Development • Supplementary information
Development 142: doi:10.1242/dev.121871: Supplementary information
Development • Supplementary information
Development 142: doi:10.1242/dev.121871: Supplementary information
Development • Supplementary information
Development 142: doi:10.1242/dev.121871: Supplementary information
Development • Supplementary information
Development 142: doi:10.1242/dev.121871: Supplementary information
Development • Supplementary information
Development 142: doi:10.1242/dev.121871: Supplementary information
Development • Supplementary information
Development 142: doi:10.1242/dev.121871: Supplementary information
Development • Supplementary information
Development 142: doi:10.1242/dev.121871: Supplementary information
Development • Supplementary information
Development 142: doi:10.1242/dev.121871: Supplementary information
Development • Supplementary information
Development 142: doi:10.1242/dev.121871: Supplementary information
Development 142: doi:10.1242/dev.121871: Supplementary information
Primers
Cyclin Dx (forward)
Cyclin Dx (reverse)
Dbx1 (forward)
Dbx1 (reverse)
Dbx2 (forward)
Dbx2 (reverse)
Engrailed1 (forward)
Engrailed1 (reverse)
EpiK (forward)
EpiK (reverse)
Evx1 (forward)
Evx1 (reverse)
Gad1 (forward)
Gad1 (reverse)
GAPDH (forward)
GAPDH (reverse)
GRPR (forward)
GRPR (reverse)
HB9 (forward)
HB9 (reverse)
Krox20 (forward)
Krox20 (reverse)
Lhx1/Lim1
Lhx1/Lim1 (forward)
Lhx3/Lim3 (forward)
Lhx3/Lim3 (reverse)
Lhx5 (forward)
Lhx5 (reverse)
MafB (forward)
MafB (reverse)
N-tubulin (forward)
N-tubulin (reverse)
Neurog2 (forward)
Neurog2 (reverse)
Nkx6.1 (forward)
Nkx6.1 (reverse)
Nkx6.2 (forward)
Nkx6.2 (reverse)
nxph2 (forward)
nxph2 (reverse)
Otx2 (forward)
Otx2 (reverse)
p27xic (forward)
p27xic (reverse)
Pax2 (forward)
Pax2 (reverse)
Pax6 (forward)
Pax6 (reverse)
Sequence
AAGCACAGCGAGACCTTCAT
GGTCCTGGACTCTGAAGCTG
CCTTATCAATGCCCAGAGCACCAT
TGATCTCTTCTTCCTGTTCCCCTCC
GAATGGACCCAGGAGCACTA
TCTCCCCAGGTTCCCAAATC
AGGCCCCGAACAGCCTTCACT
TCCTGCTCCTTCTCCTGCACAG
CTCACTTTGCCAGCACTCTG
GTGATAGCAATGGCCTTCGT
ACAAGCCGCATAGGGGAACGGA
TCAACACAACCCGCCTGTGCA
ACCCTGCCAATGACTTGTTC
GGAAGCTTGCCTCTCTTTGA
TAGTTGGCGTGAACCATGAG
GCCAAAGTTGTCGTTGATGA
AACAGGAACGATGGCATAGG
CTTTGCCCATACCAGCTCAT
GTTCCAGAACCGAAGGATGA
GCACCTTTCAGCTGGACTTC
ATGGCGGCTAAAGCAGTAGA
GATCCACATTGGGGAAGATG
CGTTGCAAGATGACGCTAAA
CCTAGGTCCCCTTCTTTTCG
AACTTGGCATTCCCAGACAC
CTACCGGTGGAAAGGTCAGA
GTGCAACCTGACCGAAAAAT
CTCGCTTTCCTGACCAAGTC
ACCGAGCACAAGACTCACCT
ATTTGGTGCTGCCCAATAAG
GCCTTTCCCTCGATTGCA
GTTGGCTGCCACGACTTGT
CGACAGCGCATGAAGTAGTG
CCCCAATGTTGCACTGACAA
GGAGAGATGCTAGGTTCGCC
AAGCGAAGATCTGTTGCCCA
TCCAGCATTAACCCTGCCTG
GTACCCCAAACCCCTGACTG
TTGCAGGATCAAAGTTGCAC
GCGCAGTCAACATTGAAAA
ATCTCAAGCAACCGCCATAC
CCTTTCCCTCCTCTGTTTCC
CTTTGAAACTGGCACCCCTC
GCGTTGTGTTGGCAGCTATA
CAGTCAGCACGGCTGGGCAT
TGCCTCCAGTTGCTGCTGAGT
CAAGTCTCATTTCCCCTGGA
TGCTGTGCACAAGTCCTTTC
Development • Supplementary information
Table S1
Development 142: doi:10.1242/dev.121871: Supplementary information
Prdm12 (forward)
Prdm12 (reverse)
Slc32a1 (forward)
Slc32a1 (reverse)
Slc6a5 (forward)
