Physiol Rev 85: 423– 493, 2005;
doi:10.1152/physrev.00011.2004.
Molecular Physiology and Pathophysiology
of Electroneutral Cation-Chloride Cotransporters
GERARDO GAMBA
Molecular Physiology Unit, Instituto Nacional de Ciencias Médicas y Nutrición Salvador Zubirán and
Instituto de Investigaciones Biomédicas, Universidad Nacional Autónoma de México, Mexico City, Mexico
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
I. Introduction
II. Molecular Biology
A. Na⫹-coupled chloride cotransporters
B. K⫹-coupled chloride cotransporters
C. Orphan members
D. Genes and promoter characteristics
E. Phylogenetic and sequence comparison
III. Functional Properties
A. Thiazide-sensitive Na⫹-Cl⫺ cotransporter
B. Apical bumetanide-sensitive Na⫹-K⫹-2Cl⫺ cotransporter
C. Basolateral bumetanide-sensitive Na⫹-K⫹-2Cl⫺ cotransporter
D. K⫹-Cl⫺ cotransporter 1
E. K⫹-Cl⫺ cotransporter 2
F. K⫹-Cl⫺ cotransporter 3
G. K⫹-Cl⫺ cotransporter 4
H. Orphan members
IV. Structure-Function Relationships
A. Na⫹-coupled chloride cotransporters
B. K⫹-coupled chloride cotransporters
V. Physiological Roles
A. Thiazide-sensitive Na⫹-Cl⫺ cotransporter
B. Apical bumetanide-sensitive Na⫹-K⫹-2Cl⫺ cotransporter
C. Basolateral bumetanide-sensitive Na⫹-K⫹-2Cl⫺ cotransporter
D. K⫹-Cl⫺ cotransporter 1
E. K⫹-Cl⫺ cotransporter 2
F. K⫹-Cl⫺ cotransporter 3
G. K⫹-Cl⫺ cotransporter 4
VI. Pathophysiological Roles
A. Gitelman’s disease
B. Bartter’s disease
C. Anderman’s disease
D. Gordon’s disease
E. Potential role in polygenic diseases
VII. Conclusions and Perspective
424
424
425
430
432
433
435
437
437
439
442
442
444
446
447
448
448
448
457
458
459
461
463
466
466
468
469
470
470
473
476
476
478
481
Gamba, Gerardo. Molecular Physiology and Pathophysiology of Electroneutral Cation-Chloride Cotransporters.
Physiol Rev 85: 423– 493, 2005; doi:10.1152/physrev.00011.2004.—Electroneutral cation-Cl⫺ cotransporters compose
a family of solute carriers in which cation (Na⫹ or K⫹) movement through the plasma membrane is always
accompanied by Cl⫺ in a 1:1 stoichiometry. Seven well-characterized members include one gene encoding the
thiazide-sensitive Na⫹-Cl⫺ cotransporter, two genes encoding loop diuretic-sensitive Na⫹-K⫹-2Cl⫺ cotransporters,
and four genes encoding K⫹-Cl⫺ cotransporters. These membrane proteins are involved in several physiological
activities including transepithelial ion absorption and secretion, cell volume regulation, and setting intracellular Cl⫺
concentration below or above its electrochemical potential equilibrium. In addition, members of this family play an
important role in cardiovascular and neuronal pharmacology and pathophysiology. Some of these cotransporters
serve as targets for loop diuretics and thiazide-type diuretics, which are among the most commonly prescribed drugs
in the world, and inactivating mutations of three members of the family cause inherited diseases such as Bartter’s,
www.prv.org
0031-9333/05 $18.00 Copyright © 2005 the American Physiological Society
423
424
GERARDO GAMBA
Gitelman’s, and Anderman’s diseases. Major advances have been made in the past decade as consequences of
molecular identification of all members in this family. This work is a comprehensive review of the knowledge that
has evolved in this area and includes molecular biology of each gene, functional properties of identified cotransporters, structure-function relationships, and physiological and pathophysiological roles of each cotransporter.
I. INTRODUCTION
Physiol Rev • VOL
II. MOLECULAR BIOLOGY
After the discovery of electrically silent cotransport
mechanisms in mammalian cells and tissues 25 years ago
(138, 340), several laboratories undertook unrewarded
attempts to identify the proteins responsible for such a
transport system (94, 107, 121, 197, 251, 406). However,
the major breakthrough in this field came in the early
1990s from two different laboratories that were able to
identify the genes responsible for Na⫹-Cl⫺ (136, 137) and
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
In absorptive and secretory epithelia, transcellular
ion transport depends on specific plasma membrane proteins for mediating ion entry into and exit from cells. In
basolateral membrane of almost all epithelia (with exception of choroidal plexus), sodium exit and potassium
entrance occur through Na⫹-K⫹-ATPase, generating electrochemical gradients that constitute a driving force for
Na⫹ influx and K⫹ efflux. Transport of these ions following their gradients can be accomplished by specific ion
channels, allowing membrane passage of ions alone or by
transporters in which Na⫹ or K⫹ transport is accompanied by other ions or solutes by means of several different
solute transporters. These membrane proteins are known
as secondary transporters because ion or molecule translocation is not dependent on ATP hydrolysis but rather on
gradients generated by primary transporters. A secondary
transport mechanism that is very active in trancellular ion
transport in epithelial cells is one in which cations (Na⫹
or K⫹) are coupled with chloride, with a stoichiometry of
1:1; therefore, ion translocation produces no change in
transmembrane potential. For this reason, these transporters are known as electroneutral cation-Cl⫺ coupled
cotransporters. In addition to being heavily implicated in
ion absorptive and secretory mechanisms, electroneutral
cation-Cl⫺ coupled cotransporters play a key role in maintenance and regulation of cell volume in both epithelial
and nonepithelial cells. Because Na⫹ influx and K⫹ efflux
by electroneutral cotransporters are rapidly corrected by
Na⫹-K⫹-ATPase, the net effect of its activity is Cl⫺ movement inside or outside cells. This is known to be accompanied by changes in cell volume. Finally, a variety of new
physiological roles for electroneutral cotransporters are
emerging. One example is regulation of intraneuronal Cl⫺
concentration, thus modulation of neurotransmission
(77).
Four groups of electroneutral cotransporter systems
have been functionally identified based on cation(s) coupled with chloride, stoichiometry of transport process,
and sensitivity to inhibitors. These systems include 1) the
benzothiadiazine (or thiazide)-sensitive Na⫹-Cl⫺ cotransporter, 2 and 3) the sulfamoylbenzoic (or bumetanide)sensitive Na⫹-K⫹-2Cl⫺ and Na⫹-Cl⫺ cotransporters, and
4) the dihydroindenyloxy-alkanoic acid (DIOA)-sensitive
K⫹-Cl⫺ cotransporter. There is some overlap in sensitivity
to inhibitors in the last two groups because Na⫹-K⫹-2Cl⫺
and K⫹-Cl⫺ cotransporters can be inhibited by high concentration of DIOA or loop diuretics, respectively; how-
ever, affinity for inhibitor and the cation coupled with
chloride clearly differentiate between both groups of
transporters. Physiological evidence for these transport
mechanisms became available at the beginning of the
1980s (341) (95, 138, 237), and a remarkable amount of
information was generated in the following years by characterizing these transport systems in many different cells
and experimental conditions.
Major advances have been made in the past decade in
molecular identification and characterization of solute
carriers. To date, Human Genome Organization (HUGO)
Nomenclature Committee Database recognizes 43 solute
carries (SLC) families, which include a total of 298 transporter genes encoding for uniporters (passive transporters), cotransporters (coupled transporters), antiporters
(exchangers), vesicular transporters, and mitochondrial
transporters (175). This amount of solute carrier genes
represents ⬃1% of the total pool of genes that have been
calculated to compose human genome. One of the families that was identified at the molecular level during the
last decade contains all genes encoding for electroneutral
cation-Cl⫺ coupled cotransporters and is known as the
SLC12 family (173). With molecular identification of the
first members, several tools became available to isolate
remaining members and to study these proteins from
molecular organization of their genes, to their role in
monogenic and polygenic disease. To date, seven clearly
characterized genes and two orphan members compose
this family. It is the major goal of this review to present
comprehensive information of knowledge generated in
SLC12 family as a consequence of cloning cDNAs encoding its different members. Information is divided into five
major subjects that include 1) molecular biology of each
gene, 2) functional properties of the recombinant proteins, 3) insights into structure-function analysis, 4) physiological role of each cotransporter, and 5) involvement
of electroneutral cotransporters in pathophysiology of
monogenic and polygenic disease.
ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS
Na⫹-K⫹-2Cl⫺ cotransporters (136, 311, 440). As eloquently predicted by Homer Smith in his remarkably elegant book about fish and philosophy (378), cDNA encoding these proteins were identified first from fish sources,
because tissue from these animals proved to be an ideal
source of proteins and mRNA, due to the robust expression of these transport systems. Thereafter, homologybased approaches were used to identify corresponding
orthologs from mammalian tissues.
A. Naⴙ-Coupled Chloride Cotransporters
1. The thiazide-sensitive Na⫹-Cl⫺ cotransporter
Physiol Rev • VOL
Xenopus laevis oocytes. The cloning strategy was based
on the ability of mRNA isolated from winter flounder
urinary bladder to give rise to thiazide-(metolazone)-sensitive Cl⫺-dependent 22Na⫹ uptake when injected into X.
laevis oocytes. Consistent with previous observations, it
was shown that furosemide, acetazolamide, ouabain,
amiloride, and DIDS had no effect on cotransporter activity. The 3.7-kb cDNA clone was named flTSC for flounder
thiazide-sensitive cotransporter. As shown in Table 1,
nucleotide sequence predicted an open reading frame
(ORF) of 3,069 bp encoding a protein of 1,023 amino acid
residues with a core molecular mass of 112 kDa. Hydropathy analysis following the algorithm proposed by Kyte
and Doolittle (226) revealed the basic structure of the
Na⫹-coupled chloride cotransporters shown in Figure 1,
featuring a central hydrophobic domain containing 12
␣-helices compatible with putative transmembrane-spanning segments that is flanked by a short hydrophilic
amino-terminal domain and a long predominantly hydrophilic carboxy-terminal domain. The latter two domains
are presumably located within the cell. There is a long
hydrophilic loop connecting transmembrane segments 7
and 8, exhibiting three putative N-glycosylation sites that
are located toward the putative extracellular side of the
protein. Tissue distribution analysis by Northern blot in
winter flounder revealed expression of a 3.7-kb transcript
in urinary bladder and a shorter 3.0-kb message in several
tissues including gonads, intestine, eye, brain, skeletal
muscle, and heart (137). It was also observed that this
shorter transcript of 3.0 kb is the result of an alternative
splicing mechanism, in which the first 229 residues encoding the amino-terminal domain and the first three
putative transmembrane segments are lost. The functional consequence of such splicing has not been resolved
(276).
Primary sequences of the thiazide-sensitive cotransporter were thereafter reported from four mammalian
species, including Rattus norvegicus (rat), Mus musculus
(mouse), Oryctolagus cuniculus (rabbit), and Homo sapiens (human). Tissue distribution analysis by Northern
blot revealed the presence of transcripts only in total RNA
extracted from kidney. As shown in Table 1, two alternative transcripts were identified from rat kidney (136).
Both transcripts were apparent in Northern blot analysis
using RNA extracted from rat renal cortex and exhibited
the same ORF of 3,006 bp encoding a protein of 1,002
amino acid residues with a molecular mass of 110 kDa,
that is 61% identical to the flounder cotransporter. The
two transcripts differ in length of the 3⬘-untranslated region (UTR) as a result of alternative splicing. TSC cDNA
from mouse and rabbit were isolated using a polymerase
chain reaction (PCR) strategy designed to amplify only
the ORF; thus no information with regard to length and
characteristics of the 5⬘-UTR and 3⬘-UTR are available. In
mouse, the ORF of 3,006 bp predicts a 1,002-amino acid
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
The first electroneutral cotransporter protein identified at the molecular level was the thiazide-sensitive Na⫹Cl⫺ cotransporter from Pseudopleuronectes americanus
(winter flounder) urinary bladder (137). Original evidence
that suggested the existence of a Na⫹-Cl⫺ cotransporter
was obtained by Renfro (340), who observed that sodium
and chloride were actively transported by the flounder’s
urinary bladder in which Renfro thought there was an
electrically silent mechanism. Subsequently, he was able
to demonstrate in isolated perfused urinary bladder a
clear interdependence of active Na⫹ and Cl⫺ transport
that was independent of transepithelial voltage (341). A
few years later, pharmacological properties of this Na⫹Cl⫺ cotransport system were defined by Stokes et al. in
two studies (389, 388) in which the investigators observed
in bladder preparations that mucosal-to-serosal Na⫹ and
Cl⫺ transport were completely inhibited in a dose-dependent fashion by thiazide-type diuretics hydrochlorothiazide and metolazone. These drugs had no effect when
applied to the serosal side of the bladder. It was also
shown that the Na⫹-Cl⫺ cotransporter was not inhibited
by barium, acetazolamide, furosemide, amiloride, DIDS,
ouabain, and diphenolamine carboxylate (DPC). In fact,
in the absence of a mammalian tissue to test the potency
of thiazides, winter flounder urinary bladder was suggested as a model to assess effectiveness of this class of
diuretics (244). In addition to these observations, another
similarity observed between mammalian distal convoluted tubule (DCT) and winter flounder urinary bladder
was that in both epithelia, inhibition of Na⫹-Cl⫺ cotransporter with thiazides resulted in increased calcium absorption (63, 452). In the marine teleost, urinary bladder is
functionally and anatomically an extension of mesonephric kidney, that is, the embryologically derived form of
mesoderm, representing a kind of distal tubule located
outside the kidney (227). All this information was taken
by Hebert and co-workers (137) to identify a clone from a
winter flounder urinary bladder size-fractionated,
poly(A)⫹-RNA directional cDNA library constructed into
pSPORT1, which encodes a thiazide-sensitive Na⫹-Cl⫺
cotransporter using a functional expression strategy in
425
426
TABLE
GERARDO GAMBA
1.
Source
Identified members of the Na⫹-coupled Cl⫺ cotransporter branch (SLC12A1-3)
Name
Clone
Size, kb
5⬘-UTR,
kb
3⬘-UTR,
kb
ORF,
kb
Number of
Residues
Molecular
Mass, kDa
Accession No./
Reference Nos.
112
85
110
110
110
112
112
112
114
L11615/(137)
AF333796/(347)
U10097/(136)
The thiazide-sensitive Na⫹-Cl⫺ cotransporter (SLC12A3)
Flounder
Rat
Mouse
Rabbit
Human
flTSC
flTSC-ov
rTSCa
rTSCb
mNCC
hTSC
hTSC
hTSC
3,686
3,093
4,394
3,315
3,006
3,087
107
201
8
8
0
510
510
1,380
231
0
3
4,211
3,131
26
1,122
3,069
2,382
3,006
3,006
2,006
3,084
3,063
3,063
3,090
1,023
794
1,002
1,002
1,002
1,028
1,021
1,021
1,030
U61085/(221)
AF028241/(413)
NM000339/(377)
X91220/(265)
NM_000339/**
The apical bumetanide-sensitive Na⫹-K⫹-2Cl⫺ cotransporter (SLC12A1)
Rat
Mouse
Rabbit
Human
NKCC2A
NKCC2F
rBSC1
mNKCC2A
mNKCC2B
mNKCC2F
mBSC1-L
mBSC1-S
NKCC2A
NKCC2B
NKCC2F
hNKCC2
4,376
4,376
4,546
193
193
215
899
899
1,045
3,285
3,285
3,285
1,095
1,095
1,095
120
120
120
4,655
230
1,140
3,285
1,095
120
4,605
2,968
180
220
1,130
445
3,285
2,310
1,095
770
120
85
4,750
279
1,171
3,300
1,099
121
3,362
19
46
3,297
1,099
121
AF521915/(134)
AF521917/(134)
U10096/(136)
U20973/(187)
U20974/(187)
U20975/(187)
U94518/(290)
U61381/(290)
U07547/(311)
U07548/(311)
U07549/(311)
U58130/(375)
129
126
125
130
130
130
132
U05958/(440)
AJ486858/(69)
AJ486859/(69)
AF051561/(284)
NM_009194/(80)
U70138/(448)
U30246(313)
The basolateral bumetanide-sensitive Na⫹-K⫹-2Cl⫺ cotransporter (SLC12A2)
Shark
Eel
Rat
Mouse
Bovine
Human
NKCC1
NKCC1a
NKCC1b
rtNKCC1
mBSC2
bNKCC1
hNKCC1
5,260
4,063
3,429
6,402
4,707
4,106
3,498
438
549
1,249
40
127
129
490
164
2,666
963
13
298
cotransporter that is 97 and 61% identical to predicted
TSC sequences in rat and flounder, respectively (221). In
contrast, rabbit TSC cDNA exhibits an ORF of 3,084 bp
3,573
3,474
3,429
3,609
3,615
3,603
3,036
1,191
1,158
1,143
1,203
1,205
1,201
1,212
predicting a protein of 1,028 amino acid residues with a
molecular mass of 112 kDa. Degree of identity with flounder TSC is 61%, whereas with rat, mouse, or human TSC
FIG. 1. Proposed topologies for members of the electroneutral cation-chloride
cotransporter family. SLC12A1–3 in black
is the topology proposed for Na⫹-coupled
chloride cotransporters BSC1/NKCC2,
BSC2/NKCC1, and TSC. SLC12A4 –7 in blue
depict the topology proposed for K⫹-coupled chloride cotransporters KCC1, KCC2,
KCC3, and KCC4. SLC12A8/CCC9 in red
corresponds to topology for the orphan
member CCC9. This is the most distant
member, because there are only 11 predicted transmembrane segments and the
carboxy-terminal domain is predicted to be
located outside the cell. SLC12A9/CIP in
green is the topology proposed for an orphan member known as CIP or cotransporter interacting protein and resembles
the topology for KCCs cotransporters.
Physiol Rev • VOL
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
Shark
ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS
2. The apical bumetanide-sensitive
Na⫹-K⫹-2Cl⫺ cotransporter
Two genes encoding bumetanide-sensitive Na⫹-K⫹2Cl cotransporters were identified as part of the SLC12
family. These genes are known as SLC12A1 and SLC12A2
⫺
and encode for the apical and basolateral isoforms, respectively. The SLC12A1 gene is a renal-specific Na⫹-K⫹2Cl⫺ cotransporter isoform exclusively expressed in the
apical membrane of thick ascending limb of Henle
(TALH). The cDNA encoding this cotransporter was simultaneously identified from mammalian kidney in 1994
by two groups. Payne and Forbush (311) screened rabbit
cortical and medullary cDNA libraries inserted in ␭ZAP
using a 32P-DNA random-primed probe constructed from
cDNA encoding the T84 human colonic basolateral Na⫹K⫹-2Cl⫺ cotransporter. As shown in Table 1, a full-length
clone of 4,750 bp was identified, with an ORF of 3,297 bp
encoding a protein of 1,099 amino acid residues. Tissue
distribution analysis by Northern blot revealed the presence of transcripts only in total RNA extracted from
kidney. No functional expression was presented, but
based on high homology with basolateral Na⫹-K⫹-2Cl⫺
cotransporter, it was proposed that the isolated clone
encoded the apical isoform of this cotransporter. Because
in 1994 this group first cloned the basolateral isoform (see
later) that was named NKCC1, their clone encoding the
apical, renal-specific isoform of the Na⫹-K⫹-2Cl⫺ cotransporter was denominated NKCC2. Simultaneously, Gamba
et al. (136) isolated a 4,546-bp clone from a size-fractionated cDNA library constructed from poly(A)⫹ RNA extracted from inner stripe of outer medulla of rat kidney.
The library was screened using a random-primed 32P-DNA
probe derived from the coding region of flTSC transporter. The 3,285-bp ORF encodes a 1,095-residue protein
exhibiting 93% identity with rabbit NKCC2. Tissue distribution by Northern blot analysis also showed that transcripts were present only in total RNA from kidney; all
other tissues were negative. Functional expression analysis in X. laevis oocytes demonstrated that the isolated
clone induced a significant increase in 86Rb⫹ uptake that
was Cl⫺ dependent, Na⫹ dependent, and bumetanide sensitive, indicating that it encodes for a Na⫹-K⫹-2Cl⫺ cotransporter. Because this investigative group previously
denominated the thiazide-sensitive Na⫹-Cl⫺ cotransporter cDNA clone from flounder urinary bladder as flTSC
(137), the identified cDNA clone from renal outer medulla
was denominated rBSC1 for rat bumetanide-sensitive
FIG. 2. Sequence alignment of the carboxy-terminal domain fragment in TSC from several species, from residues 789 – 826 of human TSC.
Human 1 and human 2 correspond to sequences deposited in Genebank by Simon et al. (Genebank accession no. NM_000339) and Mastroianni et
al. (Genebank accession no. X91220), respectively. The box in human 1 sequence highlights a putative protein kinase A phosphorylation site.
Physiol Rev • VOL
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
it is 90% (413). Human TSC was simultaneously identified
by two groups. Simon et al. (377) identified a TSC primary
sequence with 1,021 residues as part of their cloning
effort to identify the complete gene during their study
of Gitelman’s disease. Supporting this observation,
Mastroianni et al. (265) screened a human kidney cDNA
library and isolated a 4,211-bp cDNA clone that encodes
an identical TSC with 1,021 residues containing 5⬘-and
3⬘-UTRs of 26 and 1,122 bp, respectively. Identity degree
of human TSC with other mammalian TSC is ⬃90%, while
with flounder it is ⬃60%.
Rabbit and human TSC are longer than rat and mouse
orthologs due to presence of 17–26 amino acid residues in
the carboxy-terminal domain that are not present in rat
and mouse TSC (Fig. 2). These extra residues were shown
to be encoded by a separate exon (exon 20) in humans
that is not present in mouse or rat. However, two distinct
Homo sapien TSC mRNA sequences have been deposited
into the genome database (www.ncbi.nlm.nih.gov). The
sequence from Mastroianni et al. (265) (X91220) exhibits
1,021 residues, including 17 extra amino acids not present
in rat or mouse TSC sequence. In contrast, one sequence
deposited by Simon et al. (377) (NM_000339) exhibits
1,030 residues with 26 extra residues not present in rat or
mouse (Table 1). As shown in Figure 2, rabbit TSC sequence is similar to the sequence reported by Simon et al.,
because the 26 extra residues from exon 20 are present in
this rodent. BLAST search of genomic databases with 78
bp encompassing the DNA sequence encoding the 26amino acid fragment revealed that this sequence aligns
perfectly with a fragment of the RP11–325K4 clone containing full sequence of human chromosome 16, suggesting that exon 20 indeed encodes 26 residues, instead of 17.
It is noteworthy that in humans there is a putative protein
kinase A (PKA) site (RPS) within the extra fragment that
is not present in rabbit, mouse, or rat TSC.
427
428
GERARDO GAMBA
tion of two alternatively splicing mechanisms (Fig. 3)
(135, 290). The first was described by Payne and Forbush
during cloning of rabbit Na⫹-K⫹-2Cl⫺ cotransporter (311)
and was also observed to be present in mouse (187), rat
(447), and human (375) kidney. This splicing mechanism
is due to presence of three mutually exclusive cassette
exons of 96 bp designated A, B, and F, which encode for
32 amino acid residues corresponding to the second half
of the putative transmembrane domain TM2 and the contiguous intracellular loop between TM2 and TM3 (Fig. 3).
This splicing mechanism produces three BSC1/NKCC2
proteins that are identical, with the exception of the 32
amino acids encoded by A, B, or F cassettes. Existence of
an isoform containing exons A and F together was suggested by Yang et al. (447) following amplification of a
DNA band for such an isoform by PCR; nonetheless, its
real existence as a protein was not addressed. BSC1/
NKCC2 orthologs for isoforms A and F were also identified at the molecular level by Gagnon et al. (134) from
Squalus acanthias (shark) kidney. Interestingly, no isoform B is expressed in shark kidney, which lacks a welldeveloped juxtaglomerular complex. Because there are
data to support that B isoform could be the Na⫹-K⫹-2Cl⫺
sensing isoform in macula densa cells (see sect. VB), this
observation suggests that B exon arose later in the evolutionary chain, when complete tubuloglomerular feedback mechanisms were developed. Interestingly, the AF
isoform was also observed by Gagnon et al. (134) in shark
kidney, together with other spliced variants lacking transmembrane segment 8; however, all these variants were
not functional when expressed in HEK-293 cells or in X.
laevis oocytes.
Second splicing of SLC12A1 gene has been observed
only in mouse kidney, is produced by utilization of a
polyadenylation site in the intron between coding exons
16 and 17, and predicts a protein with a significantly
⫹
⫹
⫺
FIG. 3. Splice variants of the mouse apical, renal specific Na -K -2Cl cotransporter BSC1/NKCC2. The central hydrophobic domain containing
12 putative transmembrane segments is flanked by predominantly hydrophilic amino- and carboxy-terminal domains. Two glycosylation sites are
depicted in the extracellular loop between membrane segments 7 and 8. The region of transmembrane domain 2 and the interconnecting segment
between transmembrane domains 2 and 3 that are highlighted in green depict the mutually exclusive cassette exons A, B, or F. The long isoform
BSC1-L contains 329 amino acid residues in the carboxy-terminal domain (highlighted in red) that are not present in the shorter isoform BSC1-S,
which contains 55 unique residues at the end of the carboxy-terminal domain (highlighted in blue). Arrows show putative protein kinase A
phosphorylation sites unique to each isoform.
Physiol Rev • VOL
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
Na⫹-K⫹-2Cl⫺ cotransporter 1; thus the apical Na⫹-K⫹2Cl⫺ cotransporter encoded by SLC12A1 gene is indistinctly known as BSC1 or NKCC2. Hereafter I will refer to
this cotransporter as BSC1/NKCC2. After initial cloning of
BSC1/NKCC2 from rat and rabbit kidney, the same cotransporter was identified at the molecular level from
mouse and human kidney (Table 1). Igarashi et al. (187)
identified a 4,655-bp clone from a mouse renal outer
medulla library containing a 3,285 ORF that encodes a
1,095-amino acid transporter that is 93 and 97% identical
to rabbit and rat BSC1/NKCC2, respectively. By Northern
blot and in situ hybridization analysis, they showed that in
mouse, BSC1/NKCC2 is also expressed exclusively in kidney, including developing kidney from the hybridization
signal in mouse embryo detected only in metanephros.
Finally, Simon et al. (375) reported the primary structure
of human BSC1/NKCC2 as part of their study of SLC12A1
gene involvement in Bartter’s disease. Human BSC1/
NKCC2 is 95% identical to rabbit and 93% to rat or mouse
BSC1/NKCC2. As shown in Figure 1, the proposed topology of BSC1/NKCC2 is very similar to that of TSC or
BSC2/NKCC1. A central hydrophobic domain of ⬃475
residues containing 12 putative membrane-spanning segments is flanked by two predominantly hydrophilic domains: a short amino-terminal domain of ⬃165 amino
acids and a long carboxy-terminal domain of ⬃450 residues. Both domains are presumably located within the
cell and contain several putative PKA and protein kinase
C (PKC) phosphorylation sites. Central hydrophobic domain exhibits a long hydrophilic loop located between
transmembrane segments 7 and 8 that contains two putative N-glycosylation sites.
Molecular diversity in electroneutral cotransporter
family is increased due to existence of alternative splicing
isoforms or variants. At least six isoforms of BSC1/
NKCC2 are expressed in mouse kidney due to combina-
ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS
3. The basolateral bumetanide-sensitive
Na⫹-K⫹-2Cl⫺ cotransporter
SLC12A2 gene encodes the Na⫹-K⫹-2Cl⫺ cotransporter that is ubiquitously expressed. This cotransporter
is present in both epithelial and nonepithelial cells. In
epithelial cells, its expression is confined to basolateral
membrane, some examples of which are gills, trachea,
intestine, and renal collecting duct. The sole exception is
choroid plexus, in which this cotransporter is expressed
in apical membrane (326). In 1994, the same two independent research teams who cloned BSC1/NKCC2 also identified cDNA encoding the basolateral cotransporter. Xu et
al. (440) using monoclonal antibodies J3 and J7 that recognize epitopes in the carboxy-terminal half of the cotransporter (256) were able to isolate from a shark rectal
gland cDNA library a single 5,260-bp cDNA clone that
encoded a protein of 1,191 amino acid residues. When this
clone was transfected into HEK-293 cells, a robust bumetanide-sensitive Na⫹-K⫹-2Cl⫺ cotransporter mechanism
was induced, exhibiting functional properties similar to
those previously shown as present in shark rectal gland
(127). As shown in Table 1, full-length cDNA clone was
denominated NKCC1. Tissue distribution analysis by
Northern blot revealed presence of NKCC1 transcripts in
all tissues. Also in 1994, this team was also able to identify
the mammalian ortholog from a human colonic (T84 epithelial cell line) cDNA library using a probe constructed
from shark NKCC1 cDNA. ORF of 3,036 bp predicted that
human NKCC1 is a 1,212-amino acid residue cotransPhysiol Rev • VOL
porter with molecular mass of 132 kDa, which by Northern blot analysis was also shown to be expressed in most
tissues. Simultaneously, a cDNA encoding the basolateral
Na⫹-K⫹-2Cl⫺ cotransporter was identified from a mouse
inner medullary collecting duct cell line (mIMCD-3) cDNA
library by Delpire et al. (80), using degenerative primers
that were designed over highly homologous regions of
putative transmembrane domains 1 and 10 of TSC and
BSC1 (136, 137). Because these authors previously denominated thiazide-sensitive Na⫹-Cl⫺ cotransporter as
TSC (137) and apical renal-specific bumetanide-sensitive
Na⫹-K⫹-2Cl⫺ cotransporter BSC1 (136), basolateral isoform was denominated BSC2. Hereafter I will refer to this
cotransporter as BSC2/NKCC1.
As shown in Figure 1, the proposed topology of
BSC2/NKCC1 is similar to that of TSC or BSC1/NKCC2.
The central hydrophobic domain exhibits a long hydrophilic loop located between transmembrane segments 7
and 8 that contains two putative N-glycosylation sites,
both of which are conserved in BSC1/NKCC2, but only
one of which is present in TSC. BSC2/NKCC1 is the only
member of the family to date for which proposed topology is supported by experimental data. Gerelsaikhan and
Turner (140) studied transmembrane topology of NKCC1
using an in vitro translation system designed to test membrane-insertion properties of putative membrane-spanning helices, by fusing each with a carboxy terminal reported sequence containing multiple N-linked glycosylation sites. With this strategy, they observed that NKCC1 is
indeed composed of 12 membrane-spanning segments.
The first eight segments exhibit the classical ⬃20 residue
length helices, while segments 9 and 10, as well as segments 11 and 12 together are ⬃36 residues in length,
suggesting that these transmembrane segments form a
hairpin-like structure in the membrane or take up either a
nonhelical or a partial helical structure. Presence of asparagine and proline residues in the middle between segments 9 and 10, and segments 11 and 12 are in accord with
the possibility that hairpin helices are present (282).
As shown in Table 1, basolateral Na⫹-K⫹-2Cl⫺ cotransporter BSC2/NKCC1 has been identified at the molecular level from other three species including rat (284),
Bos taurus (bovine) (448), and Anguilla anguilla (eel)
(69). The case of eel is interesting because Cutler and
Cramb (69) identified two different genes encoding highly
homologous NKCC1 isoforms that were denominated
NKCC1a and NKCC1b. Degree of identity at amino acid
level between both cotransporters is ⬃80%. The majority
of the divergence is located in the first 80 –90 residues of
the amino-terminal domain in which degree of identity is
not ⬎35%; however, the remainder of the sequence exhibits an identity of 85%. NKCC1a of ⬃13 kb was present in
all tissues, whereas NKCC1b of 6 kb was observed only in
brain RNA. The authors proposed that existence of two
NKCC1 genes in eel fits with the paradigm that a certain
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
shorter carboxy-terminal domain (290). This splicing produces two BSC1/NKCC2 proteins that are identical at the
amino-terminal and transmembrane domains but differ in
length and sequence from the carboxy-terminal domain.
The longer isoform exhibits a carboxy terminus of 457
amino acid residues, of which the last 383 are not present
in the shorter isoform. In contrast, the shorter truncated
isoform contains a carboxy terminus of 129 residues, of
which the last 55 are not present in the longer isoform.
Interestingly, long and short carboxy-terminal domains
contain different putative PKA and PKC phosphorylation
sites and are currently known as BSC1-L (for long) and
BSC1-S (for short) (269). Mount et al. (290) using a PCR
strategy demonstrated that both splicing events are independent from each other in such a way that a total of six
isoforms are produced in mouse kidney: three BSC1-L
isoforms (A, B, and F) and three BSC1-S isoforms (A, B,
and F). Rabbit polyclonal antibody raised against the 55
unique piece of BSC1-S was useful to demonstrate by
Western blot and immunohistochemical analysis that
BSC1-S protein of the expected size is present in mouse
kidney, exclusively expressed in apical membrane of
TALH (290). The functional significance of spliced isoforms is discussed in section IIIB.
429
430
GERARDO GAMBA
B. Kⴙ-Coupled Chloride Cotransporters
The K⫹-Cl⫺ cotransport mechanism was first described in low-potassium sheep red blood cells as a swelling- and N-ethylmaleimide (NEM)-activated K⫹ efflux
pathway (95, 237). Cotransport of K⫹ and Cl⫺ is interdependent, with a 1:1 stoichiometry and low-affinity constants for both ions (for excellent reviews, see Refs. 62,
235). Although red blood cells have remained as the primary model tissue for this class of ion transport, functional and physiological evidence for existence of a similar K⫹-Cl⫺ cotransporter was soon reported in several
cells and tissues including neurons (346), vascular
smooth muscle (4), endothelium (317), epithelia (12, 155),
heart (445), and skeletal muscle (430), suggesting that
K⫹-Cl⫺ cotransport is implicated not only in regulatory
volume decrease, but also in transepithelial salt absorption (12), renal K⫹ secretion (108), myocardial K⫹ loss
during ischemia (445), and regulation of neuronal Cl⫺
concentration (346). Molecular identification of genes encoding K⫹-Cl⫺ cotransporters was possible due to their
homology with Na⫹-coupled Cl⫺ cotransporters. Four
genes encoding K⫹-Cl⫺ cotransporters were identified as
part of the SLC12 family; these genes are known as
Physiol Rev • VOL
SLC12A4, SLC12A5, SLC12A6, and SLC12A7 and encode
the isoforms known as KCC1, KCC2, KCC3, and KCC4,
respectively.
1. The K⫹-Cl⫺ cotransporter KCC1
Identification of four K⫹-Cl⫺ cotransporter genes
was possible due to the so-called in silico cloning strategies (291) that were based on identification of sequences
in Genebank, particularly the expressed sequence tag databases (dbEST), which were initiated in 1992 and that
underwent dramatic enlargement throughout the 1990s.
Molecular identification of human KCC1 was based on
finding several human dbEST that were ⬍50% identical to
BSC1/NKCC2, BSC2/NKCC1, or TSC, indicating that EST
sequences belonged to an unidentified member of the
family. Therefore, probes derived from dbEST were used
by Gillen et al. (142) to isolate full-length clones from
human, rat, and rabbit kidneys that encode a membrane
protein of 1,085 amino acid residues (see Table 2) that is
expressed in all tested tissues as a predominant 3.8-kb
transcript. Stable HEK-293 cells transfected with rabbit
KCC1 cDNA exhibited 86Rb⫹ uptake and efflux mechanisms compatible with known characteristics of the red
blood cell K⫹-Cl⫺ cotransporter, i.e., 86Rb⫹ transport induced by rabbit KCC1 was Na⫹ independent, Cl⫺ dependent, furosemide sensitive, and activated by NEM or cell
swelling.
KCC1 sequence exhibits low identity with Na⫹-coupled chloride cotransporters BSC1/NKCC2, BSC2/NKCC1,
and TSC of ⬃25%, but with a remarkable similarity in
proposed secondary structure. Hydrophobicity analysis of
KCC1 using the Kyte-Doolittle algorithm (226) predicts
existence of a central hydrophobic domain flanked by
short amino-terminal and long carboxy-terminal domains
predicted to be intracellular. The central domain is composed by 12 putative transmembrane segments. As shown
in Figure 1, proposed topology is very similar, but with a
noticeable structural difference between KCC1 (and all
KCCs) and Na⫹-coupled chloride cotransporters, which
include location and length of the extracellular loop containing potential N-linked glycosylation sites. This loop in
KCC1 is larger and is predicted to be located between
putative TM5 and TM6, with four potential N-linked glycosylation sites, conserved among rat, rabbit, and human
KCC1. In contrast, as discussed previously, extracellular
N-linked glycosylation loop of Na⫹-coupled chloride cotransporters is shorter and predicted to be located between TM7 and TM8.
As shown in Table 2, after initial cloning of KCC1
cDNA by Gillen et al. (142), KCC1 orthologs have been
cloned from other species. Pellegrino et al. (316) using a
homology PCR-based approach isolated cDNA clones encoding KCC1 from human erythroleukemia cell line K256
and also from mouse erythroleukemia cell line MEL. De-
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
percentage of the teleost genome underwent ancient duplication. Functional differences between both cotransporters have not been explored.
Molecular diversity in BSC2 is also increased by existence of one alternatively spliced isoform. As part of
their cloning and characterization of mouse SLC12A2
gene, Randall et al. (332) intentionally searched for alternative spliced isoforms by PCR-amplifying segments containing two to three exons. A spliced variant was detected
from mouse brain total RNA; it lacked the 48 bp that
correspond to entire exon 21. Thus 16 residues within the
carboxy terminal are not present. Existence of spliced
transcript was confirmed by RNase protection assay.
Analysis of distribution within brain showed that transcript lacking exon 21 is present in all areas examined
except in choroid plexus, in which the only isoform containing exon 21 is expressed. This spliced variant, however, was also observed in human ocular-trabecular meshwork cells; in addition, with the use of a kinetic PCR
strategy it was observed that exon 21-lacking isoform is
expressed in several human tissues, with an up to 68-fold
variation in isoforms ratio among 14 tested tissues. Brain
was the only tissue in which the isoform lacking exon 21
was significantly more abundant than the longer one
(418). Spliced variant performs as an Na⫹-K⫹-2Cl⫺ cotransporter (418), but its physiological significance is not
yet known. However, it is important to note that the
absence of the exon 21 sequence removes the sole putative PKA site present in the entire BSC2 sequence.
431
ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS
TABLE
2.
Source
Identified members of the K⫹-coupled Cl⫺ cotransporter branch (SLC12A4-7)
Name
Clone
Size, kb
5⬘-UTR,
kb
3⬘-UTR
kb
ORF,
kb
Number of
Residues
Molecular
Mass, kDa
Accession No./
Reference Nos.
1,085
1,085
1,085
1,085
1,086
1,085
1,085
1,011
1,068
1,085
120
120
120
120
120
120
120
112
118
120
U55815/(142)
AF047339/(316)
AF121118/(370)
U55053/(142)
AF028807/(180)
U55054/(142)
AF047338/(316)
AF054505/(316)
AF054506/(316)
BC021193/(391)
1,116
1,114
1,115
1,116
123
123
123
123
U55816/(313)
BC054808/(391)
AF332064
AF208159/(380)
1,099
1,150
1,150
1,011
1,099
122
127
127
112
122
AF211855
AF105366/(292)
AF116242/(331)
AF477977
AF108831/(178)
1,083
1,106
1,083
119
120
119
AF087436/(290)
AF538347/(414)
AF105365/(292)
K⫹-Cl⫺ cotransporter 1 (SLC12A4)
Rat
Mouse
Rabbit
Pig
Human
KCC1
KCC1
KCC1
KCC1
KCC1
KCC1
KCC1
KCC1-1
KCC1-2
KCC1
3,726
3,755
3,764
3,734
3,351
3,722
3,613
3,761
3,768
3,888
0
0
67
20
36
55
0
0
0
69
471
520
442
459
57
412
358
728
564
560
3,255
3,255
3,255
3,255
3,258
3,255
3,255
3,033
3,204
3,255
Rat
Mouse
Human
KCC2
KCC2
KCC2
KCC2
5,560
5,708
3,656
5,907
115
84
85
0
2,103
2,282
226
3,348
3,348
3,342
3,345
2,559
K⫹Cl⫺ cotransporter 3 (SLC12A6)
Mouse
Human
KCC3b
KCC3a
KCC3a
KCC3 variant
KCC3b
5,964
4,260
3,450
4,453
3,767
0
164
0
774
51
2,667
646
0
646
419
3,297
3,450
3,450
3,033
3,297
K⫹-Cl⫺ cotransporter 4 (SLC12A7)
Mouse
Rabbit
Human
KCC4
KCC4
KCC4
5,155
4,331
5,239
72
184
4
1,834
829
1,986
gree of identity among human, rat, rabbit, and mouse
KCC1 is ⬃96%. Interestingly, KCC1 was not present in
human or mouse reticulocytes but was present during the
early stages of erythroleukemia cell differentiation, suggesting that level of expression of KCC1 mRNA may play
a role in early stages of erythroid maturation. Pellegrino
et al. (316) also isolated two distinct mRNAs exhibiting
different ends of the protein; one mRNA contained a stop
codon at residue 1,012, resulting in a 73-amino acid truncated protein, and the second contained distinct sequence
after residue 1,056 and resulted in a 23-amino acid truncated protein. It was suggested that both could be alternatively spliced isoforms; however, no further actions
were taken to support this hypothesis. Finally, KCC1 has
also been identified from Sus Scorfa (pig) and from Caenorhabditis elegans, exhibiting 94 and 42% identity, respectively, with other mammalian KCC1 orthologs. Both
clones were shown in HEK-293 transfected cells to encode a K⫹-Cl⫺ cotransporter (180).
2. The K⫹-Cl⫺ cotransporter KCC2
Finding two EST from human brain exhibiting 35%
identity with human BSC2/NKCC1 allowed Payne et al.
(313) to amplify by PCR a 286-bp cDNA fragment from rat
brain that was then used as a template to prepare a
32
P-DNA random primed probe to screen a rat brain cDNA
Physiol Rev • VOL
3,249
3,318
3,249
library under low-stringency conditions. From 19 clones
isolated, 7 were KCC1 and 12 corresponded to a new
closely related cDNA named KCC2. The 5,566-bp fulllength clone encodes a protein of 1,116 amino acid residues with predicted molecular mass of 123 kDa that is
67% identical to KCC1. As shown in Table 2, a similar
cDNA was later isolated and sequenced from mouse as
part of a large-scale project launched to identify all human
and mouse ORFs by the Mammalian Gene Collection
Program Team (http//mgc.nci.nih.gov) (391). Hydrophobicity analysis revealed a protein with 12 putative-transmembrane segments with a topology similar to KCC1
(Fig. 1) in which the glycosylated extracellular loop is
located between transmembrane segments 5 and 6. Northern blot analysis revealed that a single transcript of ⬃5.6
kb was expressed only in poly(A)⫹ RNA from the central
nervous system (CNS), indicating that KCC2 is a brainspecific gene. By PCR analysis, several rat nervous system-derived cell lines such as primary astrocytes, glioma
cell line, and pheochromocytoma cell line were positive
for KCC1 but negative for KCC2. In addition, in situ
hybridization analysis revealed that KCC2 is present in all
layers of cortex, all areas of hippocampus, and the granular layer of the cerebellum, whereas white matter was
devoid of any signal, suggesting that KCC2 is expressed
exclusively in neurons.
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
K⫹-Cl⫺ cotransporter 2 (SLC12A5)
432
GERARDO GAMBA
3. The K⫹-Cl⫺ cotransporter KCC3
Three groups simultaneously identified a third gene
encoding a K⫹-Cl⫺ cotransporter (SLC12A6) from human
mRNA by means of two different strategies. Hiki et al.
(178) used a differential display PCR strategy in human
umbilical vein endothelial cells (HUVEC) designed to
identify transcripts that exhibited change in expression
level after cells were treated with vascular endothelial cell
growth factor (VEGF). A consistent upregulated band was
sliced off and used as a probe to isolate corresponding
full-length cDNA from a HUVEC library that corresponded to a putative membrane transporter with 77%
identity with KCC1 and 73% with KCC2; thus isolated
cDNA clone was named KCC3 and encodes a protein of
1,099 amino acid residues with a hydropathy profile identical to that of KCC1 and KCC2 (Fig. 1). It was shown in
the same study in transfected HEK-293 cells that KCC3
performed as a furosemide-sensitive K⫹-Cl⫺ cotransporter that exhibited, however, no response to hypotonicity. The new gene was located at human chromosome
15q13 and was shown to be expressed in several tissues
including brain, kidney, and liver. Simultaneously, Mount
et al. (292) following the in silico strategy identified several human ESTs that were useful to isolate two new
members of K⫹-Cl⫺ cotransporter subfamily that were
named KCC3 and KCC4. These proteins exhibited ⬃70%
identity with KCC1 and KCC2. KCC3 cDNA was isolated
from a human muscle cDNA library, and Northern blot
analysis revealed variable expression of two 6- to 7-kb
bands in several tissues, suggesting the possibility of alternative splicing. KCC3 was also isolated by Race et al.
(331) following the in silico strategy from a human placenta cDNA library. These authors, using transfected
HEK-293 cells, showed that KCC3 encodes a furosemidesensitive and an NEM-activated K⫹-Cl⫺ cotransporter that
exhibited a slight but significant activation by hypotonicity. As shown in Table 2, full-length KCC3 cDNA isolated
by Mount et al. (292) and by Race et al. (331) encodes a
Physiol Rev • VOL
1,150-amino acid residue cotransporter. The difference
with the 1,099-residue protein from Hiki et al. (178) resides in length and sequence of the amino-terminal domain, due to the presence of two alternative first exons in
the SLC12A6 gene with transcriptional initiation at separate promoters, which were denominated as exon 1a and
exon 1b, thus generating the terminology of KCC3a and
KCC3b for long and short isoforms, respectively (315).
Exon 1a encodes 90 amino acids not present in the 39residue exon 1b. mRNA encoding KCC3a is widely expressed, with abundant message by Northern blot analysis in brain, kidney, muscle, lung, and heart, while the
KCC3b transcript is more abundant in kidney than in any
other tissue. Interestingly, there are several potential
phosphorylation sites for PKC (292) within the 51 amino
acid residues present in KCC3a (exon 1a) that are thus not
present in KCC3b (exon 1b) (178), suggesting that these
isoforms are subjected to different posttranslational regulation. As discussed in section IIIF, KCC3a and KCC3b
isoforms perform as hypotonically activated K⫹-Cl⫺ cotransporters when X. laevis oocytes were used as the
heterologous expression system.
