells.
Transfected cells were treated with eA5-Fc on ice for 30 min, fixed, and incubated with a Fcspecific secondary antibody (top panels) or with an anti-phosphotyrosine (p-Tyr) antibody
(middle panels). (B) Quantification of the data in A. Data represents means ± S.D.
Approximately 100 cells were quantified per transfection. *P and **P <0.001, one-way
developing limb is a well-known site of EphB2 expression. (D) Semi-quantitative RT-PCR
analysis using RNA extracts from the left forelimb of the embryo shown in (C). (E and F)
Experiments were performed as described in panels C and D, except they were performed
on EphB2-dC BAC transgenic embryos. (G) EphB2-dC transgenic brains display axon
guidance defects in the anterior commissure. Serial horizontal sections of the indicated mice
at P5 were taken at the level of the anterior commissure (ac). Note that the acP tract in the
ventralmost sections of EphB2-dC brains have migrated abnormally towards the floor of the
brain (bottom panels) whereas those of their wild type littermate controls are barely visible in
the corresponding sections (top panels).
Development • Supplementary information
ANOVA. (C) LacZ expression in the right forelimb of a EphB2 BAC transgenic embryo. The
Development 143: doi:10.1242/dev.129478: Supplementary information
Fig. S4. Ectopic expression of EphB2 or EphB2-dC disrupts development of the
neural retina by E14.5
(A-C) Experiments were performed as described in Fig. 4B and C,
except that whole retinas were removed from littermate embryos at E14.5 for photography.
The retinas from EphB2-injected embryos (5 of 5) are smaller than their wild type controls,
but do not show any optic fissure closure defects. (D-F) Experiments were performed as
at E14.5 for photography. 80% of the retinas from EphB2-dC-injected embryos (4 of 5) are
much smaller than wild type and show deep indentations along the site of optic fissure
closure.
Development • Supplementary information
described in Fig. 4K and L, except that whole retinas were removed from littermate embryos
Development 143: doi:10.1242/dev.129478: Supplementary information
Fig. S5. JNK activation is highly dependent on Eph receptor type. (A-F) EphB2 or
EphB2-dC were transiently transfected into the indicated cell lines for 48 hours before the
cells were stained with an anti-phospho-JNK antibody. (G-L) Experiments were performed as
described in (A-F), except that the indicated Eph receptor expression vectors were
transfected into HEK293 cells and cell surface binding of ephrinA5-Fc or ephrinB1-Fc was
detected with an Fc-specific secondary antibody. Note that both EphB2 and EphB3 induce
Development • Supplementary information
strong JNK phosphorylation.
Fig. S6. (A and B) Experiments were performed as described in Fig. 6A and B using
HEK293 cells stably expressing EphB2-dC or EphB3. The western blot analysis in (B) was
performed using cells expressing EphB2-dC. These data were obtained simultaneously with
the results presented in Fig. 6A and B. (C) Experiments were performed as described in Fig.
6D and F using P19 cells stably expressing EphB2. (D and E) Quantification of the data in
(C) as described in Fig. 6E and G. *P< 0.001; **P<0.01, one-way ANOVA.
Development • Supplementary information
Development 143: doi:10.1242/dev.129478: Supplementary information
Development 143: doi:10.1242/dev.129478: Supplementary information
Fig. S7. Expression of Vax2 and Pax2 in the developing optic cup at E11.5. (A) Vax2
panels). Likewise, a coronal section from an E11.5 embryo was stained with an anti-Pax2
antibody (bottom panels). Note that expression of both Vax2 and Pax2 in the proximoventral
optic cup is not significantly altered in ephrin-A5 null mutant or EphB2-dC embryos. (B)
Experiments were performed as described in (A), except that they were performed on
EphB2 wild type or null mutant littermate embryos. (C) A horizontal section from an E11.5
embryo was stained with an anti-Pax2 antibody. Note that, for unknown reasons, the nuclear
localization of Pax2 is clear in horizontal sections but less so in coronal sections.
Development • Supplementary information
mRNA in a coronal section from an E11.5 embryo detected by in situ RNA hybridization (top
Fig. S8. Ephrin-A2 partially supplements ephrin-A5 during optic fissure closure. (A)
Semi-quantitative RT-PCR using RNA extracts from the optic cups of embryos at E11.5.
Ephrin-A2 is detectable in the optic cup but is expressed at lower levels than ephrin-A5. (B)
Development • Supplementary information
Development 143: doi:10.1242/dev.129478: Supplementary information
Development 143: doi:10.1242/dev.129478: Supplementary information
Whole retinas were removed from littermate embryos at E14.5 for photography as described
in Fig. 5E. EphrinA2-/-; ephrinA5+/- embryos are similar to the ephrinA5 null mutant embryos
in Fig. 1G. In contrast, ephrinA2+/-; ephrinA5-/- embryos show more severe defects in optic
fissure closure, nearly reaching the level of EphB2 null mutant embryos as presented in Fig.
5E. The fraction appearing in the lower right corner of each panel represents the ratio of
Development • Supplementary information
embryos showing the corresponding optic fissure closure phenotype.