Slc6a5 (reverse)
Sox3 (forward)
Sox3 (reverse)
Vsx1 (forward)
Vsx1 (reverse)
CGTGCCATCAAGCCTTGGCCT
TCCCATTCAGGGGTTAAAACCCGA
CAGTGTGAGCGATGCCTAAA
AATGACTTTCCGTCCCTGTG
GACTCAAACTGCCGCCTAAG
CCGTTGGAAATCAGAGGAAA
TACCTGTGCTGGATCTGCTG
AGACACTTACGCGCACATGA
TGGAGCCATGGTGAGACACTCCA
TGCGGTGCTTGAGAGATCAATGGC
Table S2
Click here to Download Table S2
Click here to Download Table S3
Table S4
Click here to Download Table S4
Development • Supplementary information
Table S3
Development 142: doi:10.1242/dev.121871: Supplementary information
Movie 1. Uninjected control tadpoles naturally perform an escape reflex
movement in response to a stimulus. Narrative frames from a time-lapse series
showing an uninjected Xenopus laevis tadpole that initiates an escape reflex
Development • Supplementary information
movement when poked with a pipette tip.
Development 142: doi:10.1242/dev.121871: Supplementary information
Movie 2. Prdm12 MO-injected tadpoles are unable to perform a coordinated
escape reflex movement in response to a stimulus. Narrative frames from a timelapse series showing that a Xenopus laevis tadpole bilaterally injected at the two-cell
stage with a Prdm12 MO (10 ng/blastomere) is able to respond when poked with a
Development • Supplementary information
pipette tip but is unable to coordinate swimming movements.
Development 142: doi:10.1242/dev.121871: Supplementary information
Movie 3. Prdm12 mRNA-injected tadpoles are unable to respond to touch and
are paralyzed. Narrative frames from a time-lapse series showing that a Xenopus
laevis tadpole bilaterally injected at the two-cell stage with mouse Prdm12 mRNA
Development • Supplementary information
(150 ng/blastomere) is totally paralyzed.
Development 142: doi:10.1242/dev.121871: Supplementary information
Supplementary Materials and Methods
Prdm12 and other expression vectors used in frog microinjection and in ovo
electroporation experiments
The Xenopus Prdm12 expression vector was constructed by PCR from Xenopus EST
BM179581, using the primers forward 5’-GAATTCGTCAGACTCGCAGGCAGAAT-3’ and
reverse 5’-CTCGAGGGGCATGGCCTTCACAG-3’. The PCR product was cloned into the
EcoRI and XhoI sites of the pCS2-Flag vector. The pCS2-VP16-Flag-Prdm12 and PCS2EnR-Flag-Prdm12 were obtained by PCR from Xenopus EST BM179581 using primers
forward
5’-CTCGAGATGGACTACAAGGACGACGAT-3’
and
reverse
5’-
TCTAGAGGTCACAGCACCATGGTTGGAAT-3’
or
forward
5’-
CTCGAGCATGGACTACAAGGACGACGAT-3’
and
reverse
5’-
TCTAGAGTCACAGCACCATGGTTGGAAT-3’, respectively. The PCR product was
cloned between the XhoI and XbaI sites of pCS2-VP16 or of pCS2-EnR (Kessler, 1997).
Mouse Prdm12 in pCS2-Flag was obtained by PCR from pCAG-Flag-mPrdm12 (Yang and
Shinkai, 2013) using the primers forward 5’-GAATTCGCTCCCAGCTGAGGCCCTGGTG3’ and reverse 5’-CTCGAGTCACAGCACCATGGCCGGCAGGTG-3’ and cloned into the
EcoRI and XhoI sites of pCS2-FLAG. The amphioxus Prdm12 (aPrdm12) cDNA was
subcloned into the EcoRI and XhoI sites of the pCS2-Flag using primers 5’and
GAATTCGCCGACCCTGTTTGATCGTCAGCTG-3’
CTCGAGTCAATAACATGGCGACCGAACGAACGT-3’.