4. The K⫹-Cl⫺ cotransporter KCC4
There is a fourth gene encoding an isoform of the
K⫹-Cl⫺ cotransporter, which was identified by Mount et
al. (292) from mouse and human kidney mRNA by PCR
using several ESTs to guide the design of appropriate
primers. KCC4 cDNA encodes a protein of 1,083 amino
acid residues with a hydropathy profile similar to that of
other K⫹-Cl⫺ cotransporters (Fig. 1). The degree of identity with KCC1, KCC2, and KCC3 is 67, 72, and 67%,
respectively. KCC4 is expressed in several tissues, with
higher levels in heart and kidney and very low levels in
brain. Within the CNS, the main localization of KCC4
protein is on cranial nerves (204). Functional expression
in X. laevis oocytes demonstrated that KCC4 encodes a
K⫹-Cl⫺ cotransporter that can be activated by incubation
in hypotonicity or after NEM exposure (275, 292). KCC4
cDNA has also been isolated from rabbit kidney by
Velázquez and Silva (414) and encodes a 1,106-amino acid
protein that contains 23 extra residues not present in
mouse or human orthologs. These extra residues are located within the amino-terminal domain as two separate
fragments of 11 and 12 residues. No studies were done to
demonstrate if this is due to alternative splicing or is a
cloning artefact.
C. Orphan Members
Two orphan members of the cation-chloride cotransporter family have been described. Caron et al. (49) identified human ESTs with 25% degree of identity with KCCs,
BSC1/NKCC2, BSC2/NKCC1, and TSC, suggesting that the
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
The KCC2 cotransporter has been also isolated and
sequenced from other two species. Human KCC2 cDNA
was isolated by Song et al. (380) using a PCR-based
homology approach. As shown in Table 2, a single
5,907-bp cDNA was isolated that encodes a 1,116-residue
protein that is 99% identical to rat KCC2. Differentiated
NT2-N cells with retinoic acid exhibited expression of
KCC2, corroborating the presence of this transcript in a
neuronal-derived cell line. KCC2 cDNA has been also
isolated and sequenced from mouse by means of a highthroughput sequence study designed to identify gene-coding variants within alcohol-related QTLs in a mouse model
of alcohol addiction (102) and also by the Mammalian
Gene Collection Program Team (http//mgc.nci.nih.gov)
(391).
433
ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS
TABLE
3.
members (714 amino acids), and it is ⬃30% identical to
BSC1/NKCC2, with particular conservation of predicted
transmembrane segments 1, 2, 6, and 7. Predicted topology (Fig. 1) is unique in the family because there is a short
intracellular amino-terminal domain followed by 11 membrane segments, with a glycosylated carboxy-terminal
tail. Transport function is not yet known because heterologous expression in X. laevis oocytes failed to detect
significant activity in transport of 36Cl⫺, 86Rb⫹, and 22Na⫹
and revealed no interaction with coinjected TSC, BSC1/
NKCC2, or KCC4, suggesting that this protein does not
form heterodimers with other family members. There are
clear orthologs within Drosophila and C. elegans genomes, and interestingly, this gene has been identified as
a psoriasis-susceptibility candidate gene on chromosome
3q21 (176).
D. Genes and Promoter Characteristics
1. Na⫹-coupled chloride cotransporters
The gene encoding the renal-specific bumetanidesensitive Na⫹-K⫹-2Cl⫺ cotransporter (SLC12A1) has
been mapped in humans at chromosome 15 (375), in rat at
chromosome 3 (423), and in mouse at chromosome 2
(330). SLC12A1 in humans encompasses 80 kb and contains 26 exons (Table 3). Intron range spans from 120 bp
to 15 kb. A GT dinucleotide repeat within the gene is
highly polymorphic with 42% heterozygosity in 50 unrelated subjects (375). SLC12A1 promoter region has been
cloned from mouse genomic DNA (188). It was first
shown in this study, using nuclear run-off assays, that
BSC1/NKCC2 kidney-specific expression is due to regulation at the level of initiation of gene transcription and not
at posttranscriptional regulation. Subsequently, the promoter was cloned, and transcription initiation was de-
Characteristics of SLC12 genes and their promoters
Gene
Cotransporter
SLC12A1
BSC1/NKCC2
SLC12A2
BSC2/NKCC1
SLC12A3
TSC
SLC12A4
KCC1
SLC12A5
KCC2
SLC12A6
SLC12A7
SLC12A8
SLC12A9
KCC3
KCC4
CCC9
CIP
Chromosome
Human: 15
Rat: 3
Mouse: 8
Human: 5
Mouse: 18
Human: 16
Rat: 19
Mouse: 8
Human: 16
Mouse: 5
Human: 20
Mouse: 8
Human: 15
Human: 5
Human: 3
Human: 7
Size, kb
Number
of Exons
Promoter,
bp
Start Site,
bp
Reference Nos.
80
26
2,255
⫺280
188, 330, 375, 423
75
28
2,063
⫺270
80, 314, 332
55
26
1,019
⫺18
23
24
1,938
⫺121
30
24
NA
NA
354, 380
NA
NA
NA
NA
NA
NA
NA
NA
NA
NA
NA
NA
NA
NA
NA
NA
178, 292
292
NA
49
NA, information not available.
Physiol Rev • VOL
85 • APRIL 2005 •
www.prv.org
257, 308, 37, 400
180, 231, 392
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
gene encoding such a transcript could be a distant but
related member of the family. A ␭ZAP II/human heart
cDNA library was screened using a random primed 32PDNA probe constructed from EST under low-stringency
conditions until a 3,276-bp full-length transcript clone was
isolated and named CIP for cotransporter interacting protein (GeneBank accession no. AF284422). A single ORF of
2,742 bp predicted a protein of 915 amino acid residues
with a molecular mass of 96 kDa. As shown in Figure 1,
hydropathy analysis of CIP protein revealed a topology
that more closely resembles KCC cotransporters, because
the long glycosylated extracellular loop is located between transmembrane segments 5 and 6. CIP amino- and
carboxy-terminal domains are 44 and 370 amino acids in
length, respectively. Northern blot analysis revealed wide
distribution along tissues, and functional expression flux
studies were performed in both HEK-293 cells and X.
laevis oocytes transfected with cDNA and cRNA, respectively. Unfortunately, no increase in 22Na⫹, 86Rb⫹, or
36 ⫺
Cl was observed under any multiple experimental approaches tested. For this reason, CIP is considered an
orphan member of the family because its transport substrate is not known. However, coinjection experiments
that were performed revealed that BSC2/NKCC1, but not
BSC1/NKCC2 or KCC1, was significantly and reproducibly
inhibited when coinjected with CIP; for this reason the
new clone was denominated CIP for cotransporter interacting protein. Coimmunoprecipitation experiments suggested that a potential explanation for CIP effects upon
NKCC1 involves physical interaction between both proteins. The gene SLC12A9 encoding this cotransporter was
located to human chromosome 7q22.
Finally, the most recent and distant member of the
family has been provisionally denoted SLC12A8 (289)
(GeneBank accession no. AF345197). This is a membrane
protein that is much shorter than the remainder of family
434
GERARDO GAMBA
Physiol Rev • VOL
yielded significant luciferase activity. Then, similar to the
observation made on SLC12A1 promoter (188), deletions
of ⬎1 kb that reduced promoter region to 702 or 516 bp
resulted in a significant increase in luciferase activity,
suggesting the existence of silencer sequences in deleted
bases. Further deletions resulted in progressive reduction
of luciferase activity, suggesting the presence of enhancer
elements.
The gene encoding thiazide-sensitive Na⫹-Cl⫺ cotransporter (SLC12A3) has been mapped at chromosomes 16q13 in humans (265, 377), 19p12–14 in rats (400),
and 8 in mice (308). As shown in Table 3, human SLC12A3
is 55 kb long and contains 26 exons (377). All exon-intron
boundaries have the conventional 5⬘-GT and 3⬘-AT consensus splice sites. There is a polymorphic genetic marker
of a GT-dinucleotide repeat within SLC12A3 gene that
exhibited heterozygosity of 48% in 45 unrelated Caucasian
subjects. SLC12A3 promoter region has been cloned from
humans (257) and rat (400) genomic DNA. In humans,
transcription initiation is confined to an area from ⫺18 to
⫺6 upstream of the translation start codon, and maximum
promoter activity in mouse distal convoluted cell line
(MDCT) (257) transfected with pCAT3 constructs was
obtained with construct containing 1,019 bp of the 5⬘flanking region; however, 75% of activity was observed
with a promoter containing only 134 bp of the 5⬘-flanking
region. Sequence analysis of promoter revealed the presence of a TATA element, two Sp binding sites, and potential binding sites for NF-1/CTF or NY-I/CP-I. Consistent
with the general belief that TSC exhibits kidney-specific
expression, the promoter region in humans displayed repressor activity in Chinese hamster ovary-derived cell line
CHO-K1, which requires the presence of two Sp binding
sites. Promoter activity in MDCT cells transfected with a
pACT3 construct containing ⫺1,019 to ⫹1 of the 5⬘-flanking region was shown to inhibit transcription in response
to acidification of the extracellular medium, but not to
hypertonicity or presence of mineralocorticoid DOCA.
The observation that acidosis inhibited promoter activity
is consistent with a marked fall in renal cortical abundance of TSC assessed by either Western blot of renal
cortical proteins (211) or by [3H]metolazone binding to
plasma membranes from renal cortex (119) of rats exposed to chronic NH4Cl loading.
With the use of luciferase reporter gene analysis in
HEK-293 cells, maximal activity of rat SLC12A3 promoter
was obtained with ⫺2,093 bp of the 5⬘-flanking region;
nonetheless, most activity was found present using a
⫺580-bp fragment. The transcription initiation site in the
rat was located 18 bases upstream of the start codon.
Several putative consensus transcription factor recognition sequences were observed, including a TATA box in
position ⫺42, three SRY, five Pit-1, and two Sp1 binding
sites, two glucocorticoid response elements (GRE), one
cAMP response element (CRE), and an HFH-3 binding
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
fined as ⫺280 bp of the 5⬘ start codon. It was observed,
however, that in mouse SLC12A1, there is a first exon of
34 bp in length that is noncoding, followed by a first intron
of 1,101 bp and a second exon containing the translation
start codon. Cloned promoter is composed of 2,255 bp,
and sequence analysis revealed a TATA box located at
position ⫺29 and consensus recognition sites for several
transcription factors, of which the most interesting could
be a binding site for HNF-1 at ⫺211 bp. In developing
mouse kidney, expression of HNF-1 precedes expression
of BSC1/NKCC2 (239), and this factor has been implicated
in regulation of tissue-specific expression in liver, pancreas, kidney, and intestine. One example is renal epithelium-specific expression of the Ksp-cadherin that is due to
interaction with transcription factors NHF-1␣ and
NHF-1␤ (21). In this regard, transfection of TALH-derived
cells with pGL3B-NKCC2 construct, that contained 2,255
bp of SLC12A1 promoter region fused to a luciferase
reporter gene, resulting in a 130-fold increase in luciferase
activity, while transfection of NIH 3T3 cells resulted in no
activity. With the use of TALH-derived cells, it was demonstrated that deletion of ⫺2,255 to ⫺1,529 bp produced
an approximately threefold increase in luciferase activity,
suggesting that this region contains negative regulatory
elements. Deletion from ⫺1,529 to ⫺469 bp had no further
effect, but deletion from ⫺469 to ⫺190 resulted in 76%
reduction of promoter activity, suggesting that this region
contains positive regulatory elements. HFN-1 binding site
is located in this region. Finally, a cAMP response-element binding protein is located at nucleotide ⫺1,111. This
site could be important because it is known that Na⫹-K⫹2Cl⫺ cotransporter activity in TALH is increased by vasopressin (171, 280) and that chronic administration of 1desamino-[8-D-arginine]vasopressin (DDAVP) to SpragueDawley and Brattleboro rats is associated with increase in
BSC1/NKCC2 abundance at protein level (209). It is not
known whether this effect is at the regulation of gene
transcription or by increasing protein stability. The effect
of DDAVP on mRNA levels, however, has not been reported.
As shown in Table 3, basolateral Na⫹-K⫹-2Cl⫺ cotransporter isoform gene SLC12A2 has been shown as
located at chromosomes 5q23 in humans (314) and at
chromosome 18 in mouse (80). The complete gene has
been cloned from mouse DNA, covering a region of 75 kb
(332), and is composed of 28 exons that are on average
111 bp in length, except for exons 1 and 27 that are 864
and 941 bp long, respectively. Transcription start site was
defined at ⫺270 bp upstream of the ORF start codon.
Randall et al. (332) first cloned the promoter region. Sequence revealed numerous SP1 consensus sites and binding sites for different transcription factors, including
MEF2, a CACCC binding, OTF/1–2A, NF␬B, and AP-2.
Transfection of mouse IMDC3 cells with 2,063-bp promoter region ligated to a luciferase reporter gene (pGL3)
ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS
2. The K⫹-coupled chloride cotransporters
Ubiquitously expressed K⫹-Cl⫺ cotransporter KCC1
gene SLC12A4 has been localized on chromosomes 16q22
in humans (231) and on chromosome 8 in mice (392) and
encompasses a region of 23 kb in the genome and is
composed of 24 exons (180). As shown in Table 3, this is
the smallest gene of the electroneutral cotransporter family. Intron length ranges from 75 bp to 4.5 kb, while the
exon range spans 95–242 bp. All intron-exon boundaries
possess conventional 5⬘-GT and 3⬘-AT consensus splice
sites. In contrast, gene encoding KCC1 in Caenorhabditis
elegans is composed of 9 exons and 10 introns that encompass 3.5 kb (180). Zhou et al. (451) recently screened
a human genomic BAC library and identified a 1,938-bp
KCC1 promoter. A single transcription initiation site was
located 121 bp before the first methionine encoding
codon ATG. KCC1 promoter lacks TATA and CCAAT
consensus sequences but contains one GATA-1 consensus
site, two AP-2 sites, and three GC/CACC binding-related
proteins that are motifs for several transcription factors
including Sp-1. Transfection of different size promoters
(⫺1938, ⫺720, and ⫺369) with luciferase reporter into
K562 and HeLa cells demonstrated that promoter is active
in both erythroid and nonerythroid cells. Finally, mutaPhysiol Rev • VOL
tions designed to eliminate AP-2 sites reduced promoter
activity by one-half, and those in which consensus sequences InR and DPE are eliminated reduced activity by
⬎10-fold.
Neuronal-specific K⫹-Cl⫺ cotransporter KCC2 gene
SLC12A5 has been mapped at chromosome 20q13 in humans (354, 380) and at chromosome 5 in mice (354)
(Table 3). Human SLC12A5 encompasses 24 coding exons spread over ⬃30 kb of genomic DNA. Exons 21 and 22
encode a carboxy-terminal insertion unique to KCC2 discussed later. All intron-exon boundaries obey GT-AG
(380). Mean exon size is 140 bp, ranging from 45 to 242 bp.
The SLC12A5 promoter region has not been studied in
detail. However, it is known that neuron-restricted expression pattern in KCC2 is at least due in part to the
presence of a neuronal-restrictive silencing element
(NRSE). A genomic clone containing ⬃7 kb of KCC2
5⬘-flanking region, exon 1, and ⬃11 kb of downstream
sequence revealed that mouse KCC2 gene contains the
sequence TTCAGCACCACGGACAGCGCC within intron 1
(205). This sequence was also observed within intron 1 in
humans (380) and is 80% homologous to consensus site
for a neuronal-restrictive silencing factor binding (NRSF).
This NSRF is known to be responsible for negative transcriptional regulation of genes in nonneuronal cells (360).
Mouse putative NRSE contains four mismatched nucleotides when compared with classical NRSE; however,
three have been previously shown to be nonessential for
NRSF binding (360). In addition, Karadsheh and Delpire
(205) observed that the 21-bp fragment containing the
putative NRSE was able to interact with proteins isolated
from C17 nonneuronal cells and that addition of cold
NRSE fragment displaced the binding. In addition, in a
luciferase gene reported assay carried out in C17 cells,
investigators observed that luciferase activity yielded by
KCC2 promoter alone was completely prevented with
KCC2 promoter construct also containing NSRE sequence.
SLC12A6 and SLC12A7 genes that encode KCC3 and
KCC4 isoforms of K⫹-Cl⫺ cotransporters have been located at human chromosomes 15q13–14 and 5p15.3, respectively (178, 292). To date, however, complete gene or
promoter regions have not been reported. Similarly,
SLC12A9 cDNA encoding CIP was cloned from a human
heart cDNA library, and the gene was located at human
chromosome 7q22. The complete gene or promoter regions have not been described. Finally, by BLAST search
analysis, the gene encoding SLC12A8 has been localized
at human chromosome 3q21–22.
E. Phylogenetic and Sequence Comparison
Figure 4 shows the phylogenetic tree, and Table 4
shows the degree of identity obtained from alignment
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
site. Rat promoter displays repressor activity in a human
hepatocyte cell line (HepG2) and a rat vascular smooth
muscle cell line (A10), but not in human embryonic kidney cells HEK-293 (400). In addition, transgenic rats harboring a construct containing 5⬘-flanking region of rat
SLC12A3 promoter fused to LacZ gene displayed immunoreactivity against ␤-galacosidase exclusively in DCT
(400). One potential explanation for TSC kidney-specific
expression is presence of the HFH-3 binding site in ⫺393
bp of rat promoter. The HFH-3 transcription factor belongs to HFH/winged helix factor family, and its expression in mammalian kidney has also been shown to be
restricted to the epithelium of DCT (305). Members of the
HFH/winged family are known to be involved in tissuespecific gene expression and differentiation during embryonic development (228); thus HFH-3 transcription factor could be involved in defining TSC tissue-specific expression. Consistent with this view, Taniyama et al. (400)
showed that overexpression of HFH-3 transcription factor
stimulated activity of the 5⬘-FL/rTSC promoter construct
in HepG2 cells, assessed by luciferase activity, and that
point mutations in HFH-3 binding site on rTSC promoter
were associated with marked loss of HFH-3 transcription
factor effect. Stimulation, however, was only approximately threefold over activity observed in mock transfected HepG2 cells, while in HEK-293 5⬘-FL/TSC transfected cells, luciferase activity was 25-fold over mocktransfected cells, suggesting that other elements are
probably involved in defining TSC gene expression.
435
436
GERARDO GAMBA
FIG. 4. Phylogenetic tree of the electroneutral cation-coupled chloride cotransporter family SLC12. Numbers indicate degree of identity.
TABLE
4.
Degree of identity among members of the electroneutral cotransporter family
Full sequence
KCC1
KCC3
KCC2
KCC4
BSC1
BSC2
TSC
CIP
CCC9
KCC1
100
75.3
69.3
68.8
25.0
25.5
22.3
24.2
19.2
KCC1
KCC3
79.7
100
69.4
69.2
25.4
24
25
24.7
18.1
KCC3
KCC2
75.6
76.5
100
72.6
23.8
23.7
22.7
25.1
18.2
KCC2
KCC4
KCC4
74.0
75.4
80.0
100
24.4
25.6
24.4
23.3
20.0
BSC1
31.4
30.4
30.6
30.6
100
62.4
51.8
23.3
22.9
BSC1
BSC2
32.6
30.9
31.3
32.0
78.7
100
52.2
22.8
24.3
BSC2
TSC
27.5
27.8
27.1
27.1
60.5
58.8
100
21.6
21.8
TSC
19.2
CIP
CIP
27.9
28.7
27.0
26.8
25.4
26.3
24.6
100
KCC1
KCC3
KCC2
KCC4
BSC1
BSC2
TSC
CIP
CCC9
Central hydrophobic domain sequence
Amino-terminal domain sequence
KCC1
KCC3
KCC2
KCC4
BSC1
BSC2
TSC
CIP
KCC1
100
38.1
44.3
39.8
13.6
16.1
15.3
22.0
KCC3
81.1
100
49.5
33.1
12.4
12.4
15.4
17.1
KCC3
KCC2
66.8
69.5
100
49.5
15.5
17.5
12.4
19.5
KCC2
KCC4
67.4
68.1
68.4
100
12.7
14.4
12.7
24.4
KCC4
BSC1
21.0
21.9
19.1
20.1
100
27.7
23.5
24.4
BSC1
BSC2
18.0
19.1
17.0
20.4
55.9
100
21.3
24.4
BSC2
TSC
19.6
20.1
21.1
19.9
48.4
50.1
100
17.1
TSC
CIP
KCC1
18.2
18.2
18.2
19.4
18.2
20.3
16.7
100
CIP
KCC1
KCC3
KCC2
KCC4
BSC1
BSC2
TSC
CIP
CCC9
Carboxy-terminal domain sequence
Physiol Rev • VOL
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
analysis of all members of electroneutral cotransporter
family. Alignment was performed according to the Clustal
W method using DNASTAR MegaAlign software. For this
analysis, predicted sequences of human cotransporter
proteins were used. As shown in Figure 4, two main
branches are clearly separated: one branch is composed
of cotransporters that utilize Na⫹ as cation in the coupled
process, regardless of their use of K⫹, and include BSC1/
NKCC2, BSC2/NKCC1, and TSC, while the remaining
branch is composed of cotransporters that use K⫹ as a
unique cation coupled with Cl⫺ include KCC1, KCC2,
KCC3, and KCC4. As seen in Table 4, degree of identity
between members of one branch with the other is ⬃25%.
The K⫹-coupled Cl⫺ cotransporters branch is subdivided
into two subfamilies: one composed of KCC1 and KCC3
that exhibit ⬃75% identity, and the other of KCC2 and
KCC4 that share ⬃72% of amino acid residues. Identity
between both KCC subfamilies is ⬃65%. Finally, overall
ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS
Physiol Rev • VOL
degree of identity ⬍13% between BSC1/NKCC2 and BSC2/
NKCC1; thus this is a unique region in both cotransporters. The presence of several putative phosphorylation
sites, including one putative PKA site in BSC2/NKCC1,
suggests that this region may be associated with specific
regulatory properties of each cotransporter. The remaining unique region belongs to KCC2. There are 73 amino
acid residues in the carboxy-terminal domain of KCC2
that are not present in KCC1, KCC3, and KCC4. This
region also contains several putative regulatory sites, including one for PKA phosphorylation.
III. FUNCTIONAL PROPERTIES
Since the discovery of these membrane transport
systems, several investigators have studied in different
cells and organisms the functional characteristics of the
basolateral Na⫹-K⫹-2Cl⫺ and K⫹-Cl⫺ cotransporters.
Characterization of the same cotransport system in several different cells has yielded important functional differences in which it is difficult to define whether they are
related to the cotransporter protein itself, to species differences in the protein, or to the environment in which it
was studied. In the case of K⫹-Cl⫺ cotransporter, most
functional characterization has been carried out in erythrocytes and before knowing that there are four different
genes encoding this cotransporter. We will not review
here the functional characterization that has been performed in situ in cells expressing these cotransporters.
For in-depth reviews about it see References 161, 162,
164, 235, 234, 337, 351, 427. Due to its unique and specific
localization in the kidney, together with absence of reliable stable cell lines from TALH and DCT, functional
characterization of apical Na⫹-K⫹-2Cl⫺ and Na⫹-Cl⫺ cotransporters has been less active (for review, see Refs. 19,
302, 348). In recent years, with identification and cloning
of cDNA encoding all members of the family, in-depth
characterization of the major functional, pharmacological, and some regulatory properties has been possible,
increasing our understanding of the cotransporter process. In this section we review the functional characterization of each member of electroneutral cotransporter
family that has been performed by means of functional
expression assays of cloned cDNAs in mammalian (v.gr.
HEK-293 cells, MDCK cells, etc.) or nonmammalian (v.gr.
X. laevis oocytes) expression systems.
A. Thiazide-Sensitive Naⴙ-Clⴚ Cotransporter
As discussed in the previous section and shown in
Table 1, TSC cDNA has been identified and cloned in fish
from winter flounder urinary bladder (137) and in mammals from rat (136), mouse (221), rabbit (43), and human
(265, 377) renal cortex. Heterologous expression of te-
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
identity of orphan members CIP and CCC9, between the
two, and with the remainder of the family is ⬃20%.
In Table 4, overall degree of identity using the full
sequence of all cotransporters is shown in the green
boxes. Degree of identity of only the central hydrophobic
domain, which according to Kyte-Doolittle (226) algorithm contains 12 ␣-helices that correspond to putative
transmembrane segments, is shown in blue boxes, while
degree of identity using only amino- or carboxy-terminal
domains are shown in red and black boxes, respectively.
As mentioned previously, topology has been experimentally corroborated only in BSC2/NKCC1 (140); thus BSC2/
NKCC1 sequence was used as a guide to define each
domain. As shown in Table 4, the central domain is the
protein section possessing the highest conservation.
Length of this region is ⬃470 and ⬃ 540 residues in
Na⫹-coupled and K⫹-coupled cotransporters, respectively. There is a slight increase in degree of identity when
alignment analysis is performed using only sequences of
central hydrophobic domain (Table 4), compared with full
sequence. Amino-terminal domain (defined as the portion
that extends from the first methionine to the beginning of
transmembrane segment 1) is the most variable segment
of these proteins. Length ranges from 41–285 residues and
identity among KCCs is between 45–50%, while in Na⫹coupled cotransporters identity is ⬍30%, and between
both branches is ⬍15% (Table 4). Alternative splicing
affecting sequence of amino-terminal domain has been
described in KCC3, in which two different amino-terminal
sequences are possible (315). The other member in which
alternative splicing involves amino-terminal domain is
TSC because an isoform lacking amino-terminal domain,
and the first three transmembrane segments have been
identified in several tissues of winter flounder (276).
The carboxy-terminal domain (defined as the segment extending from first amino acid residue after transmembrane segment 12 to the end of the protein) is more
conserved in the KCC branch than in Na⫹-coupled cotransporters. As shown in Table 4, among KCCs the percentage of identity in carboxy-terminal domain is similar
to the degree observed within central hydrophobic domain, while in Na⫹-coupled cotransporters the identity is
lower. The length of this domain ranges from 413 to 480
residues. An alternatively splicing isoform in BSC2/
NKCC1 due to lack of 21 residues of the carboxy-terminal
domain has been described. Consequences of the splicing
are not yet known (332). As previously discussed, there is
also evidence for a shorter carboxy-terminal domainspliced variant in BSC1/NKCC2 (290). Modifications in the
carboxy-terminal sequence and length confer upon the
cotransporter with interesting changes in functional properties that are discussed in section IIIB. Finally, there are
two unique regions within the carboxy-terminal domain.
One in the Na⫹-K⫹-2Cl⫺ cotransporter of ⬃60 amino acid
residues that is not present in TSC, which exhibits a
437
438
GERARDO GAMBA
5. Ion transport and thiazide-sensitive kinetics
of TSC orthologs
TABLE
Na⫹ Km, mM
Cl⫺ Km, mM
Polythiazide IC50, ␮M
Rat TSC
(283)
Mouse
TSC (352)
Flounder
TSC (410)
7.6 ⫾ 1.6
6.3 ⫾ 1.1
3 ⫻ 10⫺7
7.2 ⫾ 0.4
5.6 ⫾ 0.6
4 ⫻ 10⫺7
58.2 ⫾ 7.1
22.1 ⫾ 4.2
7 ⫻ 10⫺6
Reference numbers are given in parentheses.
Physiol Rev • VOL
FIG. 5. Kinetics of metolazone inhibition of rat (rTSC) and flounder
(flTSC) thiazide-sensitive Na⫹-Cl⫺ cotransporter expressed in Xenopus
laevis oocytes, as stated. rTSC and flTSC activity is expressed as percent
of control 22Na⫹ uptake (60 min) in the absence of inhibitor.
uretic tested. One example is depicted in Figure 5 that
shows dose-dependent inhibition of rTSC and flTSC expressed in X. laevis oocytes in a simultaneous experiment
in which oocytes injected with each cotransporter cRNA
were exposed to identical uptake mediums containing
different concentrations of the drug. EC50 values are
shown in Table 5. In fact, at 10⫺4 M concentration, certain
thiazides such as trichloromethiazide and chlorthalidone
reduced flTSC activity by only 68 and 46%, respectively
(410), whereas the same concentration of all thiazides
inhibited rTSC by ⬎95% (283). Therefore, in TSC higher
affinity for ions accompanies higher affinity for thiazides.
Two different proposals for order of ion binding to
cotransporter have been advanced for TSC. One was
based on data obtained by Tran et al. (404) who assessed
the cotransporter by measuring [3H]metolazone binding
to membranes extracted from renal cortex, while the
other data were obtained by Monroy et al. (283), based on
functional expression experiments of rTSC expressed in
X. laevis oocytes. Beamount et al. (26) observed that
tracer [3H]metolazone is able to bind to plasma membranes at two different sites: one with high affinity (Kd ⫽
4.27 nM) and the other with low affinity (Kd ⫽ 289 nM).
This latter site was unspecific, whereas the high-affinity
[3H]metolazone binding site was found present only in
renal cortical membrane preparations and was selectively
blocked by thiazides, with an affinity profile similar to
their potency as clinical diuretics. In addition, high-resolution autoradiography of kidney sections with tracer
[3H]metolazone as marker strongly suggested that the
high-affinity binding site was present only in cells from
DCT (27). Thus, before TSC cDNA and protein became
available, assessing the high-affinity site for metolazone in
membrane preparations from renal cortex was the stan-
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
leost, rat, mouse, and human TSC has been achieved in X.
laevis oocytes (72, 136, 137, 221, 283, 352). This expression system has shown to be an excellent tool to obtain
clean and reproducible TSC expression, whereas transfection in mammalian cells has not been successful. The
best results obtained to date using wild-type TSC cDNA
transfected into mammalian cells (MDCK cells) consisted
of a small increase over background not ⬎25% (74). Thus
basically all TSC functional characterization has been
performed using X. laevis oocytes as expression system.
Initial characterization of TSC was obtained after
cloning of the flounder cotransporter, in which observations from Renfro (341) and Stokes et al. (389) were
confirmed, i.e., that Na⫹ and Cl⫺ transport was indeed
interdependent and specifically inhibited by thiazide-type
diuretics, with an affinity profile similar to that previously
shown for inhibition of Cl⫺-dependent Na⫹ absorption in
flounder urinary bladder, assessed as the short-circuit
current (244) and for thiazide competition for high-affinity
[3H]metolazone binding site on rat kidney cortical membranes (26). More recently, functional, pharmacological,
and some regulatory properties of rat TSC (rTSC) (283),
mouse TSC (mTSC) (352), and flounder (flTSC) (410)
were described by assessing 22Na⫹ uptake in X. laevis
oocytes microinjected with cRNA in vitro transcribed
from each of these orthologs. As shown in Table 5, a
number of interesting differences were observed between
fish and mammalian TSC. Analysis of ion transport kinetic
properties revealed that apparent Km values for Na⫹ and
Cl⫺ in mammalian TSC proteins, either rTSC or mTSC,
are significantly lower than Km values observed in the
teleost protein flTSC. Km values of ⬍10 mM for Na⫹ and
Cl⫺ observed in rTSC by Monroy et al. (283) agree with
previous observations by Velázquez et al. (412) that Na⫹
and Cl⫺ in DCT absorption were interdependent, with
one-half maximal concentration of both ions ⬃10 mM;
thus mammalian TSC exhibits significantly higher affinity
for cotransported ions. Interestingly, in mammalian TSC,
affinity for both ions is similar, whereas in teleost TSC,
affinity for extracellular Cl⫺ is higher than affinity for
Na⫹. The polythiazide ⬎ metolazone ⬎ bendroflumethiazide ⬎ trichloromethiazide ⬎ chlorthalidone inhibitory
profile is similar between teleost and mammalian TSC,
but flTSC exhibited lower affinity for every thiazide di-
ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS
Physiol Rev • VOL
tween rat and flounder TSC because in the latter species,
ion concentration has no effect on affinity for thiazide
diuretics (410).
In addition to kinetic and pharmacological differences, mammalian and teleost TSC are differently regulated by cell volume because behavior of rTSC and flTSC
is different in response to changes in extracellular medium osmolarity. rTSC activity is reduced by ⬃40% in
hypotonicity, whereas flTSC activity is reduced in hypertonicity. Thus mammalian TSC is activated by cell shrinkage, while flounder TSC is activated by cell swelling.
Because X. laevis oocytes were used for both experiments, this observation also suggests that a different response to cell volume changes is encoded within the
cargo molecule.
B. Apical Bumetanide-Sensitive
Naⴙ-Kⴙ-2Clⴚ Cotransporter
Apical and renal specific isoforms of the Na⫹-K⫹2Cl cotransporter have been cloned and analyzed at the
functional level from shark (134), rat (136), mouse (187,
290), rabbit (311), and human (384) kidney. Initial cloning
demonstrated in X. laevis oocytes that the 1,095 amino
acid residues isolated from rat outer medulla by Gamba et
al. (136) induced appearance of significant 86Rb⫹ uptake
over background that was Na⫹ and Cl⫺ dependent, bumetanide sensitive, but metolazone and DIDS resistant.
Simultaneously, Payne and Forbush (311) also cloned the
Na⫹-K⫹-2Cl⫺ cotransporter cDNA from a rabbit outer
medulla ␭ZAP cDNA library. No functional expression
was present, but as shown in Table 1, the investigators
were able to isolate what appeared to be three alternatively spliced isoforms, due to the existence of three
mutually exclusive cassette exons denominated A, B, and
F. The same isoforms were later shown as present also in
Na⫹-K⫹-2Cl⫺ cotransporter from mouse (187, 290) and
human (384) kidney. As shown in Figure 6, differences
among A, B, and F isoforms in exon sequence are subtle.
The majority of amino acid residues are identical among
A, B, and F isoforms. There are only three residues not
⫺
FIG. 6. Amino acid sequence of mutually exclusive cassette exons
A, B, and F of mouse apical renal specific Na⫹-K⫹-2Cl⫺ cotransporter.
Red boxes depict amino acid residues that are different in the three
exons. Orange boxes highlight the residues that are unique to isoform A,
blue box the residue that is unique to isoform B, and green boxes the
residues unique to isform F.
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
dard approach to assess putative thiazide receptor, i.e.,
the thiazide-sensitive Na⫹-Cl⫺ cotransporter, and much
information regarding the cotransporter role in several
physiological and pathophysiological processes was obtained following this strategy (25, 28, 53, 54, 117–119). In
one of these studies, Tran et al. (404) analyzed the effect
of extracellular ion concentration on [3H]metolazone
binding to renal cortical membranes and basically observed that in putative thiazide-sensitive transport protein
sodium increases, while chloride decreases the affinity for
metolazone and sodium increases the affinity for chloride.
Based on these data, they proposed that TSC contains two
binding sites: one that is selective for sodium and the one
that can recognize either chloride or metolazone in a
competitive fashion, that is, chloride and metolazone
share the same site on the cotransporter or that binding of
chloride or metolazone to its own site prevents binding of
the other. In this model, occupancy of the sodium site
increases affinity of the second site for chloride and/or
metolazone; similar results were observed using a numerical computerized model to perform kinetic predictions in
TSC (52).
Monroy et al. (283) proposed a different model for
ion and diuretic interactions. This model is based on
analysis of functional properties of rTSC expressed in X.
laevis oocytes. In this model, it was observed that affinity
for Na⫹ or Cl⫺ was changed as a function of counterion
concentration in the uptake medium. For instance, the
apparent Km for extracellular Cl⫺ varied from 6.4 ⫾ 1.7 to
21.2 ⫾ 0.4 mM when extracellular Na⫹ concentration was
40 or 2 mM, respectively. Thus the lower the extracellular
Na⫹ concentration, the lower the Cl⫺ affinity, supporting
predictions advanced by Tran et al. (404) that Na⫹ increases Cl⫺ binding. However, a similar observation was
obtained for affinity of extracellular Na⫹ because Km
values for Na⫹ moved from 7.2 ⫾ 2.4 mM when extracellular Cl⫺ concentration was 40 mM to 41.9 ⫾ 6.9 when Cl⫺
concentration in the uptake medium was 2 mM. These
data suggested that binding of each ion is random but that
it is nevertheless affected by concentration of the counterion. A similar observation was made with regard to
metolazone affinity. When metolazone dose-response effect was performed in low Na⫹ or Cl⫺ concentration, it
was observed that IC50 was shifted to the left, indicating
that the lower the Na⫹ or the Cl⫺ concentration, the
higher the affinity for metolazone, suggesting that both
ions compete with metolazone for binding in the cotransporter. Thus the proposed model included a random order
of binding with both ions affecting affinity for the counterion and competing with thiazide diuretics (283). To
date, data discussed in section IVA, in which some specific
point mutations have been studied in TSC protein, appears to favor the Cl⫺ to metolazone interaction hypothesis. Interestingly, competition between ions and thiazides in TSC generated another functional difference be-
439
440
GERARDO GAMBA
both cTALH and mTALH, with higher expression in the
outer stripe of outer medulla, whereas the B isoform is
present only in cTALH. No B isoform was observed in
mTALH.
Early studies on isolated cTALH segments by Burg
(45) and on mTALH segments by Rocha and Kokko (347)
indicated that NaCl transport rate in mTALH is significantly more rapid than in cTALH, but with greater diluting
power in the later segment (334). These observations
suggested the existence of heterogeneity of transport
properties along TALH. The hypothesis was also supported by the fact that apparent affinity for Cl⫺ observed
by Greger (150), Hus-Citharel and Morel (186), and
Eveloff (115) when cTALH was used as a source of
plasma membrane vesicles, was different from the apparent affinity obtained by Koenig (217) and Burnham (46)
when mTALH was used. Thus it was speculated that
heterogeneity in salt transport along TALH could be due
to axial distribution of the three isoforms, namely, A, B,
and F, of the Na⫹-K⫹-2Cl⫺ cotransporter, exhibiting different ion affinities and transport rate. Plata et al. (324)
and Giménez et al. (144) simultaneously obtained evidence that this is indeed the case in mouse and rabbit
isoforms, respectively. When expressed in X. laevis oocytes, F isoform was shown to be the variant with the
lowest affinity for cotransported ions (Table 6). This is the
isoform that is predominantly expressed in the inner
stripe of outer medulla, where salt concentration is very
high and where greater changes in extracellular osmolarity occur. The A isoform was shown to be the variant with
the highest transport capacity, together with affinity for
cotransported ions that was higher than in the F isoform,
⫹
⫹
⫺
FIG. 7. Localization of the F, A, and B isoforms of apical Na -K -2Cl cotransporter BSC1/NKCC2 along the thick ascending limb of Henle
(TALH). Isoform F in green is mainly expressed in the inner strip of the outer medulla, isoform A is present all along the TALH, and isoform B is
exclusively expressed in the cortical portion of the TALH.
Physiol Rev • VOL
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
conserved among the three isoforms (boxed in red in Fig.
6); in addition, few residues not conserved in one isoform
are identical in the other two, i.e., are unique to one
isoform. These include three residues in A isoform (highlighted in orange boxes), one residue in B isoform (highlighted in blue box), and four residues in F isoform (highlighted in green boxes). Because differences in the sequence of exon 4 are subtle, it was proposed that exon
cassettes could endow the cotransporter with different
ion affinities or even with different ion specificities. In this
regard, Eveloff and Calamia (116) and Sun et al. (393)
previously showed that rabbit and mouse TALH, respectively, exhibited expression of a K⫹-independent, but
nonetheless bumetanide-sensitive Na⫹-Cl⫺ transport
mechanism. However, the first functional characterization of Na⫹-K⫹-2Cl⫺ with each different cassette exon
performed by Plata et al. (325) showed that the three
murine isoforms (A, B, and F) of the SLC12A1 gene
encode the Na⫹-K⫹-2Cl⫺ and not Na⫹-Cl⫺ cotransporter,
suggesting that difference among spliced variants could
be in ion transport or bumetanide-affinity kinetics. This
hypothesis was also supported by intrarenal localization
studies of Payne and Forbush (311), Igarashi et al. (187),
and Yang et al. (447), which demonstrated by Northern
blot analysis, in situ hybridization analysis with specific
probes, and single-nephron RT-PCR, respectively, that
these isoforms exhibited axial distribution along TALH of
rabbit, mouse, and rat kidney, respectively. As shown in
Figure 7, the F isoform was absent in cortical TALH
(cTALH) and present in medullary TALH (mTALH), with
higher levels of expression in the inner than in the outer
stripe of the outer medulla. The A isoform is present in
441
ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS
6. Major functional properties of mutually exclusive cassette exon isoforms A, B, and F of the renal
specific Na⫹-K⫹-2Cl⫺ cotransporter BSC1/NKCC2
TABLE
Sodium, mM
F
A
B
Potassium, mM
Chloride, mM
Mouse*
Rabbit†
Mouse*
Rabbit†
Mouse*
Rabbit†
Bumetanide‡
IC50, ␮M
20.6 ⫾ 7.2
5.0 ⫾ 3.9
3.0 ⫾ 0.6
66.7 ⫾ 5.8
16.4 ⫾ 1.9
20.6 ⫾ 2.4
1.54 ⫾ 0.16
0.96 ⫾ 0.16
0.76 ⫾ 0.07
2.93 ⫾ 4.48
0.78 ⫾ 0.08
0.89 ⫾ 0.17
29.2 ⫾ 2.1
22.2 ⫾ 4.8
11.6 ⫾ 0.7
111 ⫾ 13.4
44.6 ⫾ 3.87
8.95 ⫾ 1.13
3.4
2.0
0.60
Uptake,‡
nmol/oocyte
Response
to Cell
Swelling‡
19.3 ⫾ 1.9
13.2 ⫾ 1.6
12.0 ⫾ 1.5
222
2
22
* Expressed as EC50 (324). † Expressed as Km (144). ‡ Analyzed only in mouse BSC1/NKCC2 (324).
Physiol Rev • VOL
As discussed later and shown in Table 1, a carboxyterminal domain spliced isoform has been identified from
a mouse outer medulla cDNA library (290). This shorter
isoform contains 55 amino acid residues at the end of
carboxy-terminal domain that are not present in the Na⫹K⫹-2Cl⫺ cotransporter. Using rabbit polyclonal antibody
against this 55 unique piece, Mount et al. (290) were able
to demonstrate the existence of this shorter protein in
mouse outer medulla by Western blot analysis. In addition, immunohistochemistry demonstrated that antiBSC1-S antibody exclusively labeled TALH cells apical
membrane. Labeling was heterogeneous because not all
cells were positive, suggesting that some cells do and
others do not express this shorter isoform. Staining decreased in frequency along individual medullary rays toward the cortex. In addition to observed cellular heterogeneity, staining of mTALH with BSC1-S antibody lacked
sharp apical definition, suggesting a significant component of subapical expression.
Functional expression in X. laevis oocytes has suggested two different roles for this shorter BSC1-S isoform:
as a regulatory molecule and as a cotransporter. As a
regulatory molecule, BSC1-S exerts a dominant-negative
effect on the longer Na⫹-K⫹-2Cl⫺ cotransporter isoform
that can be abrogated by cAMP (325). In multiple experiments, Plata et al. (325) observed that BSC1-S reduced
transport activity of the high-expressing BSC1-L isoform.
This effect occurred irrespective of which of the mutually
exclusive cassettes (A, B, and F) were included in coexpressed cRNAs. The possibility of competition for translation in BSC1-S/BSC1-L coinjected oocytes was ruled
out, because coinjections of BSC1-L with unrelated
cRNAs did not significantly reduce uptake. In addition,
cAMP abrogated the inhibitory effect of BSC1-S isoform,
suggesting a specific functional effect. Thus Plata et al.
(325) concluded that the carboxy-terminal truncated isoform of SLC12A1 gene in mouse exerts a dominant-negative function on ion transport by the Na⫹-K⫹-2Cl⫺ cotransporter, a property that is reversed by cAMP. More
recently, using a confocal microcopy strategy, in BSC1-L
and BSC1-S proteins in which EGFP was attached in
frame to the amino-terminal domain, Meade et al. (269)
observed that the mechanism by which BSC1-S reduced
Na⫹-K⫹-2Cl⫺ cotransporter activity is by preventing ar-
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
but lower than in the B isoform. Thus the Na⫹-K⫹-2Cl⫺
variant with high capacity, middle affinity is expressed all
along mTALH and cTALH. Finally, the B isoform was
observed to be the variant with the highest affinity for
three cotransported ions. Therefore, the B isoform only
present in cTALH, in which Na⫹-Cl⫺ concentration of
tubular fluid has been greatly reduced, exhibits the highest affinity for ions. This explains the dilution power of
cTALH. Interestingly, the A and F isoforms, but not the B
variant, are expressed in shark kidney (134), supporting
the proposed relationship between the B exon and the
macula densa, due to the fact that this latter isoform is
expressed in this region of the nephron, which is lacking
in shark kidneys.
As shown in Table 6, in addition to differences in ion
transport kinetics, Plata et al. (324) observed three major
differences among the isoforms. 1) The B isoform is the
one with highest affinity for bumetanide, while the A and
F isoforms were very similar. 2) The A isoform is the
molecular variant with the highest capacity for transport.
Although each time oocytes were injected with similar
amounts of cRNA, combined data from 11 experiments
(Table 6) showed that uptake in oocytes injected with the
A isoform cRNA was significantly higher than uptake
observed in B and F oocytes. However, analysis performed by confocal microscopy in oocytes injected with
cRNA from each isoform in which enhanced green fluorescence protein (EGFP) was attached in-frame to the
amino-terminal domain revealed that surface expression
of the three isoforms was similar. Thus, although similar
amounts of cotransporter isoforms were present in the
plasma membrane, 86Rb⫹ uptake was higher in oocytes
injected with the A isoform, suggesting that this is the
variant with the highest capacity. 3) The F isoform exhibits the highest sensitivity to extracellular osmolarity.
When oocytes injected with each isoform were exposed
to the same hypotonic medium, inhibition of 86Rb⫹ uptake was significantly higher in F than in A or B oocytes.
In this regard, it is known that changes in interstitial
osmolarity occur with greater intensity in inner stripe of
the outer medulla, where the F isoform is mainly expressed. Thus higher sensitivity for changes in cell volume in the F isoform agrees with its proposed localization.