The
5’-
pCS2-Flag-aPR-mZF
construct was constructed by PCR from pCS2-Flag-aPrdm12 using the primers forward 5’reverse
5’-
AGGCCTGGGACACCGGGGATCCCCAG-3’ and subcloned into the EcoRI and StuI sites
of the pCS2-Flag-mPrdm12 plasmid. The pCS2-Flag-mPR-aZF construct was constructed by
PCR
from
pCS2-Flag-aPrdm12
using
AGGCCTGCCACAGCCAGAGGAGTTTGCAGCT-3’
the
primers
and
forward
reverse
5’5’-
CTCGAGTCAATAACATGGCGACCGAACGAACGT -3’ and subcloned into the StuI and
XhoI sites of the pCS2-Flag-mPrdm12 plasmid.
All constructs were verified by sequencing and the level of overexpressed protein monitored
by western blot analysis using an anti-Flag (M2, Sigma) primary antibody and a goat antimouse IgG secondary antibody conjugated with horseradish peroxidase, followed by
detection by chemiluminescence (ECL, Amersham).
Development • Supplementary information
and
GAATTCGCCGACCCTGTTTGATCGTCAGCTG-3’
Development 142: doi:10.1242/dev.121871: Supplementary information
Previously described expression constructs used for in ovo electroporations include: pMIXGPax6-IRES-GFP (Hack et al., 2004), pCIG-dnRAR (Novitch et al., 2003), pCAGG-Dbx1,
pCAGG-rNkx6.1 (Briscoe et al., 2000), pCAG-Flag-mPrdm12-IRES-Puro and the different
mouse Prdm12 mutants (Yang and Shinkai, 2013).
Previously described templates used include: Pax6 (Chow et al., 1999), Cyp26 (Hollemann et
al., 1998), and nLacZ (Chitnis et al., 1995), Dbx2 (Ma et al., 2011), Nkx6.1 (Ma et al., 2013),
Nkx6.2 (Ma et al., 2013), noggin (Smith and Harland, 1992).
In situ hybridization and immunohistochemistry
Frog embryos were fixed in 4% paraformaldehyde for 1-2 hours and whole mount in situ
hybridization experiments were performed as described (Sive et al., 2000) using digoxigeninor fluorescein-labeled antisense probes revealed with BCIP, NBT/BCIP or magenta phos.
Probes were generated as indicated: pCMV-SPORT6-Prdm12 (EST BM179581, SalI, T7),
pCMV-SPORT6-Dbx1 (EST CF287983, SalI, T7), pGEMT-Pax6 (EST BAA13680, NotI, T7),
pBSK-Evx1 (EST BJ031047, SalI, T7) or else as previously described: N-tubulin (Chitnis et
al., 1995), Dbx2 (Ma et al., 2011), En1 (Eizema et al., 1994), Evx1 (Ruiz I Altaba, 1990),
Krox20 (Nieto et al., 1991), MafB (Ishibashi and Yasuda, 2001), Nkx6.1 (Ma et al., 2013),
Nkx6.2 (Ma et al., 2013), Pax3 (Bang et al., 1997), Pax7 (NIBB, AY725267), Ptf1a and Gad1
(Dullin et al., 2007), Vsx1 (D'Autilia et al., 2006), Xiro3 (Bellefroid et al., 1998) and Pax2
(Heller and Brändli, 1997). For sections, following the completion of the whole mount
procedure, embryos were gelatine-embedded and vibratome-sectioned at 30 m thickness.
Chick embryos were fixed for 2 hours in 4% paraformaldehyde, washed in PBST, and
2002), embryos were dehydrated in 30% sucrose/PBS, frozen in gelatin (7.5% gelatin, 15%
sucrose/PBS) and sectioned at 15 m thickness. The chick Prdm12 probe was generated
starting from a pBSK+ cPrdm12 cDNA (EST BU233582; EcoRI, T3). The chick En1 in situ
plasmid was as previously described (Logan et al., 1996). For antibody analyses, embryos
were dehydrated in 30% sucrose/PBS, frozen in gelatin (7.5% gelatin, 15% sucrose/PBS) and
sectioned at 15 m. Antibodies used were: mouse anti-En1 (4G11, DSHB), mouse anti-Flag
(M2, Sigma), mouse anti-GFP (clones 7.1 and 13.1, Roche), rabbit anti-GFP (A6455,
Invitrogen), sheep anti-CHX10 (X1190P, Exalpha), mouse anti-Evx1 (99.1-3A2, DSHB),
goat anti-Foxp1 (AF4534, R&D systems), rabbit anti-Foxp2 (AB16046, Abcam), rabbit anti-
Development • Supplementary information
cryoprotected in 30% sucrose in PBS. For in situ hybridization staining (Bel-Vialar et al.,
Development 142: doi:10.1242/dev.121871: Supplementary information
Foxd3 (generous gift from Dr. Thomas Müller), rabbit anti-bHLHb5 (generous gift from Dr.