442
GERARDO GAMBA
C. Basolateral Bumetanide-Sensitive
Naⴙ-Kⴙ-2Clⴚ Cotransporter
The Na⫹-K⫹-2Cl⫺ cotransporter basolateral isoform
BSC2/NKCC1 has been identified at the molecular level
Physiol Rev • VOL
from several mammalian sources and from shark rectal
gland (Table 1). However, functional expression analysis
has been performed only from human (314) and shark
orthologs (189, 440). In both cases, characterization was
obtained in HEK-293 cells transfected with corresponding
cDNA. Affinity constants for transported ion and inhibition by bumetanide observed in these studies are shown
in Table 7. It is obvious from the data in Table 7 that
human Na⫹-K⫹-2Cl⫺ cotransporter exhibits significantly
higher affinity for Na⫹, K⫹, and Cl⫺ compared with shark
ortholog. In addition, affinity for bumetanide inhibition is
also higher in mammalian than in shark cotransporter.
This situation is similar to that discussed previously for
rat and flounder TSC, suggesting that electroneutral cation-chloride cotransporters from mammalian sources exhibit higher affinity for ions that do their fish orthologs. As
discussed in detail in section IVA, differences in ion and
bumetanide transport affinity and inhibition, respectively,
between human and shark Na⫹-K⫹-2Cl⫺ cotransporter
have been exploited by Isenring and Forbush (192) to
define major affinity modifier regions within the cotransporter. Two alternative spliced isoforms of mouse BSC2
have been reported by Randall et al. (332), and two different genes encoding basolateral isoforms in eel were
reported by Cutler and Cramb (69); however, functional
consequences are still unknown. In addition to characterization of human and shark cDNA clones mentioned previously, endogenous basolateral Na⫹-K⫹-2Cl⫺ cotransporter has been extensively characterized in situ from
many different cells and tissues. Discussion of this information is beyond the scope of this work and has been
extensively reviewed recently in excellent manuscripts to
which the reader is referred (164, 192, 351).
D. Kⴙ-Clⴚ Cotransporter 1
Before molecular identification of four genes encoding isoforms of the K⫹-Cl⫺ cotransporter, the majority of
functional characterization of this cotransport system
was performed in red blood cells (235, 234). In this sec-
7. Ion transport kinetics and bumetanide
affinity of the ubiquitously expressed Na⫹-K⫹-2Cl⫺
cotransporter isoform BSC2/NKCC1
TABLE
Sodium
Km, mM
hNKCC1
hNKCC1
HEK-293
sNKCC1
sNKCC1
sNKCC1
Rubidium
Km, mM
Chloride
Km, mM
19.6 ⫾ 4.9 2.68 ⫾ 0.72 26.5 ⫾ 1.3
15.2 ⫾ 1.5
1.6–2.5
31 ⫾ 1.0
22
12
110
42
12
110
165 ⫾ 34
14 ⫾ 8.0
101 ⫾ 24
113 ⫾ 11
9.6–11.6
102 ⫾ 7
Bumetanide
Ki, ␮M
Reference
Nos.
0.16
0.044–0.079
0.054
0.54
0.57
0.22–0.30
314
189
440
440
314
189
hNKCC1, human NKCC1; sNKCC1, shark NKCC1.
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
rival of the cotransporter to the plasma membrane; again,
this effect can be prevented by cAMP. Thus it is likely that
in mouse mTALH, activation of the Na⫹-K⫹-2Cl⫺ cotransporter by hormones generating cAMP via their respective
Gs-coupled receptors (v.gr. vasopressin) requires the
presence of the shorter BSC1-S isoform. In this hypothesis, absence of cAMP allows BSC1-S to reduce cotransporter activity, while in the presence of cAMP, the BSC1-S
negative effect upon the longer BSC1-L isoform is inhibited. In this regard, Mount et al. (290) observed that
expression of BSC1-S is axially distributed along the
TALH, because cTALH appears to express many fewer
BSC1-S than mTALH segments. This heterogeneity may
explain the observation that in mouse the vasopressin
effect is present in mTALH but absent in cTALH (170).
The murine shorter isoform BSC1-S also exhibits
activity as a cotransporter. Using X. laevis oocytes as an
expression system, Plata et al. (323) observed that BSC1-S
cRNA encodes a K⫹-independent, but nevertheless loop
diuretic-sensitive, Na⫹-Cl⫺ cotransporter that requires exposure to hypotonicity for activation, by a mechanism
that includes a shift in expression of the cotransporter
protein from cytosol to plasma membrane. In addition, it
was also shown that Na⫹-Cl⫺ transport function of
BSC1-S in hypotonic media is inhibited by addition of
cAMP and further stimulated by blocking PKA activity
with H-89. In this regard, existence of a K⫹-independent,
furosemide-sensitive Na⫹-Cl⫺ cotransporter in rabbit and
mouse mTALH was proposed years before that by Eveloff
and co-workers (11, 116) and Sun et al. (393), respectively. In rabbit mTALH cells exposed to hypotonicity, the
furosemide-sensitive Na⫹-Cl⫺ cotransporter was apparent, whereas when cells were exposed to isotonicity,
furosemide-sensitive Na⫹ uptake became K⫹ dependent,
constituting the Na⫹-K⫹-2Cl⫺ cotransporter mechanism
(116). A few years later, Sun et al. (393) using isolated
perfused mouse mTALH tubules observed that vasopressin (i.e., cAMP) shifts the mode of apical cotransport from
Na⫹-Cl⫺ to Na⫹-K⫹-2Cl⫺. Taken together, these data indicate that in mTALH, when extracellular osmolarity is
low (or cell swelling occurs by other means) and in the
absence of vasopressin (or cAMP), transepithelial salt
reabsorption is mainly due to an apical Na⫹-Cl⫺ cotransporter, encoded by the shorter carboxy-terminal domain
isoform of SLC12A1 gene (323), whereas when extracellular osmolarity is increased and/or in the presence of
vasopressin, the major salt transport pathway is the Na⫹K⫹-2Cl⫺ cotransporter, encoded by BSC1/NKCC2, the long
carboxy-terminal domain isoform of SLC12A1 gene (325).
443
ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS
TABLE
8.
ologous expression system (31, 275, 392). In these cells,
hypotonicity activation of KCC1 activity was more apparent. Su et al. (392) using mouse KCC1 and Mercado et al.
(275) using rabbit KCC1 observed that in X. laevis oocytes
KCC1 is not functional in isotonicity. However, a 20-fold
increase in Cl⫺-dependent 86Rb⫹ uptake was observed
when oocytes were incubated in hypotonicity. As shown
in Figure 8, this behavior of KCC1 is similar to that seen
in KCC3 and KCC4 but different from KCC2. As shown in
Table 8, both studies showed that hypotonicity-induced
activation could be prevented by calyculin A, indicating
that blocking protein phosphatases activity abrogated
KCC1 activation, as previously demonstrated in the K⫹Cl⫺ cotransport pathway of rabbit and human red blood
cells (40, 195, 200, 219, 382). Thus activation of KCC1 by
cell swelling requires dephosphorylation of the cotransporter. To further discriminate between phosphatases in
addition to calyculin A, the effects of okadaic acid at a
concentration of 1 nM, which inhibits only protein phosphatase (PP) 2A, and cypermethrin, which inhibits only
PP2B (37, 111), were tested. Because these two compounds did not affect activation of KCC1 in X. laevis
oocytes (275), it was concluded that PP1 is the phosphatase involved in activation of KCCs during cell swelling.
Apparent affinity for K⫹ and Cl⫺ varied among studies. As shown in Table 8, one study suggested that the Km
value for extracellular K⫹ is ⬎50 mM, while the other
study showed that the apparent K⫹ Km is around 17 mM.
In a third study, Km for Rb⫹ transport of ⬃12 mM was
obtained by Bergeron et al. (31), suggesting that a Km for
K⫹ transport of 17 mM is probably real. The apparent Cl⫺
Km is also ⬃17 mM, suggesting that affinity is similar for
both cotransported ions. One study showed that 86Rb⫹
uptake was possible in the presence of other anions,
Functional properties of K⫹-Cl⫺ cotransporter KCC1 by using heterologous expression systems
Gillen and Forbush
(142)
Holtzman et al.
(180)
Su et al.
(392)
Mercado et al.
(275)
Bergeron et al.
(31)
Expression system
HEK-293 cells
Xenopus laevis oocytes
Xenopus laevis oocytes
Xenopus laevis oocytes
Source of KCC1 cDNA
Rabbit
HEK-293 cells
Pig
Human
Mouse
Rabbit
Rabbit
No
20-fold
⫹
⫹⫹⫹
No
No
Reduction by 25%
17.5 ⫾ 2.3 mM
No
4-fold
Caenorhabditis elegans
Activity in isotonicity
Activation by hypotonicity
Activation by NEM
Inhibition by calyculin
Inhibition by okadaic acid
Inhibition by cypermetrin
Effect of barium
K⫹ affinity (Km)*
Rb⫹ affinity (Km)
NH⫹
4 affinity (Km)
Cl⫺ affinity (Km)*
Bumetanide affinity
Anion series
Yes
2-fold
⫹
Yes
2-fold
⫹
No
20-fold
⫹
⫹⫹⫹
⫹
⬎50 mM
⬎25 mM
59 ⫾ 9 ␮M (Ki)
16.1 ⫾ 4.2
180 ␮M (IC50)
Cl⫺ ⬎ SCN⫺ ⫽ Br⫺ ⬎
PO3⫺
⬎ I⫺ ⬎ gluconate
4
* K⫹ and Cl⫺ Km in Figure 10 were 25.5 ⫾ 3.2 and 38.5 ⫾ 11 mM, respectively.
Physiol Rev • VOL
85 • APRIL 2005 •
www.prv.org
12.4 ⫾ 3.1
22.9 ⫾ 13.5
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
tion, functional data obtained from each isoform by functional expression experiments are reviewed. To date,
functional analysis of all four K⫹-Cl⫺ cotransporter (KCC)
isoforms has revealed significant regulatory, kinetic, and
pharmacological differences among KCC isoforms.
As shown in Table 8, five studies have dealt with
some aspects of the functional properties of KCC1. Functional characterization of KCC1 was initially obtained by
Gillen et al. (142) when KCC1 cDNA was first identified
from rabbit, rat, and human sources. Rabbit isoform
(rbKCC1) was used for functional expression experiments in HEK-293 cells. It was shown that transfection of
HEK-293 cells with rbKCC1 cDNA produced a significant
increase of an 86Rb⫹ efflux mechanism that was activated
by twofold when cells were exposed to hypotonicity.
rbKCC1 activity assessed as Cl⫺-dependent 86Rb⫹ uptake
was stimulated by NEM and inhibited by the presence of
2 mM furosemide, indicating that rbKCC1 indeed encoded
a K⫹-Cl⫺ cotransporter with similar characteristics to
those previously reported in erythrocytes (232, 233). Although ion transport kinetics for Cl⫺ and Rb⫹ dependency of 86Rb⫹ uptake were assessed, Km values were
reported only as ⬎25 mM for Rb⫹ and as ⬎50 mM for
extracellular Cl⫺. In contrast, Ki values for loop-diuretic
inhibition of 86Rb⫹ uptake were more precisely measured
as 59 ⫾ 9 ␮M for bumetanide and 40 ⫾ 4 ␮M for furosemide. Holtzman et al. (180) also used HEK-293 cells to
study certain functional properties of KCC1 cloned from
pig, human, and the nematode Caenorhabditis elegans.
They showed that when transfected into HEK-293 cells all
three KCC1 orthologs behaved as K⫹-Cl⫺ cotransporters
that were twofold activated by hypotonicity.
Functional properties of mouse and rabbit KCC1
have been also analyzed using X. laevis oocytes as heter-
444
GERARDO GAMBA
⫹
⫺
FIG. 8. Functional expression of K -Cl
cotransporter isoforms in Xenopus laevis oocytes microinjected
with 10 –20 ng of in vitro-transcribed cRNA per oocytes.
Uptakes were performed under hypotonic conditions, in
the presence (open bars) or absence (black bars) of
extracellular chloride. 86Rb⫹ uptake in all isoforms was
Cl⫺ dependent and higher than uptake observed in waterinjected oocytes. In contrast, inset shows behavior of the
same batch of oocytes when 86Rb⫹ uptake was performed under isotonic conditions. KCC2 was the sole
cotransporter in which uptake was significantly different
from water-injected oocytes.
than that observed in water-injected oocytes. In addition,
86
Rb⫹ uptake in the presence of NH⫹
4 , but in the absence
of extracellular K⫹ or cold Rb⫹, was similar to that shown
in the presence of cold Rb⫹. Dependence of 86Rb⫹ influx
on extracellular NH⫹
4 concentrations in KCC1 (and also in
KCC3 and KCC4) was best fitted with a one-binding-site
model and exhibited an apparent Km similar to that
shown for extracellular K⫹ (see Table 8). As was first
shown in the red blood cell K⫹-Cl⫺ cotransporter (450),
Bergeron et al. (31) also observed that K⫹-Cl⫺ cotransporter activity is regulated by intracellular pH. They observed that KCC1 and KCC3 exhibited lower activity at
intracellular pH (pHi) ⬍7.0 or ⬎7.5, while in KCC2 lower
activity was observed at pHi ⬍7.5, and KCC4 was less
active at pHi ⬎7.5. These observations point to a role for
the K⫹-Cl⫺ cotransporter in regulation of pHi.
E. Kⴙ-Clⴚ Cotransporter 2
FIG. 9. Changes in intracellular pH after incubation of Xenopus
laevis oocytes injected with cRNA encoding various K⫹-dependent cation-Cl⫺ cotransporters in media containing different concentrations of
NH⫹
4 . Acidification rates were recorded in noninjected oocytes or in
oocytes expressing BSC1/NKCC2, KCC1, KCC3a, or KCC4, as stated. The
recording in each panel is a representative example of a typical experiment from 4 –11 oocytes. [Modified from Bergeron et al. (31).]
Physiol Rev • VOL
There are three reports available concerning functional properties of KCC2. After initial cloning of rat
KCC2, Payne (310) performed a careful analysis of several
functional characteristics of rat KCC2 as expressed in
HEK-293 cells. As shown in Table 9, he observed that
KCC2 was functional in isotonic conditions and that treatment with 1 mM NEM further increased KCC2 activity by
twofold, while cell swelling had no effect on cotransporter activity. Ion transport kinetic analysis revealed that
apparent Km for K⫹ and Cl⫺ were ⬃6 and 101 mM, respectively, indicating that affinity for extracellular K⫹ was
significantly higher than for extracellular Cl⫺. These observations, together with the high level of neuronal-specific expression previously shown for KCC2, allowed the
investigator to propose the hypothesis that KCC2 could be
an important membrane protein to move Cl⫺ out of the
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
specifically isethionate and bromide (275), with the profile shown in Table 8. As shown in Figure 9, an interesting
observation made by Bergeron et al. (31), not only in
KCC1 but also in KCC3 and KCC4, is that K⫹-Cl⫺ cotrans⫹
porters are capable of transporting NH⫹
4 instead K .
⫹
When exposed to increased concentration of NH4 in the
external medium, KCC-injected X. laevis oocytes developed significant intracellular acidification that was higher
445
ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS
TABLE
9.
Functional properties of K⫹-Cl⫺ cotransporter KCC2 by using heterologous expression systems
Payne (310)
HEK-293 cells
Rat
Yes
No
⫹
Song et al. (380)
Xenopus laevis oocytes
Rat
Yes
3.5-fold
⫹
⫹⫹⫹*
Xenopus laevis oocytes
Human
Yes
20-fold
⫹
⫹⫹⫹†
No
No
5.2 ⫾ 0.9 mM
9.3 ⫾ 1.8 mM
6.8 ⫾ 0.9 mM
50 ␮M (IC50)
80 ␮M (IC50)
Cl⫺ ⬎ Br⫺ ⬎ I⫺ ⫽
SCN⫺ ⫽ PO3⫺
⫽
4
gluconate
101 mM
25 ⫾ 3 ␮M (Ki)
55 ⫾ 13 ␮M (Ki)
* Calyculin A inhibition of KCC2 activity was observed in isotonicity and also in hypotonicity. † Calyculin A inhibition of KCC2 activity was
observed only in hypotonicity. ‡ K⫹ and Cl⫺ Km in Figure 10 of this work were 11.7 ⫾ 2.6 and 7.2 ⫾ 0.8 mM, respectively.
cell, regulating intraneuronal Cl⫺ concentration and thus
the type of response to certain neurotransmitters such as
GABA. This major role of KCC2 was later confirmed (250,
346) and will be discussed in section VE. A second proposed possibility, with regard to the high affinity for extracellular K⫹ in KCC2 that is not present in KCC1 (see
Table 8), was that KCC2 could play a fundamental role in
buffering extracellular K⫹ concentration in CNS. Specifically, KCC2 was proposed to be one of the pathways that
participate in reuptake of K⫹ that leaves cells during
neuronal activity. In this scenario, efflux of K⫹ that normally occurs during heavy neuronal activity or during
pathophysiological processes such as ischemia or hypoxia, results in increased concentration of extracellular
K⫹ that in turns activates K⫹ influx by the cotransporter.
In addition to K⫹, it has been shown that similar to KCC1,
KCC3, and KCC4 (31), KCC2 is also capable of transporting NH⫹
4 (246, 432).
Using heterologous expression system in X. laevis
oocytes, Strange et al. (390) studied rat KCC2 cDNA and
Song et al. (380) identified and cloned KCC2 cotransporter cDNA from human sources. Although there is 99%
identity between rat and human KCC2, several interesting
differences in their functional properties were observed,
in particular with respect to those reported by Payne
(310). As shown in Table 9, human or rat KCC2 was
functional when oocytes were incubated in isotonicity but
were further activated by cell swelling by ⬃3.5-fold in rat
(390) and 20-fold in human KCC2 (380); this effect was
not observed by Payne in rat KCC2 expressed in HEK-293
cells (310). Inhibition of PP1 with 1 ␮M calyculin A prevented swelling-induced increase in 86Rb⫹ influx in rat
and human KCC2. Because K⫹-Cl⫺ cotransporters are
known to be activated by cell swelling, the fact that KCC1
and KCC2 are not activated by cell swelling in HEK-293
Physiol Rev • VOL
cells but are remarkably stimulated in X. laevis oocytes
suggests as one possible explanation that HEK-293 cells
do not possess some regulatory pathways required for
such activation. As shown in Figure 8, one interesting
difference between KCC2 with other K⫹-Cl⫺ cotransporters, when X. laevis oocytes were used as expression
system, is that KCC2 exhibited activity when oocytes
were incubated in isotonicity during uptake. All four cotransporters were activated by hypotonicity. This observation suggests the intriguing possibility that amino acid
sequences of KCC2 could contain a motif that endows this
isoform with the ability to be active in isotonic conditions.
In this regard, as previously mentioned, KCC2 contains a
unique sequence of 73 amino acid residues in the carboxyterminal domain that are not present in KCC1, KCC3, or
KCC4.
Apparent Km for Rb⫹ transport that was observed by
Song et al. (380) in 9.3 ⫾ 1.8 mM is consistent with Km
observed for K⫹ influx by Payne (310); however, apparent
Km for Cl⫺ transport is totally different. A Km value of ⬃7
mM was observed by Song et al. under both isotonic and
hypotonic conditions, suggesting that the difference with
regard to the Payne study is probably not due to the cell
volume at which KCC2 was expressed. Because it is
known that electroneutral cotransporters form homodimers (73, 284, 385) and due to the relatively low level
of expression in HEK-293 cells, one potential explanation
for this discrepancy is formation of heterodimers with an
endogenously expressed K⫹-Cl⫺ cotransporter in HEK293 cells, producing mixed kinetics. When X. laevis oocytes were used as an expression system, this possibility
was unlikely to occur because, on one hand, although it is
known that these cells express an endogenous K⫹-Cl⫺
cotransporter (xKCC) (272), activity of exogenously expressed KCC2 protein was 20-fold, suggesting that in-
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
Expression system
Source of KCC1
Activity in isotonicity
Activation by hypotonicity
Activation by NEM
Inhibition by calyculin
Inhibition by okadaic acid
Inhibition by cypermetrin
Effect of barium
K⫹ affinity (Km)‡
Rb⫹ affinity (Km)
Cl⫺ affinity (Km)‡
Furosemide affinity
Bumetanide affinity
Anion series
Strange et al. (390)
446
GERARDO GAMBA
creased uptake was due solely to the exogenous cotransporter. On the other hand, kinetic analysis of xKCC revealed
an apparent Km for Cl⫺ influx of 15.4 ⫾ 4.7 mM (272).
F. Kⴙ-Clⴚ Cotransporter 3
TABLE
10. Functional properties of the K⫹-Cl⫺ cotransporter KCC3 by using heterologous expression systems
Hiki et al. (178)
KCC3b
Expression system
Source of KCC1
Activity in isotonicity
Activation by hypotonicity
Activation by NEM
Inhibition by calyculin
Inhibition by okadaic acid
Inhibition by cypermetrin
K⫹ affinity (Km)*
Rb⫹ affinity (Km)
NH⫹
4 affinity (Km)
Cl⫺ affinity (Km)*
Furosemide affinity
Bumetanide affinity
Anion series
HEK-293 cells
Human
Yes
No
⫹
Race et al. (331)
KCC3a
HEK-293 cells
Human
Yes
⫹
⫹⫹
9.5 ⫾ 1.4 mM
10 ␮M (Ki)
40 ␮M (Ki)
51 ⫾ 9 mM
50 ␮M (IC50)
100 ␮M (IC50)
Bergeron et al. (31)
KCC3a
Mercado et al. (273)
KCC3a
Xenopus laevis oocytes
Human
No
11-fold
Xenopus laevis oocytes
Human
No
20-fold
⫹
⫹⫹⫹
No
No
11.8 ⫾ 0.9 mM
10.7 ⫾ 2.5 mM
17.2 ⫾ 3.0 mM
17.3 ⫾ 2.2 mM
7.6 ⫾ 1.2 mM
180 ␮M (IC50)
Br⫺ ⬎ Cl⫺
* K⫹ and Cl⫺ affinity in KCC3a and KCC3b are similar. K⫹ and Cl⫺ Km for KCC3a in Figure 10 of this work were 14.9 ⫾ 2.6 and 9.4 ⫾ 1.9 mM,
respectively.
Physiol Rev • VOL
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
As discussed in section IIB, KCC3a and KCC3b differ
in length and sequence of amino-terminal domain due to
the existence of two alternative exons 1, denominated 1a
and 1b (315). When expressed in the X. laevis oocyte
system, both isoforms induced the appearance of robust
Cl⫺-dependent 86Rb⫹ uptake mechanism that was present
only when oocytes were incubated in hypotonicity (Fig. 8)
(273). Functional consequences of two different exons 1
have not yet been established.
Initial characterization of KCC3 was performed by
Hiki et al. (178) in KCC3b. As shown in Table 10, similar
to previous observations in KCC1 and KCC2, the investigators showed that when HEK-293 cells were used as the
expression system, KCC3b was functional under isotonic
conditions, slightly activated by NEM, but without further
activation by cell swelling. Race et al. (331) also used
HEK-293 cells to express KCC3a cloned from a human
placenta cDNA library and observed slight activation under hypotonic conditions. They performed ion-transport
kinetic analysis and obtained apparent Km values for extracellular K⫹ and Cl⫺ of 9.5 ⫾ 1.4 and 51 ⫾ 9 mM,
respectively. Affinity for K⫹ was lower than that shown in
KCC1 (Table 8) and similar to KCC2 (Table 9), while
affinity for Cl⫺ was significantly different from previous
values in both KCC1 and KCC2. Real Km values are difficult to define because investigators made it clear on one
hand that kinetics were carried out in cells with a low
level of KCC3 expression because it was impossible to
obtain kinetic analysis in cells pretreated with NEM, and
on the other hand that different numbers were obtained in
each experiment. For instance, they mention that in 12
different experiments Km observed for Cl⫺ varied from 6
to 60 mM with mean of 32 ⫾ 4 mM, suggesting again that
a low level of expression could be producing different
types of heterodimers with an endogenous cotransporter.
As shown in Table 10, using X. laevis oocytes as the
expression system, Mercado et al. (273) observed robust
activity of KCC3a and KCC3b during cell swelling, resulting in apparent Km values for K⫹ and Cl⫺ that were ⬃10
mM, suggesting high affinity for cotransported ions, similar to that shown for KCC2. Another source of variability
is that kinetic analysis was performed by different groups
or by the same group but using different batch of oocytes,
and different solutions. To define differences in kinetic
properties of K⫹-Cl⫺ cotransporter isoforms in my laboratory, we have recently performed ion transport kinetics
analysis of KCC1, KCC2, KCC3a, and KCC4 simultaneously, in the same experiment, using the same batch of
oocytes and solutions. Uptakes were done under hypotonic conditions. Results from this analysis are shown in
Figure 10. K⫹ and Cl⫺ transport kinetics were very similar
among KCC2, KCC3a, and KCC4. Only KCC1 appears to
be different, exhibiting a significantly lower affinity for
both transported ions. Km values for K⫹ transport in
KCC1, KCC2, KCC3a, and KCC4 were 25.5 ⫾ 3.2, 11.7 ⫾
2.76, 14.9 ⫾ 2.68, and 10.2 ⫾ 2.4 mM, respectively,
whereas Km values for Cl⫺ transport in the same order
were 38.5 ⫾ 11, 7.23 ⫾ 0.8, 9.41 ⫾ 1.9, and 5.6 ⫾ 1.1 mM,
respectively. Thus affinity profile for extracellular K⫹ and
Cl⫺ among KCCs is KCC2 ⫽ KCC4 ⫽ KCC3 ⬎ KCC1.
Finally, KCC3 was shown as the only variant in which
86
Rb⫹ uptake is better in the presence of an anion, different from Cl⫺. Uptake in the presence of Br⫺ was slightly
but significantly better than in the presence of Cl⫺.
ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS
447
⫹
⫺
FIG. 10. Apparent Km values for K (A) and Cl (B) in Xenopus
laevis oocytes microinjected with 10 –20 ng/oocytes cRNA in vitro transcribed from rabbit KCC1 (black), human KCC2 (green), human KCC3
(blue), or mouse KCC4 (red). 86Rb⫹ uptake experiments for each ion
kinetic analysis (K⫹ or Cl⫺) were performed for all cotransporters in the
same assay, using oocytes from the same frog, injected the same day and
using the same hypotonic solutions. At the end of the uptake period,
oocytes were dissolved in 10% sodium dodecyl sulfate, and tracer activity was determined for each oocyte by ␤-scintillation counting.
G. Kⴙ-Clⴚ Cotransporter 4
There are only two reports that have addressed functional characteristics of KCC4. Initial characterization by
Mount et al. (292) using X. laevis oocytes demonstrated
that KCC4 cDNA encodes a K⫹-Cl⫺ cotransport mechanism that was not functional when oocytes were incubated under isotonic conditions, but that exhibited a
⬎200-fold activation during cell swelling. Later Mercado
et al. (275) performed a detailed characterization of KCC4
properties. It was shown in this study that similar to other
Physiol Rev • VOL
⫹
⫺
FIG. 11. Kinetics of furosemide inhibition of the different K -Cl
cotransporter isoforms expressed in Xenopus laevis oocytes. cRNA in
vitro transcribed from KCC1 cDNA (shown in black), KCC2 cDNA
(shown in green), KCC3 cDNA (shown in blue), or KCC4 cDNA (shown
in red) was injected at ⬃12.5 ng/oocytes 4 days before the influx assays.
86
Rb⫹ uptake was performed for 60 min in hypotonic solutions containing 20 mM K⫹, 50 mM Cl⫺, and 2 ␮Ci/ml 86Rb⫹. Each KCC activity is
expressed as percent of control 86Rb⫹ uptake in the absence of loop
diuretic.
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
KCCs, activation of KCC4 during cell swelling is also
prevented by calyculin A, but not by okadaic acid and
cypermethrin, suggesting a major role for PP1 in activating the cotransporter. Apparent Km values for extracellular K⫹ and Cl⫺ were 17.5 ⫾ 2.7 and 16.2 ⫾ 4.2 mM,
respectively, although more recent values obtained in my
laboratory (Fig. 10) are somewhat lower. As shown in
Figure 9, Bergeron et al. (31) demonstrated that KCC4 is
⫹
also capable of transporting NH⫹
4 instead K . The Km
⫹
value for Rb uptake in the presence of extracellular Rb⫹
was 12.3 ⫾ 5.5 mM, while the Km value for Rb⫹ uptake in
the presence of NH⫹
4 was 13.5 ⫾ 5.5 mM. These values
revealed an affinity for NH⫹
4 similar to that shown for
extracellular K⫹. Interestingly, Bergeron et al. (31) also
showed that KCC4 is pH regulated. Maximal activity is
reached at extracellular pH ⬍7.0, and the cotransporter
becomes inactive at pH ⬎7.8. This is an important observation given the expression of KCC4 in intercalated cells
of renal collecting duct, suggesting a role for this cotransporter in acid-base metabolism (see sect. VG).
Affinity for furosemide and bumetanide in KCC4 is
the lowest of all isoforms. The IC50 observed by Mercado
et al. (275) for both furosemide or bumetanide was ⬃900
␮M. Figure 11 is composed of dose-response curves for
furosemide observed at my laboratory using X. laevis
oocytes as the expression system for all four K⫹-Cl⫺
cotransporters. Data for each cotransporter were published separately for KCC1 and KCC4 by Mercado et al.
(275), for KCC2 by Song et al. (380), and for KCC3a by
448
GERARDO GAMBA
H. Orphan Members
Two orphan members of the electroneutral cationchloride cotransporter family have been described. Caron
et al. (49) identified an mRNA encoding a protein of 915
amino acid residues that exhibit 25% identity with K⫹-Cl⫺,
Na⫹-K⫹-2Cl⫺, and Na⫹-Cl⫺ cotransporters, but with a
topology that remains K⫹-Cl⫺ cotransporters because the
large extracellular glycosylated loop is located between
transmembrane segments 5 and 6 (Fig. 1). The function of
this protein is not known because its properties as a
cotransporter have not been defined. Microinjections of
X. laevis oocytes with a sufficient amount of good-quality
cRNA resulted in no increase in 22Na⫹, 86Rb⫹, or 36Cl⫺
uptake under several experimental conditions that included the following: 1) preincubation in hypertonic, isotonic and hypotonic medium; 2) changing uptake medium
pH with NaOH or HCl; 3) replacing Rb⫹ with NH⫹
4,
SO42⫺, PO42⫺, and Cl⫺ with gluconate, or Na⫹, Rb⫹,
Ca2⫹, or Mg2⫹ with N-methylglucamine; 4) by increasing
concentrations of either SO42⫺, PO42⫺, Ca2⫹, or Mg2⫹
severalfold; and 5) by adding amino acids at 1 mM. HEK293 cells were also not useful for functional expression of
this protein. Because functional interaction among other
members of the family was shown as possible (325),
interaction of CIP with KCC1, BSC1/NKCC2, and BSC2/
NKCC1 was tested in X. laevis oocytes coinjected with
CIP in addition to one of these cotransporter’s cRNAs.
Results showed that CIP had no effect on BSC1/NKCC2 or
KCC1 activity, but consistently inhibited activity of BSC2/
NKCC1 protein. Coimmunoprecipitation analysis suggested that the functional connection between CIP and
BSC2/NKCC1 is a physical association between the two
proteins.
The last member of the family to be identified is
currently known as CCC9. It is a protein of 714 amino acid
residues that exhibits the most distinct topology (Fig. 1).
Functional expression in X. laevis oocytes under several
Physiol Rev • VOL
experimental conditions has been unsuccessful (289);
thus no functional properties for this membrane protein
are known.
IV. STRUCTURE-FUNCTION RELATIONSHIPS
Interest of researchers in analysis of structure-function relationships in cation-chloride cotransporters began
before molecular identification of each cotransporter. The
first studies were performed by analyzing kinetics of ion
binding with regard to the cotransporter in different cell
types and kinetics of interactions between ions and inhibitors. Later, behavior of tracer 3H-inhibitor binding to
membrane preparations from several cells was used as an
index of cotransporter activity and thus was employed to
propose some structure-function relationships. In these
studies, observation that reduction in Cl⫺ concentration
was associated with an increase in bumetanide affinity
(165), together with the fact that increasing extracellular
Cl⫺ concentration (but not Na⫹ or K⫹) resulted in decrease of [3H]bumetanide binding to membranes isolated
from dog kidney outer medulla (128), suggested that Cl⫺
and bumetanide compete for the same site in the Na⫹-K⫹2Cl⫺ cotransporter. Because a similar observation was
done by Tran et al. (404) between [3H]metolazone and
extracellular Cl⫺ in rat renal cortex-membrane preparations, it was also proposed that in TSC chloride and
metolazone compete for the same site.
Cloning of cotransporter cDNAs increased the possibility to perform structure-function relationship studies,
first by providing a topologic model of each cotransporter
and second, because the possibility of designing chimeras
between cotransporters and point-mutated clones became feasible. As shown in Figure 1 and Table 4, predicted topology is different between cotransporters using
Na⫹ (with or without K⫹) or K⫹ (without Na⫹). Degree of
identity between these two branches is not ⬎25%. In
contrast, within the Na⫹-coupled branch of the family,
i.e., among Na⫹-Cl⫺ and Na⫹-K⫹-2Cl⫺ cotransporters, degree of identity is ⬎50%. Thus differences in cation coupled with chloride (sodium vs. potassium) seems to be
based on a slightly different structure, although several
key functional properties are common among members in
both branches of the family, such as coupling cations with
chloride following an electroneutral fashion, sensitivity to
similar inhibitors, and regulation by changes in cell volume.
A. Naⴙ-Coupled Chloride Cotransporters
As previously discussed, the sole study in which
proposed topology in one member of SLC12 family has
been carefully analyzed was performed by Gerelsaikhan
and Turner (140) in BSC2/NKCC1. It was concluded, as
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
Mercado et al. (273), but I wished to show this in the same
figure to illustrate a clear difference in a functional property among K⫹-Cl⫺ cotransporters. In all cases, uptakes
were performed for 1 h under hypotonic conditions, in the
absence of extracellular Na⫹ and in the presence of 2 ␮Ci
86
Rb⫹. Uptake observed in the absence of loop diuretic
was taken as 100%. As Figure 11 shows, the affinity profile
for furosemide in K⫹-Cl⫺ cotransporter isoforms is
KCC2 ⬎ KCC1 ⫽ KCC3 ⬎ KCC4. It is intriguing that KCC2
and KCC4, which belong to the same subfamily of KCCs
(Fig. 5), exhibit opposite affinity for the diuretics. The
studies mentioned previously have also shown that K⫹Cl⫺ cotransporter can be inhibited by ⬎75% with 100 ␮M
concentration of DIOA and DIDS, and by 20 –30% with
thiazide diuretics at a high concentration (2 mM).
ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS
predicted by the Kyte-Doolittle algorithm, that BSC2/
NKCC1 is composed by 12 membrane-spanning segments
that are flanked by amino- and carboxy-terminal domains
located within the cell. Transmembrane (TM) segments
1– 8 exhibit the classical ⬃20 residue ␣-helices and TMs
9 –10 and 11–12 are ⬃36 residues in length, forming a
hairpin-like structure in the membrane or making up either a nonhelical or a partial-helical structure. With degree of identity in central transmembrane domain of at
least 60% between Na⫹-K⫹-2Cl⫺ and Na⫹-Cl⫺ cotransporters, it is reasonable to suggest that topology in BSC1/
NKCC2 and TSC is similar to that in BSC2/NKCC1.
Evidence has been obtained for Na⫹-K⫹-2Cl⫺ and
Na -Cl⫺ cotransporters that these proteins form homodimers in plasma membrane. Moore-Hoon and Turner
(285) used rat parotid plasma membrane to analyze the
basolateral Na⫹-K⫹-2Cl⫺ cotransporter BSC2/NKCC1 using the reversible chemical cross-linker 3,3⬘-dithiobis-(sulfosuccinimidyl propionate) (DTSSP). They observed that
BSC2/NKCC1 migrates at ⬃335 kDa. After denaturation
with a high concentration of Triton X-100, single monomers of ⬃170 kDa were obtained, in which the investigators were unable to detect the presence of any other
protein. Further evidence of homodimer formation by
BSC2/NKCC1 was provided by quantitative analysis of
molecular sizes of oligomers formed by combinations of
full-length BSC2/NKCC1 and amino-terminal truncated
peptides of BSC2/NKCC1 expressed in HEK-293 cells;
thus authors concluded that BSC2/NKCC1 in plasma
membrane forms homodimers. Similar results were later
observed on apical BSC1/NKCC2 by Starremans et al.
(385) and TSC by De Jong et al. (73). In these studies,
different strategies were used to assess dimeric conformation of cotransporters when X. laevis oocytes were
injected with in vitro-transcribed cRNA from different
FLAG- or HA-tagged wild-type cotransporters and concatamer constructions. Strategies used included chemical
cross-linking experiments that revealed shifts in proteinband sizes from monomeric to multimeric compositions
and coimmunoprecipitation assays in cotransporters previously tagged with FLAG and HA epitopes in the aminoterminal domain. These experiments revealed that FLAGBSC1/NKCC2 and HA-BSC1/NKCC2 (385), as well as
FLAG-TSC and HA-TSC (73), are physically linked. Sucrose gradient centrifugation in both cotransporters demonstrated that high molecular complexes have a molecular weight equivalent to a dimeric configuration. Finally,
concatamer cotransporters were constructed by combining, in tandem, two wild-type monomers or a wild-type
monomer with a mutant monomer containing one of the
naturally occurring mutations in Bartter’s or Gitelman’s
⫹
Physiol Rev • VOL
disease. In both cotransporters, when expressed in oocytes, concatamers containing wild-type monomers in
tandem exhibited significant activity as bumetanide-sensitive Na⫹-K⫹-2Cl⫺ cotransporter (385) or thiazide-sensitive Na⫹-Cl⫺ cotransporter (73). A concatamer was constructed with a wild-type BSC1/NKCC2 monomer and a
mutant monomer containing the Bartter type I mutation
G319R. This mutation was selected because it was previously shown by the same group (384) that it affects Na⫹K⫹-2Cl⫺ cotransporter activity, without reducing its insertion into plasma membrane. Results showed that concatamer protein was present in plasma membrane, but
that activity was reduced by 50% when compared with
double wild-type concatamer. Using a similar strategy,
concatamers containing two wild-type TSC monomer or
one wild-type monomers and a mutant G741R Gitelmantype monomer were constructed. The mutation selected
was previously shown to produce a TSC protein not processed in oocytes, and thus mutant protein does not reach
the plasma membrane (72). Functional expression experiments revealed that concatamer constructed with two
wild-type monomers was functional, while concatamer
containing a wild-type monomer and a mutant monomer
was not active, because the protein did not reach the
plasma membrane. Therefore, it was suggested that BSC1/
NKCC2 and TSC function as homodimers in which both
monomers interact with each other, because mutation in
one monomer affected the function of both. It is possible,
in addition, that members of the SLC12 family can build
heterocomplexes among different members of the family.
For instance, CIP does not appear to transport ions itself,
but does appear to inhibit transport activity of BSC2/
NKCC1 without any effect on BSC1/NKCC2 or KCC1,
raising the possibility that CIP may form a heterocomplex
specifically with BSC2/NKCC1 (49).
2. Affinity modifier domains or residues in the
Na⫹-K⫹-2Cl⫺ cotransporter
The most extensive attempt to begin to understand
structure-function relationship issues within the branch
of Na⫹-coupled chloride cotransporters has been conducted by Isenring and Forbush (for review, see Ref. 192)
in BSC2/NKCC1. These authors took advantage of kinetic
differences in apparent affinity for ions and for bumetanide between shark and human BSC2/NKCC1 orthologs
that exhibit 74% degree of identity. They first observed
during their cloning effort of the human cotransporter
(314) a higher affinity for ions and bumetanide inhibition
in human BSC2/NKCC1, which is approximately sixfold
higher than in shark ortholog. Subsequently, by means of
single-point mutagenesis strategy to create a series of
silent restriction sites along cDNA of both cotransporters,
six chimera proteins between human and shark BSC2/
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
1. The Na⫹-coupled chloride cotransporter
forms homodimers
449
450
GERARDO GAMBA
were switched between human and shark BSC2/NKCC1
(191). Functional analysis in HEK-293 cells demonstrated
significant changes in affinity for Na⫹ and K⫹ in these
chimeras, with no change in Cl⫺ affinity, suggesting that
sequences within second TM segments affect transport
affinity for cations, but not for Cl⫺. Furthermore, specific
mutagenesis in pairs of residues in second transmembrane domain revealed that two residues are involved in
defining Na⫹ affinity, and another pair in K⫹ affinity.
Although no changes in Cl⫺-transport affinity were
observed, a clear change in bumetanide affinity occurred.
Chimera with shark TM2 segment transplanted into human cotransporter exhibited bumetanide-affinity constant
similar to that of the shark Na⫹-K⫹-2Cl⫺ cotransporter
(0.76 vs. 1.04 ␮M, respectively), while chimera with human TM2 segment switched into shark cotransporter exhibited similar constant to human cotransporter (0.34 vs.
0.28 ␮M), suggesting that bumetanide affinity follows the
second TM segment. Previous studies in which binding
kinetics of tracer [3H]bumetanide to dog kidney outer
medulla membrane preparation were assessed (128) and
careful kinetic analysis of bumetanide and chloride interaction in duck red blood cells were determined (165)
strongly suggested that bumetanide binds at one of the
chloride sites of the cotransporter. Thus this observation
was surprising because it was shown that TM2 chimeras
exhibited no change in chloride-transport kinetics, together with an important switch in bumetanide affinity,
⫹
FIG. 12. Apparent Km values for Na ,
Rb⫹, and Cl⫺ expressed in mM and Ki, as
stated. Ion transport and bumetanide inhibitory kinetic analyses were performed
in HEK-293 cells transfected with wildtype human or shark BSC2/NKCC1 cDNA
(HHH and SSS, respectively) or with each
of the chimeric proteins depicted in each
graph. Black bars represent clones in
which central transmembrane domain belongs to human cotransporter, whereas
open bars represent clones in which this
domain belongs to shark cotransporter. All
clones are named with three letters. H,
human; S, shark. The first letter indicates
to whom the amino-terminal domain belongs (human or shark), the second letter
indicates origin of central transmembrane
domain, and the third letter indicates the
origin of carboxy-terminal domain. For instance, the clone SHS is a chimera with
central transmembrane domain from human BSC2/NKCC1 and both amino- and
carboxy-terminal domains from shark.
[Modified from Isenring and Forbush
(189).]
Physiol Rev • VOL
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
NKCC1 were constructed in which amino-terminal, carboxy-terminal, or both domains were switched, one for
the other (189). HEK-293 cells were transfected with corresponding cDNAs for functional characterization. Thus
chimeras in which central hydrophobic transmembrane
domain of human BSC1/NKCC2 was flanked by aminoterminal domain, carboxy-terminal domain, or both from
shark ortholog, and vice versa, were analyzed. As shown
in Figure 12, human and shark BSC2/NKCC1 exhibit significant differences in apparent Km for Na⫹, K⫹, and Cl⫺
transport, as well as Ki for bumetanide inhibition, indicating that affinity for ions and bumetanide is higher in
human cotransporter. As shown also in Figure 12, behavior of ion-transport and bumetanide-inhibition kinetics in
all chimeric clones were determined by the source of
central transmembrane domain, regardless of the source
of both amino- and carboxy-terminal domains. These observations demonstrated the importance of central hydrophobic domain in defining affinity for cotransported ions
and for inhibition by bumetanide.
In their next study, knowing that TM1 and TM3 are
identical between shark and human BSC2/NKCC1, while
TM2 is different, the investigators’ chimera construction
approach was extended to include the first three TMs,
assuming that differences observed in functional properties would be due to diverging sequences within TM2.
Consequently, two chimeras were constructed in which
amino-terminal domain and the first three TM segments
ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS
FIG. 13. Schematic representation of the proposed contribution of
each transmembrane segment of BSC2/NKCC1 to fractional changes in
apparent affinity for Na⫹, K⫹, and Cl⫺ in chimeric proteins from human
and shark BSC2/NKCC1. [Modified from Isenring and Forbush (192)].
Physiol Rev • VOL
Functional analysis of three spliced isoforms of apical BSC1/NKCC2 also revealed a role of TM2 in iontransport kinetics (144, 324). As discussed in previous
sections (see Figs. 3, 6, and 7), existence of three mutually
exclusive cassette exons in SLC12A1 gene produce three
cotransporter proteins that differ in key residues within
TM2 and in the interconnecting segment between TM2
and TM3. As shown in Table 6, functional expression of
the three isoforms in X. laevis oocytes demonstrated
significant differences in ion-transport and bumetanide
affinities. Higher and lower affinities were observed in
isoforms B and F, respectively. Thus, in apical Na⫹-K⫹2Cl⫺ cotransporter isoforms, differences in sequences
within TM2 and in the interconnecting segment between
TM2 and TM3 are accompanied by changes in affinity for
cotransporter ions, suggesting that TM2 is not only implicated in cation affinity, but also in defining Cl⫺ affinity. In
this regard, Gagnon et al. (134) identified that BSC1/
NKCC2 isoforms A and F are present in shark kidney. The
investigators first observed that isoforms A and F were
functional when expressed in X. laevis oocytes. Then,
kinetic analysis revealed that A isoform exhibited significantly lower Km values for Na⫹, K⫹, and Cl⫺ than the F
isoform, indicating that the former is the high-affinity
variant (133). These observations confirmed that exon 4
affects ion-transport affinity for Na⫹, K⫹, and Cl⫺. In this
study, two chimera proteins between A and F isoforms
were produced by switching cotransporters at the middle
of the exon 4 sequence, and thus to be able to switch only
the region of exon 4 that is part of TM2 or only the region
that is part of the interconnecting segment between TM2
and TM3. Thus chimera A/F contained TM2 sequence of
variant A followed by interconnecting sequence of variant
F, and vice versa, occurred with chimera F/A. When kinetic analysis of these two chimeric proteins was compared with isoforms A and F, it was shown that affinity for
cations (Na⫹ and K⫹) in chimeras A/F and F/A were
similar to A, suggesting that residues on both sides of
exon 4 were important to define higher and lower cation
affinity of isoforms A and F, respectively. Behavior in Cl⫺
affinity was different. Apparent Km value for extracellular
Cl⫺ was similar between variant A (⬃6.9 mM) and chimera F/A (⬃8.6 mM) and between F variant (⬃69.1 mM)
and chimera A/F (⬃70 mM). These observations suggest
that the majority of differences in Cl⫺-transport affinity
between isoforms A and F were conveyed by variant
residues of the interconnecting segment between TM2
and TM3. Thus sequences not located within a TM segment affect affinity for chloride. Although it is expected
that amino acid residues conforming translocation pockets in the cotransporter will be located within TM domains, these observations suggest that amino acids outside membrane-domain helices can also behave as affinity-modifier residues. Interestingly, chimera behavior in
terms of bumetanide affinity was completely the opposite.
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
suggesting that chloride- and bumetanide-binding sites
are different.
Further construction of chimera clones between
shark and human BSC2/NKCC1 demonstrated that
switching TM 8 –12 does not confer a difference in ion
affinities between human and shark cotransporters (190).
A chimera in which only TM7 was changed resulted in a
cotransporter showing Km for Na⫹, K⫹, and Cl⫺ with
values that were intermediate between human and shark.
Then, chimeras and point mutations in TM4 and TM5
demonstrated that some residues in TM4 affect Km values
for K⫹ and Cl⫺ but not for Na⫹. As shown in Figure 13,
with all these results in which similarities and differences
in structure and functional properties conferred by each
TM segment were taken together (189 –191), it was proposed that three TM segments play an important role in
defining ion-transport kinetics in BSC2/NKCC1. Accordingly, TM2 is involved in Na⫹ and Rb⫹ kinetics, TM4 in
Rb⫹ and Cl⫺ kinetics, and TM7 in Na⫹, Rb⫹, and Cl⫺
kinetics. Interestingly, as mentioned previously, behavior
of several chimeric proteins in terms of bumetanide inhibition was completely different from behavior observed
in ion-transport kinetics. Evidence was obtained that even
TM 2– 6 and 10 –12 play a role in defining affinity for loop
diuretics. Because several chimeras in which the same
TM segments were switched from human to shark and
vice versa did not exhibit mirror image behavior, authors
were not able to develop models to explain their results,
and it was proposed that bumetanide binding probably
requires conformational interaction between TM and extracellular domains.
451
452
GERARDO GAMBA
Physiol Rev • VOL
FIG. 14. Functional properties of TBT chimera (A) in which central
hydrophobic domain belongs to BSC1/NKCC2 (in red) while both aminoand carboxy-terminal domains belong to TSC (in blue). Black region
represents the sequence encoded by BSC1/NKCC2 exon 4 that generates
alternative splicing isoforms A, B, and F. The injection of TBT cRNA into
Xenopus laevis oocytes (B) induced the appearance of an 86Rb⫹ uptake
mechanism that is evident in the presence of Na⫹, K⫹, and Cl⫺ (open
bars). Increased uptake is reduced in the absence of extracellular Cl⫺
(black bar), or in the presence of 10⫺4 M bumetanide (red bar), but is not
affected by 10⫺4 M metolazone (blue bar). [Modified from Tovar-Palacio
et al. (403).]
3. Cysteine scanning mutagenesis
in Na⫹-K⫹-2Cl⫺ cotransporter
In an attempt to analyze functional roles of certain
selected residues in BSC2/NKCC1, Dehaye et al. (76) used
the substituted cysteine accessibility method in which potential residues in BSC2/NKCC1 are replaced by cysteines
and then the effect of cysteine-specific reagents, such as
2-aminoethylmethanethiosulfonate (MTSEA) or 2-(trimethylammonium) ethyl methanethiosulfonate (MTSET),
on functional properties of the cotransporter was assessed. If certain residues play a role in defining functional properties, it is expected that cysteine substituting
for a particular residue will interact with MTSEA or
MTSET, resulting in a change of that particular property
for which the residue under study is responsible, whereas
if the cysteine substitute is a noncritical residue, interaction with MTSEA or MTSET will have no functional consequence. In this study, Dehaye et al. (76) mutated several
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
Bumetanide-affinity constant was similar in variant A
(0.30 ␮M) and chimera A/F (0.39 ␮M) and between variant
F (0.8 ␮M) and chimera F/A (1.4 ␮M), suggesting that
residues located within TM2 and not within the TM2-TM3
interconnecting segment play a role in defining bumetanide affinity. This observation is also against the possibility that bumetanide and chloride compete for the same
site in the cotransporter.
Because these structure-function studies in Na⫹-K⫹⫺
2Cl cotransporter were performed using spliced isoforms of BSC1/NKCC2 (133, 144, 324) or chimeras between orthologs of BSC2/NKCC1 (192), all constructs
were anticipated to perform as Na⫹-K⫹-2Cl⫺ cotransporters. Therefore, although valuable information was obtained regarding structural requirements to define kinetic
properties in both isoforms, it is possible that no information was obtained concerning structural requirements
to define specificity for ions or diuretics. It has been
shown, for instance, in glucose transporters that domains
defining kinetic properties are not necessarily the same as
those defining transport-process specificity or binding of
a particular inhibitor (15, 299). In this regard, as shown in
section IIIB, a carboxy-terminal domain of SLC12A1 in
mouse behaves as a K⫹-independent but loop diureticsensitive, thiazide-resistant Na⫹-Cl⫺ cotransporter (323),
suggesting that carboxy-terminal domain could be important to endow BSC1/NKCC2 with K⫹ transport ability. For
this reason, Tovar-Palacio et al. (403) have recently taken
advantage of homology between TSC and BSC1/NKCC2 to
design chimeric proteins in which both amino- and carboxy-terminal domains were switched between cotransporters. Interestingly, the majority of chimeras were functional. Figure 14 shows the chimera TBT in which the
central hydrophobic domain of the Na⫹-K⫹-2Cl⫺ cotransporter BSC1/NKCC2 is flanked by amino- and carboxyterminal domains of the Na⫹-Cl⫺ cotransporter TSC. The
graph below shows that 86Rb⫹ uptake was Cl⫺ dependent,
and bumetanide sensitive but metolazone resistant. This
is a behavior identical to BSC1/NKCC2, indicating that
residues that endow BSC1/NKCC2 with these functional
properties are located within the central hydrophobic
domain. Although overall identity between rat BSC1/
NKCC2 and TSC is 52% (136), degree of identity varies
along the central hydrophobic domain in such a way that
⬎85% is present in 6 of 12 transmembrane helices (1, 2, 3,
6, 8, and 10), 55–75% in two helices (4 and 9) as well as in
interconnecting segments facing intracellular side, and
⬍50% in four transmembrane domains (5, 7, 11, and 12)
and interconnecting segments facing the extracellular
side of the cotransporters, pointing out to these divergent
sequences within the central TM as the more likely regions of the cotransporters to contain the specificitydefining residues for both ion transport and diuretic sensitivity.
ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS
4. Regulatory motifs in BSC2/NKCC1
amino-terminal domain
It is well known that activity of the Na⫹-K⫹-2Cl⫺
cotransporter is tightly regulated because activity of this
cotransporter should be coordinated with chloride-extrusion mechanisms. On one hand, in its basolateral version
BSC2/NKCC1 represents an important pathway to provide
cells with chloride ions that will be secreted in the apical
membrane, mainly through a cystic fibrosis transmembrane conductance regulator (CFTR)-related mechanism.
On the other hand, in TALH cells chloride ions reabsorbed
through the apical version of the cotransporter BSC1/
NKCC2 are transported out of the cell into renal interstitium by chloride channels known as CLC-KB. The basolateral isoform may remain inactive until stimuli such as
cell shrinkage or secretagogues acting by means of Gscoupled receptors activate the cotransporter by a process
that requires phosphorylation. In contrast, the apical isoform is usually active, but activity level is under tight
control by hormones acting also through Gs-coupled receptors, such as vasopressin, parathyroid hormone, and
isoproterenol.
It has been firmly established that Na⫹-K⫹-2Cl⫺ cotransporter regulation is associated with phosphorylation/dephosphorylation of the cotransporter protein.
When BSC2/NKCC1 is activated by several different stimuli, the protein becomes phosphorylated, while inhibition
of the cotransporter function is associated with dephosphorylation. In addition, cell treatment with the protein
phosphatase 1 inhibitor calyculin A prevents cotransporter dephosphorylation, hence increasing its activity.
Although BSC2/NKCC1 is activated when cells are exposed to hormones acting through Gs-coupled receptor
producing cAMP (e.g., isoproterenol), the cotransporter
does not appear to be phosphorylated by a PKA-dependent mechanism (222, 223). Several lines of evidence
strongly suggest that intracellular chloride concentration
Physiol Rev • VOL
is the common pathway to regulate the cotransporter.
When intracellular chloride concentration falls, the cotransporter becomes phosphorylated; in contrast, when
chloride concentration rises, the cotransporter is dephosphorylated and therefore inhibited. For instance, it has
been postulated that increase of intracellular cAMP levels
is responsible for increasing chloride extraction in apical
membrane by activating CFTR, a well-known PKA substrate, and that consequential decrease in intracellular
chloride due to improved secretion is what triggers activation of BSC2/NKCC1 (255). A similar situation was
proposed several years ago by Greger and Schlatter (155)
regarding the mechanisms by which vasopressin activates
salt reabsorption in TALH. A critical review of studies
regarding regulation of Na⫹-K⫹-2Cl⫺ cotransporter function by shrinkage or intracellular chloride is beyond the
scope of this work. Interested readers are referred to
several excellent reviews published specifically in this
subject in recent years (124, 164, 351). What I want to
present here is recent information regarding structurefunction studies revealing that at least part of the regulatory phosphorylation/dephosphorylation of BSC2/NKCC1
occurs in threonine residues located within amino-terminal domain, together with protein motifs known to be
associated with binding of kinases or phosphatases, indicating that this domain plays an important role in defining
regulatory properties of the cotransporter.
The first study that presented evidence suggesting
that activation of BSC2/NKCC1 cotransporter was associated with phosphorylation of a threonine residue was
reported by Lytle and Forbush (254), who used suspensions of shark rectal gland tubules in which they demonstrated that maneuvers such as addition of cAMP or cell
shrinking were associated with activation of the cotransporter, assessed as an increment of [3H]benzmetanide
binding. Then, by immunoprecipitation with specific
monoclonal antibodies against BSC2/NKCC1, they were
able to show that activation was associated with cotransporter phosphorylation. Extensive protein digestion together with two-dimensional, thin-layer electrophoresis
on cellulose plates allowed them to show that the phosphorylation pattern was similar among different stimuli,
and to isolate the peptide FGHNTIDAVP that became
phosphorylated in the threonine residue. A few years
later, when shark BSC2/NKCC1 cDNA was identified at
the molecular level (440), it was shown that this peptide
corresponds to amino acid residues 184 –194 that are
located within the amino-terminal domain. Supporting
this observation, Kurihara et al. (222) demonstrated that
BSC2/NKCC1 from rat parotid gland is phosphorylated in
the amino-terminal domain when activated by isoproterenol. Because it is known that no putative PKA phosphorylation sites are present in BSC2/NKCC1 amino-terminal
domain, the same group in a follow-up study (223) observed that although PKA is involved in isoproterenol
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
residues to cysteine (S311, Val-312, Ala-316, Ala-405, Ala528, and Ser-530) that were previously suggested, mainly
by the Isenring and Forbush studies discussed previously,
to be at or near binding sites for sodium, potassium, or
chloride on BSC2/NKCC1. None of these mutations, however, rendered BSC2/NKCC1 sensitive to cysteine specific
reagents, suggesting that mutated residues could be inaccessible to sulfhydryl reagents. It was observed, however,
that mutating the amino acid A483 to cysteine, a residue
located in TM6, rendered the cotransporter sensitive to
MTSEA or MTSET, indicating that A483 plays an important functional role. Further functional analysis revealed
that A483C substitution had no effect on ion-transport
affinity but resulted in a remarkable sixfold increase in
bumetanide affinity, suggesting that TM6 is associated
with bumetanide binding.
453
454
GERARDO GAMBA
Physiol Rev • VOL
because mutant T184A becomes activated only when exposed in preincubation to the lowest chloride-containing
media. Finally, threonine-202 was also shown as required
for activation of BSC2/NKCC1 by low intracellular chloride, but the difference with wild type was less pronounced. In addition, the same group performed studies
in vivo using a specific antiphospho-BSC2/NKCC1 antibody denominated R5, which was raised against a synthetic peptide of amino-terminal domain containing threonine-212 and -217 of human BSC2/NKCC1 (corresponding to threonine-184 and -189 of shark BSC2/NKCC1).
Results demonstrated that phosphorylation correlates
with functional activation of the cotransporter by isoproterenol in rat parotid gland and respiratory epithelium
(126). Finally, supporting the conclusion that threonine
residues in the amino-terminal domain play a key role in
regulation of BSC2/NKCC1 activity by several different
effectors (cell shrinkage, intracellular chloride, isoproterenol, forskolin), Darman et al. (70) showed that BSC2/
NKCC1 contains a PP1-binding site in the amino-terminal
domain near the phosphorylation sites. It is known that to
perform its specific action on particular serine or threonine residues, PP1 must bind to a motif that should be
adjacent to the residues that will be dephosphorylated,
thus preventing indiscriminate effects of PP1 in several
phosphoproteins (60). The binding motif for PP1 catalytic
subunit is known as RVxF, although highly conserved
variations of the consensus are also functional, allowing a
more broad motif to be (R/K)(V/I)xF. Darman et al. (70)
observed that the amino-terminal domain of human BSC2/
NKCC1 contains the sequence RVNFVD and demonstrated that mutagenesis designed to eliminate the motif
resulted in cotransporters that exhibited higher activity
than wild-type control at any chloride concentration in
preincubation media. Furthermore, improving the binding
capacity of the motif by adding acidic residues to obtain
KRVRFED resulted in a BSC2/NKCC1 protein nearly impossible to activate at any chloride concentration. These
observations are consistent with higher levels of phosphorylation in mutant BSC2/NKCC1; in other words, elimination of the PP1c motif seems to decrease the ability of
PP1 to dephosphorylate the cotransporter. Finally, it was
also shown that BSC2/NKCC1 is specifically coprecipitated with PP1c, suggesting that interaction between cotransporter and PP1 takes place.
Another regulatory motif recently shown as present
in BSC2/NKCC1, as well as in other members of the cation
chloride cotransporter family, is a motif that serves as a
recognition site for two regulatory proteins known as
Ste20-related proline-alanine-rich kinase (SPAK) and oxidative stress response 1 (OSR1). These are closely related
serine/threonine kinases exhibiting amino acid identity of
67%. SPAK was originally cloned from rat brain (SPAK)
and is located in human chromosome 2q31.1 (407).
SPAK’s physiological role or substrate has not been elu-
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
activation of BSC2/NKCC1, another unknown factor located beyond PKA activation must be present. This other
factor can be another kinase cascade that phosphorylates
the cotransporter in a threonine residue that is not part of
a PKA-putative site. In this regard, it has been demonstrated in avian erythrocyte Na⫹-K⫹-2Cl⫺ cotransporter
that all tested activators of BSC2/NKCC1 resulted in cotransporter phosphorylation with a similar pattern in
phosphoamino acid analysis (252), suggesting use of a
common final pathway to activate the cotransporter. In
this study, however, phosphorylation was observed to
occur in both amino- and carboxy-terminal domains because phosphorylated cotransporter was immunoprecipitated with monoclonal antibodies and chemically fragmented with N-chlorosuccinimide to produce two major
32
P-labeled fragments of 82 and 41 kDa, respectively, from
which the smaller one was recognized with specific monoclonal antibody raised against the BSC2/NKCC1 carboxyterminal domain, suggesting that serines or threonines in
the carboxy-terminal domain also become phosphorylated during cotransporter activation.
Careful phosphopeptide analysis and phosphorylation stoichiometry measurements performed by Darman
and Forbush (71) in shark rectal gland BSC2/NKCC1 after
maximal stimulation with a combination of calyculin A, to
prevent PP1 activity and hence dephosphorylation, and
forskolin, to stimulate Gs-coupled receptor mechanisms,
demonstrated that an average of 3.0 ⫾ 0.4 phosphates/mol
of cotransporter was incorporated, suggesting that at
least three sites on the cotransporter are phosphorylated
after exposure to these agents. Exhaustive trypsin digestion and separation of peptides by HPLC followed by
matrix-assisted, laser desorption ionized mass spectrometry were used to identify three phosphoacceptor amino
acid sites within the cotransporter amino-terminal domain. These residues were all threonines located at amino
acid numbers 184, 189, and 202. Functional significance of
these sites was tested by eliminating each one by means
of point mutations. Mutant clones were expressed in
HEK-293 cells. This analysis revealed that the most important site is threonine-189 because substitution of this
residue with alanine resulted in complete inhibition of
cotransporter, suggesting that phosphorylation of this residue is required to achieve constitutive activity. Interestingly, it was observed that BSC2/NKCC1 activity in HEK293 cells transfected with the mutant T189A was lower
than in nontransfected cells, suggesting that nonactive
T189A cotransporter applies a dominant negative effect
on the endogenous cotransporter, similar to what has
been shown to occur with nonactive variants in BSC1/
NKCC2 (325), KCC1 (50), and CIP (49). Elimination of
threonine-184 or -202 resulted in normally active cotransporters. However, in-depth analysis revealed that threonine-184 is a residue required to achieve a response to
intracellular chloride similar to that observed in wild type,
ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS
FIG. 16. Proposed model of amino-terminal domain and the first
two transmembrane segments of BSC2/NKCC1 based on human sequence. Each circle represents an amino acid residue, and all red circles
depict residues identical between human and shark BSC2/NKCC1.
Shown in blue are the three threonines suggested as phosphorylation
sites, in black a single PP1-binding motif, and in green two SPAK-binding
motifs. All proposed motifs are located in highly conserved areas.
Although investigators were unable to show that SPAK
cotransfection clearly increases the sensitivity of BSC2/
NKCC1 to changes in intracellular chloride, it was demonstrated that DNSPAK drastically inhibits activation of
shark or human BSC2/NKCC1 by exposing cells to hypertonicity or lowering intracellular chloride. With the use of
previously mentioned R5 antibody, directed against a peptide containing threonines 184 and 189, it was observed
that DNSPAK cotransfection resulted in a significant decrease of BSC2/NKCC1 phosphorylation when intracellular chloride was lowered. Because the inhibitory effect of
FIG. 15. Conservation of phenylalanine and valine in the amino-terminal domain of several members of the cation
chloride cotransporters family, in which
the first five (in blue and picture at right)
physically interact with SPAK. In contrast, KCC1 and KCC4 (in red and picture
at right) do not interact with SPAK. Note
the presence of the motif (R/K)FX(V/I) in
the first five members, not present in
KCC1 and KCC4. [Modified from Piechotta et al. (322)].
Physiol Rev • VOL
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
cidated, but its expression has been localized to neurons
and to transport epithelial cells that are rich in Na⫹-K⫹ATPase. OSR1 was identified by means of large-scale DNA
sequencing of a genomic region on chromosome 3p22p21.3 (399). Association between SPAK and members of
the electroneutral cation chloride cotransporter family
was evidenced by Piechotta et al. (322) following a yeast
two-hybrid screen designed to search for proteins that
interact with K⫹-Cl⫺ cotransporter isoform KCC3a. Using
the same system, they showed that SPAK and OSR1 were
able to interact with other members of the family including KCC3b, BSC1/NKCC2, and BSC2/NKCC1, but not with
KCC1 or KCC4, despite high conservation on the minimal
requirement for SPAK binding domain determined in
KCC3a (see Fig. 15). KCC2 and TSC were not included in
the analysis because these cotransporters lack the minimal SPAK-binding motif (R/K)FX(V/I). This motif was
shown to be present at the amino-terminal domain: once
in KCC3a, KCC3b, and BSC1/NKCC2 and twice in BSC2/
NKCC1. In this last cotransporter, the motif RFQVDPESV
is located 76 residues downstream of the first methionine,
and a second motif RFRVNFDPA is located 48 amino acid
residues after the first and overlaps with the PP1 motif
discussed previously (RVxF) (Fig. 16). Piechotta et al.
(321) raised a polyclonal antibody against SPAK that together with anti-BSC2/NKCC1 antibodies were used to
demonstrate that both proteins can be coimmunoprecipitated from brain tissue, indicating its physical interaction.
Finally, immunohistochemical studies of choroid plexus
and salivary gland revealed that both BSC2/NKCC1 and
SPAK were coexpressed in the apical membrane of choroid plexus and basolateral membrane of salivary gland,
suggesting their functional association. Furthermore, in
the choroid plexus of BSC2/NKCC1 knockout mice, the
SPAK signal was found solely in the cytoplasm.
Conflicting results have been obtained recently by
two groups regarding the functional significance and molecular mechanisms by which SPAK regulates the BSC2/
NKCC1 cotransporter. Dowd and Forbush (92) studied
regulation of BSC2/NKCC1 by SPAK in HEK-293 cells
transfected with human or shark BSC2/NKCC1 alone, or
together with either SPAK or a dominant-negative SPAK
mutant K101R (DNSPAK) known to lack kinase activity.
455
456
GERARDO GAMBA
5. The thiazide-sensitive Na⫹-Cl⫺ cotransporter
The thiazide-sensitive Na⫹-Cl⫺ cotransporter TSC
has also been subjected to studies designed to reveal
some aspects of structure-function relationship in this
cotransporter. These studies, however, have been based
on guided/point mutations to show the role of specific
amino acid residues, rather than on working with big
fragments of cotransporters to expose functional roles of
a particular domain. Some of these studies were carried
out by searching for functional effects of certain amino
acid residues found to be mutated in patients with Gitelman’s disease (72, 221, 352). Information from these studies with Gitelman’s disease mutations will be discussed in
detail in section VIA.
Physiol Rev • VOL
Hoover et al. (181) demonstrated that glycosylation is
essential to normal TSC function. As discussed in section
IIA, mammalian TSC contains two putative N-glyscosylation sites within the extracellular loop located between
TM7 and TM8 (136). Flounder TSC, in contrast, contains
three putative sites, one of which is conserved with mammalian TSC (137). Hoover et al. (181) first demonstrated
that TSC is glycosylated in vivo because molecular weight
of TSC protein from rat kidney is reduced after enzymatic
deglycosylation with protein N-glycosidase F, from a
broad band of 135–150 kDa to a sharp band of 113 kDa,
corresponding to TSC core molecular weight. Then, point
mutations that eliminate each or both glycosylation sites
revealed that TSC activity is reduced when glycosylation
is prevented. Elimination of one site (either N204 or
N242) resulted in a 50% reduction of TSC activity, while
elimination of both sites was associated with a ⬎95%
reduction. Western blot analysis, however, showed that
nonglycosylated proteins of the expected core size for
TSC (⬃113 kDa) were produced, suggesting that absence
of glycosylation is associated with cotransporter-aberrant
processing, thus reducing its expression in plasma membrane. Supporting this hypothesis, confocal image analysis of EGFP-wild-type and EGFP-mutant TSC demonstrated significant reduction in mutant EGFP-TSC protein
in plasma membranes when glycosylation was prevented.
An interesting observation made in this study is that
prevention of glycosylation was associated with increased affinity for extracellular Cl⫺ and metolazone; no
increase in affinity for extracellular Na⫹ was observed. As
shown in Figure 17A, single glycosylation mutants exhibited a rise in metolazone affinity that was further increased in the double mutant, suggesting that sugar moieties in native TSC inhibit access of diuretics to its binding site. This effect was accompanied by an increase in
Cl⫺ affinity, supporting the proposal of Tran et al. (404)
that thiazide-type diuretics and chloride bind to the same
site on the cotransporter.
Analysis of functional consequences of single-nucleotide polymorphism that changes glycine-264 for an alanine (G264A) performed by Moreno et al. (288) revealed
that TSC activity is reduced by 50%, without affecting its
synthesis, glycosylation, and trafficking to plasma membrane, suggesting that substitution of residue G264 for an
alanine resulted in a cotransporter with lower intrinsic
activity. Glycine-264 is located within TM4 and is conserved not only in TSC from all species, but also in all
members of the electroneutral cotransporter family. In
addition to its effect on TSC intrinsic activity, G264A
polymorphism also affects TSC affinity for Cl⫺ and thiazides. Ion-transport kinetics revealed that Na⫹ affinity
was similar between wild-type and G264A TSC, but that
Cl⫺ affinity was significantly higher in G264A TSC; in
addition, affinity for metolazone was also increased. Figure 17B depicts the concentration response for inhibition
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
DNSPAK was abrogated by the protein phosphatase inhibitor calyculin A, it was concluded that it is related to
alterations in phosphorylation/dephosphorylation of
BSC2/NKCC1. As previously shown by Piechotta et al.
(322), reciprocal coimmunoprecipitation was obtained
between SPAK and BSC2/NKCC1, demonstrating their
coassociation. Because Dowd and Forbush (92) also
showed that phosphorylation of PASK increased by 5.5fold when cells were exposed to low intracellular Cl⫺
concentration, it was suggested that PASK could be the
cotransporter kinase that has been postulated to be autophosphorylated by changes in cell volume or low intracellular Cl⫺ concentration (5, 253, 255). In contrast to
these observations, Piechotta et al. in a recent study (321)
used site-directed mutagenesis to eliminate one or both
SPAK-OSR1 motifs in BSC2/NKCC1 and X. laevis oocytes
as the expression system. They observed that response to
hypertonicity or low intracellular chloride was indistinguishable between mutants and wild-type BSC2/NKCC1.
Using yeast two-hybrid system, they also demonstrated
that elimination of both motifs completely prevents interaction between BSC2/NKCC1 and SPAK. Thus they concluded that preventing binding between both proteins
does not eliminate the modulatory effect of SPAK on the
Na⫹-K⫹-2Cl⫺ cotransporter. With the hypothesis that
other binding partners of these novel kinases could be
required to reconstitute their activity, a yeast two-hybrid
screen of a brain mouse library using SPAK binding domain as bait allowed them to identify at least six proteins,
of which one is WNK4, a novel kinase associated with
hereditary hypertension and that has been recently shown
to inhibit BSC2/NKCC1 activity (198). Thus additional
studies are required to understand the nature and modulation of BSC2/NKCC1 or other members of the family by
SPAK or OSR1. Meanwhile, based on the information
discussed previously, Figure 16 depicts the regulatory
motifs shown to be present in the amino-terminal domain
of BSC2/NKCC1, which suggest that the amino-terminal
domain is endowed with important regulatory properties.
ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS
457
in three different locations along TSC that include two
glycosylation sites, a single nucleotide polymorphism a
G264A polymorphism, and a Gitelman-type mutation. In
all cases, increased affinity for extracellular Cl⫺ and metolazone was observed, with no effect on Na⫹ affinity.
B. Kⴙ-Coupled Chloride Cotransporters
of wild-type TSC and G264A by metolazone. When uptakes were performed in the presence of 96 mM NaCl, the
IC50 for metolazone inhibition was similar between wildtype and G264A TSC. In contrast, when extracellular Cl⫺
concentration was fixed to about the apparent Km value
for Cl⫺, it was apparent that IC50 in G264A was shifted to
the left.
Functional analysis of Gitelman-type mutations that
reduce, but do not completely inhibit, TSC function revealed that one mutation (G627V) located at the beginning
of the carboxy-terminal domain exhibits an increase in
both Cl⫺ and metolazone affinity (352). Thus, to date, the
possibility that thiazide-type diuretics and Cl⫺ bind to the
same site in the cotransporter in a competitive fashion is
supported by mutation or substitution of single residues
Physiol Rev • VOL
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
FIG. 17. Metolazone affinity of rat TSC. A: effect of prevention of
glycosylation on metolazone affinity in rat TSC. Uptakes were performed in oocytes injected with wild-type TSC (black), single mutant
N404Q TSC (blue), single mutant N424Q (green), and double mutant
N404,424Q (red). Uptake was normalized taking as 100% of each group
that was incubated in the absence of metolazone. [Modified from Hoover
et al. (181).] B: effect of extracellular Cl⫺ concentration and single
nucleotide polymorphism G264A on thiazide affinity in rat TSC. Uptakes
were performed in oocytes injected with wild-type TSC (blue) and
G264A TSC (red) by using uptake solutions containing extracellular Cl⫺
concentration of 96 mM (continuous lines and solid symbols) or around
apparent Km for each clone that was 6 mM in wild-type and 1 mM in
G264A (discontinuous lines and open symbols). [Modified from Moreno
et al. (287).]
There is basically no information at present regarding structure-function relationship in K⫹-Cl⫺ cotransporters. On one hand, no specific inhibitor is known to be able
to prepare tracer 3H-inhibitor, as was accomplished with
[3H]bumetanide (163) and [3H]metolazone (26) for Na⫹K⫹-2Cl⫺ and Na⫹-Cl⫺ cotransporters, respectively, to assess binding behavior on cell membrane preparations and
the effect that physiological or pathophysiological maneuvers may have on binding properties. Even if this were
possible, it would probably produce confounding results
because we know that the majority of tissues express
two, three, or even four K⫹-Cl⫺ cotransporter isoforms.
On the other hand, molecular identification of K⫹-Cl⫺
cotransporters came several years after Na⫹-Cl⫺ and
Na⫹-K⫹-2Cl⫺ cotransporters cDNA were cloned. Thus
molecular tools for studying K⫹-Cl⫺ cotransporters have
been available for a few years. Furthermore, the unexpected finding of four different genes coding for similar
cotransporters has persuaded investigators to define fundamental questions such as physiological role that each
isoform may have at both cellular and individual organ
levels. Thus several publications regarding functional
properties, tissue distribution, and immunohistochemical
analysis on several tissues and production of knockout
mice of each cotransporter have been reported.
The only study dealing specifically with a structurefunction relationship to date was done by Strange et al.
(390). It is well known that regulation of K⫹-Cl⫺ cotransporter activity by phosphorylation follows a mirror image
as do those of the Na⫹-K⫹-2Cl⫺ cotransporter, i.e., phosphorylation of the K⫹-Cl⫺ cotransporter is associated
with inactivation of the protein, whereas dephosphorylation is associated with increased cotransporter function.
For instance, the PP1 inhibitor calyculin A, by preventing
dephosphorylation of these proteins, increases activity of
the Na⫹-K⫹-2Cl⫺ cotransporter but reduces the function
of the K⫹-Cl⫺ cotransporter (for review, see Refs. 62, 125,
235, 291); according to these observations, when expressed in X. laevis oocytes, activation of KCC cotransporters by hypotonicity is prevented by calyculin A (275,
390). Because it has been suggested that tyrosine kinase is
involved in regulation of K⫹-Cl⫺ cotransporter activity
(125), Strange et al. (390) studied the role of a conserved
tyrosine residue located in the carboxy-terminal domain
of all four KCCs, corresponding to Y1087 in KCC2. They
observed that substitution of this tyrosine with aspartate,
a mutation that mimics phosphorylation, reduced basal
458
GERARDO GAMBA
activity of KCC2 in isotonic conditions by 80% and completely blocked further activation of the cotransporter by
cell swelling. The effect was not associated with reduction in the immunofluorescence signal in plasma membranes of oocytes expressing Y1087D, compared with
wild-type KCC2, indicating that traffic of mutant protein
to cell surface was not affected. However, further experiments using selective tyrosine phosphatase inhibitors
failed to show any effect on KCC2 cotransporter function.
The authors concluded that Y1087 plays an important role
in normal cotransporter function, but that it does not
regulate cotransporter activity by functioning as a residue
for tyrosine phosphorylation.
Electroneutral cation-chloride cotransporters are
membrane proteins that translocate Cl⫺ together with a
cation that can be Na⫹, K⫹, or both, maintaining the
requirement of electroneutrality by using Na⫹-Cl⫺, K⫹Cl⫺, or Na⫹-K⫹-2Cl⫺ stoichiometry. As with other solute
cotransporters, all ions must be present to allow conformational changes to occur that are required to move ions
from one side of the membrane to the other. Each cotransporter can potentially move ions from inside to outside, or from outside to inside, the cell. Because these are
secondary transporters, however, movement of ions will
depend on preestablished gradients sustained by primary
transporters, of which the most important is Na⫹-K⫹ATPase; in doing so, it is the cation gradient that dictates
the direction in which Cl⫺ are moved. Therefore, cotransporters that utilize Na⫹ as the driving force translocate
cotransported ions from outside the cell to inside, because Na⫹ concentration is higher in the extracellular
space. In contrast, cotransporters that use K⫹ as the
driving force translocate K⫹-Cl⫺ from inside the cell to
the extracellular space, due to the higher concentration of
K⫹ within the intracellular compartment. Because Na⫹
and K⫹ are quickly returned to the extracellular or intracellular space, respectively, by Na⫹-K⫹-ATPase, the activity of these cotransporters usually changes the intracellular Cl⫺ concentration. Thus the SLC12 family is made
up of membrane transporters capable of setting intracellular chloride concentration below or above equilibrium.
Therefore, this is one of the major functions of these
cotransporters at the cell physiology level (for a recent
and excellent review of intracellular Cl⫺ regulation, see
Ref. 7).
Another major function of electroneutral cation-chloride cotransporters is their well-known role as membrane
proteins that participate in cell volume regulation. Because these cotransporters possess an important ion efflux or influx capacity, and some are ubiquitously expressed, their activation is one of the mechanisms that
Physiol Rev • VOL
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
V. PHYSIOLOGICAL ROLES
diverse cells use to adjust their internal osmolarity when
they are exposed to changes in extracellular osmolarity.
When cells are exposed to increased osmolarity in the
extracellular medium, water content of the cell is reduced
because water molecules move toward the space in which
water is less concentrated; this is followed by a significant
reduction in cell volume. To compensate for osmolarity
differences between intra- and extracellular space, several mechanisms are activated to increase intracellular
ion concentration, thus reducing the gradient for movement of water molecules outside the cell. One of these
pathways is the Na⫹-K⫹-2Cl⫺ cotransporter, particularly
the basolateral and ubiquitously expressed isoform BSC2/
NKCC1, which by concentrating Na⫹, K⫹, and Cl⫺ into
cells promotes recovery of the original cell volume. Thus
Na⫹-K⫹-2Cl⫺ cotransporter is a membrane protein activated during regulatory volume increase (RVI) (for a complete and recent review, see Ref. 351). In contrast, when
cells are exposed to a decrease in extracellular osmolarity, the gradient now favors movement of water molecules
into the cell, resulting in cell swelling. Under these circumstances, membrane proteins that allow efflux of ions
are activated to release effective osmolytes from the cell,
and thus reduce the gradient for water movement. K⫹-Cl⫺
cotransporters are some of the pathways activated under
these circumstances. By extruding ions, KCCs help to
decrease intracellular osmolarity, thus K⫹-Cl⫺ cotransporters are membrane proteins that are activated during
regulatory volume decrease (RVD) (for an excellent review of mechanisms involved in RVI and RVD, see Ref.
230).
A third universal role for electroneutral cotransporters is their important participation in transepithelial
movement of ions. The only member of the family not
involved in this activity is KCC2, because its expression is
neuron specific. When expressed in epithelial cells, electroneutral cotransporters are polarized to the apical or
basolateral membrane. Two genes of the family encode
for cotransporters that are currently believe to be expressed only in the apical membrane of particular regions
of the nephron. These are TSC, which is present only in
DCT (20, 48, 106, 248, 301, 327, 400, 447), and BSC1/
NKCC2, which is only expressed in TALH (98, 203, 290,
297). The major role of these isoforms is translocation of
ions from the lumen into cells to promote transepithelial
transport, thus playing a key role in reabsorption of salt in
the kidney. In contrast, in epithelial cells BSC2/NKCC1 is
only expressed in basolateral membrane [except in choroid plexus, which exhibits expression in apical membrane (326, 438)], the major function of which is to provide Cl⫺ that are required for secretion in the apical
membrane. K⫹-Cl⫺ cotransporters KCC1, KCC3, and
KCC4 are all expressed in several epithelial cells, but
precise localization of each isoform is not completely
known (see below). However, it is highly likely that these
ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS
A. Thiazide-Sensitive Naⴙ-Clⴚ Cotransporter
The thiazide-sensitive Na⫹-Cl⫺ cotransporter is the
major NaCl transport pathway in the apical membrane of
the mammalian distal convoluted tubule (DCT) (63, 109,
220, 327, 412), a nephron region that mediates reabsorption of 5–10% of glomerular filtrate. The molecular mechanism of salt reabsorption in DCT is shown in Figure 18A.
In the kidney, DCT begins few cells after macula densa
and is divided into “early” and “late” segments (337). The
majority of studies in human, rabbit, mouse, and rat kidney agree that TSC is the major sodium reabsorption
pathway along the entire DCT. While in early DCT TSC is
the only Na⫹ transport pathway, during the late portion
its expression overlaps with the epithelial sodium channel
known as ENaC (48, 109, 247, 248, 301, 337). The sodium
gradient that drives transport from lumen to interstitium
is generated and maintained by very intense activity of
Na⫹-K⫹-ATPase that is polarized to the basolateral membrane (91). Potassium that enters the cell through Na⫹K⫹-ATPase is secreted at the luminal membrane by
Physiol Rev • VOL
⫹
FIG. 18. Schematic representation of Na -coupled chloride cotransporters in transepithelial ion transport. A: ion transport pathways in
distal convoluted tubule. Salt is transported in apical membrane by the
Na⫹-Cl⫺ cotransporter encoded by the SLC12A3 gene. B: ion transport
pathways in TALH. Salt is transported in the apical membrane by the
Na⫹-K⫹-2Cl⫺ cotransporter encoded by SLC12A1 gene. C: ion transport
pathways in secretory epithelial cell from any secretory epithelium such
as trachea, gills, intestine, salivary gland, etc. Salt is transported from
interstitial space into the cell by means of the Na⫹-K⫹-2Cl⫺ cotransporter encoded by the SLC12A2 gene.
ROMK K⫹ channels (441) and by an apical K⫹-Cl⫺ cotransporter (14). Thus rate of Na⫹-Cl⫺ reabsorption determines in part the rate of K⫹ secretion.
TSC also modulates magnesium and calcium reabsorption, the latter in an inversely related fashion. Blocking activity of the Na⫹-Cl⫺ cotransporter increases Ca2⫹
reabsorption, while increased expression or activity of
Na⫹-Cl⫺ cotransporter reduces Ca2⫹ reabsorption (63).
The mechanism by which thiazide diuretics increase calcium reabsorption is still unclear. Thiazides reduce NaCl
entry at apical membrane, while intracellular Na⫹ is continuously pumped out of the cell by Na⫹-K⫹-ATPase at the
basolateral membrane, reducing the concentration of this
cation within the cell. As a result, electrical gradient for
Ca2⫹ entry at apical membrane is increased, opening the
rate of Ca2⫹ transport through calcium channels (141). In
a recent study, however, it was observed that preventing
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
cotransporters are also involved in transepithelial ion
transport.
Finally, a fourth and emerging role of electroneutral
cotransporters is their participation in clamping intraneuronal chloride concentration either above or below its
electrical potential equilibrium (6). This role in neuronal
physiology is critical to define type and magnitude of
response to neurotransmitters such as GABA. Family
members involved in this activity are those expressed in
the CNS, with particular importance on BSC2/NKCC1,
KCC2, and KCC3 (274, 312).
Soon after discovery of electroneutral cotransport
processes, much information was produced regarding potential roles of Na⫹-K⫹-2Cl⫺ and K⫹-Cl⫺ cotransporters in
cell volume regulation, particularly in nonepithelial cells
such as erythrocytes, as well as in epithelial salt secretion
and renal reabsorption. The majority of these studies
were produced before cotransporter genes were identified at the molecular level; this information will not be
reviewed here. There are several excellent and extensive
reviews that present comprehensive information concerning the manner in which this knowledge evolved, to which
readers are referred (104, 151, 161, 164, 235, 236, 302, 348,
351, 427). In this section, what I present is a review of
information generated since cloning of the cotransporter’s cDNAs that is helping us to obtain better understanding of previously known roles or that has revealed new
roles for each cotransporter that were either suspected or
unsuspected. My focus in this section is toward understanding physiological roles of each cotransporter, not
only at the cellular physiology level, but also at the levels
of the physiology of different organs and systems.
459
460
GERARDO GAMBA
Physiol Rev • VOL
blood pressure. TSC is regulated by the mineralocorticoid
aldosterone. Micropuncture studies in adrenalectomized
rats showed several years ago that increase in sodium
tubule fluid-to-plasma concentration ratio in DCT (177)
was decreased to control levels by aldosterone, and microperfusion investigations showed that aldosterone increases thiazide-sensitive salt transport in DCT (411). In
addition, aldosterone has been shown to increase [3H]metolazone binding in membrane fractions from renal cortex, a measure of TSC abundance (117), and by immunoblotting with specific anti-TSC antibodies, it has been
demonstrated that elevated plasma aldosterone concentration is associated with an increase in TSC abundance in
renal cortex when plasma aldosterone was increased by
either dietary sodium restriction (262) or aldosterone infusion (210). Another study in which aldosterone was
infused in dexamethasone-replaced adrenalectomized
rats increased TSC abundance in renal cortex, and this
effect was completely prevented by spironolactone (296).
Additionally, it was demonstrated that loop and thiazide
diuretic administrations are associated with increased
expression of TSC (294) and that increased expression
can be abrogated with spironolactone (1). All this information together suggests that aldosterone regulation of
TSC protein is mediated through classical mineralocorticoid receptors. Interestingly, however, existing evidence
indicates that TSC regulation by mineralocorticoids must
be indirect, i.e., unrelated to TSC gene transcription, because there has been consistent failure to detect changes
in TSC mRNA levels in response to dietary salt restriction
(288, 436) or furosemide administration (1, 288). In this
regard, a study in which TSC mRNA and protein levels
were assessed simultaneously showed that increase in
TSC protein induced by dietary NaCl restriction was not
accompanied by detectable changes in TSC mRNA levels
(263). Despite positive regulation by aldosterone, TSC is
the only transport protein that is decreased during the
aldosterone escape phenomenon (424). This observation
suggests that one of the principal targets of pressure
natriuresis is TSC; a similar conclusion was drawn by
Majid and Navar based on measurements of pressure
natriuresis in intact dogs (258).
Abundance of TSC protein in kidney is not regulated
by aldosterone alone. TSC is a target for other hormones
and regulators. For instance, TSC abundance is moderately increased by vasopressin administration (dDAVP)
(100). However, when the kidney undergoes escape from
vasopressin-induced water retention after development of
hyponatremia, TSC abundance is more markedly increased (101). It was proposed that increase in TSC abundance in response to water retention may be associated
with inappropriate secretion of antidiuretic hormone.
TSC abundance is also increased under hyperinsulinemic
conditions such as obesity (38), streptozotocin adminis-
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
extracellular volume contraction in rats treated with hydrochlorothiazide prevented the reduction in urinary calcium excretion (298). Because it was also observed that
expression of calcium transport proteins such as calcium
channel TRPV5 and calbindin-D28K was reduced, it was
concluded that another potential explanation is that hypocalciuric effects of thiazides are due to extracellular
volume contraction. This secondary effect of thiazides
constitutes the basis for their use in treatment of calcium
stone disease and may also explain protective effects of
thiazides in osteoporosis (333, 361, 428). In addition, TSC
indirectly modulates potassium and acid-base metabolism
because secretion of these ions in renal collecting tubule
is affected by NaCl delivery to this region of nephron.
The fundamental role of the TSC Na⫹-Cl⫺ cotransporter encoded by the SLC12A3 gene in preserving extracellular fluid volume and divalent cation homeostasis has
been firmly established by identification of inactivating
mutations of this gene as the cause of Gitelman’s disease
(see sect. VIA) (221, 264, 265, 377). TSC also plays a key
role in renal and cardiovascular pharmacology. As shown
in Figure 18A, the apical Na⫹-Cl⫺ cotransporter in DCT is
the major target for thiazide-type diuretics (chlorthalidone, hydrochlorothiazide, bendroflumethiazide, metolazone) (109, 136, 389). Chlorothiazide was the first effective antihypertensive agent available for clinical use, and
its launch into clinical medicine in 1957 (300) was considered the greatest breakthrough in the history of drug
treatment of hypertension (105, 129). Diuretics are currently used in treatment of high blood pressure, edematous states such as chronic cardiac failure, chronic renal
failure, chronic liver failure, and nephrotic syndrome, as
well as derangements of calcium metabolism such as
renal stone disease and osteoporosis (130). Results from
the recently published Antihypertensive and Lipid-Lowering Treatment to Prevent Heart Attack Trial (ALLHAT)
study (401) showed that thiazides are not only effective in
lowering blood pressure levels in hypertensive patients,
but also help to prevent chronic cardiovascular complications. Thus the seventh report of the Joint National
Committee on Prevention, Detection, and Evaluation of
High Blood Pressure (57) recommends thiazides as the
drug of choice for treatment of hypertension, either as a
single agent or in combination with other antihypertensive drugs.
With the availability of cDNA probes, cDNA primers,
and high-quality polyclonal antibodies to the majority of
transporters expressed along the nephron, several techniques have been implemented to study patterns of Na⫹
transporter abundance changes under several physiological and pathophysiological circumstances (for review,
see Refs. 213–215). These studies have revealed that TSC
expression is highly regulated by multiple factors known
to modulate renal excretion of sodium and hence arterial
ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS
B. Apical Bumetanide-Sensitive
Naⴙ-Kⴙ-2Clⴚ Cotransporter
Apical bumetanide-sensitive Na⫹-K⫹-2Cl⫺ cotransporter BSC1/NKCC2 is the major salt transport pathway in
mammalian TALH, which is in charge of reabsorbing
⬃15–20% of glomerular filtrate. Function of this cotransporter in TALH is not only critical for salt reabsorption,
but also for production and maintenance of countercurrent multiplication mechanism, and thus in renal ability to
produce urine that can be more diluted or concentrated
than plasma, a functional capacity essential for survival of
land mammals, including humans. In addition, TALH
Physiol Rev • VOL
plays an important role in divalent cations (Ca2⫹ and
Mg2⫹) and ammonium (NH⫹
4 ) reabsorption. Transcellular
salt reabsorption by TALH promotes paracellular reabsorption of divalent cations (168), and NH⫹
4 can substitute
for K⫹ in BSC1/NKCC2 cotransporter to behave as a
⫺
Na⫹-NH⫹
cotransporter. As I mentioned at the be4 -2Cl
ginning of this section, basic demonstrations of major
roles that Na⫹-K⫹-2Cl⫺ cotransport plays in salt reabsorption in TALH were produced many years before identification of cotransporters at the molecular level and have
been extensively reviewed in excellent manuscripts to
which interested readers are referred (151, 152, 159, 167,
169, 174, 279, 348, 435). Thus here we will first review the
general mechanism of salt reabsorption in TALH that will
be of help in understanding the roles of the Na⫹-K⫹-2Cl⫺
cotransporter BSC1/NKCC2 in renal physiology, pharmacology, and pathophysiology, and then we will review
new information regarding the physiology of this cotransporter in kidney that has been produced since identification of the SLC12A1 gene.