Bennett Novitch) and guinea pig anti-Dbx1 (Pierani et al., 2001) .
Zebrafish embryos were analyzed by fluorescent double in situ hybridization as
previously described (Cerda et al., 2009). The zebrafish Prdm12 probe was generated from
pGEMT-zPrdm12 (EST BC085382, NotI, T7). The following probes were as described:
dbx1a, dbx1b and dbx2 (Gribble et al., 2007; England et al., 2011), nkx6.1 (Cheesman et al.,
2004) and nkx6.2 (Hutchinson et al., 2007).
For in situ hybridization of mouse embryos, 20 µm cryostat sections of 4%
paraormaldehyde-fixed, 30% sucrose/PBS-infused tissues frozen in gelatin (7.5% gelatin,
15% sucrose/PBS) were used. In situ hybridization experiments were performed as previously
described (Wilkinson and Nieto, 1993) using digoxigenin-labeled antisense Prdm12
(Kinameri et al., 2008), En1 (Davis and Joyner, 1988) and Prdm13 (EST A930001O19)
riboprobes.
Amphioxus embryos were analyzed by in situ hybridization as previously described
(Holland et al., 1996). The B. lanceolatum Prdm12 probe was generated from pGemTeasyPrdm12 (EST KP235486; NcoI, SP6). For the B. lanceolatum Engrailed (En) probe, B.
lanceolatum En was cloned by PCR from adult cDNA using the following primers designed
on the basis of B. lanceolatum transcriptome sequences (Oulion et al., 2012): forward 5’GAGTGACATTTCGGATTCGTATGCGTCTTCGGT-3’
and
reverse
5’-
CGAGCATAGCCTGGACATGCATGACTAGC-3’. The PCR product was then cloned into
the pGemT easy vector (Promega) and the riboprobe synthesized (EST KP23548; NcoI, SP6).
Following the in situ hybridization procedure, the embryos were first photographed as whole
sectioned at 3 m thickness using an ultramicrotome (Holland et al., 1996). For both dorsal
views and sections, the final images were obtained by merging stacks of indivual photos using
the program Helicon Focus version 6.2.2 (www.heliconsoft.com).
RNA sequencing, data processing and statistical analysis
For sequencing, the RNA-samples were prepared with the "TruSeq RNA Sample Prep
Kit v2" according to the manufacturer's protocol (Illumina). Single read (50 bp) sequencing
was conducted using a HiSeq 2000 (Illumina). Two independent biological replicates were
analyzed for each condition. Sequencing quality was checked and approved using the FastQC
software (http://www.bioinformatics.babraham.ac.uk/projects/fastqc/). Sequence images were
Development • Supplementary information
mounts and subsequently counterstained in Ponceau S, embedded in Spurr’s resin and
Development 142: doi:10.1242/dev.121871: Supplementary information
transformed to BCL files with the Illumina BaseCaller software and samples were
demultiplexed to FASTQ files with CASAVA (version 1.8.2). Sequences were aligned to the
genome reference sequence of Xenopus tropicalis (Joint Genome Institute assembly v4.2).
Alignment was performed using the STAR alignment software (Dobin et al., 2013; version
2.3.0e) allowing for 5 mismatches within 50 bases. Subsequently, conversion of resulting
SAM files to sorted BAM files, filtering of unique hits and counting was conducted with
SAMtools (Li et al., 2009, version 0.1.18) and HTSeq (Anders et al., 2014, version 0.6.1p1).
Data
was
preprocessed
and
analyzed
in
the
R/Bioconductor
environment
(www.bioconductor.org) using the DEseq2 package (Anders and Huber, 2010, version
1.2.10). Specifically, the data were normalized and tested for differentially expressed genes
based on a generalized linear model likelihood ratio test assuming negative binomial data
distribution. Candidate genes were filtered to a minimum of 2-fold change and FDR-corrected
p-value < 0.05. Gene annotation was performed using Xenopus tropicalis entries from
Ensembl (www.ensembl.org) via the biomaRt package (Durinck et al., 2009, version 2.18.0).