1. Molecular physiology of salt reabsorption by TALH
Molecular mechanisms of salt reabsorption by TALH
are shown in Figure 18B. Na⫹-K⫹-ATPase polarized to
basolateral membrane produces continuous efflux of sodium ions into interstitial space, generating a gradient for
sodium transport on the apical side (155). The major
pathway for sodium reabsorption in apical membrane of
TALH is Na⫹-K⫹-2Cl⫺ cotransporter BSC1/NKCC2 (149,
153, 154, 156, 170). As shown in Figure 18B, salt reabsorption in TALH requires simultaneous operation of several
transport proteins. Entrance of salt together with K⫹
occurs through the Na⫹-K⫹-2Cl⫺ cotransporter BSC1/
NKCC2. Sodium and chloride ions leave the cell in basolateral membrane through Na⫹-K⫹-ATPase and Cl⫺ channels (CLC-Kb), respectively. Both Na⫹-K⫹-ATPase and
CLC-Kb channels are composed of two subunits: one that
carries out the transport function and another that is
required for successful targeting of Na⫹-K⫹-ATPase or
CLC-Kb complex to plasma membrane (139, 208, 268, 335,
371, 372, 421). These subunits in Na⫹-K⫹-ATPase or
CLC-Kb are ␤-subunit and Barttin, respectively.
Basically all potassium ions entering across the apical plasma membrane are returned to tubular lumen via
an inwardly rectifying K⫹ channel known as ROMK. Potassium concentration in the glomerular ultrafiltrate (4
meq/l) is much lower than that of sodium (145 meq/l) or
chloride (110 meq/l). Thus K⫹ concentration in the lumen
of TALH would be rapidly reduced below the minimum
required for transport, stopping the function of the Na⫹K⫹-2Cl⫺ cotransporter. K⫹ recycling, however, ensures
that potassium concentration within TALH lumen will be
enough to allow proper function of the cotransporter.
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
tration (426), or insulin infusions (99), suggesting that
increased sodium reabsorption by TSC could be implicated in development of hypertension under these conditions. There are other regulators of TSC expression: gonadectomy in female rats is associated with decrease in
TSC expression, which was corrected when estradiol was
administered (416). Metabolic acidosis induces a decrease in TSC abundance, while metabolic alkalosis increases it (211). Potassium depletion reduces expression
of TSC by a mechanism that includes a decrease in TSC
mRNA levels (13). Therefore, regulation of TSC expression appears to be an important cog in overall mechanisms by which renal sodium excretion is regulated.
In winter flounder, transcripts encoding a shorter,
truncated TSC isoform have been observed in several
tissues including gonads, brain, skeletal muscle, intestine,
heart, and eye (Table 1) (137). In mammals, however, the
thiazide-sensitive Na⫹-Cl⫺ cotransporter is considered to
be a kidney-specific gene, although several reports suggested its presence in many other tissues. Existence of a
thiazide-sensitive Na⫹-Cl⫺ cotransporter has been suggested in brain (82), blood vessels (58), pancreas (32),
peripheral blood mononuclear cells (2), bone (22), gallbladder (65), and heart (93); however, the molecular nature of a putative thiazide-sensitive mechanism in these
tissues has not been properly defined. Although some
studies exhibit RT-PCR amplification of a TSC cDNA fragment, the existence of the protein has not been demonstrated by Western blot or other means. The only exception seems to be bone, in which a preliminary report
revealed that TSC presence in bone cells has been observed by immunohistochemistry (97). In some tissues
such as brain and blood vessels, the thiazide effect is due
to interaction with other proteins such as AMPA receptors (120), carbonic anhydrase (319), potassium channels
(320), or nitric oxide production (61). Thus it is possible
that expression of TSC is not specific for kidney, as it was
initially thought (136), but confirmation of protein expression elsewhere is still pending.
461
462
GERARDO GAMBA
Physiol Rev • VOL
(presumably isoform B), which is blocked by loop diuretic (297). Increased delivery of NaCl to connecting
tubule and collecting duct results in greater Na⫹ reabsorption and K⫹ secretion by principal cells, causing a
greater rate of H⫹ secretion by intercalated cells of connecting tubule and outer medullary collecting duct, thus
producing hypokalemia and metabolic alkalosis, a major
finding of Bartter’s disease (see sect. VIB). Finally, increased reabsorption of divalent cations, as a result of
positive voltage in TALH lumen generated by Na⫹-K⫹2Cl⫺ cotransporter, explains the hypercalciuric effect of
loop diuretics, which is highly valuable during management of life-threatening hypercalcemia.
2. Regulation of the Na⫹-K⫹-2Cl⫺ cotransporter
Increasing net NaCl reabsorption in TALH by hormones generating cAMP via their respective Gs-coupled
receptors such as vasopressin, glucagon, parathyroid hormone, ␤-adrenergic, and calcitonin is a fundamental
mechanism for regulating salt transport in this nephron
segment (171, 172). Of these hormones, the most important is the antidiuretic hormone vasopressin. As demonstrated in isolated perfused tubule studies mediated by
cAMP, vasopressin increases NaCl absorption by TALH
(166, 171, 356) following a mechanism that appears to
involve trafficking of Na⫹-K⫹-2Cl⫺ cotransporter, BSC1/
NKCC2, from an intracellular vesicular pool to apical
plasma membrane (143, 269, 325). In a recent study using
a polyclonal antibody that recognizes BSC1/NKCC2 when
phosphorylated at threonine residues located in the
amino-terminal domain, Gimenez and Forbush (143) observed that vasopressin’s effect in mouse TALH may be
dependent in part on phosphorylation of BSC1/NKCC2
and that vasopressin action in TALH induces phosphorylation of Na⫹-K⫹-2Cl⫺ cotransporter protein that is associated with migration of cotransporter containing vesicles
to apical membrane (143). In addition, as discussed in
section IIIB, in mice, the stimulatory effect of vasopressin
on BSC1/NKCC2 trafficking appears to be related to inhibition by cAMP of a dominant-negative effect of the 770amino acid short isoform BSC1-S on trafficking of fulllength isoform BSC1/NKCC2 (269, 325). Other hormones
that generate cAMP via their respective Gs-coupled receptors stimulate concomitant increases in NaCl absorption
rate, such as parathyroid hormone, calcitonin, and glucagons, presumably using similar mechanisms to those demonstrated for vasopressin (89, 103, 286). Prostaglandin E2
has been demonstrated to have a short-term inhibitory
effect on NaCl absorption in TALH (387), presumably via
its ability to inhibit cAMP production in TALH cells (402).
Another mediator that regulates TALH NaCl transport via
effects in BSC1/NKCC2 is nitric oxide, which directly
inhibits NaCl absorption in isolated perfused preparations
(304).
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
Moreover, positive voltage within TALH that resulted
from K⫹ recycling together with movement of sodium and
chloride to interstitial space drives reabsorption of a second cation through paracellular pathway. Because tight
junctions are permeable to sodium, magnesium, and calcium, all three ions are reabsorbed at rates dependent on
their luminal concentrations. Thus coordinated function
between Na⫹-K⫹-2Cl⫺ cotransporter, apical K⫹ channels,
and basolateral Cl⫺ channels renders TALH epithelial
cells thermodynamically more efficient because two cations are reabsorbed at the expense of ATP needed to
pump one (393).
The fundamental role of apical Na⫹-K⫹-2Cl⫺ cotransporter in salt reabsorption in TALH has been firmly established by demonstration that mutations in SLCA12A1 are
associated with the development of Bartter’s disease and
by BSC1/NKCC2 knockout mice that reproduced a clinical picture that is similar to this illness. In this study,
Takahashi et al. (397) developed a mouse with targeted
disruption of SLC12A1 gene resulting in mice that were
born normally but developed a clear dehydration state by
day 1 of life. Then, all mice failed to thrive and by day 7
presented with severe renal failure, metabolic acidosis,
hyperkalemia, high plasma renin activity, and hydronephrosis. Before the end of the second week all homozygous pups were dead. Interestingly, indomethacin treatment improved metabolic conditions of most pups by 7
days, although 90% died by 3 wk. However, the 10% that
survived were able to reach adulthood without further
treatment and at 10 mo exhibited the expected hypokalemia and metabolic alkalosis. In contrast to patients with
Bartter’s disease, survival mice developed marked hydronephrosis probably due to excessive fluid that exceeded
the maximum capacity of ureters resulting in increased
pressure of the renal pelvis.
Apical Na⫹-K⫹-2Cl⫺ cotransporter BSC1/NKCC2 also
plays an important role in cardiovascular and renal pharmacology because this cotransporter is the main pharmacological target of loop diuretics (furosemide, bumetanide, ethacrynic acid, torasemide, and piretanide), the
most potent natriuretic agent available for clinical use.
The functional description on Figure 18B of salt reabsorption in TALH cells helps us to understand the mechanisms
by which loop diuretics exert their potent effects in kidney. By blocking the Na⫹-K⫹-2Cl⫺ cotransporter, loop
diuretics reduce salt reabsorption rate in TALH. Thus
delivery of salt to the distal nephron is increased, producing significant natriuresis and diuresis. When macula
densa at the end of TALH sense an increase in NaCl
delivery, this will be usually compensated by decreasing
glomerular filtration rate as a result of activation of the
tubuloglomerular feedback mechanism (359). This compensation, however, does not occur when increased NaCl
delivery is mediated by loop diuretics because the saltsensing protein in macula densa is also BSC1/NKCC2
ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS
Physiol Rev • VOL
C. Basolateral Bumetanide-Sensitive
Naⴙ-Kⴙ-2Clⴚ Cotransporter
After the discovery of an electroneutral Na⫹-K⫹-2Cl⫺
cotransport mechanism by Geck et al. in Ehrlich cells
(138), it was soon established that this salt-transport pathway was present in several epithelial and nonepithelial
cells. As previously mentioned, at cellular physiology
level a major role of the Na⫹-K⫹-2Cl⫺ cotransporter in
epithelial and nonepithelial cells is in cell-volume regulation processes, mainly as one of the membrane transporters activated during cell shrinkage, as part of regulatory
volume increase mechanisms (230). As shown in Figure
18C, in epithelial cells the Na⫹-K⫹-2Cl⫺ cotransporter is
polarized to basolateral membrane and plays a critical
role in providing cells with Cl⫺ that are secreted through
the apical membrane. The driving force for Na⫹ transport
maintained by Na⫹-K⫹-ATPase activity allows BSC2/
NKCC1 to transport Na⫹, K⫹, and Cl⫺ from interstitium
into the cell. The majority of the Na⫹ and K⫹ recycle into
interstitial fluid by Na⫹-K⫹-ATPase and conductive pathways, respectively, while Cl⫺ are secreted into the lumen
by several conductive pathways, one of the most important being the CFTR (364). The existence of Na⫹-K⫹-2Cl⫺
cotransporter in secretory epithelium from several organs
including respiratory epithelium, parotid gland, intestine,
colon, eye, ear, mammary gland, and shark rectal gland,
among others, was originally demonstrated by functional
analysis and later by immunolocalization using specific
antibodies. The sole exception is in the choroid plexus in
the CNS in which BSC2/NKCC1 expression is polarized to
the apical membrane, together with Na⫹-K⫹-ATPase
(438). Most of this information has been recently reviewed. Interested readers are advised to consult these
excellent manuscripts (164, 351). What I wish to review
here are the physiological roles that have emerged for
BSC2/NKCC1 at the organ or system level due in part to
the observations done in knockout mice. As shown in
Figure 19, several interesting phenotypes have arisen in
mice harboring disrupted mutations on the SLC12A2
gene that include gastrointestinal, cardiovascular, auditory, salivary, testicular, and growth retardation phenotypes.
Mice lacking basolateral Na⫹-K⫹-2Cl⫺ cotransporter
expression were produced simultaneously by Flagella et
al. (123) and Delpire et al. (78) by targeted disruption of
exons 6 and 9, respectively. BSC2/NKCC1-null mice were
normal at birth but exhibited growth retardation apparent
from the first day of life. Body weight 10 wk after birth
was ⬃25% lower than normal or heterozygous mice. A few
days after birth, null mice exhibited several interesting
phenotypes that are aiding in revealing the role of BSC2/
NKCC1 in several organs (Fig. 19).
BSC2/NKCC1 knockout mice are deaf due to a sensorineural defect. These mice exhibit the characteristic
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
In addition to the short-term effect of vasopressin on
BSC1/NKCC2 trafficking or activity, long-term increases
in vasopressin levels have been demonstrated to upregulate BSC1/NKCC2 protein expression in TALH cells (209).
This action results in long-term potentiation of NaCl
transport in TALH, as demonstrated by Besseghir et al.
(33) in isolated perfused tubule studies in which the investigators observed that chronic in vivo administration
of antidiuretic hormone to Brattleboro rats significantly
increased basal voltage and chloride transport in TALH.
In addition, long-term change in prostaglandin E2 levels
appears to modulate BSC1/NKCC2 expression levels in
TALH because the cyclooxygenase inhibitors indomethacin or diclofenac increased BSC1/NKCC2 abundance, an
effect that was reversed by misoprostol, a prostaglandin
E2 analog (122). Supporting this observation, Escalante et
al. (112) previously showed in isolated rabbit mTALH
cells that arachidonic acid metabolites produced a concentration-dependent inhibition of Na⫹-K⫹-2Cl⫺ cotransporter activity, an effect that was prevented by selective
inhibition of cytochrome P-450 monooxygenases.
In addition to actions of hormones that generate
cAMP in TALH, regulatory mediators using other signal
mechanisms also modulate BSC1/NKCC2 expression in
TALH. Glucocorticoids increase BSC1/NKCC2 mRNA and
protein expression by a mechanism that requires vasopressin, while aldosterone has no effect on BSC1/NKCC2
expression levels (18). By stimulating cGMP production,
nitric oxide increases BSC1/NKCC2 expression, as observed by Turban et al. (405) as a marked decrease in this
cotransporter abundance in response to inhibition of nitric oxide synthases by NG-nitro-L-arginine methyl ester
(L-NAME). In addition, while angiotensin II infusion was
found to increase BSC1/NKCC2 abundance in TALH
(225), absence of AT1a receptors in mice (44) or blockade
of angiotensin II AT1 receptors by candesartan (36) did
not produce opposite effects, suggesting that the angiotensin II effect on BSC1/NKCC2 expression is indirect and
related to local changes in nitric oxide or PGE2 levels.
Finally, expression of BSC1/NKCC2 is also regulated by
acid-base status. Chronic metabolic acidosis has been
shown to enhance expression of BSC1/NKCC2 mRNA and
protein in medullary TALH (17) by glucocorticoid-dependent and -independent mechanisms (18). In this regard, it
has been recently found that what metabolic acidosis
does is increase the stability of BSC1/NKCC2 mRNA,
without affecting SLC12A1 transcription rate (206). Under physiological conditions, most of the ammonium produced in the proximal tubule is reabsorbed in TALH to be
later secreted in medullary collecting ducts and excreted
into urine (146, 216). Thus, during acidosis in which production of ammonium by proximal tubule is increased,
enhancing of BSC1/NKCC2 expression arises as a compensatory mechanism to increase ammonium reabsorption.
463
464
GERARDO GAMBA
shaker/waltzer phenotype apparent in continuous circling
and head movements accompanied by frequent loss of
balance. This behavior is known to be due to inner-ear
dysfunction. The existing mouse model of shaker-withsyndactylism is a radiation-induced mutant mouse exhibiting deafness and fusion of digits. This colony has produced the fused-phalanges mouse syFP that exhibits various degrees of digit fusion without deafness, and the
no-syndactylism syNS that is deaf without syndactylism.
Using a positional cloning approach, Dixon et al. (90)
recently demonstrated that SLC12A2 is the gene defective in syNS mice. Thus three different disruptions in the
SLC12A2 gene produced similar inner ear phenotype.
BSC2/NKCC1-null mice exhibit histological evidence of
dysfunction of epithelial secretion in labyrinth such as
collapse of endolymphatic cavity and a Reissner’s membrane lying above on the top of stria vascularis, rather
than in its normal position between scala media and scala
vestibules; in addition, it is known that BSC2/NKCC1 is
Physiol Rev • VOL
expressed in the basolateral membrane of stria vascularis
and vestibular cells (78). Thus it is likely that BSC2/
NKCC1 plays an important role in providing epithelial
cells with sufficient K⫹, which is secreted in the apical
side into cochlear chamber (353). Absence of the Na⫹K⫹-2Cl⫺ cotransporter in basolateral membrane is then
associated with significant reduction of K⫹ secretion into
endolymph. Supporting this conclusion, a similar sensorineural-deafness phenotype is present in knockout mice
of a subunit of the K⫹ channel (minK) present in apical
membrane of stria vascularis, through which K⫹ are secreted (417). Therefore, two distinct disruptions of K⫹ handling by stria vascularis cells result in profound deafness.
BSC2/NKCC1-null mice exhibit growth retardation,
and ⬃30% spontaneously died between days 18 and 26 of
life, due to cecum bleeding and severe blockade of colon.
A similar situation occurs in CFTR knockout mice (379),
suggesting that the basolateral Na⫹-K⫹-2Cl⫺ cotransporter plays indeed a very important role in providing
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
FIG. 19. Several phenotypes result from targeted disruption of the SLC12A2 gene. Total absence of BSC2/NKCC1 is associated with
azoospermia [modified from Pace et al. (306)]; growth retardation, deafness, and imbalance (78, 123); decreased pain perception (229, 394); impaired
saliva production [modified from Evans et al. (114)]; decrease in blood pressure levels (123, 277), and gastrointestinal secretory problems ending
in death due to cecum and colonic blockade (123, 157). Although BSC2/NKCC1 knockout mice exhibit a clear decrease in Cl⫺ influx in respiratory
epithelium, the absence of a respiratory phenotype appears to be due to compensation by other anion transporters (158).
ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS
Physiol Rev • VOL
due to a reduction in vascular tone; however, no further
studies to verify this hypothesis have been performed.
Male BSC2/NKCC1-null mice are infertile, whereas
females exhibit successful pregnancies without reproductory impairment. Histological analysis revealed normal
reproductive organs in females. In contrast, complete
infertility of males was associated with deficit in spermatocyte production accompanied by architectural disruption of testis and epididymis (306). These observations
suggest that the absence of a basolateral Na⫹-K⫹-2Cl⫺
cotransporter in seminiferous tubules has a similar consequence to that seen in inner ear, in which impairment in
K⫹ secretion results in blockade of spermatocyte maturation. In addition, low levels of testosterone and luteinizing hormones in null mice suggested a deficit in hypothalamus/pituitary axis (79).
The Na⫹-K⫹-2Cl⫺ cotransporter encoded by the
SLC12A2 gene appears to have very important functional
roles in primary sensory neurons of vertebrates by making possible presynaptic inhibition and nociception (10,
51, 229, 394). Functional expression of NKCC1 in these
nerve cells was first shown by Alvarez-Leefmans et al. (8).
Using double-barreled Cl⫺ selective microelectrodes,
these investigators measured simultaneously transmembrane potential (Em) and intracellular free Cl⫺ concentration ([Cl⫺]i) in the cell bodies of frog sensory neurons
(i.e., dorsal root ganglion cells). They showed that sensory neurons have a higher [Cl⫺]i than that predicted for
a passive distribution, that the intracellular Cl⫺ accumulation in these cells is sensitive to bumetanide and dependent on the presence of extracellular Na⫹, K⫹, and Cl⫺.
Their measurements directly showed that bumetanidesensitive Cl⫺ movements across the membrane occurred
without concurrent changes in Em and therefore concluded that the mechanism that generates and maintains
the outwardly directed Cl⫺ gradient across membrane
was an electroneutral Na⫹-K⫹-2Cl⫺ cotransport system.
They were the first to suggest that by keeping [Cl⫺]i above
electrochemical equilibrium, the cotransporter function
explained why GABA produces depolarization of primary
sensory neurons, a critical factor in producing presynaptic inhibition between afferent terminals in the spinal cord
(350). The prevailing idea regarding this issue is that
GABA released from interneurons depolarizes primary
afferent fibers via axo-axonic synapses. The depolarization inactivates Na⫹ channels sufficiently to decrease or
block action potential invasion into primary afferent terminals, thereby inhibiting transmitter release and selectively channeling sensory information into spinal cord.
GABA depolarizations result from an efflux of Cl⫺
through GABAA-gated anion channels. The key element
for generation of the outward Cl⫺ current in terminals of
primary afferents is equilibrium potential for chloride
(ECl), which is kept at a more positive value than Em by
BSC2/NKCC1. These observations suggest that intracellu-
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
epithelial cells with ions secreted in the apical membrane.
In this regard, cAMP-stimulated short-circuit current (Isc)
in jejunum and cecum of BSC2/NKCC1 knockout mice
was ⬃50% of that shown to be present in normal mice.
These observations, however, have not been consistently
observed because increased mortality due to intestinal
problems was not present in BSC2/NKCC1-null mice done
by other groups (78, 306). The difference appears to be
adaptability of intestinal epithelium, which in the absence
of Cl⫺ secretion exhibits an increase in HCO⫺
3 secretion
(157). Finally, within the gastrointestinal system, as revealed by Evans et al. (114) BSC2/NKCC1 knockout mice
also exhibited severe salivation impairment (Fig. 19). In
contrast to normal mice, null mice observed a complete
absence of BSC2/NKCC1 expression in basolateral membrane of parotid acinal cells, which was accompanied by
reduction of ⬃60% in the amount of saliva secreted in
response to muscarinic agonist carbachol, with a total
loss of bumetanide-sensitive Na⫹-K⫹-2Cl⫺ influx. The remaining saliva production is due to compensatory upregulation of AE2 Cl⫺/HCO3⫺ exchanger expression. A similar
situation occurs with ion transport in airway epithelia.
Normal mice exhibit robust bumetanide-sensitive ion
transport in basolateral membrane of tracheal epithelium,
which is absent in BSC2/NKCC1 null mice. However,
spontaneous airway diseases are not developed in knockout mice. Experiments performed with ion substitutions
and several drugs suggest that absence of Cl⫺ secretion
by the Na⫹-K⫹-2Cl⫺ cotransporter in null mice is well
compensated with HCO⫺
3 secretion (158).
Conflicting results were observed between two
groups regarding blood pressure effects of BSC2/NKCC1
targeted disruption. Pace et al. (306) reported that arterial
blood pressure measured in conscious mice using a tailcuff system revealed no significant difference between
BSC2/NKCC1 wild-type and null mice. In addition, no
difference in renal function and vasopressin response was
observed; however, a decrease in blood pressure has been
recorded by Flagella et al. (123). This group first reported
that blood pressure levels measured by means of femoral
artery catheter on anesthetized mice revealed a significant decrease in blood pressure in both heterozygous ⫹/⫺
(77 ⫾ 4.1 mmHg) and homozygous ⫺/⫺ (68 ⫾ 2.8 mmHg)
mice, when compared with normal mice (92 ⫾ 4 mmHg).
The blood pressure in this mouse model was reanalyzed
in awake animals by means of tail-cuff system to assess
systolic blood pressure, and a significant reduction was
again observed in BSC2/NKCC1-null mice (114 ⫾ 2.2
mmHg in null vs. 131 ⫾ 2.5 mmHg in wild-type) (277). No
changes in aldosterone and electrolytes in blood suggested that low blood pressure is not due to a decrease in
extracellular fluid volume. Cardiac function was normal.
A small but significant reduction in contractility of portal
veins was observed, suggesting that hypotension could be
465
466
GERARDO GAMBA
KCC1 mRNA transcripts are present in all tested tissues
including brain, colon, heart, kidney, liver, lung, spleen,
stomach, placenta, muscle, and pancreas. The expression
in erythrocytes was later demonstrated by Pellegrino et
al. (316). Therefore, KCC1 is a ubiquitously expressed
isoform of K⫹-Cl⫺ cotransporters that appears to play a
fundamental role in cell volume regulation. In this regard,
it has been shown that KCC1 is activated by cell swelling
(142, 275). The majority of K⫹-Cl⫺ cotransporter activity
in red blood cells has been attributed to KCC1, with some
contribution of KCC3 (238). It has been speculated that
K⫹-Cl⫺ efflux in red blood cells is an important mechanism for cell size reduction with maturation and that
activity of the K⫹-Cl⫺ cotransporter is increased in hemoglobinopathies such as sickle cell disease (235).
Since four unexpected genes encoding K⫹-Cl⫺ cotransporters were identified following in silico cloning
strategies, little is still known on the physiological roles of
each K⫹-Cl⫺ cotransporter gene at the organ or system
levels. Moreover, simultaneous expression of at least two
or three KCCs in several organs is common. Absence of
KCC1 knockout mice in world literature precludes clarification of KCC1 physiological roles at the organ level. As
previously mentioned, KCC1 is widely expressed in cells
and tissues, but its presence could be related to either its
fundamental role in cell volume regulation or a certain
role in physiological aspects of a particular tissue. For
instance, KCC1 is expressed in the basolateral membrane
of exocrine glands such as salivary, parotid, and pancreatic glands (349), but the physiological role of such expression remains to be clarified. The fact that KCC1 is
expressed in basolateral membrane of colonic epithelium
and K⫹ (but not Na⫹) depletion is associated with a
significant increase in KCC1 mRNA and protein levels
suggest that KCC1 in colon is involved into transepithelial
transport of K⫹ (355).
All four K⫹-Cl⫺ cotransporters are expressed in the
CNS (29, 204, 313, 315) in which regulation of intracellular
Cl⫺ concentration by electroneutral cotransporter plays
an important role in defining type and magnitude of response to certain neurotransmitters. Specific roles of
KCC1 in CNS, however, have not been defined. By in situ
hybridization it was shown that expression of KCC1
mRNA is low and widespread, with higher expression
within olfactory bulb, hippocampus, cerebellum, and choroid plexus (59, 202). However, the physiological role of
KCC1 remains elusive.
D. Kⴙ-Clⴚ Cotransporter 1
E. Kⴙ-Clⴚ Cotransporter 2
The K⫹-Cl⫺ cotransporter KCC1 is a ubiquitously
expressed protein. As discussed in section IIB, KCC1 was
the first isoform of KCC cotransporters to be identified at
the molecular level (142). In this study it was shown that
Initial cloning of KCC2 cDNA demonstrated that expression of this K⫹-Cl⫺ cotransporter is restricted to the
CNS (313). Following in situ hybridization and immunohistochemical studies it was shown that KCC2 expression
Physiol Rev • VOL
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
lar Cl⫺ accumulation by the BSC2/NKCC1 is a key component of GABA depolarization and modulation of sensory input to the spinal cord.
Later on, using specific antibodies against BSC2/
NKCC1, the presence of this cotransporter was confirmed
in the plasma membrane of dorsal root ganglion neurons
from mice (326), and those from frogs, cats, and rats,
including their afferent axons (9). GABA-induced currents
in dorsal neurons of wild-type and BSC2/NKCC1-null mice
were studied by Sung et al. (394) using gramicidin-perforated patch and whole cell recordings. In neurons from
wild-type animals, intracellular Cl⫺ accumulation was
suggested because GABA evoked inward currents at resting membrane potentials. In contrast, in neurons from
BSC2/NKCC1-null animals, no current was observed at
resting membrane potential, and GABA evoked reduced
depolarizing or even hyperpolarizing currents. In this
same study, it was shown that BSC2/NKCC1-null animals
exhibited an impaired nocioceptive phenotype. Specifically, experiments with BSC2/NKCC1-null mice demonstrated impaired pain perception in the hot plate test,
suggesting that Na⫹-K⫹-2Cl⫺ cotransporter is involved in
pain perception. More recently, Laird et al. (229) examined the role of the cotransporter in generation of touchevoked pain (allodynia). BSC2/NKCC1-null animals
showed an increase in tail flick latencies and a reduction
in pain behavior induced by intradermal capsaicin compared with heterozygous and wild-type animals. The
BSC2/NKCC1-null animals showed a reduction in stroking
hyperalgesia (touch-evoked pain) compared with wildtype and heterozygous mice. As BSC2/NKCC1 is responsible for the generation of presynaptic inhibition between
afferent terminals in the spinal cord, these results supported the notion that presynaptic interactions between
low- and high-threshold afferents can underlie allodynia
(51).
Expression of NKCC1 is developmentally regulated
in postnatal rat brain (59, 328). Consistent with this finding, in embryonic neurons, GABA has a widespread depolarizing action (30) that seems crucial in promoting
Ca2⫹ influx, influencing important developmental events
such as neuronal proliferation, differentiation, and migration and neurite extension and targeting. Again, depolarizing action of GABA is likely to result from an efflux of
chloride through GABAA-gated anion channels, the driving force for Cl⫺ efflux being generated and maintained
by BSC2/NKCC1 (443).
ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS
Physiol Rev • VOL
The role of KCC2 in CNS physiology is so important
that complete ablation of KCC2 expression in null mice
results in early neonatal death that is basically secondary
to apneic respiratory failure (184). Consistent with a role
of KCC2 in switching GABA response from excitatory to
inhibitory, it was observed in the same study that GABA
and glycine were inhibitory in wild-type neurons but excitatory in KCC2-null mice neurons. KCC2 silencing by
itself cannot explain the depolarizing shift of ECl. The
latter requires active accumulation of Cl⫺, which is likely
to act without the opposing force of KCC2. Development
of a KCC2-null mice exhibiting modest residual expression of KCC2 provided Woo et al. (437) with knockout
mice that survive some time after birth; this allowed the
investigators to study effects of dramatic, but not absolute, reduction in KCC2 expression. The homozygous null
mice exhibited continuous generalized seizures, because
these mice are very easily triggered by modest stimuli.
Constant epilepsy resulted in neuronal damage with postnatal death at ⬃17 days of age. Interestingly, heterozygous animals exhibited no particular phenotype but possessed a lower threshold for epileptic seizures induced by
pentylenetetrazole. That reduced KCC2 expression resulted in animals with intractable epilepsy is another
evidence for the role of this cotransporter in regulation of
neuronal excitability and suggests a role for KCC2 in
human epilepsy.
As previously discussed, coordinated expression of
electroneutral cation chloride cotransporters during development in certain neuronal groups is a primary event
defining the type of response to neurotransmitters that
interact with gated anion channels. The transition in the
response to GABA from excitatory in prenatal period to
inhibitory in postnatal life appears to be explained by
intraneuronal Cl⫺ concentrations that are observed in
developing versus in mature neurons (77). Developing
neurons exhibit an [Cl⫺]i that is maintained above its
electrochemical potential equilibrium, whereas mature
neurons exhibit [Cl⫺]i below its potential equilibrium. As
Figure 20 shows, change from excitatory in prenatal life
to inhibitory in postnatal life is associated with BSC2/
NKCC1 downregulation together with KCC2 upregulation
after birth (59, 243, 278, 328). In early development, BSC2/
NKCC1 appears to be the primary transporter responsible
for high intraneuronal Cl⫺ concentration. Expression of
this cotransporter, however, is downregulated after birth.
In contrast, expression of KCC2 in neuronal groups like
hipoccampal, cortical, and retinal neurons is absent during early development, but present after birth and during
adult life (346, 420); thus it is currently believed that
switching of intraneuronal Cl⫺ concentration in neurons
from early development to postnatal life is due to changes
in the type of electroneutral cotransporter that is expressed.
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
is prominent in neurons throughout the CNS. KCC2 expression is high in pyramidal neurons of the hippocampus, granular cells, and Purkinje neurons of the cerebellum, retinal neurons, and neuronal groups throughout the
brain stem (202). The neuronal restriction for KCC2 expression is probably due to negative transcriptional regulation in all other cells, since SLC12A5 genes possess a
single neuronal-restrictive silencing element (NRSE) that
is located just 3⬘ of exon 1. This restrictive element is
present in both human and mouse genes (205, 380).
In conjunction with NKCC1, KCC2 expression in neurons is extremely important in defining the type and magnitude of response to certain neurotransmitters such as
glycine and GABA during development and maturation. In
central neurons, binding of GABA to GABAA receptors in
adult animals opens ligand-gated Cl⫺ channels, allowing
inward movement of Cl⫺ into cells with the consequent
hyperpolarization. Thus in adult animals, GABA has a
hyperpolarizing inhibitory effect on neuronal excitability.
In contrast, binding of GABA to GABAA receptors during
early neuronal development produces an outward Cl⫺
current, resulting in membrane depolarization. The latter
is in all similar to that already discussed for adult sensory
neurons (see above). Several lines of evidence support
the hypothesis that, in addition to NKCC1, [Cl⫺]i is regulated during ontogeny by KCC2, thereby explaining the
perinatal differences in GABA response. KCC2 expression
levels are very low at birth, with a marked increase during
the first week of postnatal development (59, 250). Reduction of KCC2 expression in pyramidal cells from rat hippocampus using antisense oligonucleotides markedly
shifted the reversal potential of GABA response (346).
This is likely to be explained by releasing the action of
KCC2 on NKCC1. The latter now works without the opposing thermodynamic force of KCC2. Depolarizing response to GABA early in development triggers Ca2⫹ influx
via both voltage-dependent and NMDA-gated channels
(131, 240), with significant neurodevelopmental consequences (47, 160, 212). In this regard, while GABA induced expression of KCC2 protein, thus limiting its brief
window of neurotrophic effect (240), brain-derived neurotrophic factor (BDNF) and neurotrophin-4 decrease
KCC2 expression, thus amplifying neuronal excitability in
conditions associated with upregulation of BDNF (345).
As discussed in section IIIE, KCC2 is the K⫹-Cl⫺
cotransporter with the higher affinity for both cotransported ions (310, 380), which is appropriate to the emerging role of KCC2 as a buffer of both external K⫹ and
internal Cl⫺ that was suggested by Payne (310). Thus, if
extracellular K⫹ is increased during neuronal activity
to values as high as 10 –12 mM, a range wherein KCC2
is highly active, driving force for net K⫹-Cl⫺ cotransport
will switch from efflux to influx. This reversibility of
K⫹-Cl⫺ cotransport has been verified experimentally (75,
193, 201).
467
468
GERARDO GAMBA
F. Kⴙ-Clⴚ Cotransporter 3
KCC3 cDNA was independently identified by three
groups in 1999 (178, 178, 292, 331, 331). Since then, study
of this K⫹-Cl⫺ cotransporter has begun to reveal interesting roles in cell growth and in CNS, inner ear, and vascular physiology. The role in cell growth will be discussed in
section VIE.
KCC3 protein is expressed in most brain areas, including hypothalamus, cerebellum, brain stem, cerebral
cortex, and white matter (315). It is also abundant in
spinal cord and is expressed at very low levels in dorsal
root ganglia. A possible role of KCC3 protein in cerebrospinal fluid K⫹ reabsorption is suggested by its presence
at the base of the choroid plexus. The neuronal groups
expressing KCC3 are the large hippocampal neurons, cortical pyramidal neurons, and cerebellar Purkinje neurons,
as well as in white matter tracts throughout the brain.
Ontogeny of KCC3 correlates with development of myelin, because expression is low at birth and increases
during postnatal development, similar to the pattern observed for myelin binding protein (29, 315).
Mutations in KCC3 are the cause of a rare neurological illness known as Anderman’s disease, also known as
hereditary motor and sensory neuropathy associated with
agenesis of the corpus callosum (HMSN/ACC, OMIM
218000). This is an interesting disease because some of
Physiol Rev • VOL
the clinical manifestations are due to developmental
problems (in neurons), while others are due to neurodegeneration (particularly in white matter). In addition, the
clinical picture includes deficiencies of both central and
peripheral nervous system, as well as in cognitive activity.
KCC3 central role in CNS development and function has
been corroborated by reproduction of most of the neurological problems seen in Anderman’s disease in a KCC3
knockout mice model (42, 183). Mice homozygous for
disruption of KCC3 were found to exhibit severe locomotor deficit, peripheral neuropathy, and sensorimotor gating deficit. Mice did not have agenesis or dysgenesis of the
corpus callosum. Although these findings collectively reveal critical roles for KCC3 in development and maintenance of nervous system, it remains unknown how loss of
KCC3-mediated K⫹-Cl⫺ cotransport causes various features of HMSN/ACC, and why absence of KCC3 cannot be
compensated by other KCCs also present in neurons.
Reduction in cell growth or cell volume regulation observed in KCC3-null mice neurons (42) could be implicated in progressive neurodegeneration.
In addition to BSC2/NKCC1 (see above) and KCC4
(see below), KCC3 have an important role in development
and function of inner ear (42). In normal conditions, KCC3
is expressed in supporting cells of inner and outer hair
cells, in epithelial cells of the organ of Corti, and in type
I and III fibrocytes of stria vascularis. In contrast to
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
FIG. 20. Schematic representation of
relationship between maturation of neurons, type of response to GABA, and expression of electroneutral cotransporters. Right and left diagrams depict BSC2/
NKCC1 and KCC2 cotransporters expression
and a representative whole cell voltageclamp analysis showing the type of responses to GABA. The left diagram
shows prenatal situation in which KCC2
expression is minimal and BSC2/NKCC1
expression is robust. The response to
GABA is excitatory. In contrast, the right
panel shows the postnatal situation.
BSC2/NKCC1 expression is reduced,
whereas KCC2 expression is increased,
resulting in a response to GABA that is
inhibitory. [Modified from Delpire (77)
and Mercado et al. (274).]
ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS
Physiol Rev • VOL
sodium nitroprusside and the nitric oxide-independent
soluble guanylyl cyclase activator YC-1 induced upregulation of KCC1 mRNA expression. The soluble guanylyl
cyclase inhibitor LY83583 abrogates positive effects of
both sodium nitroprusside and YC-1, indicating that activation of guanylyl cyclase is involved. In addition, 8-bromo-cGMP also increased KCC1 mRNA expression by a
mechanism that was partially abrogated by KT5823. Thus
mRNA expression of both KCC1 and KCC3 is enhanced by
activating the nitric oxide/cGMP pathway. A further study
in primary cultures of rat vascular smooth muscle cells
revealed that fast nitric oxide releasers NONOates such as
NOC-5 and NOC-9, but not the slow releaser NOC-18, are
able to upregulate KCC1 and KCC3 mRNA levels. NOC-5
and NOC-9 effects were prevented by the soluble guanylyl
cyclase inhibitor LY83583, indicating again that activation
required the classical pathway of nitric oxide-soluble guanylyl cyclase-cGMP-PKG (86). Finally, the most recent
work related to this issue revealed that sodium nitroprusside, YC-1, and 8-bromo-cGMP increased mRNA levels of
both KCC3a and KCC3b isoforms, with more apparent
effect in KCC3b (85). All these data showing that powerful
vasodilators induce activation of KCC3 cotransporter suggest that KCC3 activity could be associated with vasodilatation. If this turns out to be true, then derangement in
KCC3 activity could be associated with decreased vasorelaxation, thus increasing peripheral vascular resistance.
For this reason, the development of high blood pressure
in KCC3-null mice (42) is an important observation that
supports a role of KCC3 in arterial pressure regulation.
G. Kⴙ-Clⴚ Cotransporter 4
KCC4 is the K⫹-Cl⫺ cotransporter isoform for which
less information is available regarding its role in global
physiology. This isoform was identified by Mount et al.
(292), and its tissue distribution is basically ubiquitous,
although in certain tissues expression is less apparent
than that of KCC1. Northern blot analysis of KCC4 in
nervous tissues suggested that no transcripts are present
in the CNS; however, recent studies using RT-PCR and
Western blot using specific antibodies have shown that
KCC4 is present in both the central and peripheral nervous system, with higher expression in peripheral nerves
(trigeminal, sciatic) and spinal cord than in whole brain
(29, 204). Within the brain, expression of KCC4 is higher
in the brain stem, followed by midbrain, with minimal to
nonexpression in cerebral cortex and hippocampus. Thus
there is a gradient of KCC4 expression in the nervous
system that goes forebrain ⬍ midbrain ⬍ spinal cord ⬍
peripheral nerves. In addition, evidence was shown by
Karadsheh et al. (204) that KCC4 is present not only in
neurons, but also in oligodendrocytes and in the apical
membrane of choroid plexus epithelial cells, suggesting a
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
observations on BSC2/NKCC1 (79) and KCC4 (41) knockout mice, deafness in KCC3 is not present at birth and
develops during the first year of life, associated with the
degenerative process of the cochlea.
Arterial pressure is elevated in KCC3 knockout mice
(42). This variable was not assessed in knockout animals
from Howard et al. (183) and does not appears to be a
major clinical problem in patients with HMSN/ACC (96);
however, the average age of death in Anderman’s patients
is 24 years, which could be an early stage for hypertension
to be present. Boettger et al. (42) by means of chronic
implanted catheters observed that arterial pressure in
wild-type mice at 3–5 mo of age was 100 ⫾ 2 mmHg,
whereas in KCC3 knockout mice it was 118 ⫾ 2 mmHg
(P ⬍ 0.01). The mechanism is not known but could be
related to expression and activity of KCC3 in vascular
smooth muscle cells (178) or kidney (42, 293). In this
regard, interesting studies have been produced revealing
a role of nitric oxide and vasodilators in regulating KCC3
activity in vascular smooth muscle cells. First, it was
observed in low potassium (LK) sheep red blood cells that
activity of K⫹-Cl⫺ cotransporter was increased by nitric
oxide (3). Because nitric oxide is a potent vasodilator,
investigators hypothesized that activation of KCCs in vascular smooth muscle by nitric oxide could be implicated
in vasodilation. Thus Adragna et al. (4) assessed the effect
of several vasodilatory drugs such as hydralazine, sodium
nitroprusside, isosorbide mononitrate, and pentaerythritol on K⫹-Cl⫺ cotransporter activity in LK red blood cells
and vascular smooth muscle cells in primary cultures. All
vasodilators activated K⫹-Cl⫺ cotransporter in both types
of cells, and a specific inhibitor of protein kinase GKT5823 abolished the increase in K⫹-Cl⫺ cotransporter activity induced by sodium nitroprusside. In addition, inhibition of K⫹-Cl⫺ cotransporter decreased vasodilatory
response magnitude to hydralazine; thus it was suggested
that the K⫹-Cl⫺ cotransporter was activated by nitric
oxide through a cGMP pathway and that this activation
was involved in response to vasodilators.
Molecular analysis of vascular smooth muscle cells
revealed that among K⫹-Cl⫺ cotransporters, KCC1 and
KCC3 are expressed, whereas KCC2 and KCC4 are not
present. KCC1 abundance is higher than KCC3 by a 2:1
relation (87). mRNA expression of both cotransporters
was analyzed under experimental conditions designed to
activate protein kinase G (PKG). With the use of semiquantitative PCR strategy, it was observed that KCC3
mRNA expression was upregulated by the cell membranepermeable 8-bromo-cGMP. This effect was abrogated by
the PKG inhibitor KT5823, indicating that activation of
PKG is involved and was not affected by concomitant
incubation with actinomycin D, suggesting that increased
transcription of the SLC12A6 gene is not involved (87).
Similar observations were obtained for KCC1 mRNA (84).
In this study it was observed that the nitric oxide donor
469
470
GERARDO GAMBA
VI. PATHOPHYSIOLOGICAL ROLES
Given the multiple physiological roles for electroneutral cation-coupled chloride cotransporters in the kidney,
CNS, and other organs, it was expected that variations in
function and/or expression of these genes played a role in
human pathophysiology. To date, inactivating mutations
of three members in this family have been shown to be
linked with development of inherited conditions such as
Physiol Rev • VOL
Gitelman’s, Bartter’s, and Anderman’s diseases. In addition, changes in functional regulation of TSC in Gordon’s
disease have been suggested to be a key mechanism in the
pathophysiology of this inherited disease in which genetic
primary defect occurs in other genes. Finally, the known
physiological role of cotransporters, together with their
involvement in inherited diseases and observations performed in knockout mice with targeted disruption of each
electroneutral cotransporter, indicate that members of
this family are also potentially involved in some of the
most important polygenic diseases, such as hypertension,
epilepsy, cancer, and osteoporosis. In this section, we
review each of the inherited diseases due to primary
defects in members of cation-coupled chloride cotransporters and the evidence for their involvement in polygenic diseases.
A. Gitelman’s Disease
In 1966, Gitelman, Graham, and Welt (145) reported
the metabolic study of three patients seen at the North
Carolina Memorial Hospital (United States) featuring a
syndrome characterized by hypokalemia, hypomagnesemia, and metabolic alkalosis who exhibited clear
renal impairment for conservation of potassium and magnesium. Patients were not hypertensive and had normal
urinary excretion of aldosterone, excluding primary aldosteronism. Two of the three patients were sisters, and
their parents were distantly related through a common
male ancestor. Since then, this rare inherited condition is
known as Gitelman’s disease and features an autosomal
recessive pattern of inheritance. The majority of affected
patients began with the clinical picture in the second or
third decade of life, clinically evidenced by hypokalemic
metabolic alkalosis, accompanied with arterial hypotension, hypocalciuria, and hypomagnesemia. The clinical
picture resembles that observed in patients intoxicated
with thiazide-type diuretics and is similar to that present
in Bartter’s disease; thus these two conditions are the
major differential diagnosis. In 1992, Bettinelli et al. (34)
studied a cohort of 34 pediatric patients with inherited
hypokalemic metabolic alkalosis among whom Bartter’s
disease was present in 18 and Gitelman’s disease was
present in 16. Because children with Bartter’s disease
exhibited hypercalciuria, while those with Gitelman’s disease exhibited hypocalciuria, the investigators concluded
that both diseases are easily distinguishable on the basis
of urinary calcium excretion.
Due to resemblance of Gitelman’s disease with clinical and metabolic picture of chronic thiazide-type diuretic intoxication, TSC became a strong candidate for
the cause of the disease. Thus, after molecular identification of TSC from fish and mammalian sources (136, 137),
complete linkage between Gitelman’s disease and the
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
role for this K⫹-Cl⫺ cotransporter isoform in K⫹ reabsorption. Finally, KCC4 expression is downregulated after
birth (243).
Specific role of KCC4 in CNS physiology has not been
elucidated. KCC4 knockout animals were normal at birth
and exhibit no apparent malfunction of the nervous system. At an early age (14 days), hearing in KCC4-null mice
is normal; however, it quickly deteriorates over the next
10 days, at the end of which the mice are completely deaf
(41). This is associated with total loss of outer hair cells of
basal cochlea by 21 days of age. Because immunohistochemical analysis of wild-type mice demonstrated that
within the inner ear KCC4 is expressed in Deiters’ cells,
which have been suggested to transport K⫹ from outer
hair cells (and thus endolymph) to adjacent epithelial
cells, thus recycling K⫹ via stria vascularis, it was postulated that absence of K⫹ transport in Deiters’ cells results
in reduction of K⫹ absorption by outer hair cells and thus
accumulation in endolymph.
KCC4 plays an interesting role in acid-base metabolism. KCC4-null mice develop renal tubular acidosis. Urinary pH in knockout mice was observed to be significantly higher than in wild-type animals (7.3 ⫾ 0.1 vs. 6.4 ⫾
0.1, P ⬍ 0.01) and thus null animals develop compensated
metabolic acidosis (41). Intrarenal distribution analysis of
KCC4 by means of polyclonal antibodies revealed abundant expression in basolateral membrane of several
nephron segments, including proximal tubule, DCT, and
CD. In this later part of the nephron, expression is heavy
in ␣-intercalated cells that are in charge of proton secretion (41, 293, 414). Thus it has been postulated that KCC4
activity in intercalated cells could be required for basolateral Cl⫺ extraction, which in turn is necessary to keep
the AE1 Cl⫺/HCO3⫺ exchanger fully active. In this regard,
Boettger et al. (41) demonstrated high intracellular Cl⫺
concentration in KCC4 knockout mice ␣-intercalated
cells. In addition, as previously discussed in section IIIG,
K⫹-Cl⫺ cotransporters are able to transport ammonium
instead of K⫹. Finally, expression of KCC4 in basolateral
membrane of TALH could account for the proposed basolateral K⫹-Cl⫺ cotransport activity described by Greger
et al. (155). Although KCC4 is expressed in many other
tissues, physiological roles for its presence have not been
reported.
ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS
amino- to the carboxy-terminal domain of TSC, without
preference for a particular location along the protein (55,
64, 67, 241, 245, 259, 264, 271, 281, 307, 339, 377, 395, 396,
398, 442, 449). Figure 21 illustrates the proposed TSC
secondary structure and location of the majority of reported mutations. Up to 77% result from nucleotide substitutions producing missense or nonsense mutations or
frame shifts that terminate in truncated proteins. In general, these substitutions occur in amino acid residues that
are conserved among TSC from human, rat, mouse, rabbit, and flounder. Small deletions are responsible for
10.4% of mutations, whereas nucleotide substitutions affecting either donor or acceptor splice sites are responsible for 7.2%. The remainder is due to micro-lesions, such
as small insertions or indels.
Gitelman’s disease is an autosomal recessive disorder. Thus one would expect that the majority of patients
would exhibit homozygous mutations inherited from both
parents; however, this occurs only in 18% of cases. There
⫹
⫺
FIG. 21. Mutations in human thiazide-sensitive Na -Cl cotransporter TSC reported in patients with Gitelman’s disease. Each circle represents
one amino acid residue. All circles in red represent mutations. Mutations numbered 1–9 are the following: 1, W174; 2, S178L; 3, Y180K; 4, R261H;
5, P349L; 6, A464T; 7, F536L; 8, L542P; and 9, A569V. There is a blue circle every 25 residues. Every 100 residues are numbered. The black circle
in transmembrane segment 4 depicts the position of a single nucleotide polymorphism G264A.
Physiol Rev • VOL
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
locus for TSC in human chromosome 16 was observed by
several groups (242, 264, 329, 377). This information
strongly suggested that inactivating mutations of
SLC12A3 were the causative agent of Gitelman’s disease.
Later, a phenotype resembling Gitelman’s disease was
obtained in mice by targeted disruption of TSC gene
(363), and heterologous expression in X. laevis oocytes of
mouse or human TSC cRNA containing some point mutations reported in Gitleman’s kindreds revealed that mutant TSC proteins are nonfunctional (72, 221). Thus it is
currently accepted that Gitelman’s disease is due to inactivating mutations of TSC.
At present, ⬃65 independent kindreds with Gitelman’s disease have been studied, and the majority of
reported mutations have been deposited in the Human
Gene Mutation Database at the Institute of Medical Genetics in Cardiff, United Kingdom (http://archive.uwcm.
ac.uk/uwcm/mg/hgmd0.html). There are ⬃100 different
mutations spread throughout the SLC12A3 gene, from the
471
472
GERARDO GAMBA
mechanisms by which mutations reduce or abolish transporter activity. A mutation could 1) impair protein synthesis, 2) impair protein processing, 3) impair insertion of
an otherwise functional protein into plasma membrane,
4) impair functional properties of the cotransporter, and
5) accelerate protein removal or degradation. Although
not studied, it is highly likely that mutations that introduce stop codons or produce frame shifts and those in
which splicing is abolished resulting in nonsense proteins
belong to group 1 (Fig. 22), in which synthesis of the
complete protein is impaired (375, 395, 408). Using heterologous expression system in X. laevis oocytes, Kunchaparty et al. (221) analyzed functional consequences of
several missense mutations reported along TSC protein in
kindreds with Gitelman’s disease; they observed that proteins were synthesized but were not properly glycosylated
and not expressed at the plasma membrane. These results
indicated that the majority of Gitelman’s missense mutations pertain to the second possibility (Fig. 22) because
they impair cotransporter function by interfering with
protein processing. These conclusions are supported by
results from Hoover et al. (181) indicating that glycosylation of TSC is required for proper folding and trafficking
of cotransporter to plasma membrane. Later, functional
properties and surface expression analysis performed by
De Jong et al. (72) and Sabath et al. (352) revealed that
Gitelman’s missense mutations resulting in partial functional proteins belong to the third possibility in Figure 22,
in which missense mutation results in a cotransporter
with apparently normal processing and normal functional
and kinetic properties, but in which insertion into plasma
membrane is partially impaired. Interestingly, as reviewed
later, missense mutations of other members of the electroneutral cotransporter family, such as the Na⫹-K⫹-2Cl⫺
cotransporter in type I Bartter’s disease (384) and the
KCC3 K⫹-Cl⫺ cotransporter in Anderman’s disease (183),
2) Defects in protein processing
Bartter (384), Gitelman
(72,221)
1) No protein synthesis
Bartter (374,408), Gitelman (376)
3
1
3) Impaired protein insertion
Gitelman (72,352)
2
4
5
5) Accelerate protein removal
4) Impaired functional properties
Bartter syndrome-BSC1 (384)
Anderman syndrome-KCC3 (184)
Physiol Rev • VOL
85 • APRIL 2005 •
www.prv.org
FIG. 22. Molecular mechanisms explaining
decreased activity of electroneutral cotransporters in inherited syndromes. [Modified from
Sabath et al. (352).]
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
is great variability in the mutation pattern in each kindred.
In a review of all mutations reported up to 2002, Reissinger et al. (339) showed that ⬃45% of all patients are
compound heterozygous, that is, inherited mutations
from the father and the mother are different. That compound heterozygosis is the most common form of the
disease is shown in most reports containing more than
one kindred (for examples, see Refs. 67, 241, 245, 259, 377,
395). Surprisingly, the second most common finding is
heterozygous patients, that is, when the mutation was
found only in one allele and occurred in up to 30% of
kindreds. Because inheritance of Gitelman’s disease is
clearly recessive and heterozygous relatives of patients
with Gitelman’s disease are clinically and metabolically
asymptomatic, it is likely that there was a failure to detect
the mutation in the other allele in heterozygous patients.
The most common approach for study of mutations in the
SLC12A3 gene has been the single-strand conformation
polymorphism (SSCP) known to have limitations in resolution power. In addition, only exon and exon-boundary
mutations have been studied; thus mutations in promoter
regions, within regulatory elements at both 5⬘- and 3⬘UTRs, within poly(A) signal sequence and within introns
have not been excluded. Only ⬃18% of patients exhibit
the classical homozygous pattern in which the same mutation was inherited from both parents. Finally, in 7% of
patients, three or more mutations occur. Only one study,
in 20 patients from 12 different European families who
were of Gypsy origin, revealed the same mutation in all
patients (64). All these patients were homozygous for a
substitution of G for T in the first position of intron 9,
affecting consensus donor splice site motif and resulting
in a nonsense protein. Identical mutation in Gypsy families from distinct European regions suggests an ancient
mutation originating from a common ancestor.
As shown in Figure 22, there are at least five potential
ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS
B. Bartter’s Disease
Bartter’s disease was originally described in 1962 by
Bartter et al. (23) as a salt-losing nephropathy accompanied by polyuria, hypokalemic metabolic alkalosis, and
hypertrophy of the juxtaglomerular complex. It is now
known that Bartter’s disease represents a group of autosomal-recessive disorders with common underlying
pathophysiology due to absence or severe reduction in
TALH ability for salt reabsorption. The majority of patients with this disease are seen in consanguineous families. This is a more severe nephropathy than Gitelman’s
disease, because the clinical picture is usually apparent in
the first year of life or even in antenatal period as excessive accumulation of amniotic fluid (polyhydramnios).
The characteristic clinical picture includes a salt-wasting
state with low blood pressure, metabolic alkalosis with
hypokalemia, hypereninemia, and secondary aldosteronism (366). The majority of patients also exhibit hypercalciuria and some develop nephrocalcinosis. Elevated levels of prostaglandin E2 in blood and urine are common,
particularly in patients with antenatal disease, and it is
known that treatment with cyclooxygenase inhibitors
such as indomethacin improves child development and
facilitates salt and water-loss management. The fact that
clinical and biochemical response to indomethacin and
the specific cyclooxygenase-2 inhibitor Refecoxib are
similar strongly supports that increased prostaglandin E2
is due to chronic activation of cyclooxygenase-2 activity
in the macula densa (338).
Bartter’s disease is a monogenic, but nevertheless
heterogeneous, disease in which at least five different
genes in the TALH are implicated. Three are directly
involved in salt reabsorption, and two genes regulate salt
transporters. Thus Bartter’s disease is classified into five
types: the first four are due to inactivating mutations,
whereas type V is the result of activating mutations. Although five different genes have been associated with
FIG. 23. Relationship between age- and sex-adjusted
diastolic blood pressure (left) and urinary sodium excretion
(right) in a large family with Gitelman’s disease including 26
patients with Gitelman’s disease (⫺/⫺), 113 heterozygous
subjects (⫺/⫹), and 60 normal subjects (⫹/⫹). *Groups
⫺/⫹ and ⫹/⫹ are different from ⫺/⫺ group (P ⫽ 0.002).
**Groups ⫺/⫺ and ⫺/⫹ are different from ⫹/⫹ group (P ⫽
0.06). [Modified from Cruz et al. (68).]
Physiol Rev • VOL
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
behave as the fourth possibility in Figure 22, because
mutated proteins are normally produced and inserted into
plasma membrane, implying a defect in functional properties or intrinsic activity of the cotransporter.
Careful clinical study of several unrelated patients
with Gitelman’s disease allowed Cruz et al. (67) to obtain
an interesting record of clinical and metabolic consequences of diminished TSC activity in humans. Matched
comparison of 50 unrelated patients with normal subjects
revealed that although Gitelman’s disease is not clinically
apparent until the third decade of life (age of diagnosis in
this cohort was 28.3 ⫾ 2.1 yr), patients exhibited a significantly reduced quality of life due to the presence of
several unspecific symptoms such as salt craving, thirst,
dizziness, fatigue, muscle weakness, cramps, paresthesias, nocturia, polydipsia, and polyuria. As a consequence,
patients with Gitleman’s disease have significantly lower
scores in terms of limitations caused by physical health,
emotions, energy level, and general health perception.
Cruz et al. (68) also performed an analysis of a large
family of 199 members, of whom 26 were patients with
Gitelman’s disease (both alleles affected), 113 were heterozygous (one allele affected), and 60 were normal subjects. Of the 26 affected patients, 17 were homozygous for
deletion of exons 1–7 and 9 patients were compound
heterozygous, exhibiting one allele with exon 1–7 deletion
and another allele with a missense mutation Gly642Ala in
the carboxy-terminal domain. As expected, patients with
Gitelman’s disease exhibit a significantly lower blood
pressure. Interestingly, however, as shown in Figure 23,
although blood pressure in heterozygous subjects was
normal, 24-h sodium urine excretion was significantly
higher, suggesting that heterozygous subjects have selfselected a higher sodium intake sufficient to compensate
for a mild salt-wasting disorder, including low blood pressure. Thus one of the most important roles of TSC is
participation as one of the gene products defining the
normal blood pressure.
473
474
GERARDO GAMBA
Physiol Rev • VOL
with the consequent depletion of intracellular K⫹, thus
decreasing the driving force for K⫹ secretion into cochlear duct. Reduction in K⫹ concentration of endolymph
in the cochlear duct is associated with deafness.
Another possible mechanism for developing Bartter’s
disease with sensorineural deafness is by inheriting inactivating mutations in both CLC-KA and CLC-KB (358),
producing a type IV-like disease. Finally, two reports have
shown that gain-of-function mutations in calcium-sensing
receptor also produce a Bartter’s-like disease, now known
as Bartter’s disease type V (409, 429). The calcium-sensing
receptor is heavily expressed in the basolateral membrane of TALH (343, 344), and its activation by extracellular calcium reduces apical BSC1/NKCC2 and ROMK
proteins activity (342). In other words, by activating the
calcium-sensing receptor, extracellular calcium produces
a furosemide-like effect in TALH. Mutations L125P,
C131W, and A845E (409, 429) produce a shift to the left in
calcium EC50, maintaining the calcium-sensing receptor
fully activated at low calcium levels, thus behaving as
activating mutations.
Figure 24 depicts a panel with the proposed secondary structure of each protein responsible for Bartter’s
disease types I-IV and the locations of missense mutations
that have been deposited in the Human Gene Mutation
Database at the Institute of Medical Genetics in Cardiff,
United Kingdom (http://archive.uwcm.ac.uk/uwcm/mg/
hgmd0.html). With the exception of Barttin, mutations are
distributed along BSC1/NKCC2, ROMK, or CLC-KB without preference within the protein. There are only five
studies reporting mutations in Bartter’s type I patients
(132, 224, 375, 384, 408). Figure 24 depicts all mutations
described along the SLC12A1 gene. Missense mutations
include G193R, R199G, G224D, G243E, A267S, V272F,
R302Q, G319R, C436Y, del245Y, G478A, S507P, A508T,
A510D, del526N, A555T, T625X, D648N, and Y998X. In
addition, five different small deletions producing frame
shifts, and thus truncated proteins, have been reported.
Mutations in BSC1/NKCC2 are distributed through the
cotransporter. In contrast to what is observed in Gitelman’s disease, in which compound heterozygosity is the
most common genomic finding, 50% of patients with type
I Bartter’s disease are homozygous for one mutation, 15%
are compound heterozygous, and in 35% only a heterozygous mutation was observed. The most common defects
are missense mutations, followed by truncated proteins
due to either frame shifts or generation of stop codons.
Functional expression analysis of BSC1/NKCC2 mutants
G193R, A267S, G319R, A508T, del526N, and Y998X by
Starremans et al. (384) revealed that the molecular mechanism of disease in these mutants is different from what
has been observed in the Gitelman’s mutations discussed
previously (see Fig. 22). Expression levels in X. laevis
oocytes of BSC1/NKCC2 harboring these mutations were
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
Bartter’s disease, not all kindreds have been shown as
linked with the chromosomal regions in which these
genes are located; that is, there remain kindreds in which
the disease gene has not been found, indicating that there
should be at least a sixth gene implicated in production of
this monogenic disease.
As shown in Figure 18B and discussed in section VB,
three transport proteins are required for proper salt reabsorption in the TALH: the apical bumetanide-sensitive
Na⫹-K⫹-2Cl⫺ cotransporter BSC1/NKCC2, the apical inward rectifying K⫹ channel ROMK, and the basolateral
chloride channel CLC-KB. Inactivation of any of these
transport proteins results in severe blockade of salt reabsorption in TALH and thus constitutes the first three types
of Bartter’s diseases. Type I is due to inactivating mutations in BSC1/NKCC2 (35, 224, 318, 375, 408) because
absence of a functional Na⫹-K⫹-2Cl⫺ cotransporter in
apical membrane prevents salt transport in the TALH.
Bartter syndrome type II is due to inactivating mutations
in ROMK (83, 207, 376, 419). When apical K⫹ channels are
not functional, absence of K⫹ recycling quickly depletes
the luminal fluid of K⫹; hence, Na⫹-K⫹-2Cl⫺ cotransporter activity is prevented. Consistent with these two
gene defects, mice knockout models of types I and II
Bartter’s diseases have been produced by targeted disruption of BSC1/NKCC2 (397) and ROMK (249), respectively.
Both models exhibit a salt-wasting syndrome with polyuria and progressive renal failure, with a high mortality
rate in the first week of life (⬎95%).
Bartter’s disease type III is the result of an inactivating mutation in CLC-KB (218, 373). Absence of an efficient
chloride-extrusion mechanism in TALH prevents chloride
efflux, with a consequent increase in intracellular chloride
concentration that in turn reduces activity of both the
Na⫹-K⫹-2Cl⫺ cotransporter and K⫹ channels. Bartter’s
disease type IV is the result of inactivating mutations in a
protein known as Barttin (BSND) (39). BSND is a regulatory subunit of chloride channels CLC-KA and CLC-KB
(113) that is not required for channel activity itself, but
that is necessary to drive chloride channels CLC-KA and
CLC-KB to plasma membrane (421). Thus absence in
CLC-KB activity is a consequence of inactivation of
BSND. Children with Bartter’s disease type IV due to
mutations in BSND also exhibit sensorineural deafness.
The reason is that BSND is not only a subunit of CLC-KB,
but also of CLC-KA, which is heavily expressed in the
basolateral membrane of marginal cells of stria vascularis
of the cochlea and dark cells localized at the base of crista
ampullaris of vestibular organ (39). Here, CLC-KA, and
thus BSND, is required for extrusion of intracellular chloride. In the absence of this efflux mechanism, accumulation of chloride within cells prevents the activity of the
basolateral Na⫹-K⫹-2Cl⫺ cotransporter BSC2/NKCC1,
475
ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS
significantly lower than wild-type. The first three were
properly glycosylated, whereas the latter three were not
further processed; nevertheless, all these mutations were
correctly routed to the plasma membrane, suggesting that
studied mutations probably result from the fourth possibility in Figure 22, in which proteins are normally pro-
TABLE
cessed but exhibit a dramatic decrease in intrinsic cotransporter activity.
Finally, as seen in Table 11, there are similarities and
differences in clinical features of patients with Bartter’s
disease, according to the gene causing the disease; thus
there is a clinical-molecular correlation. All patients
11. Clinical features of patients with Bartter’s disease according to genomic classification in type I to IV
Affected gene
Hypokalemia
Metabolic alkalosis
Age of onset
Poliuria
Nephrocalcinosis
Polyhydramnios
Sensorineural deafness
End-stage renal disease
Type I
Type II
Type III
Type IV
SLC12A1
Severe
Moderate
Neonatal
Yes
Yes
Yes
Rare
No
KCNJ1/ROMK
Severe
Moderate
Neonatal
Yes
Yes
Yes
Rare
No
C1CNKB
Moderate
Mild
First decade
Uncommon
No
No
No
No
BSND
Severe
Moderate
Neonatal
Yes
Yes
Yes
Yes
Yes
Physiol Rev • VOL
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
FIG. 24. Inactivating mutations in four membrane proteins causing Bartter’s disease. Protein proposed topology and mutations are shown for
Na⫹-K⫹-2Cl⫺ cotransporter BSC1/NKCC2 (132, 224, 375, 384, 408), K⫹ channel ROMK (194, 207, 362, 376, 383, 419), Cl⫺ channel CLC-CK (218, 373),
and barttin (39), as stated. Mutations in this figure are those that have been deposited into Human Gene Mutation Database at Cardiff and reported
in corresponding articles.
476
GERARDO GAMBA
present with hypokalemia and metabolic alkalosis, which
are less severe in type III patients. Antenatal presentation
and polyhydramnios are more often seen in Bartter’s type
I, II, and IV, than in type III disease. In addition, patients
with type III disease do not develop nephrocalcinosis.
Type IV is associated with deafness and with development
of chronic renal failure (168, 270). Therefore, age of clinical presentation and certain features such as nephrocalcinosis, deafness, and chronic renal failure help the clinician to orientate the molecular analysis to find out the
diseased gene.
C. Anderman’s Disease
Physiol Rev • VOL
D. Gordon’s Disease
A syndrome of salt-dependent hypertension with hyperkalemia and hyperchloremic metabolic acidosis accompanied by suppression of the renin angiotensin aldosterone
axis was described in 1970 by Gordon et al. (147). The
disease was later proposed for being named pseudohypoaldosteronism type II (PHAII) by Schambelan et al.
(357), due to its resemblance with pseudohypoladoternism type I. The disease is today known as either PHAII or
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
In 1972, Andermann and colleagues (96) reported an
inherited disease described in patients with agenesis of
corpus callosum with anterior horn cell disease. The majority of their patients showed clear evidence of central
and peripheral neurologic disease with mental retardation, areflexia, and paraplegia (96). This complex disease
is better known as hereditary motor and sensory neuropathy associated with agenesis of corpus callosum (HMSN/
ACC, OMIM 218000). It is a severe sensorimotor neuropathy transmitted in autosomal-recessive fashion and is
found at high frequency in the French-Canadian population of Quebec, Canada in two northeastern regions of the
country known as Saguenay-Lac-St-Jean region and Charlevoix County (183), due to a French founder effect. Patients with this defect exhibit clinical features of both
developmental and neurodegenerative problems that involve both central and peripheral nervous system. An
extensive study of 64 patients (266) revealed that in addition to several neurologic features such as pthosis, upper-gaze palsy, facial asymmetry, areflexia, and scoliosis,
the majority of patients usually have some degree of
mental retardation that ranges from mild to severe. Psychotic episodes are not uncommon; thus cognitive function is also affected. Radiologic examination shows no
evidence of agenesis of the corpus callosum in 33% of cases,
partial agenesis in 9%, and complete agenesis in 58%.
It was first established by fine mapping that the gene
responsible for HMNS/ACC was located in chromosome
15q (182); later within this region the SLC12A6 gene
encoding K⫹-Cl⫺ cotransporter KCC3 was found to be
linked with this syndrome (183). By SSCP, all 81 FrenchCanadian patients studied by Howard et al. (183) were
homozygous for a guanidine deletion at exon 18 in nucleotide 2436 (delG2436). This deletion converts a GT-splice
donor into TA, resulting in a splicing defect, thus generating a frame shift that produces a truncated protein at
amino acid residue 813; the last 338 residues are removed.
This truncation occurs in KCC3 ⬃94 residues after TM12.
There is only one patient reported as compound heterozygous, with one allele having the typical delG2436 and the
other allele, with a cytosine and thymine deleted, together
with guanidine insertion in exon 11, resulting also in a
truncated protein (183). The G2436 deletion results in a
protein normally processed, glycosylated, and inserted
into plasma membrane, but it is not functional, suggesting
that absence of most of the KCC3 carboxy-terminal domain is not necessary for processing or trafficking of the
cotransporter, but it is required to endow KCC3 with
K⫹-Cl⫺ cotransporter capacity. Thus delG2436 mutation
probably results in the fourth possibility in Figure 22, in
which proteins are normally processed but exhibit a dramatic decrease in intrinsic cotransporter activity. Mutations in SLC12A6 in patients from other countries with a
clinical picture similar to that of HMSN/ACC have also
been found. Two children from Verona, Italy, are homozygous for a mutation in exon 15 in which arginine-675 is
replaced by a stop codon (R675X), truncating the protein
just after the beginning of the carboxy-terminal domain,
while two boys from Turkey exhibit a nonsense mutation
in exon 22, truncating the protein at residue 1011
(R1011X) (81, 96, 183). Thus, in contrast to that observed
in Gitelman’s disease, in which ⬎100 mutations in TSC
have been observed without preferences along the protein, nearly all studied patients with Anderman’s disease
share the same deletion-mutation in nucleotide 2436 due
to a clear founder effect or to the fact that they inherited
another mutation that also truncates the protein in the
carboxy-terminal domain.
Supporting genetic association between SLC12A6
and HMSN/ACC as discussed previously, Howard et al.
(183) also showed that mice homozygous for a deletion of
exon 3 within the SLC12A6 gene developed severe locomotor deficit, peripheral neuropathy, and sensorimotor
gating deficit; similar observations were obtained by Boettger et al. (42) also by deleting exon 3. Mice did not
exhibit partial or complete agenesis of corpus callosum. It
is known, however, that this is a variable feature in human
disease, even within the same kindred. Interestingly, prepulse inhibition (PPI), a measure of sensorimotor gating,
was defective in KCC3-null mice and reduced in heterozygous mice, suggesting a gene-dosage effect. This defect
has potential relevance with regard to psychotic episodes
often seen in HMSN/ACC patients.
ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS
Physiol Rev • VOL
WNKs are a novel group of kinases discovered by Xu
et al. (439) during their searching for novel members of
the mitogen-activated protein (MAP)/extracellular signalregulated protein kinase (ERK) kinase (MEK) family. A
novel 7.2-kb cDNA encoding a serine/threonine kinase of
2,126 amino acid residues was cloned from a rat brain
cDNA library. A major characteristic was absence of catalytic lysine that is usually found in subdomain II in all
known protein kinases. In WNK1, the residue in this position is a cysteine, and this new kinase was denoted
WNK1 [with no lysine (k) kinase]. Three additional members of the family have been identified at the molecular
level and denoted WNK2, WNK3, and WNK4 with corresponding genes located in human chromosomes 9,
Xp11.22, and 17, respectively (179, 415, 433).
Cellular and physiological functions of WNKs are not
known, and a serine/threonine phosphorylation motif by
these kinases has not been defined. However, the fact that
mutations in both kinases are able to produce a saltdependent form of human hypertension has attracted the
attention of several groups. It was first shown that WNK1
was ubiquitously expressed in several tissues (433), particularly in those known to be rich in chloride-transporting epithelial cells (56), whereas expression of WNK4 was
shown as restricted to distal nephron structures such as
DCT and CCD (433). In a more recent study using PCR
and Western blot analysis, however, expression of WNK4
was shown to be present also in several other epithelial
tissues (198). WNK4 has emerged as what appears to be a
multi-regulator of transport proteins in distal nephron.
Wilson et al. (434) and Yang et al. (446) demonstrated
using the heterologous expression system in X. laevis
oocytes that wild-type WNK4 reduces TSC activity, due at
least in part to reduction in surface expression of TSC
when WNK4 was coinjected. This negative effect of WNK4
on TSC expression was reduced or not observed when
mutant WNK4 harboring certain point mutations described in PHAII kindreds were used. In addition, Yang et
al. (446) also showed that negative effect of WNK4 on TSC
was completely prevented in the presence of wild-type
WNK1, suggesting that WNK1 regulates WNK4 activity.
Thus it was proposed by both groups that under physiological conditions TSC activity is regulated by WNK4 kinase. When WNK4 is mutated, absence or reduction in its
negative regulatory effect renders TSC constitutively active, thus increasing salt reabsorption by DCT. This hypothesis could explain Gordon’s disease as a disease resulting from overactivity of the renal Na⫹-Cl⫺ cotransporter and, hence, the high sensitivity of all clinical
findings to small doses of thiazide diuretics. Supporting
such a regulatory effect of WNK4 upon TSC, it has been
shown that WNK4 also exerts a dominant-negative effect
on other chloride-influx mechanisms (198). This hypothesis will require that mutations in WNK4 be of the inactivating type in which WNK4 loses its normal activity
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
Gordon’s disease. There are three case reports of this
disease reported before 1970 by Paver and Pauline (309),
Stokes et al. (386), and Arnold and Healy (16). At present,
there are ⬃40 patients reported in 11 families and ⬃17
sporadic cases.
Gordon’s disease is an autosomal-dominant illness
featuring hypertension with hyperkalemia, despite normal
glomerular filtration rate. Decrease in urinary H⫹ excretion produces hyperchloremic metabolic acidosis. Hypertension appears in all patients until adult life if untreated.
Thus metabolic abnormalities develop first and hypertension develops later in life. This is the reason why some
patients with this disease were reported under the eponymous of Spitzer-Weinstein syndrome (261, 381, 431), because this is the clinical presentation in childhood during
which hypertension has not yet developed. After performing a careful metabolic study in a male patient aged 23
years, Schamberlan et al. (357) suggested that the primary
abnormality was increase in reabsorptive capacity of distal nephron for chloride. Since that time, this proposal has
been known as the chloride-shunt hypothesis. On the
other hand, all clinical features are quite sensitive to
treatment with low-dose, thiazide-type diuretics (148).
Mayan et al. (267) observed in a single kindred that reduction of blood pressure with a small dose of hydrochlorothiazide was ⬃6 –7 times higher than that expected for
the essential hypertensive population. In addition, they
also observed that in contrast to nonaffected relatives,
patients exhibited hypercalciuria and significant decrease
in bone mineral density (BMD); thus Gordon’s syndrome
is the accurate mirror image of Gitelman’s disease. While
the first disease features hypertension, hyperkalemia, hyperchloremic metabolic acidosis, hypercalciuria, and decrease in BMD, all of which can be treated with low-dose
thiazide diuretic, the second disease resembles a thiazideintoxication state featuring hypotension, hypokalemia,
metabolic alkalosis, and hypocalciuria, with an increase
in BMD. Chronic use of thiazide diuretics increases BMD
and is useful to prevent osteoporosis (361). Thus it was
hypothesized that Gordon’s disease could be due to gainof-function mutations in the SLC12A3 gene encoding
TSC, inasmuch as inactivating mutations in this gene
produce Gitelman’s disease. However, no significant linkage was found between PHAII and SLC12A3 locus on
chromosome 16 (374). Instead, it was observed that families with Gordon’s disease exhibited significant linkage
with three different loci along human genome located in
chromosomes 1q31– 42 (260), 12p13 (88), and 17p11-q21
(260), indicating that at least three genes are capable of
producing the disease. The gene responsible in families
linked to chromosome 1 remains a mystery, but in chromosomes 12 and 17, it was found that Gordon’s disease is
associated with mutation in two kinases known as WNK1
and WNK4, respectively (433).
477
478
GERARDO GAMBA
E. Potential Role in Polygenic Diseases
descendents of hypertensive subjects than in those of
normotensive parents, and arterial blood pressure levels
exhibit a higher degree of correlation within members of
the family than within unrelated members of the same
community. Furthermore, blood pressure level correlation is higher between consanguineous than between
adopted siblings (185). However, primary hypertension is
not a monogenic disease with a dominant or recessive
pattern of inheritance. Thus the current paradigm is that
hypertension results from a polygenic inherited susceptibility toward environmental factors (i.e., salt consumption) that when exposed properly induces increase in
blood pressure levels.
Several members of the electroneutral cotransporter
gene family are potentially implicated in polygenetic predisposition toward hypertension; the most important one
appears to be the SLC12A3 gene. Evidence supporting
this statement includes the following: 1) TSC is one of the
genes that is clearly a part of the gene pool that working
together defines normal blood pressure levels. Inactivating mutations of TSC are the cause of Gitelman’s disease,
which among other clinical and metabolic manifestations
features arterial hypotension (68), and recent evidence
strongly suggests that TSC activity is implicated in the
mechanism of arterial hypertension in Gordon’s disease
(434, 446). Thus a decrease in TSC activity is associated
with hypotension, while an increase in TSC activity accompanies hypertension. As shown in Figure 25, it is
noteworthy that both situations are similar in time required to express a change in blood pressures. In this
Known and emerging physiological roles of electroneutral cotransporter family members, their involvement
in monogenic diseases, and their locations within certain
regions in human genome suggest that electroneutral cation-chloride cotransporters can be potentially implicated
in development of complex polygenic diseases, as well as
in defining type and magnitude of response to pharmacological treatment.
1. Arterial hypertension
High blood pressure is one of the most common
diseases in adults living in industrialized cities. Presence
of hypertension in the majority of studies is defined as
having sustained increase in diastolic blood pressure with
values ⬎90 mmHg, usually accompanied with systolic
blood pressure levels ⬎140 mmHg. Several studies in
different countries have shown that prevalence of hypertension in adult population is ⬎20%. People with increased blood pressure levels are at higher risk for developing acute myocardial infraction, stroke, chronic renal
failure, and congestive cardiac failure. The cause of primary arterial hypertension is not known, but it is clear
that hypertension is a disease with an important genetic
component, because hypertension is more common in
Physiol Rev • VOL
FIG. 25. Gene defects in TSC or WNK kinases and development of
changes in blood pressure levels. Gitelman’s disease is due to inactivating mutations that decrease activity of TSC. Although this is present
since birth, patients are usually hypotensive until the second or third
decade of life. A similar situation occurs with Gordon’s disease. In this
disease, mutations that appear to activate WNK1 and inactivate WNK4
have been proposed to result in increased TSC activity. These defects
are also present since birth; however, hypertension is evident until the
second or third decade of life. Thus, in two inherited diseases in which
mutation of one gene is sufficient to produce increase or decrease in
blood pressure levels, it takes several years to reach the abnormal
change in blood pressure.
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
upon TSC. Although this is the rule of autosomal-recessive diseases, in which inactivating mutations in both
alleles are required, there are several examples of autosomal-dominant diseases resulting from inactivating mutations only in one allele that nevertheless are sufficient to
express the disease. Possible explanations are haploinsufficiency, when absolutely both functional alleles are required to sustain normal protein activity, such as in familial hypercholesterolemia, or dominant-negative effect,
when products from both alleles interact to be functional
and inactivating mutation of one allele renders the remaining allele also inactive; examples are some types of
porphyrias and type I osteogenesis imperfecta (24). The
consequence of mutations on WNK4 activity, however, is
not clear because WNK4 has also been shown to have a
regulatory effect on other transport proteins of distal
nephron such as K⫹ channel ROMK (199) and claudins
(444), but in both cases mutations behave as gain of
function because the dominant-negative effect on ROMK
or the phosphorylation effect on claudins is increased
when mutant WNK4 are used instead of wild-type kinase.
Thus it is possible that WNK4 mutations behave as lossof-function mutations for TSC and gain-of-function mutations when it comes to ROMK channel and claudins. One
limitation to understanding WNK4 kinase biochemical
properties is that no activity of WNK4 has been obtained
in vitro or in HEK-293 cells (425).
ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS
Physiol Rev • VOL
associated with modulation of KCC3 expression (see sect
In addition, recent characterization of KCC3-null
mice in which blood pressure was assessed in awake
animals by using chronic intra-arterial catheters reported
that absence of KCC3 activity is associated with hypertension (42).
VF).
2. Epilepsy
There are several causes of epilepsy in humans that
range from inherited rare disorders to the most common
neurologic diseases such as stroke, metabolic encephalopathy, and trauma. In most cases, seizures are accompanied by several other neurologic symptoms and signs.
However, the most common presentation of seizures, as a
single and isolated neurologic event in humans, is in the
form of an idiopathic disease known as epilepsy, which
like arterial hypertension, diabetes, and many forms of
cancer displays a complex pattern of inheritance; thus it
belongs to the so-called polygenic complex diseases.
Several candidate regions along human chromosomes have been shown as linked with families expressing several subtypes of idiopathic epilepsy. Two examples
are the finding that juvenile myoclonic epilepsy and centrotemporal spikes in families with rolandic epilepsy are
linked with a region located in chromosome 15q14 (110,
295). This is exactly the region in which the SLC12A6
gene encoding KCC3 is located. However, a preliminary
report found no evidence of mutations in KCC3 in these
syndromes, and Dupre et al. (96) reported that seizures
are rarely seen in patients with HMSN/ACC.
Another cotransporter that is potentially implicated
in human epilepsy is KCC2. As discussed in section VE,
KCC2 is a key protein implicated in defining intracellular
chloride concentration in several neurons. In doing so,
KCC2 is critical for defining type and intensity of response
to GABA. The greater the activity of KCC2, the lower the
intraneuronal chloride; thus when GABA activates its Cl⫺
channel-associated receptor, the large gradient for chloride created by KCC2 will be the driving force facilitating
Cl⫺ entry into neurons, thus producing hyperpolarization.
Under these circumstances, GABA behaves as an inhibitory stimulus. If KCC2 is not active or absent, then intraneuronal chloride concentration will be above its potential equilibrium, and the result of interaction between
GABA and its Cl⫺ channel-associated receptor will be to
open a pathway for Cl⫺ efflux, producing depolarization.
In this instance, GABA behaves as an excitatory neurotransmitter; thus absence of KCC2 should render certain
neurons hyperexcitable. This hypothesis was indeed
shown to be true by KCC2 knockout mice studied by Woo
et al. (437) in which KCC2 expression was dramatically
reduced but still present at ⬃5% of normal. KCC2-null
mice presented with marked spasticity and generalized
seizures. In addition, although heterozygous mice showed
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
regard, both conditions are also similar to primary hypertension, which usually takes longer to be established.
That is, although Gitelman’s and Gordon’s diseases are
due to gene defects present since birth, decrease or increase in blood pressure, respectively, is not developed
until the second or third decade of life, i.e., defective
regulation of blood pressure can be compensated by years
and/or salt loss/retention is so slow that several years are
required to express a change in blood pressure levels. 2)
TSC is the protein target of thiazide-type diuretics, which
have been recommended for years as the first-line drug in
the pharmacological treatment of hypertension (57). 3)
Physiological evidence shows that TSC is an important
effector in defining natriuresis pressure curve because
Majid and Navar (258) showed that TSC is one of the
sodium-entry pathways in the distal nephron that is involved in mediating arterial pressure-induced changes in
sodium excretion occurring when mean arterial pressure
rises ⬎100 mmHg; in addition, Wang et al. (424) revealed
that during aldosterone escape TSC is the only nephron
transporter that is downregulated, suggesting that decreasing TSC expression is required for increased blood
pressure to restore natriuresis despite the continuous
presence of a high concentration of aldosterone. Thus
pressure-natriuresis is defined at least in part by TSC.
Therefore, all these clinical, genomic, pharmacological,
and physiological data together strongly suggest that TSC
can potentially be implicated in primary hypertension.
Other members of the electroneutral cation-chloride
cotransporters are also potentially implicated in arterial
hypertension. BSC1/NKCC2 causing Bartter’s disease type
I is another good candidate because inactivating mutations of SLC12A1 result in arterial hypotension; this effect was reproduced in BSC1/NKCC2 knockout mice
(397). Therefore, this cotransporter is also potentially
implicated in primary arterial hypertension. Other candidates are BSC2/NKCC1 and KCC3. Numerous studies
have suggested that increased activity of several transport
proteins, including BSC2/NKCC1 in red blood cells and
vascular smooth muscle cells, is associated with arterial
hypertension (for an extensive review, see Ref. 303). Apparently there is no genetic disease as a result of inactivating or gain-of-function mutations in SLC12A2 gene;
therefore, there is no human disease that helps to reveal
the role of BSC2/NKCC1 in regulating blood pressure. In
addition, results from knockout mice are conflicting because two different observations have been made. Flagella et al. (123) reported a significant reduction in blood
pressure level in BSC2/NKCC1-null mice, whereas this
was not observed by Pace et al. (306) (see sect. VC).
KCC3 is the K⫹-Cl⫺ cotransporter isoform suggested
to play a role in blood pressure regulation and that can be
potentially implicated in hypertension. Several studies
have shown that regulation of vascular smooth muscle
constriction/relaxation by nitric oxide and vasodilators is
479
480
GERARDO GAMBA
no particular phenotype, they exhibited high susceptibility for epileptic seizures. Thus, although no Mendelian
causes of epilepsy map to locus for human SLC12A5 gene
on chromosome 20, it remains a possibility that genetic
variability in this gene might affect multiple aspects of
human epilepsy (380).
3. Cancer
Physiol Rev • VOL
FIG. 26. Transfection of cervical cancer cells with KCC mutant
⌬N117 inhibits growth of malignant cells. Cell number was counted
every day by means of a hemocytometer. Trypan blue exclusion was
used to assess viability that was 100% in all groups along the days.
Groups studied were wild-type cells (solid circles), Mock-transfected
cells (open circles), and ⌬N117 transfected cells (open triangles). *P ⬍
0.05 compared with wild-type or Mock transfected groups. [Modified
from Shen et al. (368).]
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
A series of elegant studies performed in cervical
cancer cell lines have recently drawn our attention to the
potential role that electroneutral cation-chloride cotransporters may have on cell growth regulation as well as
proliferation and invasiveness of malignant neoplasias.
Cancer cells undergo very fast proliferation with an increased rate of mitosis and metabolism and are capable of
adjacent-tissue migration and invasion. All these activities
are expected to have profound consequences on cellvolume homeostasis. For these reasons, Shen et al. (367)
first analyzed K⫹-Cl⫺ cotransporter activity and expression in normal cervical cells and human cervical-cancer
cell lines. They observed that cells from a normal cervix
exhibited cell swelling-induced activation of a Cl⫺-dependent Rb⫹ efflux mechanism that was compatible with
K⫹-Cl⫺ cotransporter activity. The magnitude of K⫹-Cl⫺
cotransporter activation, however, was significantly
higher in cervical cancer cell lines such as SiHA and CasKi
than in normal human cervical cells. Moreover, evidence
was shown that KCC1, KCC3, and KCC4 mRNA can be
detected from cervical cells, but that level of mRNA expression, particularly of KCC3 mRNA, was higher in SiHA
and CasKi cells than in normal cervix, indicating that KCC
mRNA expression is upregulated in cervical cancer and
that process of cervical malignancy is associated with
increasing activity of K⫹-Cl⫺ cotransporters. The central
role of K⫹-Cl⫺ cotransporter during RVD was suggested
by the observation that DIOA prevented RVD in cervical
cancer cells. Then, to study cellular and molecular mechanisms of KCC3 regulation and function in neoplastic
cells, Shen et al. (369) developed a stable KCC3-transfected, NIH/3T3 7– 4 cell line. KCC3 was chosen for study
because, on one hand, it was shown that it is the K⫹-Cl⫺
cotransporter with highest expression in cervical cancer
cells (367), and on the other hand, in vascular endothelial
cells KCC3 mRNA expression is upregulated by vascular
endothelial growth factors (178). They observed that
KCC3 transfection enhanced cell growth, an effect that
was prevented by DIOA. While 33% of KCC3-transfected
cells were shown to be in G2/M phase of cell cycle, only
15% were in this phase after 3 days of treatment with
DIOA. This effect of KCC3 was accompanied by phosphorylation/dephosphorylation events in Rb and cdc2 kinases. These are key proteins that regulate progression
from G1 to S phase and G2 to M phase, respectively. In
KCC3-transfected cells, phosphorylation was increased in
Rb but decreased in cdc2, a situation reversed by DIOA.
Thus it was concluded that KCC3 plays an important role
in cell growth regulation. Finally, in a more recent study,
Shen et al. (368) showed that K⫹-Cl⫺ cotransport is indeed an important modulator of cell growth and invasiveness in human cervical cancer cells. First, they showed by
immunofluorescence analysis of surgical specimens of
cervical cancer using polyclonal antibody raised against
human KCC1, which also recognized KCC4, a remarkable
overexpression of K⫹-Cl⫺ cotransporter in cancer cells
when compared with normal cervix. Then, they developed a cervical cancer cell line that was transfected with
the ⌬N117 mutant KCC1, previously shown by Casula et
al. (50) to exert a dominant-negative effect on KCC activity. Transfection of a ⌬N117 mutant into neoplastic cells
completely abolished cell swelling, NEM, and starurosporine-induced increase in KCC activity in neoplastic cells.
In addition, the ⌬N117 mutant also reduced RVD, not only
by reducing K⫹-Cl⫺ cotransporter activity, but also by
decreasing activity of volume-sensitive organic osmolyte/
anion channel, which leads to chloride and taurine efflux.
As shown in Figure 26, these effects of ⌬N117 mutant into
KCCs and cell-volume regulation are associated with a
significant decrease in cellular growth of cervical cancer
cells (368). ⌬N117 mutant transfection into cervical cancer cells also produces a decrease in invasion capacity
together with a series of biochemical effects that are in
agreement with the observed reduction in growth and
invasion, which include, decrease in phosphorylation of
Rb and increase in phosphorylation of cdc2, decrease in
expression and activity of MMP2 and MMP9, known to be
implicated in integrin-induced dissolution of extracellular
matrix, and decrease in expression of integrins ␣6␤4 and
ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS
␣v␤3, known to play a critical role in cervical cancer
invasion. Finally, when SCID mice were inoculated with
wild-type or ⌬N117 mutant-transfected cervical cancer
cells, it was observed that ⌬N117 mutant significantly
reduced the rate of tumor growth. All this information
strongly suggests that cell volume regulatory mechanisms
can be critical in defining the ability of a malignant tumor
to grow and invade neighboring tissues, and that electroneutral cotransporters appear to be implicated in these
mechanisms in cancer cells. In addition, it also opens a
potential source of new antineoplastic therapies to be
explored.
Osteoporosis is another polygenic disease that represents a major health care problem in the industrialized
world. It is a systemic disease of the skeleton characterized by reduction in BMD and deterioration of bone microarchitecture, increasing as a consequence the risk of
fractures. Due to functional interaction of TSC with calcium-transport mechanisms, TSC is involved in renal calcium absorption, and thiazide-type diuretics are also useful in treatment of kidney stone disease. In addition, a
preliminary report strongly suggests the presence of TSC
in bone (97). Inactivating mutations of TSC in patients
with Gitelman’s disease are associated with high BMD
(66), while patients with Gordon’s disease in whom increased activity of TSC appears to be implicated exhibit
lower BMD than nonaffected members of the family
(267). These findings, together with evidence that hypertensive patients treated with thiazides are at lower risk for
osteoporosis (196, 333, 336, 361, 365), underlie the importance of TSC in bone metabolism, making TSC a potential
target for development of bone-sparing drugs in the elderly and suggesting that genetic variations of TSC could
be implicated in defining risk for developing osteoporosis.
phan members are still waiting to be defined. Molecular
identification and functional characterization of cotransporter orthologs in several species such as avian, amphibian, fish, bacteria, and plants that will help to understand
structure-function-regulation relationships and evolutionary issues are still pending. Our understanding of structure-function relationship is in its very beginning. Amino
acid residues or domains critically involved in Na⫹, K⫹,
and Cl⫺ translocation, as well as those required for inhibitor binding, are completely unknown. Structural biology
of each cotransporter is unknown due to the almost complete impossibility to date to obtain crystals of membrane
proteins. Little is known about regulatory properties and
pathways of each cotransporter. Physiological roles in
several organs for the majority of members in the family
need to be defined, as well as their involvement in complex polygenic disease. Thus, although a lot of progress
has been made in understanding electroneutral cation-Cl⫺
coupled cotransporters, and we have seen two decades of
intense research in this field, it is clear that another 20
years of even more exciting research and discoveries are
ahead of us.