Gene Ontology (GO) analysis was performed using DAVID (http://david.abcc.ncifcrf.gov)
(Dennis et al. 2003). RNAseq data have been deposited at NCBI GEO (GSE64551).
Chromatin immunoprecipitation (ChIP) and bioinformatics
In the mouse, ChIP-qPCR was performed starting with neural tube tissues from
embryonic day 11.5 embryos. Tissues were dissected and placed in buffer A (15 mM HEPES
[pH 7.6], 60 mM KCl, 15 mM NaCl, 0.2 mM EDTA, 0.5 mM EGTA, 0.34 M sucrose) on ice.
Nuclei were liberated by Dounce homogenization and purified by centrifugation through a
mM EGTA, 1.25 M sucrose). Nuclei were then fixed in 1% formaldehyde for 10 min at 30°C
and fixation was terminated by adding glycine to a final concentration of 0.125 M. After
centrifugation through another sucrose gradient, fixed nuclei were lysed in sonication buffer
(1% Triton, 0.1% sodium deoxycholate, 150 mM NaCl, 50 mM Tris, 5 mM EDTA).
Chromatin was sheared using a Diagenode Bioruptor for 42 min on high power with 30 sec
on-off cycles. 250 μg of neural tube chromatin was immunoprecipitated with 5 μg of affinitypurified rabbit anti-Pax6 antibody (Abcam #ab5790) and protein A/G agarose beads (Santa
Cruz). Captured bead-antibody complexes were washed twice with sonication buffer, three
times with a high-salt buffer (1% Triton, 0.1% sodium deoxycholate, 750 mM NaCl, 50 mM
Tris, 5 mM EDTA), twice with LiCl buffer (0.5% NP-40, 0.5% sodium deoxycholate, 250
mM LiCl, 10 mM Tris, 1 mM EDTA), and once with TE (10 mM Tris pH 8.0, 1 mM EDTA).
Development • Supplementary information
sucrose gradient (15 mM HEPES [pH 7.6], 60 mM KCl, 15 mM NaCl, 0.1 mM EDTA, 0.25
Development 142: doi:10.1242/dev.121871: Supplementary information
Elutions were performed with 1% SDS, 0.1 M NaHCO3, and 10 mM Tris at 65°C for 10 min.
The immunoprecipitated chromatin was purified using Qiagen’s PCR cleanup kit and resuspended in 60 μl water. ChIP enrichment was determined by qPCR. The Kirrel2 open
reading frame was used as a negative control (Borromeo et al., 2014). The following primers
were used: Kirrel2 forward 5’-AGAGGACATGGTGGTGCTGTTGG-3’ and reverse 5’TGAGCAGAGACCAGCTCACCTG-3’,
Prdm12
forward
5’-
TGCTACAGCTTTCTTCCAGGG-3’ and reverse 5’-TAAACGGTGTCCATTGCGGA-3’.
ChIP efficiency (CE) was calculated relative to the input as CE = (2Ct input − Ct ChIP) × DF ×
100%, where DF is the dilution factor between the input and the ChIP sample. qPCR assays
were carried out in triplicates. Error bars represent standard deviations.
In Xenopus, ChIP-seq was performed starting from 300 animal caps derived from
embryos injected at the 4-cell stage in each blastomere with mouse Prdm12 mRNA (150 pg)
or noggin mRNA (100 pg) plus mouse Flag-Prdm12 mRNA (150 pg) and cultured to stage 28
in the presence of RA. Two independent biological replicates were analyzed for each
condition. Samples were prepared for ChIP using methods described in Blythe et al. (2009)
with the following modifications: animal caps were fixed for 30 min in 1% formaldehyde,
chromatin was sheared on a BioRuptor (30 min; 30 sec on and 2 min off at highest power
setting) and following immunoprecipitation the high-salt wash (buffer II) was omitted.