I thank Drs. Norma A. Bobadilla and Francisco J. AlvarezLeefmans for critical reading of the manuscript and all the
members of the Molecular Physiology Unit (past and present)
for stimulating work and discussions over the years. I also
express my gratitude to Dr. Steven C. Hebert for more than a
decade of invaluable help and collaboration.
Experimental work performed in the author’s laboratory
has been supported by the Mexican Council of Science and
Technology, Dirección General de Asuntos del Personal Académico of the National University of Mexico, Fundación Miguel
Alemán, the Howard Hughes Medical Institute, National Institute of Diabetes and Digestive and Kidney Diseases Grants
DK-36803 and DK-064635, and the Wellcome Trust.
Address for reprint requests and other correspondence: G.
Gamba, Molecular Physiology Unit, Vasco de Quiroga No. 15, Tlalpan
14000, Mexico City, Mexico (E-mail: [email protected]).
VII. CONCLUSIONS AND PERSPECTIVE
REFERENCES
Major advances have been made in our understanding of electroneutral cation-Cl⫺ coupled cotransporter
family. One decade after molecular identification of the
first members of the family, nine genes have been identified, from which seven encode for the cotransporter and
two remain orphans. A lot of information has been produced for each gene in several areas including molecular
biology, functional properties of the cloned cotransporters as expressed in transfected cells, structure-function
relationship studies, physiological roles at both cellular
and organ levels, and pathophysiology and involvement in
human disease. The majority of data produced since cloning of each cotransporter cDNA in these areas have been
reviewed in the present work. There is still a lot of work
that needs to be done. Functional properties of two orPhysiol Rev • VOL
1. Abdallah JG, Schrier RW, Edelstein C, Jennings SD, Wyse B,
and Ellison DH. Loop diuretic infusion increases thiazide-sensitive Na⫹/Cl⫺ cotransporter abundance: role of aldosterone. J Am
Soc Nephrol 12: 1335–1341, 2001.
2. Abuladze N, Yanagawa N, Lee I, Jo OD, Newman D, Hwang J,
Uyemura K, Pushkin A, Modlin RL, and Kurtz I. Peripheral
blood mononuclear cells express mutated NCCT mRNA in Gitelman’s syndrome: evidence for abnormal thiazide-sensitive NaCl
cotransport. J Am Soc Nephrol 9: 819 – 826, 1998.
3. Adragna NC and Lauf PK. Role of nitrite, a nitric oxide derivative, in K-Cl cotransport activation of low-potassium sheep red
blood cells. J Membr Biol 166: 157–167, 1998.
4. Adragna NC, White RE, Orlov SN, and Lauf PK. K-Cl cotransport in vascular smooth muscle and erythrocytes: possible implication in vasodilation. Am J Physiol Cell Physiol 278: C381–C390,
2000.
5. Altamirano AA, Breitwieser GE, and Russell JM. Effects of
okadaic acid and intracellular Cl⫺ on Na⫹-K⫹-Cl⫺ cotransport.
Am J Physiol Cell Physiol 269: C878 –C883, 1995.
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
4. Osteoporosis
481
482
GERARDO GAMBA
Physiol Rev • VOL
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
The Metabolic and Molecular Basis of Inherited Disease, edited by
Scriver CR, Beaudet AL, Sly WS, and Valle D. New York: McGraw
Hill, 2001, p. 3– 45.
Beaumont K, Vaughn DA, Casto R, Printz MP, and Fanestil
DD. Thiazide diuretic receptors in spontaneously hypertensive rats
and 2-kidney 1-clip hypertensive rats. Clin Exp Hypertens A12:
215–226, 1990.
Beaumont K, Vaughn DA, and Fanestil DD. Thiazide diuretic
receptors in rat kidney: identification with [3H]metolazone. Proc
Natl Acad Sci USA 85: 2311–2314, 1988.
Beaumont K, Vaughn DA, and Healy DP. Thiazide diuretic receptors: autoradiographic localization in rat kidney with [3H]metolazone. J Pharmacol Exp Ther 250: 414 – 419, 1989.
Beaumont K, Vaughn DA, Maciejewski AR, and Fanestil DD.
Reversible downregulation of thiazide diuretic receptor by acute
renal ischemia. Am J Physiol Renal Fluid Electrolyte Physiol 256:
F329 –F334, 1989.
Becker M, Nothwang HG, and Friauf E. Differential expression
pattern of chloride transporters NCC, NKCC2, KCC1, KCC3, KCC4,
and AE3 in the developing rat auditory brainstem. Cell Tissue Res
312: 155–165, 2003.
Ben Ari Y, Tseeb V, Raggozzino D, Khazipov R, and Gaiarsa
JL. gamma-Aminobutyric acid (GABA): a fast excitatory transmitter which may regulate the development of hippocampal neurones
in early postnatal life. Prog Brain Res 102: 261–273, 1994.
Bergeron MJ, Gagnon E, Wallendorff B, Lapointe JY, and
Isenring P. Ammonium transport and pH regulation by K⫹-Cl⫺
cotransporters. Am J Physiol Renal Physiol 285: F68 –F78, 2003.
Bernstein PL, Zawalach W, Bartiss A, Reilly R, Palcso M, and
Ellison DH. The thiazide-sensitive Na-Cl cotransporter is expressed in rat endocrine pancreas (Abstract). J Am Soc Nephrol 6:
732, 1995.
Besseghir K, Trimble ME, and Stoner L. Action of ADH on
isolated medullary thick ascending limb of the Brattleboro rat.
Am J Physiol Renal Fluid Electrolyte Physiol 251: F271–F277,
1986.
Bettinelli A, Bianchetti MG, Girardin E, Caringella A, Cecconi M, Appiani AC, Pavanello L, Gastaldi R, Isimbaldi C, and
Lama G. Use of calcium excretion values to distinguish two forms
of primary renal tubular hypokalemic alkalosis: Bartter and Gitelman syndromes. J Pediatr 120: 38 – 43, 1992.
Bettinelli A, Ciarmatori S, Cesareo L, Tedeschi S, Ruffa G,
Appiani AC, Rosini A, Grumieri G, Mercuri B, Sacco M, Leozappa G, Binda S, Cecconi M, Navone C, Curcio C, Syren ML,
and Casari G. Phenotypic variability in Bartter syndrome type I.
Pediatr Nephrol 14: 940 –945, 2000.
Beutler KT, Masilamani S, Turban S, Nielsen J, Brooks HL,
Ageloff S, Fenton RA, Packer RK, and Knepper MA. Long-term
regulation of ENaC expression in kidney by angiotensin II. Hypertension 41: 1143–1150, 2003.
Bialojan C and Takai A. Inhibitory effect of a marine-sponge
toxin, okadaic acid, on protein phosphatases. Specificity and kinetics. Biochem J 256: 283–290, 1988.
Bickel CA, Verbalis JG, Knepper MA, and Ecelbarger CA.
Increased renal Na-K-ATPase, NCC, and beta-ENaC abundance in
obese Zucker rats. Am J Physiol Renal Physiol 281: F639 –F648,
2001.
Birkenhager R, Otto E, Schurmann MJ, Vollmer M, Ruf EM,
Maier-Lutz I, Beekmann F, Fekete A, Omran H, Feldmann D,
Milford DV, Jeck N, Konrad M, Landau D, Knoers NV, Antignac C, Sudbrak R, Kispert A, and Hildebrandt F. Mutation of
BSND causes Bartter syndrome with sensorineural deafness and
kidney failure. Nat Genet 29: 310 –314, 2001.
Bize I, Munoz P, Canessa M, and Dunham PB. Stimulation of
membrane serine-threonine phosphatase in erythrocytes by hydrogen peroxide and staurosporine. Am J Physiol Cell Physiol 274:
C440 –C446, 1998.
Boettger T, Hubner CA, Maier H, Rust MB, Beck FX, and
Jentsch TJ. Deafness and renal tubular acidosis in mice lacking
the K-Cl co-transporter Kcc4. Nature 416: 874 – 878, 2002.
Boettger T, Rust MB, Maier H, Seidenbecher T, Schweizer M,
Keating DJ, Faulhaber J, Ehmke H, Pfeffer C, Scheel O,
Lemcke B, Horst J, Leuwer R, Pape HC, Volkl H, Hubner CA,
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
6. Alvarez-Leefmans FJ. Intracellular Cl⫺ regulation and synaptic
inhibition in vertebrate and invertebrate neurons. In: Chloride
Channels and Carriers in Nerve Muscle and Glial Cells, edited by
Alvarez-Leefmans FJ and Russell JM. New York: Plenum, 1990, p.
109 –158.
7. Alvarez-Leefmans FJ. Intracellular chloride regulation. In: Cell
Physiology Source Book. A Molecular Approach, edited by Sperelakis N. San Diego, CA: Academic, 2001, p. 301–318.
8. Alvarez-Leefmans FJ, Gamiño SM, Giraldez F, and Noguerón
I. Intracellular chloride regulation in amphibian dorsal root ganglion neurons studied with nonselective microelectrodes. J Physiol
406: 225–246, 1988.
9. Alvarez-Leefmans FJ, Leon-Olea M, Mendoza-Sotelo J, Alvarez FJ, Anton B, and Garduno R. Immunolocalization of the
Na(⫹)-K(⫹)-2Cl(⫺) cotransporter in peripheral nervous tissue of
vertebrates. Neuroscience 104: 569 –582, 2001.
10. Alvarez-Leefmans FJ, Nani A, and Márquez S. Chloride transport, osmotic balance and presynaptic inhibition. In: Presynaptic
Inhibition and Neural Control, edited by Rudomin P, Romo R, and
Mendell LM. New York: Oxford Univ. Press, 1998, p. 50 –79.
11. Alvo M, Calamia J, and Eveloff J. Lack of potassium effect on
Na-Cl cotransport in the medullary thick ascending limb. Am J
Physiol Renal Fluid Electrolyte Physiol 249: F34 –F39, 1985.
12. Amlal H, Paillard M, and Bichara M. Cl(⫺)-dependent NH⫹
4
transport mechanisms in medullary thick ascending limb cells.
Am J Physiol Cell Physiol 267: C1607–C1615, 1994.
13. Amlal H, Wang Z, and Soleimani M. Potassium depletion downregulates chloride-absorbing transporters in rat kidney. J Clin
Invest 101: 1045–1054, 1998.
14. Amorim JB, Bailey MA, Musa-Aziz R, Giebisch G, and Malnic
G. Role of luminal anion and pH in distal tubule potassium secretion. Am J Physiol Renal Physiol 284: F381–F388, 2003.
15. Arbuckle MI, Kane S, Porter LM, Seatter MJ, and Gould GW.
Structure-function analysis of liver-type (GLUT2) and brain-type
(GLUT3) glucose transporters: expression of chimeric transporters
in Xenopus oocytes suggests an important role for putative transmembrane helix 7 in determining substrate selectivity. Biochemistry 35: 16519 –16527, 1996.
16. Arnold JE and Healy JK. Hyperkalemia, hypertension and systemic acidosis without renal failure associated with a tubular defect in potassium excretion. Am J Med 47: 461– 472, 1969.
17. Attmane-Elakeb A, Mount DB, Sibella V, Vernimmen C, Hebert SC, and Bichara M. Stimulation by in vivo and in vitro
metabolic acidosis of expression of rBSC-1, the Na⫹-K⫹(NH⫹
4 )2Cl⫺ cotransporter of the rat medullary thick ascending limb.
J Biol Chem 273: 33681–33691, 1998.
18. Attmane-Elakeb A, Sibella V, Vernimmen C, Belenfant X,
Hebert SC, and Bichara M. Regulation by glucocorticoids of
⫺
expression and activity of rBSC1, the Na⫹-K⫹(NH⫹
4 )-2Cl cotransporter of medullary thick ascending limb. J Biol Chem 275: 33548 –
33553, 2000.
19. Bachmann S, Bostanjoglo M, Schmitt R, and Ellison DH. Sodium transport-related proteins in the mammalian distal nephron:
distribution, ontogeny and functional aspects. Anat Embryol 200:
447– 468, 1999.
20. Bachmann S, Velázquez H, Obermuller N, Reily RF, Moser D,
and Ellison DH. Expression of the thiazide-sensitive Na-Cl cotransporter by rabbit distal convoluted tubule cells. J Clin Invest
96: 2510 –2514, 1995.
21. Bai Y, Pontoglio M, Hiesberger T, Sinclair AM, and Igarashi P.
Regulation of kidney-specific Ksp-cadherin gene promoter by hepatocyte nuclear factor-1beta. Am J Physiol Renal Physiol 283:
F839 –F851, 2002.
22. Barry ELR, Gesek FA, Kaplan MR, Hebert SC, and Friedman
PA. Expression of the sodium-chloride cotransporter in osteoblastlike cells: effects of thiazide diuretics. Am J Physiol Cell Physiol
272: C109 –C116, 1997.
23. Bartter FC, Pronove P, Gill JR Jr, and MacCardle RC. Hyperplasia of the juxtaglomerular complex with hyperaldosteronism
and hypokalemic alkalosis. A new syndrome 1962. J Am Soc Nephrol 9: 516 –528, 1998.
24. Beaudet AL, Scriver CR, Sly WS, and Valle D. Genetics, biochemistry, and molecular basis of variant human phenotypes. In:
ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS
43.
44.
45.
46.
48.
49.
50.
51.
52.
53.
54.
55.
56.
57.
58.
59.
60.
61.
Physiol Rev • VOL
62. Cossins AR and Gibson JS. Volume-sensitive transport systems
and volume homeostasis in vertebrate red blood cells. J Exp Biol
200: 343–352, 1997.
63. Costanzo LS. Localization of diuretic action in microperfused rat
distal tubules: Ca and Na transport. Am J Physiol Renal Fluid
Electrolyte Physiol 248: F527–F535, 1985.
64. Coto E, Rodriguez J, Jeck N, Alvarez V, Stone R, Loris C,
Rodriguez LM, Fischbach M, Seyberth HW, and Santos F. A
new mutation (intron 9 ⫹1 G⬎T) in the SLC12A3 gene is linked to
Gitelman syndrome in gypsies. Kidney Int 65: 25–29, 2004.
65. Cremaschi D, Porta C, Botta G, Bazzini C, Baroni MD, and
Garavaglia M. Apical Na(⫹)-Cl(⫺) symport in rabbit gallbladder
epithelium: a thiazide-sensitive cotransporter (TSC). J Membr Biol
176: 53– 65, 2000.
66. Cruz D, Simon D, and Lifto RP. An inactivating mutation of the
thiazide sensitive NaCl co-transporter is associated with high bone
mineral density in humans (Abstract). J Bone Miner Res 14: S109,
1999.
67. Cruz DN, Shaer AJ, Bia MJ, Lifton RP, and Simon DB. Gitelman’s syndrome revisited: an evaluation of symptoms and healthrelated quality of life. Kidney Int 59: 710 –717, 2001.
68. Cruz DN, Simon DB, Nelson-Williams C, Farhi A, Finberg K,
Burleson L, Gill JR, and Lifton RP. Mutations in the Na-Cl
cotransporter reduce blood pressure in humans. Hypertension 37:
1458 –1464, 2001.
69. Cutler CP and Cramb G. Two isoforms of the Na⫹/K⫹/2Cl⫺
cotransporter are expressed in the European eel (Anguilla anguilla). Biochim Biophys Acta 1566: 92–103, 2002.
70. Darman RB, Flemmer A, and Forbush B. Modulation of ion
transport by direct targeting of protein phosphatase type 1 to the
Na-K-Cl cotransporter. J Biol Chem 276: 34359 –34362, 2001.
71. Darman RB and Forbush B. A regulatory locus of phosphorylation in the N terminus of the Na-K-Cl cotransporter, NKCC1. J Biol
Chem 277: 37542–37550, 2002.
72. De Jong JC, Van Der Vliet WA, van den Heuvel LP, Willems
PH, Knoers NV, and Bindels RJ. Functional expression of mutations in the human NaCl cotransporter: evidence for impaired
routing mechanisms in Gitelman’s syndrome. J Am Soc Nephrol 13:
1442–1448, 2002.
73. De Jong JC, Willems PH, Mooren FJ, van den Heuvel LP,
Knoers NV, and Bindels RJ. The structural unit of the thiazidesensitive NaCl cotransporter is a homodimer. J Biol Chem 278:
24302–24307, 2003.
74. De Jong JC, Willems PH, van den Heuvel LP, Knoers NV, and
Bindels RJ. Functional expression of the human thiazide-sensitive
NaCl cotransporter in Madin-Darby canine kidney cells. J Am Soc
Nephrol 14: 2428 –2435, 2003.
75. DeFazio RA, Keros S, Quick MW, and Hablitz JJ. Potassiumcoupled chloride cotransport controls intracellular chloride in rat
neocortical pyramidal neurons. J Neurosci 20: 8069 – 8076, 2000.
76. Dehaye JP, Nagy A, Premkumar A, and Turner RJ. Identification of a functionally important conformation-sensitive region of
the secretory Na⫹-K⫹-2Cl⫺ cotransporter (NKCC1). J Biol Chem
278: 11811–11817, 2003.
77. Delpire E, Rauchman MI, Beier DR, Hebert SC, and Gullans
SR. Molecular cloning and chromosome localization of a putative
basolateral Na⫹-K⫹-2Cl⫺ cotransporter from mouse inner medullary collecting duct (mIMCD-3) cells. J Biol Chem 269: 25677–
25683, 1994.
78. Delpire E. Cation-chloride cotransporters in neuronal communication. News Physiol Sci 15: 309 –312, 2000.
79. Delpire E, Lu J, England R, Dull C, and Thorne T. Deafness and
imbalance associated with inactivation of the secretory Na-K-2Cl
co-transporter. Nat Genet 22: 192–195, 1999.
80. Delpire E and Mount DB. Human and murine phenotypes associated with defects in cation-chloride cotransport. Annu Rev
Physiol 64: 803– 843, 2002.
81. Demir E, Irobi J, Erdem S, Demirci M, Tan E, Timmerman V,
De Jonghe P, and Topaloglu H. Andermann syndrome in a Turkish patient. J Child Neurol 18: 76 –79, 2003.
82. Deng L and Chen G. Cyclothiazide potently inhibits gamma-aminobutyric acid type A receptors in addition to enhancing glutamate
responses. Proc Natl Acad Sci USA 100: 13025–13029, 2003.
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
47.
and Jentsch TJ. Loss of K-Cl co-transporter KCC3 causes deafness, neurodegeneration and reduced seizure threshold. EMBO J
22: 5422–5434, 2003.
Bostanjoglo M, Reeves WB, Reilly RF, Velazquez H, Robertson N, Litwack G, Morsing P, Dorup J, Bachmann S, Ellison
DH, and Bostonjoglo M. 11Beta-hydroxysteroid dehydrogenase,
mineralocorticoid receptor, and thiazide-sensitive Na-Cl cotransporter expression by distal tubules. J Am Soc Nephrol 9: 1347–1358,
1998.
Brooks HL, Allred AJ, Beutler KT, Coffman TM, and Knepper
MA. Targeted proteomic profiling of renal Na(⫹) transporter and
channel abundances in angiotensin II type 1a receptor knockout
mice. Hypertension 39: 470 – 473, 2002.
Burg MB. Thick ascending limb of Henle’s loop. Kidney Int 22:
454 – 464, 1982.
Burnham C, Karlish SJ, and Jorgensen PL. Identification and
reconstitution of a Na⫹/K⫹/Cl⫺ cotransporter and K⫹ channel from
luminal membranes of renal red outer medulla. Biochim Biophys
Acta 821: 461– 469, 1985.
Caillard O, Ben Ari Y, and Gaiarsa JL. Long-term potentiation of
GABAergic synaptic transmission in neonatal rat hippocampus.
J Physiol 518: 109 –119, 1999.
Campean V, Kricke J, Ellison D, Luft FC, and Bachmann S.
Localization of thiazide-sensitive Na⫹-Cl⫺ cotransport and associated gene products in mouse DCT. Am J Physiol Renal Physiol 281:
F1028 –F1035, 2001.
Caron L, Rousseau F, Gagnon E, and Isenring P. Cloning and
functional characterization of a cation Cl⫺ cotransporter interacting protein. J Biol Chem 275: 32027–32036, 2000.
Casula S, Shmukler BE, Wilhelm S, Stuart-Tilley AK, Su W,
Chernova MN, Brugnara C, and Alper SL. A dominant negative
mutant of the KCC1 K-Cl cotransporter: both N- and C-terminal
cytoplasmic domains are required for K-Cl cotransport activity.
J Biol Chem 276: 41870 – 41878, 2001.
Cervero F, Laird JM, and Garcia-Nicas E. Secondary hyperalgesia and presynaptic inhibition: an update. Eur J Pain 7: 345–351,
2003.
Chang H and Fujita T. A kinetic model of the thaizide-sensitive
Na-Cl cotransporter. Am J Physiol Renal Physiol 276: F952–F959,
1999.
Chen Z, Vaughn DA, Beaumont K, and Fanestil DD. Effects of
diuretic treatment and of dietary sodium on renal binding of 3Hmetolazone. J Am Soc Nephrol 1: 91–98, 1990.
Chen Z, Vaughn DA, and Fanestil DD. Influence of gender on
renal thiazide diuretic receptor density and response. J Am Soc
Nephrol 5: 1112–1119, 1994.
Cheng NL, Kao MC, Hsu YD, and Lin SH. Novel thiazide-sensitive Na-Cl cotransporter mutation in a Chinese patient with Gitelman’s syndrome presenting as hypokalaemic paralysis. Nephrol
Dial Transplant 18: 1005–1008, 2003.
Choate KA, Kahle KT, Wilson FH, Nelson-Williams C, and
Lifton RP. WNK1, a kinase mutated in inherited hypertension with
hyperkalemia, localizes to diverse Cl⫺-transporting epithelia. Proc
Natl Acad Sci USA 100: 663– 668, 2003.
Chobanian AV, Bakris GL, Black HR, Cushman WC, Green LA,
Izzo JL Jr, Jones DW, Materson BJ, Oparil S, Wright JT Jr,
and Roccella EJ. The Seventh Report of the Joint National Committee on Prevention, Detection, Evaluation, and Treatment of
High Blood Pressure: The JNC 7 Report. JAMA 289: 2560 –2571,
2003.
Clader JA, Schacheter M, and Sever PS. Direct vascular actions
of hydrochlorothaizide and indapamide in isolated small vessels.
Eur J Pharmacol 220: 19 –26, 1992.
Clayton GH, Owens GC, Wolff JS, and Smith RL. Ontogeny of
cation-Cl⫺ cotransporter expression in rat neocortex. Brain Res
109: 281–292, 1998.
Cohen PT. Protein phosphatase 1—targeted in many directions.
J Cell Sci 115: 241–256, 2002.
Colas B, Slama M, Collin T, Safar M, and Andrejak M. Mechanisms of methyclothiazide-induced inhibition of contractile responses in rat aorta. Eur J Pharmacol 408: 63– 67, 2000.
483
484
GERARDO GAMBA
Physiol Rev • VOL
103. Elalouf JM, Roinel N, and de Rouffignac C. Effects of glucagon
and PTH on the loop of Henle of rat juxtamedullary nephrons.
Kidney Int 29: 807– 813, 1986.
104. Ellison DH. The physiologic basis of diuretic synergism: its role in
treating diuretic resistance. Ann Intern Med 114: 886 – 894, 1991.
105. Ellison DH. The thiazide-sensitive Na-Cl cotransporter and human
disease: reemergence of an old player. J Am Soc Nephrol 14:
538 –540, 2003.
106. Ellison DH, Biemesderfer D, Morrisey J, Lauring J, and Desir
GV. Immunocytochemical characterization of the high-affinity thiazide diuretic receptor in rabbit renal cortex. Am J Physiol Renal
Fluid Electrolyte Physiol 264: F141–F148, 1993.
107. Ellison DH, Morrisey J, and Desir GV. Rabbit thiazide diuretic
receptors: solubilization, chracterization and purification. J Am Soc
Nephrol 1: 683, 1990.
108. Ellison DH, Velazquez H, and Wright FS. Stimulation of distal
potassium secretion by low lumen chloride in the presence of
barium. Am J Physiol Renal Fluid Electrolyte Physiol 248: F638 –
F649, 1985.
109. Ellison DH, Velazquez H, and Wright FS. Thiazide-sensitive
sodium chloride cotransport in early distal tubule. Am J Physiol
Renal Fluid Electrolyte Physiol 253: F546 –F554, 1987.
110. Elmslie FV, Rees M, Williamson MP, Kerr M, Kjeldsen MJ,
Pang KA, Sundqvist A, Friis ML, Chadwick D, Richens A,
Covanis A, Santos M, Arzimanoglou A, Panayiotopoulos CP,
Curtis D, Whitehouse WP, and Gardiner RM. Genetic mapping
of a major susceptibility locus for juvenile myoclonic epilepsy on
chromosome 15q. Hum Mol Genet 6: 1329 –1334, 1997.
111. Enan E and Matsumura F. Specific inhibition of calcineurin by
type II synthetic pyrethroid insecticides. Biochem Pharmacol 43:
1777–1784, 1992.
112. Escalante B, Erlij D, Falck JR, and McGiff JC. Effect of cytochrome P450 arachidonate metabolites on ion transport in rabbit
kidney loop of Henle. Science 251: 799 – 802, 1991.
113. Estevez R, Boettger T, Stein V, Birkenhager R, Otto E, Hildebrandt F, and Jentsch TJ. Barttin is a Cl⫺ channel beta-subunit
crucial for renal Cl⫺ reabsorption and inner ear K⫹ secretion.
Nature 414: 558 –561, 2001.
114. Evans RL, Park K, Turner RJ, Watson GE, Nguyen HV, Dennett MR, Hand AR, Flagella M, Shull GE, and Melvin JE.
Severe impairment of salivation in Na⫹/K⫹/2Cl⫺ cotransporter
(NKCC1)-deficient mice. J Biol Chem 275: 26720 –26726, 2000.
115. Eveloff J, Bayerdorffer E, Silva P, and Kinne R. Sodiumchloride transport in the thick ascending limb of Henle’s loop.
Oxygen consumption studies in isolated cells. Pflügers Arch 389:
263–270, 1981.
116. Eveloff J and Calamia J. Effect of osmolarity on cation fluxes in
medullary thick ascending limb cells. Am J Physiol Renal Fluid
Electrolyte Physiol 250: F176 –F180, 1986.
117. Fanestil DD. Steroid regulation of thiazide-sensitive transport.
Semin Nephrol 12: 18 –23, 1992.
118. Fanestil DD, Tran JM, Vaughn DA, Maciejewski AR, and
Beaumont K. Investigation of the metolazone receptor. In: Diuretics III: Chemistry, Pharmacology and Clinical Applications, edited by Puschett JB and Greenberg A. New York: Elsevier Science,
1990, p. 195–204.
119. Fanestil DD, Vaughan DA, and Blakely P. Metabolic acid-base
influences on renal thiazide receptor density. Am J Physiol Regul
Integr Comp Physiol 272: R2004 –R2008, 1997.
120. Fedele E, Conti A, and Raiteri M. The glutamate receptor/NO/
cyclic GMP pathway in the hippocampus of freely moving rats:
modulation by cyclothiazide, interaction with GABA and the behavioural consequences. Neuropharmacology 36: 1393–1403, 1997.
121. Feit PW, Hoffman EK, Schiodt M, Kristensen P, Jessen F, and
Dunham PB. Purification of proteins of the Na/Cl cotransporter
from membranes of Ehrlich ascites cells using a bumetanide-sepharose affinity column. J Membr Biol 103: 135–147, 1988.
122. Fernandez-Llama P, Ecelbarger CA, Ware JA, Andrews P, Lee
AJ, Turner R, Nielsen S, and Knepper MA. Cyclooxygenase
inhibitors increase Na-K-2Cl cotransporter abundance in thick ascending limb of Henle’s loop. Am J Physiol Renal Physiol 277:
F219 –F226, 1999.
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
83. Derst C, Konrad M, Kockerling A, Karolyi L, Deschenes G,
Daut J, Karschin A, and Seyberth HW. Mutations in the ROMK
gene in antenatal Bartter syndrome are associated with impaired
K⫹ channel function. Biochem Biophys Res Commun 230: 641–
645, 1997.
84. Di Fulvio M, Lauf PK, and Adragna NC. Nitric oxide signaling
pathway regulates potassium chloride cotransporter-1 mRNA expression in vascular smooth muscle cells. J Biol Chem 276: 44534 –
44540, 2001.
85. Di Fulvio M, Lauf PK, and Adragna NC. The NO signaling
pathway differentially regulates KCC3a and KCC3b mRNA expression. Nitric Oxide 9: 165–171, 2003.
86. Di Fulvio M, Lauf PK, Shah S, and Adragna NC. NONOates
regulate KCl cotransporter-1 and -3 mRNA expression in vascular
smooth muscle cells. Am J Physiol Heart Circ Physiol 284: H1686 –
H1692, 2003.
87. Di Fulvio M, Lincoln TM, Lauf PK, and Adragna NC. Protein
kinase G regulates potassium chloride cotransporter-3 expression
in primary cultures of rat vascular smooth muscle cells. J Biol
Chem 276: 21046 –21052, 2001.
88. Disse-Nicodeme S, Achard JM, Desitter I, Houot AM,
Fournier A, Corvol P, and Jeunemaitre X. A new locus on
chromosome 12p13.3 for pseudohypoaldosteronism type II, an autosomal dominant form of hypertension. Am J Hum Genet 67:
302–310, 2000.
89. Di Stefano A, Wittner M, Nitschke R, Braitsh R, Greger R,
Bailly C, Amiel C, Roinel N, and de Rouffignac C. Effects of
parathyroid hormone and calcitonin on Na⫹, Cl⫺, K⫹, Mg2⫹ and
Ca2⫹ transport in cortrical and medullary thick ascending limbs of
mouse kidney. Pflügers Arch 417: 161–167, 1990.
90. Dixon MJ, Gazzard J, Chaudhry SS, Sampson N, Schulte BA,
and Steel KP. Mutation of the Na-K-Cl co-transporter gene Slc12a2
results in deafness in mice. Hum Mol Genet 8: 1579 –1584, 1999.
91. Doucet A. Function and control of Na-K-ATPase in single nephron
segments of the mammalian kidney. Kidney Int 34: 749 –760, 1988.
92. Dowd BF and Forbush B. PASK (proline-alanine-rich STE20related kinase), a regulatory kinase of the Na-K-Cl cotransporter
(NKCC1). J Biol Chem 278: 27347–27353, 2003.
93. Drewnowska K and Baumgarten CM. Regulation of cellular
volume in rabbit ventricular myocytes: bumetanide, chlorthiazide,
and ouabain. Am J Physiol Cell Physiol 260: C122–C131, 1991.
94. Dunham P, Jessen F, and Hoffman EK. Inhibition of Na-K-Cl
cotransport in Ehrlich ascites cells by antiserum against purified
proteins of the cotransporter. Proc Natl Acad Sci USA 87: 6828 –
6823, 1990.
95. Dunham PB and Ellory JC. Passive potassium transport in low
potassium sheep red cells: dependence upon cell volume and chloride. J Physiol 318: 511–530, 1981.
96. Dupre N, Howard HC, Mathieu J, Karpati G, Vanasse M,
Bouchard JP, Carpenter S, and Rouleau GA. Hereditary motor
and sensory neuropathy with agenesis of the corpus callosum. Ann
Neurol 54: 9 –18, 2003.
97. Dvorak MM, Carter H, and Riccardi D. Thiazide-sensitive sodium chloride co-transporter (NCC) in cryosections of rat and
human bone (Abstract). J Bone Miner Res 17: S246, 2002.
98. Ecelbarger C, Wade JB, Terris J, Marples D, Nielsen S, and
Knepper MA. Localization and regulation of bumetanide-sensitive
cotransporter protein in rat kidney (Abstract). J Am Soc Nephrol 6:
335, 1995.
99. Ecelbarger CA, Bickel CA, Verbalis JG, and Knepper MA.
Regulation of Na-dependent cotransporter and Na channel abundance by insulin (Abstract). J Am Soc Nephrol 11: 27A, 2002.
100. Ecelbarger CA, Kim GH, Wade JB, and Knepper MA. Regulation of the abundance of renal sodium transporters and channels by
vasopressin. Exp Neurol 171: 227–234, 2001.
101. Ecelbarger CA, Knepper MA, and Verbalis JG. Increased abundance of distal sodium transporters in rat kidney during vasopressin escape. J Am Soc Nephrol 12: 207–217, 2001.
102. Ehringer MA, Thompson J, Conroy O, Xu Y, Yang F, Canniff J,
Beeson M, Gordon L, Bennett B, Johnson TE, and Sikela JM.
High-throughput sequence identification of gene coding variants
within alcohol-related QTLs. Mamm Genome 12: 657– 663, 2001.
ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS
Physiol Rev • VOL
143. Gimenez I and Forbush B. Short-term stimulation of the renal
Na-K-Cl cotransporter (NKCC2) by vasopressin involves phosphorylation and membrane translocation of the protein. J Biol Chem
278: 26946 –26951, 2003.
144. Gimenez I, Isenring P, and Forbush B III. Spatially distributed
alternative splice variants of the renal Na-K-Cl cotransporter exhibit dramatically different affinities for the transported ions. J Biol
Chem 277: 8767– 8770, 2002.
145. Gitelman HJ, Graham JB, and Welt LG. A new family disorder
characterized by hypokalemia and hypomagnesemia. Trans Assoc
Am Physicians 79: 221–235, 1966.
146. Good DW. Ammonium transport by the thick ascending limb of
Henle’s loop. Annu Rev Physiol 56: 623– 647, 1994.
147. Gordon RD. Syndrome of hypertension and hyperkalemia with
normal glomerular filtration rate. Hypertension 8: 93–102, 1986.
148. Gordon RD and Hodsman GP. The syndrome of hypertension and
hyperkalaemia without renal failure: long term correction by thiazide diuretic. Scott Med J 31: 43– 44, 1986.
149. Greger R. Chloride reabsorption in the rabbit cortical thick ascending limb of the loop of Henle. A sodium dependent process.
Pflügers Arch 390: 38 – 43, 1981.
150. Greger R. Coupled transport of Na⫹ and Cl⫺ in the thick ascending
limb of Henle’s loop of rabbit nephron. Scand Audiol Suppl 14:
1–15, 1981.
151. Greger R. Ion transport mechanisms in thick ascending limb of
Henle’s loop of mammalian nephron. Physiol Rev 65: 760 –797,
1985.
152. Greger R. Physiology of renal sodium transport. Am J Med Sci 319:
51– 62, 2000.
153. Greger R and Schlatter E. Presence of luminal K⫹, a prerequisite
for active NaCl transport in the cortical thick ascending limb of
Henlen’s loop of rabbit kidney. Pflügers Arch 392: 92–94, 1981.
154. Greger R and Schlatter E. Properties of the lumen membrane of
the cortical thick ascending limb of Henle’s loop of rabbit kidney.
Pflügers Arch 396: 315–324, 1983.
155. Greger R and Schlatter E. Properties of the basolateral membrane on the cortical thick ascending limb of Henle’s loop of rabbit
kidney. A model for secondary active chloride transport. Pflügers
Arch 396: 325–334, 1983.
156. Greger R, Schlatter E, and Lang F. Evidence for electroneutral
sodium chloride cotransport in the cortical thick ascending limb of
Henle’s loop of rabbit kidney. Pflügers Arch 396: 308 –314, 1983.
157. Grubb BR, Lee E, Pace AJ, Koller BH, and Boucher RC.
Intestinal ion transport in NKCC1-deficient mice. Am J Physiol
Gastrointest Liver Physiol 279: G707–G718, 2000.
158. Grubb BR, Pace AJ, Lee E, Koller BH, and Boucher RC.
Alterations in airway ion transport in NKCC1-deficient mice. Am J
Physiol Cell Physiol 281: C615–C623, 2001.
159. Guggino WB, Oberleithner H, and Giebisch G. The amphibian
diluting segment. Am J Physiol Renal Fluid Electrolyte Physiol
254: F615–F627, 1988.
160. Guo X and Wecker L. Identification of three cAMP-dependent
protein kinase (PKA) phosphorylation sites within the major intracellular domain of neuronal nicotinic receptor alpha4 subunits.
J Neurochem 82: 439 – 447, 2002.
161. Haas M. Properties and diversity of (Na-K-Cl) cotransporters.
Annu Rev Physiol 51: 443– 457, 1989.
162. Haas M. The Na-K-Cl cotransporters. Am J Physiol Cell Physiol
267: C869 –C885, 1994.
163. Haas M and Forbush B III. Na,K,Cl cotransport system: characterization by bumetanide binding and photolabelling. Kidney Int 32
Suppl: S134 –S140, 1987.
164. Haas M and Forbush B III. The Na-K-Cl cotransporter of secretory epithelia. Annu Rev Physiol 62: 515–534, 2000.
165. Haas M and McManus TJ. Bumetanide inhibits (Na⫹K⫹Cl) cotransport at a chloride site. Am J Physiol Cell Physiol 245: C235–
C240, 1983.
166. Hall DA and Varney DM. Effect of vasopressin on electrical
potential difference and chloride transport in mouse medullary
thick ascending limb of Henle’s loop. J Clin Invest 66: 792– 802,
1980.
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
123. Flagella M, Clarke LL, Miller ML, Erway LC, Giannella RA,
Andringa A, Gawenis LR, Kramer J, Duffy JJ, Doetschman T,
Lorenz JN, Yamoah EN, Cardell EL, and Shull GE. Mice lacking
the basolateral Na-K-2Cl cotransporter have impaired epithelial
chloride secretion and are profoundly deaf. J Biol Chem 274:
26946 –26955, 1999.
124. Flatman PW. Regulation of Na-K-2Cl cotransport by phosphorylation and protein-protein interactions. Biochim Biophys Acta 1566:
140 –151, 2002.
125. Flatman PW, Adragna NC, and Lauf PK. Role of protein kinases
in regulating sheep erythrocyte K-Cl cotransport. Am J Physiol Cell
Physiol 271: C255–C263, 1996.
126. Flemmer AW, Gimenez I, Dowd BF, Darman RB, and Forbush
B. Activation of the Na-K-Cl cotransporter NKCC1 detected with a
phospho-specific antibody. J Biol Chem 277: 37551–37558, 2002.
127. Forbush B III, Haas M, and Lytle C. Na-K-Cl cotransport in the
shark rectal gland. I. Regulation in the intact perfused gland. Am J
Physiol Cell Physiol 262: C1000 –C1008, 1992.
128. Forbush B III and Palfrey HC. [3H]bumetanide binding to membranes isolated from dog kidney outer medulla. Relationship to the
Na,K,Cl co-transport system. J Biol Chem 258: 11787–11792, 1983.
129. Freis ED. Origins and development of antihypertensive drug treatment. In: Hypertension: Pathophysioloy, Diagnosis and Managment, edited by Laragh JH and Brenner BM. New York: Raven,
1990, p. 2093–2106.
130. Friedman PA and Bushinsky DA. Diuretic effects on calcium
metabolism. Semin Nephrol 19: 551–556, 1999.
131. Fukuda A, Muramatsu K, Okabe A, Shimano Y, Hida H, Fujimoto I, and Nishino H. Changes in intracellular Ca2⫹ induced by
GABAA receptor activation and reduction in Cl⫺ gradient in neonatal rat neocortex. J Neurophysiol 79: 439 – 446, 1998.
132. Fukuyama S, Okudaira S, Yamazato S, Yamazato M, and Ohta
T. Analysis of renal tubular electrolyte transporter genes in seven
patients with hypokalemic metabolic alkalosis. Kidney Int 64:
808 – 816, 2003.
133. Gagnon E, Bergeron MJ, Brunet GM, Daigle ND, Simard CF,
and Isenring P. Molecular mechanisms of Cl transport by the
renal Na-K-Cl cotransporter: identification of an intracellular locus
that may form part of a high affinity Cl-binding site. J Biol Chem
279: 5648 –5654, 2003.
134. Gagnon E, Forbush B, Flemmer AW, Gimenez I, Caron L, and
Isenring P. Functional and molecular characterization of the
shark renal Na-K-Cl cotransporter: novel aspects. Am J Physiol
Renal Physiol 283: F1046 –F1055, 2002.
135. Gamba G. Alternative splicing and diversity of renal transporters.
Am J Physiol Renal Physiol 281: F781–F794, 2001.
136. Gamba G, Miyanoshita A, Lombardi M, Lytton J, Lee WS,
Hediger MA, and Hebert SC. Molecular cloning, primary structure and characterization of two members of the mammalian electroneutral sodium-(potassium)-chloride cotransporter family expressed in kidney. J Biol Chem 269: 17713–17722, 1994.
137. Gamba G, Saltzberg SN, Lombardi M, Miyanoshita A, Lytton
J, Hediger MA, Brenner BM, and Hebert SC. Primary structure
and functional expression of a cDNA encoding the thiazide-sensitive, electroneutral sodium-chloride cotransporter. Proc Natl Acad
Sci USA 90: 2749 –2753, 1993.
138. Geck P, Pietrzyk C, Burckhardt BC, Pfeiffer B, and Heinz E.
Electrically silent cotransport of Na⫹, K⫹ and Cl⫺ in Ehrlich cells.
Biochim Biophys Acta 600: 432– 447, 1980.
139. Geering K, Theulaz F, Verrey M, Hauptle T, and Rossier BC.
A role for the beta-subunit in the expression of functional Na⫹-K⫹ATPase in Xenopus oocytes. Am J Physiol Cell Physiol 257: C851–
C858, 1989.
140. Gerelsaikhan T and Turner RJ. Transmembrane topology of the
secretory Na⫹-K⫹-2Cl⫺ cotransporter (NKCC1) studied by in vitro
translation. J Biol Chem 275: 40471– 40477, 2000.
141. Gesek FA and Friedman PA. Mechanism of calcium transport
stimulated by chlorothiazide in mouse distal convoluted tubule
cells. J Clin Invest 90: 429 – 438, 1992.
142. Gillen CM, Brill S, Payne JA, and Forbush B III. Molecular
cloning and functional expression of the K-Cl cotransporter from
rabbit, rat and human. A new member of the cation-chloride cotransporter family. J Biol Chem 271: 16237–16244, 1996.
485
486
GERARDO GAMBA
Physiol Rev • VOL
185.
186.
187.
188.
189.
190.
191.
192.
193.
194.
195.
196.
197.
198.
199.
200.
201.
202.
203.
204.
K-Cl cotransport already in early synaptic inhibition. Neuron 30:
515–524, 2001.
Hunt SC and Williams RR. Gentic factors in human hypertension.
In: Texbook of Hypertension, edited by Swales JD. London: Blackwell Scientific, 1994, p. 519 –538.
Hus-Citharel A and Morel F. Coupling of metabolic CO2 production to ion transport in isolated rat thick ascending limbs and
collecting tubules. Pflügers Arch 407: 421– 427, 1986.
Igarashi P, Vanden Heuver GB, Payne JA, and Forbush B III.
Cloning, embryonic expression, and alternative splicing of a murine kidney-specific Na-K-Cl cotransporter. Am J Physiol Renal
Fluid Electrolyte Physiol 269: F406 –F418, 1995.
Igarashi P, Whyte DA, Kui L, and Nagami GT. Cloning and
kidney cell-specific activity of the promoter of the murine renal
Na-K-Cl cotransporter gene. J Biol Chem 271: 9666 –9674, 1996.
Isenring P and Forbush B III. Ion and bumetanide binding by the
Na-K-Cl cotransporter. Importance of transmembrane domains.
J Biol Chem 272: 24556 –24562, 1997.
Isenring P, Jacoby SC, Chang J, and Forbush B III. Mutagenic
mapping of the Na-K-Cl cotransporter for domains involved in ion
transport and bumetanide binding. J Gen Physiol 112: 549 –558,
1998.
Isenring P, Jacoby SC, and Forbush B III. The role of transmembrane domain 2 in cation transport by the Na-K-Cl cotransporter. Proc Natl Acad Sci USA 95: 7179 –7184, 1998.
Isenring P and Forbush B. Ion transport and ligand binding by
the Na-K-Cl cotransporter, structure-function studies. Comp Biochem Physiol A Physiol 130: 487– 497, 2001.
Jarolimek W, Lewen A, and Misgeld U. A furosemide-sensitive
K⫹-Cl⫺ cotransporter counteracts intracellular Cl⫺ accumulation
and depletion in cultured rat midbrain neurons. J Neurosci 19:
4695– 4704, 1999.
Jeck N, Derst C, Wischmeyer E, Ott H, Weber S, Rudin C,
Seyberth HW, Daut J, Karschin A, and Konrad M. Functional
heterogeneity of ROMK mutations linked to hyperprostaglandin E
syndrome. Kidney Int 59: 1803–1811, 2001.
Jennings ML and Schulz RK. Okadaic acid inhibition of KCl
cotransport. Evidence that protein dephosphorylation is necessary
for activation of transport by either cell swelling or N-ethylmaleimide. J Gen Physiol 97: 799 – 817, 1991.
Jones G, Nguyen T, Sambrook PN, and Eisman JA. Thiazide
diuretics and fractures: can meta-analysis help? J Bone Miner Res
10: 106 –111, 1995.
Jorgensen PL, Petersen J, and Rees WD. Identification of a Na⫹,
K⫹, Cl⫺ cotransport protein of Mr 34000 from kidney by photolabeling with [3H]bumetanide. Biochim Biophys Acta 775: 105–110,
1984.
Kahle KT, Gimenez I, Hassan H, Wilson FH, Wong RD, Forbush B, Aronson PS, and Lifton RP. WNK4 regulates apical and
basolateral Cl⫺ flux in extrarenal epithelia. Proc Natl Acad Sci USA
101: 2064 –2069, 2004.
Kahle KT, Wilson FH, Leng Q, Lalioti MD, O’Connell AD,
Dong K, Rapson AK, MacGregor GG, Giebisch G, Hebert SC,
and Lifton RP. WNK4 regulates the balance between renal NaCl
reabsorption and K⫹ secretion. Nat Genet 35: 372–376, 2003.
Kaji DM and Tsukitani Y. Role of protein phosphatase in activation of KCl cotransport in human erythrocytes. Am J Physiol Cell
Physiol 260: C176 –C180, 1991.
Kakazu Y, Uchida S, Nakagawa T, Akaike N, and Nabekura J.
Reversibility and cation selectivity of the K(⫹)-Cl(⫺) cotransport
in rat central neurons. J Neurophysiol 84: 281–288, 2000.