Tagged proteins with associated chromatin were immunoprecipitated with anti-FLAG
antibody (Sigma, catalog number F1804). DNA fragments were then end-repaired (New
England Biolabs, end repair module), adenylated (New England Biolabs, Klenow fragment
3′–5′ exo- and da-tailing buffer), ligated to standard Illumina indexed adapters (TruSeq
then sequenced on a HiSeq 2500 at 1 × 50 to a depth of roughly 20 million reads. ChIPseq
data have been deposited at NCBI GEO (GSE64551). Reads were aligned to X. laevis interim
genome build v7.1 (The Xenopus Genome Project Consortium; Xenbase, PMID 25313157)
with bowtie2 (PMID 22388286). Peaks were called with HOMER (PMID 20513432) and
peak positions annotated relative to genes using the most recent transcriptome build from the
Xenopus Genome Project Consortium (PMID 24424412, 24934224). Peak sequences were
interrogated for motifs using HOMER (PMID 20513432, 23064439) and loaded on to the
Integrative Genome Browser for visualization (PMID 22517427).
ChIP-qPCR was performed starting from 100 stage 28 animal caps derived from
embryos injected at the 4-cell stage in each blastomere with noggin mRNA (100 pg), with or
without mouse Prdm12 mRNA (150 pg) and cultured in the presence of RA. Two
Development • Supplementary information
version 2), and PCR-amplified (New England Biolabs, Phusion, 16 cycles). Libraries were
Development 142: doi:10.1242/dev.121871: Supplementary information
independent biological replicates were analyzed for each condition. The animal cap explants
were fixed for 30 min in 1% formaldehyde, chromatin was sheared using a BioRuptor
(Diagenode) by performing two periods of 15 cycles; 30 sec on and 99 sec off at highest
power setting. DNA was then immunoprecipitated using protein A agarose beads (Millipore)
and anti-H3K9me2 (Abcam, ab1220), anti-H3K9me3 (Millipore, 07-442) antibodies. AntiIgG (Vector labs, I-1000) antibodies were used for for background normalization. Following
immunoprecipitation, samples were RNAse A (10mg/ml) and proteinase K (20mg/ml) treated.
The DNA was purified using the High pure PCR product purification kit (Roche) and reverse
cross-linked. Amplification obtained with each primer pair was quantified using the standard
curve method in 96-well Optical Reaction plates in an Applied Biosystems AbiPrism 7300
real-time PCR machine. Fold enrichments were calculated following the formula
“immunoprecipitated DNA *100 / Input DNA/ IgG DNA)” The following primer pairs were
used: Proximal Dbx1 (-3kb) forward 5’-TCCGTGTCGCAGTTATTGTC-3’ and reverse 5’CCACGTGTCTCCCAGTATGA-3’;
Distal
Dbx1
(-5kb)
forward
5’-
GGTCTCGGAGCAAGAGATTG-3’ and reverse 5’-GGTCTCAATGAGGCTTTGGA-3’;
Nkx6.1
(-0.5kb)
forward
5’-TACGGGACTTGATTGGAAGC-3’
GTGCGCTAAATGACTGCGTA-3’;
Nkx6.2
(-1.0kb)
and
reverse
forward
5’5’-
CCCCTCAGTGACTGTTTTCC-3’ and reverse 5’-AGGAAGGGTCTCTGCCTTGT-3’. Data
shown are the mean ± SEM of duplicate samples from one representative of two independent
Development • Supplementary information
experiments.
Development 142: doi:10.1242/dev.121871: Supplementary information
References
Anders, S., Huber, W. (2010). Differential expression analysis for sequence count
data. Genome Biol 11, R106.
Anders, S., Pyl, P.T., Huber, W. (2015). HTSeq-a Python framework to work with
high-throughput sequencing data. Bioinformatics 31,166-9.
Bang, A. G., Papalopulu, N., Kintner, C. and Goulding, M. D. (1997). Expression
of Pax-3 is initiated in the early neural plate by posteriorizing signals produced by the
organizer and by posterior non-axial mesoderm. Development 124, 2075-85.
Bel-Vialar, S., Itasaki, N. and Krumlauf, R. (2002). Initiating Hox gene expression:
in the early chick neural tube differential sensitivity to FGF and RA signaling
subdivides the HoxB genes in two distinct groups. Development 129, 5103-5115.
Bellefroid, E. J., Kobbe, A., Gruss, P., Pieler, T., Gurdon, J. B. and Papalopulu,
N. (1998). Xiro3 encodes a Xenopus homolog of the Drosophila Iroquois genes and
functions in neural specification. EMBO J 17, 191-203.
Blythe, S. A., Reid C. D., Kessler D. S., Klein P. S. (2009). Chromatin
immunoprecipitation in early Xenopus laevis embryos. Dev Dyn 238,1422-32.
Borromeo, M. D., Meredith, D. M., Castro, D. S., Chang, J. C., Tung, K. C.,
Guillemot, F. and Johnson, J. E. (2014). A transcription factor network specifying
inhibitory versus excitatory neurons in the dorsal spinal cord. Development 141,
2803-2812.
Briscoe, J., Pierani, A., Jessell, T. M. and Ericson, J. (2000). A homeodomain
protein code specifies progenitor cell identity and neuronal fate in the ventral neural
tube. Cell 101, 435-445.
Cheesman, S. E., Layden, M. J., Von Ohlen T., Doe C. Q., Eisen J. S. (2004).
Zebrafish and fly Nkx6 proteins have similar CNS expression patterns and regulate
motoneuron formation. Development. 131, 5221-32.
Chitnis, A., Henrique, D., Lewis, J., Ish-Horowicz, D. and Kintner, C. (1995).
Primary neurogenesis in Xenopus embryos regulated by a homologue of the
Drosophila neurogenic gene Delta. Nature 375, 761-766.
Chow, R. L., Altmann, C. R., Lang, R. A. and Hemmati-Brivanlou, A. (1999). Pax6
induces ectopic eyes in a vertebrate. Development 126, 4213-4222.
D'Autilia, S., Decembrini, S., Casarosa, S., He, R. Q., Barsacchi, G., Cremisi, F.
and Andreazzoli, M. (2006). Cloning and developmental expression of the Xenopus
homeobox gene Xvsx1. Dev Genes Evol 216, 829-834.
Davis, C. A. and Joyner, A. L. (1988). Expression patterns of the homeo boxcontaining genes En-1 and En-2 and the proto-oncogene int-1 diverge during mouse
development. Genes Dev 2, 1736-1744.
Development • Supplementary information
Cerda, G.A., Hargrave, M., Lewis, K.E. (2009). RNA profiling of FAC-sorted
neurons from the developing zebrafish spinal cord. Dev Dyn. 238, 150-61.
Development 142: doi:10.1242/dev.121871: Supplementary information
Dennis G. Jr., Sherman B.T., Hosack D.A., Yang J., Gao W., Lane H.C., Lempicki
R.A. (2003). DAVID: Database for Annotation, Visualization, and Integrated
Discovery. Genome Biol. 4: P3.
Dobin, A., Davis, C. A., Schlesinger, F., Drenkow, J., Zaleski, C., Jha, S., Batut,
P., Chaisson, M., Gingeras, T. R. (2013). STAR: ultrafast universal RNA-seq
aligner. Bioinformatics 29,15-21.
Dullin, J. P., Locker, M., Robach, M., Henningfled, K. A., Parain, K., Afelik, S.,
Pieler, T. and Perron, M. (2007). Ptf1a triggers GABAergic neuronal cell fates in the
retina. BMC Dev Biol 7, 110.
Durinck, S., Spellman, P. T., Birney, E., Huber, W. (2009). Mapping identifiers for
the integration of genomic datasets with the R/Bioconductor package biomaRt. Nat
Protoc. 4,1184-91.
Eizema, K., Koster, J. G., Stegeman, B. I., Baarends, W. M., Lanser, P. H. and
Destrée, O. H. (1994). Comparative analysis of Engrailed-1 and Wnt-1 expression in
the developing central nervous system of Xenopus laevis. Int J Dev Biol 38, 623-632.
England S., Batista M.F., Mich J.K., Chen J.K. and Lewis K.E. (2011). Roles of
Hedgehog pathway components and retinoic acid signalling in specifying zebrafish
ventral spinal cord neurons. Development 138, 5121-5134.
Gribble, S. L., Nikolaus, O. B. and Dorsky, R. I. (2007). Regulation and function of
Dbx genes in the zebrafish spinal cord. Dev. Dyn. 236, 3472-3483.
Hack, M. A., Sugimori, M., Lundberg, C., Nakafuku, M. and Götz, M. (2004).
Regionalization and fate specification in neurospheres: the role of Olig2 and Pax6.
Mol Cell Neurosci 25, 664-678.
Heller, N., Brändli, A.W. (1997). Xenopus Pax-2 displays multiple splice forms
during embryogenesis and pronephric kidney development. Mech. Dev. 69, 83-104.
Hollemann, T., Chen, Y., Grunz, H. and Pieler, T. (1998). Regionalized metabolic
activity establishes boundaries of retinoic acid signalling. EMBO J 17, 7361-7372.
Hutchinson, S. A., Cheesman, S. E., Hale, L. A., Boone, J. Q. and Eisen, J. S.
(2007). Nkx6 proteins specify one zebrafish primary motoneuron subtype by
regulating late islet1 expression. Development. 134, 1671-7.
Ishibashi, S. and Yasuda, K. (2001). Distinct roles of maf genes during Xenopus
lens development. Mech Dev. 101,155-66.
Kessler, D. S. (1997). Siamois is required for formation of Spemann's organizer.
Proc Natl Acad Sci U S A 94, 13017-13022.
Kinameri, E., Inoue, T., Aruga, J., Imayoshi, I., Kageyama, R., Shimogori, T. and
Moore, A. W. (2008). Prdm proto-oncogene transcription factor family expression
and interaction with the Notch-Hes pathway in mouse neurogenesis. PLoS One 3,
e3859.
Development • Supplementary information
Holland, L. Z., Holland, P. W. H. and Holland, N. D. (1996). Revealing homologies
between body parts of distantly related animals by in situ hybridization to
developmental genes: amphioxus versus vertebrates. In Molecular Zoology:
Advances, Strategies and Protocols (ed. J. D. Ferraris and S. R. Palumbi), pp. 267282; 473-483. New York, NY: Wiley-Liss.
Development 142: doi:10.1242/dev.121871: Supplementary information
Li, H., Handsaker, B., Wysoker, A., Fennell, T., Ruan, J., Homer, N., Marth, G.,
Abecasis, G., Durbin, R.; 1000 Genome Project Data Processing Subgroup.
(2009). The Sequence Alignment/Map format and SAMtools. Bioinformatics. 25,
2078-2079.
Logan C., Wizenmann A., Drescher U., Monschau B., Bonhoeffer F., Lumsden
A. (1996). Rostral optic tectum acquires caudal characteristics following ectopic
engrailed expression. Curr Biol. 6, 1006-14.
Ma, P., Xia, Y., Ma, L., Zhao, S. and Mao, B. (2013). Xenopus Nkx6.1 and Nkx6.2
are required for mid-hindbrain boundary development. Dev Genes Evol 223, 253259.
Ma, P., Zhao, S., Zeng, W., Yang, Q., Li, C., Lv, X., Zhou, Q. and Mao, B. (2011).
Xenopus Dbx2 is involved in primary neurogenesis and early neural plate patterning.
Biochem Biophys Res Commun 412, 170-174.
Nieto, M. A., Bradley, L. C. and Wilkinson D. G. (1991). Conserved segmental
expression of Krox-20 in the vertebrate hindbrain and its relationship to lineage
restriction. Development 113, 59-62.
Novitch, B. G., Wichterle, H., Jessell, T. M. and Sockanathan, S. (2003). A
requirement for retinoic acid-mediated transcriptional activation in ventral neural
patterning and motor neuron specification. Neuron 40, 81-95.
Oulion, S., Bertrand, S., Belgacem, M. R., Le Petillon, Y. and Escriva, H. (2012)
Sequencing and analysis of the Mediterranean amphioxus (Branchiostoma
lanceolatum) transcriptome. PLoS One 7, e36554.
Pierani, A., Moran-Rivard, L., Sunshine, M. J., Littman, D. R., Goulding, M. and
Jessell, T. M. (2001). Control of interneuron fate in the developing spinal cord by the
progenitor homeodomain protein Dbx1. Neuron 29, 367-384.
Ruiz i Altaba A. (1990). Neural expression of the Xenopus homeobox gene Xhox3:
evidence for a patterning neural signal that spreads through the ectoderm.
Development 108, 595-604.
Smith, W. C. and Harland, R. M. (1992). Expression cloning of noggin, a new
dorsalizing factor localized to the Spemann organizer in Xenopus embryos. Cell 70,
829-840.
Wilkinson, D. G. and Nieto, M. A. (1993). Detection of messenger RNA by in situ
hybridization to tissue sections and whole mounts. Methods Enzymol 225, 361-373.
Yang, C. M. and Shinkai, Y. (2013). Prdm12 is induced by retinoic acid and exhibits
anti-proliferative properties through the cell cycle modulation of P19 embryonic
carcinoma cells. Cell Struct Funct 38, 195-204.
Development • Supplementary information
Sive, H. L., Grainger, R. M. and Harland, R. M. (2000). Early development of
Xenopus laevis : a laboratory manual. Cold Spring Harbor: CSHL Press.