Kanaka C, Ohno K, Okabe A, Kuriyama K, Itoh T, Fukuda A,
and Sato K. The differential expression patterns of messenger
RNAs encoding K-Cl cotransporters (KCC1,2) and Na-K-2Cl cotransporter (NKCC1) in the rat nervous system. Neuroscience 104:
933–946, 2001.
Kaplan MR, Plotkin MD, Lee WS, Xu ZC, Lytton J, and Hebert
SC. Apical localization of the Na-K-Cl cotransporter, rBSC1, on rat
thick ascending limbs. Kidney Int 49: 40 – 47, 1996.
Karadsheh MF, Byun N, Mount DB, and Delpire E. Localization
of the kcc4 potassium-chloride cotransporter in the nervous system. Neuroscience 123: 381–391, 2004.
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
167. Hebert SC. Nephron heterogeneity. In: Handbook of Physiology.
Renal Physiology. Bethesda, MD: Am. Physiol. Soc., 1992, sect. 8,
vol. I, chapt. 20, p. 875–925.
168. Hebert SC. Bartter syndrome. Curr Opin Nephrol Hypertens 12:
527–532, 2003.
169. Hebert SC and Andreoli TE. Control of NaCl transport in the
thick ascending limb. Am J Physiol Renal Fluid Electrolyte Physiol
246: F745–F756, 1984.
170. Hebert SC, Culpepper RM, and Andreoli TE. NaCl transport in
mouse medullary thick ascending limbs. I. Functional nephron
heterogeneity and ADH-stimulated NaCl cotransport. Am J Physiol
Renal Fluid Electrolyte Physiol 241: F412–F431, 1981.
171. Hebert SC, Culpepper RM, and Andreoli TE. NaCl transport in
mouse medullary thick ascending limbs. II. ADH enhancement of
transcellular NaCl cotrasport; origin of transepithelial voltage.
Am J Physiol Renal Fluid Electrolyte Physiol 241: F432–F442,
1981.
172. Hebert SC, Culpepper RM, and Andreoli TE. NaCl transport in
mouse medullary thick ascending limbs. III. Modulation of ADH
effect by peritubular osmolality. Am J Physiol Renal Fluid Electrolyte Physiol 241: F443–F451, 1981.
173. Hebert SC, Mount DB, and Gamba G. Molecular physiology of
cation-coupled Cl⫺ cotransport: the SLC12 family. Pflügers Arch
447: 580 –593, 2004.
174. Hebert SC, Reeves WB, Molony DA, and Andreoli TE. The
medullary thick limb: function and modulation of the single-effect
multiplier. Kidney Int 31: 580 –588, 1987.
175. Hediger MA, Romero MF, Peng JB, Rolfs A, Takanaga H, and
Bruford EA. The ABCs of solute carriers: physiological, pathological and therapeutic implications of human membrane transport
proteins—introduction. Pflügers Arch 447: 465– 468, 2004.
176. Hewett D, Samuelsson L, Polding J, Enlund F, Smart D, Cantone K, See CG, Chadha S, Inerot A, Enerback C, Montgomery D, Christodolou C, Robinson P, Matthews P, Plumpton M,
Wahlstrom J, Swanbeck G, Martinsson T, Roses A, Riley J,
and Purvis I. Identification of a psoriasis susceptibility candidate
gene by linkage disequilibrium mapping with a localized single
nucleotide polymorphism map. Genomics 79: 305–314, 2002.
177. Hierholzer K, Wiederholt M, and Stolte H. The impairment of
sodium resorption in the proximal and distal convolution of adrenalectomized rats. Pflügers Arch Gesamte Physiol Menschen Tiere
291: 43– 62, 1966.
178. Hiki K, D’Andrea RJ, Furze J, Crawford J, Woollatt E, Sutherland GR, Vadas MA, and Gamble JR. Cloning, characterization, and chromosomal location of a novel human K⫹-Cl⫺ cotransporter. J Biol Chem 274: 10661–10667, 1999.
179. Holden S, Cox J, and Raymond FL. Cloning, genomic organization, alternative splicing and expression analysis of the human gene
WNK3 (PRKWNK3). Gene 335: 109 –119, 2004.
180. Holtzman EJ, Kumar S, Faaland CA, Warner F, Louge PJ,
Erickson SJ, Ricken G, Waldman J, and Dunham PB. Cloning,
characterization, and gene organization of K-Cl cotransporter from
pig and human kidney and C. elegans. Am J Physiol Renal Physiol
275: F550 –F564, 1998.
181. Hoover RS, Poch E, Monroy A, Vazquez N, Nishio T, Gamba G,
and Hebert SC. N-glycosylation at two sites critically alters thiazide binding and activity of the rat thiazide-sensitive Na(⫹):Cl(⫺)
cotransporter. J Am Soc Nephrol 14: 271–282, 2003.
182. Howard HC, Dube MP, Prevost C, Bouchard JP, Mathieu J,
and Rouleau GA. Fine mapping the candidate region for peripheral neuropathy with or without agenesis of the corpus callosum in
the French Canadian population. Eur J Hum Genet 10: 406 – 412,
2002.
183. Howard HC, Mount DB, Rochefort D, Byun N, Dupre N, Lu J,
Fan X, Song L, Riviere JB, Prevost C, Horst J, Simonati A,
Lemcke B, Welch R, England R, Zhan FQ, Mercado A, Siesser
WB, George AL Jr, McDonald MP, Bouchard JP, Mathieu J,
Delpire E, and Rouleau GA. The K-Cl cotransporter KCC3 is
mutant in a severe peripheral neuropathy associated with agenesis
of the corpus callosum. Nat Genet 32: 384 –392, 2002.
184. Hubner CA, Stein V, Hermans-Borgmeyer I, Meyer T, Ballanyi
K, and Jentsch TJ. Disruption of KCC2 reveals an essential role of
ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS
Physiol Rev • VOL
223. Kurihara K, Nakanishi N, Moore-Hoon ML, and Turner RJ.
Phosphorylation of the salivary Na(⫹)-K(⫹)-2Cl(⫺) cotransporter.
Am J Physiol Cell Physiol 282: C817–C823, 2002.
224. Kurtz CL, Karolyi L, Seyberth HW, Koch MC, Vargas R, Feldmann D, Vollmer M, Knoers NV, Madrigal G, and Guay-Woodford LM. A common NKCC2 mutation in Costa Rican Bartter’s
syndrome patients: evidence for a founder effect. J Am Soc Nephrol
8: 1706 –1711, 1997.
225. Kwon TH, Nielsen J, Kim YH, Knepper MA, Frokiaer J, and
Nielsen S. Regulation of sodium transporters in the thick ascending limb of rat kidney: response to angiotensin II. Am J Physiol
Renal Physiol 285: F152–F165, 2003.
226. Kyte J and Doolittle RF. A simple method for displaying the
hydropathic character of a protein. J Mol Biol 157: 105–132, 1982.
227. Lagler KF, Bardach JE, and Miller RR. Icthyology. New York:
Wiley, 1962.
228. Lai E, Clark KL, Burley SK, and Darnell JE Jr. Hepatocyte
nuclear factor 3/fork head or “winged helix” proteins: a family of
transcription factors of diverse biologic function. Proc Natl Acad
Sci USA 90: 10421–10423, 1993.
229. Laird JM, Garcia-Nicas E, Delpire EJ, and Cervero F. Presynaptic inhibition and spinal pain processing in mice: a possible role
of the NKCC1 cation-chloride co-transporter in hyperalgesia. Neurosci Lett 361: 200 –203, 2004.
230. Lang F, Busch GL, Ritter M, Volkl H, Waldegger S, Gulbins E,
and Haussinger D. Functional significance of cell volume regulatory mechanisms. Physiol Rev 78: 247–306, 1998.
231. Larsen F, Solheim J, Kristensen T, Kolsto AB, and Prydz H. A
tight cluster of five unrelated human genes on chromosome
16q22.1. Hum Mol Genet 2: 1589 –1595, 1993.
232. Lauf PK. Thiol-dependent passive K/Cl transport in sheep red
cells. I. Dependence on chloride and external ions. J Membr Biol
73: 237–246, 1983.
233. Lauf PK. Thiol-dependent passive K/Cl transport in sheep red
cells. IV. Furosemide inhibition as a function of external Rb⫹, Na⫹,
and Cl⫺. J Membr Biol 77: 57– 62, 1984.
234. Lauf PK and Adragna NC. K-Cl cotransport: properties and molecular mechanism. Cell Physiol Biochem 10: 341–354, 2000.
235. Lauf PK, Bauer J, Adragna NC, Fujise H, Zade-Oppen AMM,
Ryu KH, and Delpire E. Erythrocyte K-Cl cotransport: properties
and regulation. Am J Physiol Cell Physiol 263: C917–C932, 1992.
236. Lauf PK, McManus TJ, Haas M, Forbush B III, Duhm J, Flatman PW, Saier MH, and Russell JM. Physiology and biophysics
of chloride and cation cotransport across cell membranes. Federation Proc 46: 2377–2394, 1987.
237. Lauf PK and Theg BE. A chloride dependent K⫹ flux induced by
N-ethylmaleimide in genetically low K⫹ sheep and goat erythrocytes. Biochem Biophys Res Commun 92: 1422–1428, 1980.
238. Lauf PK, Zhang J, Delpire E, Fyffe RE, Mount DB, and Adragna NC. K-Cl co-transport: immunocytochemical and functional
evidence for more than one KCC isoform in high K and low K sheep
erythrocytes. Comp Biochem Physiol A Physiol 130: 499 –509, 2001.
239. Lazzaro D, De SV, De Magistris L, Lehtonen E, and Cortese R.
LFB1 and LFB3 homeoproteins are sequentially expressed during
kidney development. Development 114: 469 – 479, 1992.
240. Leinekugel X, Medina I, Khalilov I, Ben Ari Y, and Khazipov
R. Ca2⫹ oscillations mediated by the synergistic excitatory actions
of GABA(A) and NMDA receptors in the neonatal hippocampus.
Neuron 18: 243–255, 1997.
241. Lemmink HH, Knoers NV, Karolyi L, van Dijk H, Niaudet P,
Antignac C, Guay-Woodford LM, Goodyer PR, Carel JC,
Hermes A, Seyberth HW, Monnens LA, and van den Heuvel
LP. Novel mutations in the thiazide-sensitive NaCl cotransporter
gene in patients with Gitelman syndrome with predominant localization to the C-terminal domain. Kidney Int 54: 720 –730, 1998.
242. Lemmink HH, van den Heuvel LP, van Dijk HA, Merkx GF,
Smilde TJ, Taschner PE, Monnens LA, Hebert SC, and Knoers
NV. Linkage of Gitelman syndrome to the thiazide-sensitive sodium-chloride cotransporter gene with identification of mutations in
Dutch families. Pediatr Nephrol 10: 403– 407, 1996.
243. Li H, Tornberg J, Kaila K, Airaksinen MS, and Rivera C.
Patterns of cation-chloride cotransporter expression during embryonic rodent CNS development. Eur J Neurosci 16: 2358 –2370, 2002.
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
205. Karadsheh MF and Delpire E. Neuronal restrictive silencing
element is found in the KCC2 gene: molecular basis for KCC2specific expression in neurons. J Neurophysiol 85: 995–997, 2001.
206. Karim Z, Attmane-Elakeb A, Sibella V, and Bichara M. Acid pH
increases the stability of BSC1/NKCC2 mRNA in the medullary
thick ascending limb. J Am Soc Nephrol 14: 2229 –2236, 2003.
207. Karolyi L, Conrad M, Köckerling A, Ziegler A, Zimmermann
D, Roth B, Wieg C, Grzeschik K, Koch M, Seyberth H, Vargas
R, Forestier L, Jean G, Deschaux N, Rizzoni GF, Niaudet P,
Antignac C, Feldmann D, Lorridon F, Cougoureux E, Laroze
F, Alessandri JL, David L, Saunier P, Deschenes G, Hildebrandt F, Vollmer M, Proesmans W, Brandes M, van Den
Heuvel LJ, Lemmink HH, Nillesen W, Monnens L, Knoers
NVAM, Guay-Woodford LM, Wright CJ, Madrigal G, and Hebert SC. Mutations in the gene encoding the inwardly-rectifying
renal potassium channel, ROMK, cause the antenatal variant of
Bartter syndrome: evidence for genetic heterogeneity. International Collaborative Study Group for Bartter-like Syndromes. Hum
Mol Genet 6: 17–26, 1997.
208. Kawakami K, Noguchi S, Noda M, Takahashi H, Ohta T,
Kawamura M, Nojima H, Nagano K, Hirose T, Inayama S,
Hayashida H, Miyata T, and Numa S. Primary structure of the
alpha-subunit of Torpedo californica (Na⫹⫹K⫹)ATPase deduced
from cDNA sequence. Nature 316: 733–736, 1985.
209. Kim GH, Ecelbarger CA, Mitchell C, Packer RK, Wade JB, and
Knepper MA. Vasopressin increases Na-K-2Cl cotransporter expression in thick ascending limb of Henle’s loop. Am J Physiol
Renal Physiol 276: F96 –F103, 1999.
210. Kim GH, Masilamani S, Turner R, Mitchell C, Wade JB, and
Knepper MA. The thiazide-sensitive Na-Cl cotransporter is an
aldosterone-induced protein. Proc Natl Acad Sci USA 95: 14552–
14557, 1998.
211. Kim GH, Martin SW, Fernandez-Llama P, Masilamani S,
Packer RK, and Knepper MA. Long-term regulation of renal
Na-dependent cotransporters and ENaC: response to altered acidbase intake. Am J Physiol Renal Physiol 279: F459 –F467, 2000.
212. Kirsch J and Betz H. Glycine-receptor activation is required for
receptor clustering in spinal neurons. Nature 392: 717–720, 1998.
213. Knepper MA. Proteomics and the kidney. J Am Soc Nephrol 13:
1398 –1408, 2002.
214. Knepper MA and Brooks HL. Regulation of the sodium transporters NHE3, NKCC2 and NCC in the kidney. Curr Opin Nephrol
Hypertens 10: 655– 659, 2001.
215. Knepper MA and Masilamani S. Targeted proteomics in the
kidney using ensembles of antibodies. Acta Physiol Scand 173:
11–21, 2001.
216. Knepper MA, Packer R, and Good DW. Ammonium transport in
the kidney. Physiol Rev 69: 179 –249, 1989.
217. Koenig B, Ricapito S, and Kinne R. Chloride transport in the
thick ascending limb of Henle’s loop: potassium dependence and
stoichiometry of the NaCl cotransport system in plasma membrane
vesicles. Pflügers Arch 399: 173–179, 1983.
218. Konrad M, Vollmer M, Lemmink HH, van den Heuvel LP, Jeck
N, Vargas-Poussou R, Lakings A, Ruf R, Deschenes G, Antignac C, Guay-Woodford L, Knoers NV, Seyberth HW, Feldmann
D, and Hildebrandt F. Mutations in the chloride channel gene
CLCNKB as a cause of classic Bartter syndrome. J Am Soc Nephrol
11: 1449 –1459, 2000.
219. Krarup T and Dunham PB. Reconstitution of calyculin-inhibited
K-Cl cotransport in dog erythrocyte ghosts by exogenous PP-1.
Am J Physiol Cell Physiol 270: C898 –C902, 1996.
220. Kunau RT, Weller DR, and Webb HL. Clarification of the site of
action of chlorothiazide in the rat nephron. J Clin Invest 56:
401– 407, 1975.
221. Kunchaparty S, Palcso M, Berkman J, zquez H, Desir GV,
Bernstein P, Reilly RF, and Ellison DH. Defective processing
and expression of thiazide-sensitive Na-Cl cotransporter as a cause
of Gitelman’s syndrome. Am J Physiol Renal Physiol 277: F643–
F649, 1999.
222. Kurihara K, Moore-Hoon ML, Saitoh M, and Turner RJ. Characterization of a phosphorylation event resulting in upregulation of
the salivary Na(⫹)-K(⫹)-2Cl(⫺) cotransporter. Am J Physiol Cell
Physiol 277: C1184 –C1193, 1999.
487
488
GERARDO GAMBA
Physiol Rev • VOL
263. Masilamani S, Wang X, Kim GH, Brooks H, Nielsen J, Nielsen
S, Nakamura K, Stokes JB, and Knepper MA. Time course of
renal Na-K-ATPase, NHE3, NKCC2, NCC, and ENaC abundance
changes with dietary NaCl restriction. Am J Physiol Renal Physiol
283: F648 –F657, 2002.
264. Mastroianni N, Bettinelli A, Bianchetti M, Colussi G, de
Fusco M, Sereni F, Ballabio A, and Casari G. Novel molecular
variants of the Na-Cl cotransporter gene are responsible for Gitelman syndrome. Am J Hum Genet 59: 1019 –1026, 1996.
265. Mastroianni N, DeFusco M, Zollo M, Arrigo G, Zuffardi O,
Bettinelli A, Ballabio A, and Casari G. Molecular cloning, expression pattern, and chromosomal localization of the human
Na-Cl thiazide-sensitive cotransporter (SLC12A3). Genomics 35:
486 – 493, 1996.
266. Mathieu J, Bedard F, Prevost C, and Langevin P. Motor and
sensory neuropathies with or without agenesis of the corpus callosum: a radiological study of 64 cases. Can J Neurol Sci 17:
103–108, 1990.
267. Mayan H, Vered I, Mouallem M, Tzadok-Witkon M, Pauzner R,
and Farfel Z. Pseudohypoaldosteronism type II: marked sensitivity to thiazides, hypercalciuria, normomagnesemia, and low bone
mineral density. J Clin Endocrinol Metab 87: 3248 –3254, 2002.
268. McDonough AA, Geering K, and Farley RA. The sodium pump
needs its beta subunit. FASEB J 4: 1598 –1605, 1990.
269. Meade P, Hoover RS, Plata C, Vazquez N, Bobadilla NA,
Gamba G, and Hebert SC. cAMP-dependent activation of the
renal-specific Na⫹-K⫹-2Cl⫺ cotransporter is mediated by regulation
of cotransporter trafficking. Am J Physiol Renal Physiol 284:
F1145–F1154, 2003.
270. Meade P, Sabath E, and Gamba G. Fisiopatologı́a molecular del
sindrome de Bartter. Rev Invest Clin 55: 74 – 83, 2003.
271. Melander O, Orho-Melander M, Bengtsson K, Lindblad U,
Rastam L, Groop L, and Hulthen UL. Genetic variants of thiazide-sensitive NaCl-cotransporter in Gitelman’s syndrome and primary hypertension. Hypertension 36: 389 –394, 2000.
272. Mercado A, de los Heros P, Vazquez N, Meade P, Mount DB,
and Gamba G. Functional and molecular characterization of the
K-Cl cotransporter of Xenopus laevis oocytes. Am J Physiol Cell
Physiol 281: C670 –C680, 2001.
273. Mercado A, Mount DB, Cortes R, Vazquez N, and Gamba G.
Functional characterization of two alternative isoforms of the
KCC3 K-Cl cotransporter (Abstract). FASEB J 16: A58, 2002.
274. Mercado A, Mount DB, and Gamba G. Electroneutral cationchloride cotransporters in the central nervous system. Neurochem
Res 29: 17–25, 2004.
275. Mercado A, Song L, Vazquez N, Mount DB, and Gamba G.
Functional comparison of the K⫹-Cl⫺ cotransporters KCC1 and
KCC4. J Biol Chem 275: 30326 –30334, 2000.
276. Merino A, Hebert SC, and Gamba G. Correlation between water
salinity and tissue expression of the thiazide-sensitive cotransporter (TSC) in teleost (Abstract). J Am Soc Nephrol 10: 39A, 1999.
277. Meyer JW, Flagella M, Sutliff RL, Lorenz JN, Nieman ML,
Weber CS, Paul RJ, and Shull GE. Decreased blood pressure and
vascular smooth muscle tone in mice lacking basolateral Na(⫹)K(⫹)-2Cl(⫺) cotransporter. Am J Physiol Heart Circ Physiol 283:
H1846 –H1855, 2002.
278. Mikawa S, Wang C, Shu F, Wang T, Fukuda A, and Sato K.
Developmental changes in KCC1, KCC2 and NKCC1 mRNAs in the
rat cerebellum. Brain Res 136: 93–100, 2002.
279. Molony DA, Reeves WB, and Andreoli TE. Na⫹:K⫹:2Cl⫺ cotransport and the thick ascending limb. Kidney Int 36: 418 – 426,
1989.
280. Molony DA, Reeves WB, Hebert SC, and Andreoli TE. ADH
increases apical Na⫹,K⫹,2Cl⫺ entry in mouse medullary thick ascending limbs of Henle. Am J Physiol Renal Fluid Electrolyte
Physiol 252: F177–F187, 1987.
281. Monkawa T, Kurihara I, Kobayashi K, Hayashi M, and Saruta
T. Novel mutations in thiazide-sensitive Na-Cl cotransporter gene
of patients with Gitelman’s syndrome. J Am Soc Nephrol 11: 65–70,
2000.
282. Monne M, Hermansson M, and von Heijne G. A turn propensity
scale for transmembrane helices. J Mol Biol 288: 141–145, 1999.
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
244. Li JH, Zuzack JS, and Kau ST. Winter flounder urinary bladder as
a model tissue for assessing the potency of thiazide diuretics. In:
Diuretics III: Chemistry, Pharmacology and Clinical Applications, edited by Puschett JB and Greenberg A. New York: Elsevier
Science, 1990, p. 107–110.
245. Lin SH, Cheng NL, Hsu YJ, and Halperin ML. Intrafamilial
phenotype variability in patients with Gitelman syndrome having
the same mutations in their thiazide-sensitive sodium/chloride cotransporter. Am J Kidney Dis 43: 304 –312, 2004.
246. Liu X, Titz S, Lewen A, and Misgeld U. KCC2 mediates NH⫹
4
uptake in cultured rat brain neurons. J Neurophysiol 90: 2785–
2790, 2003.
247. Loffing J and Kaissling B. Sodium and calcium transport pathways along the mammalian distal nephron: from rabbit to human.
Am J Physiol Renal Physiol 284: F628 –F643, 2003.
248. Loffing J, Loffing-Cueni D, Valderrabano V, Klausli L, Hebert
SC, Rossier BC, Hoenderop JG, Bindels RJ, and Kaissling B.
Distribution of transcellular calcium and sodium transport pathways along mouse distal nephron. Am J Physiol Renal Physiol 281:
F1021–F1027, 2001.
249. Lorenz JN, Baird NR, Judd LM, Noonan WT, Andringa A,
Doetschman T, Manning PA, Liu LH, Miller ML, and Shull GE.
Impaired renal NaCl absorption in mice lacking the ROMK potassium channel, a model for type II Bartter’s syndrome. J Biol Chem
277: 37871–37880, 2002.
250. Lu J, Karadsheh M, and Delpire E. Developmental regulation of
the neuronal-specific isoform of K-Cl cotransporter KCC2 in postnatal rat brains. J Neurobiol 39: 558 –568, 1999.
251. Luo H, Beaumont K, Vaughn DA, and Fanestil DD. Solubilization of thiazide diuretic receptors from rat kidney membranes.
Biochim Biophys Acta 1052: 119 –122, 1990.
252. Lytle C. Activation of the avian erythrocyte Na-K-Cl cotransport
protein by cell shrinkage, cAMP, fluoride, and calyculin-A involves
phosphorylation at common sites. J Biol Chem 272: 15069 –15077,
1997.
253. Lytle C. A volume sensitive protein kinase regulates the Na-K-2Cl
cotransporter in duck red blood cells. Am J Physiol Cell Physiol
274: C1002–C1010, 1998.
254. Lytle C and Forbush B III. The Na-K-Cl cotransport protein of
shark rectal gland. II. Regulation by direct phosphorylation. J Biol
Chem 267: 25438 –25443, 1992.
255. Lytle C and Forbush B III. Regulatory phosphorylation of the
secretory Na-K-Cl cotransporter: modulation by cytoplasmic Cl.
Am J Physiol Cell Physiol 270: C437–C448, 1996.
256. Lytle C, Xu J, Biemesderfer D, Haas M, and Forbush B III. The
Na-K-Cl cotransport protein of shark rectal gland. I. Development
of monoclonal antibodies, immunoaffinity purification, and partial
biochemical characterization. J Biol Chem 267: 25428 –25437, 1992.
257. MacKenzie S, Vaitkevicius H, and Lockette W. Sequencing and
characterization of the human thiazide-sensitive Na-Cl cotransporter (SLC12A3) gene promoter. Biochem Biophys Res Commun
282: 991–1000, 2001.
258. Majid DSA and Navar GL. Blockade of distal nephron sodium
transport attenuates pressure natriuresis in dogs. Hypertension 23:
1040 –1045, 1994.
259. Maki N, Komatsuda A, Wakui H, Ohtani H, Kigawa A, Aiba N,
Hamai K, Motegi M, Yamaguchi A, Imai H, and Sawada KI.
Four novel mutations in the thiazide-sensitive Na-Cl co-transporter
gene in Japanese patients with Gitelman’s syndrome. Nephrol Dial
Transplant. In press.
260. Mansfield TA, Simon DB, Farfel Z, Bia M, Tucci JR, Lebel M,
Gutkin M, Vialettes B, Christofilis MA, Kauppinen-Makelin R,
Mayan H, Risch N, and Lifton RP. Multilocus linkage of familial
hyperkalaemia and hypertension, pseudohypoaldosteronism type
II, to chromosomes 1q31– 42 and 17p11-q21. Nat Genet 16: 202–205,
1997.
261. Margolis BL and Lifschitz MD. The Spitzer-Weinstein syndrome:
one form of type IV renal tubular acidosis and its response to
hydrochlorothiazide. Am J Kidney Dis 7: 241–244, 1986.
262. Masilamani S, Kim GH, Mitchell C, Wade JB, and Knepper
MA. Aldosterone-mediated regulation of ENaC alpha, beta, and
gamma subunit proteins in rat kidney. J Clin Invest 104: R19 –R23,
1999.
ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS
Physiol Rev • VOL
302. O’Grady SM, Palfrey HC, and Field M. Characteristics and
function of Na-K-Cl cotransport in epithelial tissues. Am J Physiol
Cell Physiol 253: C177–C192, 1987.
303. Orlov SN, Adragna NC, Adarichev VA, and Hamet P. Genetic
and biochemical determinants of abnormal monovalent ion transport in primary hypertension. Am J Physiol Cell Physiol 276:
C511–C536, 1999.
304. Ortiz PA, Hong NJ, and Garvin JL. NO decreases thick ascending limb chloride absorption by reducing Na(⫹)- K(⫹)-2Cl(⫺) cotransporter activity. Am J Physiol Renal Physiol 281: F819 –F825,
2001.
305. Overdier DG, Ye H, Peterson RS, Clevidence DE, and Costa
RH. The winged helix transcriptional activator HFH-3 is expressed
in the distal tubules of embryonic and adult mouse kidney. J Biol
Chem 272: 13725–13730, 1997.
306. Pace AJ, Lee E, Athirakul K, Coffman TM, O’Brien DA, and
Koller BH. Failure of spermatogenesis in mouse lines deficient in
the Na(⫹)-K(⫹)- 2Cl(⫺) cotransporter. J Clin Invest 105: 441– 450,
2000.
307. Pantanetti P, Arnaldi G, Balercia G, Mantero F, and Giacchetti G. Severe hypomagnesaemia-induced hypocalcaemia in a
patient with Gitelman’s syndrome. Clin Endocrinol 56: 413– 418,
2002.
308. Pathak BG, Shaughnessy JD Jr, Meneton P, Greeb J, Shull
GE, Jenkins NA and Copeland NG. Mouse chromosomal location of three epithelial sodium channel subunit genes and an apical
sodium chloride cotransporter gene. Genomics 33: 124 –127, 1996.
309. Paver WK and Paulilne GJ. Hypertension and hyperpotassaemia
without renal disease in a young male. Med J Aust 35: 305–306,
1964.
310. Payne JA. Functional characterization of the neuronal-specific
K-Cl cotransporter: implications for [K⫹]o regulation. Am J Physiol
Cell Physiol 273: C1516 –C1525, 1997.
311. Payne JA and Forbush B III. Alternatively spliced isoforms of
the putative renal Na-K-Cl cotransporter are differentially distributed within the rabbit kidney. Proc Natl Acad Sci USA 91: 4544 –
4548, 1994.
312. Payne JA, Rivera C, Voipio J, and Kaila K. Cation-chloride
co-transporters in neuronal communication, development and
trauma. Trends Neurosci 26: 199 –206, 2003.
313. Payne JA, Stevenson TJ, and Donaldson LF. Molecular characterization of a putative K-Cl cotransporter in rat brain. A neuronal-specific isoform. J Biol Chem 271: 16245–16252, 1996.
314. Payne JA, Xu JC, Haas M, Lytle CY, Ward D, and Forbush B
III. Primary structure, functional expression, and chromosomal
localization of the bumetanide-sensitive Na-K-Cl cotransporter in
human colon. J Biol Chem 270: 17977–17985, 1995.
315. Pearson MM, Lu J, Mount DB, and Delpire E. Localization of
the K(⫹)-Cl(⫺) cotransporter, KCC3, in the central and peripheral
nervous systems: expression in the choroid plexus, large neurons
and white matter tracts. Neuroscience 103: 481– 491, 2001.
316. Pellegrino CM, Rybicki AC, Musto S, Nagel RL, and Schwartz
RS. Molecular identification and expression of erythroid K:Cl cotransporter in human and mouse erythroleukemic cells. Blood Cells
Mol Dis 24: 31– 40, 1998.
317. Perry PB and O’Neill WC. Swelling-activated K fluxes in vascular
endothelial cells: volume regulation via K-Cl cotransport and K
channels. Am J Physiol Cell Physiol 265: C763–C769, 1993.
318. Peters M, Jeck N, Reinalter S, Leonhardt A, Tonshoff B,
Klaus GG, Konrad M, and Seyberth HW. Clinical presentation of
genetically defined patients with hypokalemic salt-losing tubulopathies. Am J Med 112: 183–190, 2002.
319. Pickkers P, Garcha RS, Schachter M, Smits P, and Hughes AD.
Inhibition of carbonic anhydrase accounts for the direct vascular
effects of hydrochlorothiazide. Hypertension 33: 1043–1048, 1999.
320. Pickkers P, Hughes AD, Russei FGM, Thien T, and Smits P.
Thiazide-induced vasodilation in humans is mediated by potassium
channel activation. Hypertension 32: 1071–1076, 1998.
321. Piechotta K, Garbarini N, England R, and Delpire E. Characterization of the interaction of the stress kinase SPAK with the
Na⫹-K⫹-2Cl⫺ cotransporter in the nervous system: evidence for a
scaffolding role of the kinase. J Biol Chem 278: 52848 –52856, 2003.
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
283. Monroy A, Plata C, Hebert SC, and Gamba G. Characterization
of the thiazide-sensitive Na(⫹)-Cl(⫺) cotransporter: a new model
for ions and diuretics interaction. Am J Physiol Renal Physiol 279:
F161–F169, 2000.
284. Moore-Hoon ML and Turner RJ. Molecular and topological characterization of the rat parotid Na⫹-K⫹-2Cl⫺ cotransporter1. Biochim Biophys Acta 1373: 261–269, 1998.
285. Moore-Hoon ML and Turner RJ. The structural unit of the
secretory Na⫹-K⫹-2Cl⫺ cotransporter (NKCC1) is a homodimer.
Biochemistry 39: 3718 –3724, 2000.
286. Morel F, Chabardes D, Imbert-Teboul M, Le Bouffant F, HusCitharel A, and Montegut M. Multiple hormonal control of adenylate cyclase in distal segments of the rat kidney. Kidney Int
Suppl 11: S55–S62, 1982.
287. Moreno E, Tovar-Palacio C, De Los HP, Guzman B, Bobadilla
NA, Vazquez N, Riccardi D, Poch E, and Gamba G. A single
nucleotide polymorphism alters the activity of the renal Na⫹:Cl⫺
cotransporter and reveals a role for transmembrane segment 4 in
chloride and thiazide affinity. J Biol Chem 279: 16553–16560, 2004.
288. Moreno G, Merino A, Mercado A, Herrera JP, GonzálezSalazar J, Correa-Rotter R, Hebert SC, and Gamba G. Electronuetral Na-coupled cotransporter expression in the kidney during variations of NaCl and water metabolism. Hypertension 31:
1002–1006, 1998.
289. Mount DB, Arias I, Xie Q, Mercado A, and Gamba G. Cloning
and characterization of SLC12A9, a new member of the cationchloride cotransporter gene family (Abstract). FASEB J 16: A807,
2002.
290. Mount DB, Baekgard A, Hall AE, Plata C, Xu J, Beier DR,
Gamba G, and Hebert SC. Isoforms of the Na-K-2Cl transporter in
murine TAL. I. Molecular characterization and intrarenal localization. Am J Physiol Renal Physiol 276: F347–F358, 1999.
291. Mount DB and Gamba G. Renal potassium-chloride cotransporters. Curr Opin Nephrol Hypertens 10: 685– 691, 2001.
292. Mount DB, Mercado A, Song L, Xu J, Geroge AL Jr, Delpire E,
and Gamba G. Cloning and characterization of KCC3 and KCC4,
new members of the cation-chloride cotransporter gene family.
J Biol Chem 274: 16355–16362, 1999.
293. Mount DB, Song L, Mercado A, Gamba G, and Delpire E.
Basolateral localization of renal tubular K-Cl cotransporters (Abstract). J Am Soc Nephrol 11: 35A, 2000.
294. Na KY, Oh YK, Han JS, Joo KW, Lee JS, Earm JH, Knepper
MA, and Kim GH. Upregulation of Na⫹ transporter abundances in
response to chronic thiazide or loop diuretic treatment in rats.
Am J Physiol Renal Physiol 284: F133–F143, 2003.
295. Neubauer BA, Fiedler B, Himmelein B, Kampfer F, Lassker U,
Schwabe G, Spanier I, Tams D, Bretscher C, Moldenhauer K,
Kurlemann G, Weise S, Tedroff K, Eeg-Olofsson O, Wadelius
C, and Stephani U. Centrotemporal spikes in families with rolandic epilepsy: linkage to chromosome 15q14. Neurology 51: 1608 –
1612, 1998.
296. Nielsen J, Kwon TH, Masilamani S, Beutler K, Hager H,
Nielsen S, and Knepper MA. Sodium transporter abundance
profiling in the kidney: effect of spironolactone. Am J Physiol
Renal Physiol 283: F923–F933, 2002.
297. Nielsen S, Maunsbach AB, Ecelbarger CA, and Knepper MA.
Ultrastructural localization of Na-K-2Cl cotransporter in thick ascending limb and macula densa of rat kidney. Am J Physiol Renal
Physiol 275: F885–F893, 1998.
298. Nijenhuis T, Hoenderop JG, Loffing J, van der Kemp AW, van
Os CH, and Bindels RJ. Thiazide-induced hypocalciuria is accompanied by a decreased expression of Ca2⫹ transport proteins in
kidney. Kidney Int 64: 555–564, 2003.
299. Noel LE and Newgard CB. Structural domains that contribute to
substrate specificity in facilitated glucose transporters are distinct
from those involved in kinetic function: studies with GLUT-1/
GLUT-2 chimeras. Biochemistry 36: 5465–5475, 1997.
300. Novello FC and Sprague JM. Benzothiadiazine dioxides as novel
diuretics. J Am Chem Soc 79: 2028 –2029, 1957.
301. Obermuller N, Bernstein P, Velázquez H, Reilly R, Moser D,
Ellison DH, and Bachman S. Expression of the thiazide-sensitive
Na-Cl cotransporter in rat and human kidney. Am J Physiol Renal
Fluid Electrolyte Physiol 269: F900 –F910, 1995.
489
490
GERARDO GAMBA
Physiol Rev • VOL
342. Riccardi D and Gamba G. The many roles of the calcium-sensing
receptor in health and disease. Arch Med Res 30: 436 – 448, 1999.
343. Riccardi D, Hall AE, Chattopadhyay N, Xu JZ, Brown EM, and
Hebert SC. Localization of the extracellular Ca2⫹/polyvalent cation-sensing protein in rat kidney. Am J Physiol Renal Physiol 274:
F611–F622, 1998.
344. Riccardi D, Lee WS, Lee K, Segre GV, Brown EM, and Hebert
SC. Localization of the extracellular Ca2⫹-sensing receptor and
PTH/PTHrP receptor in rat kidney. Am J Physiol Renal Fluid
Electrolyte Physiol 271: F951–F956, 1996.
345. Rivera C, Li H, Thomas-Crusells J, Lahtinen H, Viitanen T,
Nanobashvili A, Kokaia Z, Airaksinen MS, Voipio J, Kaila K,
and Saarma M. BDNF-induced TrkB activation down-regulates
the K⫹-Cl⫺ cotransporter KCC2 and impairs neuronal Cl⫺ extrusion. J Cell Biol 159: 747–752, 2002.
346. Rivera C, Voipio J, Payne JA, Ruusuvuori E, Lahtinen H,
Lamsa K, Pirvola U, Saarma M, and Kaila K. The K⫹/Cl⫺ cotransporter KCC2 renders GABA hyperpolarizing during neuronal
maturation. Nature 397: 251–255, 1999.
347. Rocha AS and Kokko JP. Sodium chloride and water transport in
the medullary thick ascending limb of Henle. Evidence for active
chloride transport. J Clin Invest 52: 612– 623, 1973.
348. Rose BD. Diuretics. Kidney Int 39: 336 –352, 1991.
349. Roussa E, Shmukler BE, Wilhelm S, Casula S, Stuart-Tilley
AK, Thevenod F, and Alper SL. Immunolocalization of potassium-chloride cotransporter polypeptides in rat exocrine glands.
Histochem Cell Biol 117: 335–344, 2002.
350. Rudomin P and Schmidt RF. Presynaptic inhibition in the vertebrate spinal cord revisited. Exp Brain Res 129: 1–37, 1999.
351. Russell JM. Sodium-potassium-chloride cotransport. Physiol Rev
80: 211–276, 2000.
352. Sabath E, Meade P, Berkman J, De Los HP, Moreno E, Bobadilla NA, Vazquez N, Ellison DH, and Gamba G. Pathophysiology of functional mutations of the thiazide-sensitive Na-Cl cotransporter in Gitelman disease. Am J Physiol Renal Physiol 287: F195–
F203, 2004.
353. Sakaguchi N, Crouch JJ, Lytle C, and Schulte BA. Na-K-Cl
cotransporter expression in the developing and senescent gerbil
cochlea. Hear Res 118: 114 –122, 1998.
354. Sallinen R, Tornberg J, Putkiranta M, Horelli-Kuitunen N,
Airaksinen MS, and Wessman M. Chromosomal localization of
SLC12A5/Slc12a5, the human and mouse genes for the neuronspecific K(⫹)-Cl(⫺) cotransporter (KCC2) defines a new region of
conserved homology. Cytogenet Cell Genet 94: 67–70, 2001.
355. Sangan P, Brill SR, Sangan S, Forbush B III, and Binder HJ.
Basolateral K-Cl cotransporter regulates colonic potassium absorption in potassium depletion. J Biol Chem 275: 30813–30816, 2000.
356. Sasaki S and Imai M. Effects of vasopressin on water and NaCl
transport across the in vitro perfused medullary thick ascending
limb of Henle’s loop of mouse, rat, and rabbit kidneys. Pflügers
Arch 383: 215–221, 1980.
357. Schambelan M, Sebastian A, and Rector FC Jr. Mineralocorticoid-resistant renal hyperkalemia without salt wasting (type II
pseudohypoaldosteronism): role of increased renal chloride reabsorption. Kidney Int 19: 716 –727, 1981.
358. Schlingmann KP, Konrad M, Jeck N, Waldegger P, Reinalter
SC, Holder M, Seyberth HW, and Waldegger S. Salt wasting and
deafness resulting from mutations in two chloride channels. N Engl
J Med 350: 1314 –1319, 2004.
359. Schnermann J. Juxtaglomerular cell complex in the regulation of
renal salt excretion. Am J Physiol Regul Integr Comp Physiol 274:
R263–R279, 1998.
360. Schoenherr CJ, Paquette AJ, and Anderson DJ. Identification
of potential target genes for the neuron-restrictive silencer factor.
Proc Natl Acad Sci USA 93: 9881–9886, 1996.
361. Schoofs MW, Van der KM, Hofman A, de Laet CE, Herings RM,
Stijnen T, Pols HA, and Stricker BH. Thiazide diuretics and the
risk for hip fracture. Ann Intern Med 139: 476 – 482, 2003.
362. Schulte U, Hahn H, Konrad M, Jeck N, Derst C, Wild K,
Weidemann S, Ruppersberg JP, Fakler B, and Ludwig J. pH
gating of ROMK [K(ir)1.1] channels: control by an Arg-Lys-Arg triad
disrupted in antenatal Bartter syndrome. Proc Natl Acad Sci USA
96: 15298 –15303, 1999.
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
322. Piechotta K, Lu J, and Delpire E. Cation chloride cotransporters
interact with the stress-related kinases Ste20-related proline-alanine-rich kinase (SPAK) and oxidative stress response 1 (OSR1).
J Biol Chem 277: 50812–50819, 2002.
323. Plata C, Meade P, Hall AE, Welch RC, Vazquez N, Hebert SC,
and Gamba G. Alternatively spliced isoform of the apical Na-K-Cl
cotransporter gene encodes a furosemide sensitive Na-Cl cotransporter. Am J Physiol Renal Physiol 280: F574 –F582, 2001.
324. Plata C, Meade P, Vazquez N, Hebert SC, and Gamba G.
Functional properties of the apical Na⫹-K⫹-2Cl⫺ cotransporter
isoforms. J Biol Chem 277: 11004 –11012, 2002.
325. Plata C, Mount DB, Rubio V, Hebert SC, and Gamba G. Isoforms of the Na-K-2Cl cotransporter in murine TAL. II. Functional
characterization and activation by cAMP. Am J Physiol Renal
Physiol 276: F359 –F366, 1999.
326. Plotkin MD, Kaplan MR, Peterson LN, Gullans SR, Hebert SC,
and Delpire E. Expression of the Na⫹-K⫹-2Cl⫺ cotransporter
BSC2 in the nervous system. Am J Physiol Cell Physiol 272: C173–
C183, 1997.
327. Plotkin MD, Kaplan MR, Verlander JM, Lee WS, Brown D,
Poch E, Gullans SR, and Hebert SC. Localization of the thiazide
sensitive Na-Cl cotransporter, rTSC1, in the rat kidney. Kidney Int
50: 174 –183, 1996.
328. Plotkin MD, Snyder EY, Hebert SC, and Delpire E. Expression
of the Na-K-2Cl cotransporter is developmentally regulated in postnatal rat brains: a possible mechanism underlying GABA’s excitatory role in immature brain. J Neurobiol 33: 781–795, 1997.
329. Pollak MR, Delaney VB, Graham RM, and Hebert SC. Gitelman’s syndrome (Bartter’s variant) maps to the thiazide-sensitive
cotransporter gene locus on chromosome 16q13 in a large kindred.
J Am Soc Nephrol 7: 2244 –2248, 1996.
330. Quaggin SE, Payne JA, Forbush B III, and Igarashi P. Localization of the renal Na-K-Cl cotransporter gene (Slc12a1) on mouse
chromosome 2. Mamm Genome 6: 557–558, 1995.
331. Race JE, Makhlouf FN, Logue PJ, Wilson FH, Dunham PB, and
Holtzman EJ. Molecular cloning and functional characterization
of KCC3, a new K-Cl cotransporter. Am J Physiol Cell Physiol 277:
C1210 –C1219, 1999.
332. Randall J, Thorne T, and Delpire E. Partial cloning and characterization of Slc12a2: the gene encoding the secretory Na⫹-K⫹-2Cl⫺
cotransporter. Am J Physiol Cell Physiol 273: C1267–C1277, 1997.
333. Ray WA, Griffin MR, Downey W, and Melton LJ III. Long-term
use of thiazide diuretics and risk of hip fracture. Lancet I: 687– 690,
1989.
334. Reeves WB, Molony DA, and Andreoli TE. Diluting power of
thick limbs of Henle. III. Modulation of in vitro diluting power.
Am J Physiol Renal Fluid Electrolyte Physiol 255: F1145–F1154,
1988.
335. Reeves WB, Winters CJ, and Andreoli TE. Chloride channels in
the loop of Henle. Annu Rev Physiol 63: 631– 645, 2001.
336. Reid IR, Ames RW, Orr-Walker BJ, Clearwater JM, Horne
AM, Evans MC, Murray MA, McNeil AR, and Gamble GD.
Hydrochlorothiazide reduces loss of cortical bone in normal postmenopausal women: a randomized controlled trial. Am J Med 109:
362–370, 2000.
337. Reilly RF and Ellison DH. Mammalian distal tubule: physiology,
pathophysiology, and molecular anatomy. Physiol Rev 80: 277–313,
2000.
338. Reinalter SC, Jeck N, Brochhausen C, Watzer B, Nusing RM,
Seyberth HW, and Komhoff M. Role of cyclooxygenase-2 in
hyperprostaglandin E syndrome/antenatal Bartter syndrome. Kidney Int 62: 253–260, 2002.
339. Reissinger A, Ludwig M, Utsch B, Promse A, Baulmann J,
Weisser B, Vetter H, Kramer HJ, and Bokemeyer D. Novel
NCCT gene mutations as a cause of Gitelman’s syndrome and a
systematic review of mutant and polymorphic NCCT alleles. Kidney Blood Press Res 25: 354 –362, 2002.
340. Renfro JL. Water and ion transport by the urinary bladder of the
teleost Pseudopleuronectus americanus. Am J Physiol 228: 52– 61,
1975.
341. Renfro JL. Interdependence of active Na⫹ and Cl⫺ transport by
the isolated urinary bladder of the teleost, Pseudopleuronectes
americanus. J Exp Zool 199: 383–390, 1977.
ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS
Physiol Rev • VOL
383. Starremans PF, Der Kemp AM, Knoers NM, van Den Heuvel
LJ, and Bindels RM. Functional implications of mutations in the
human renal outer medullary potassium channel (ROMK2) identified in Bartter syndrome. Pflügers Arch 443: 466 – 472, 2002.
384. Starremans PG, Kersten FF, Knoers NV, van den Heuvel LP,
and Bindels RJ. Mutations in the human Na-K-2Cl cotransporter
(NKCC2) identified in Bartter syndrome type I consistently result in
nonfunctional transporters. J Am Soc Nephrol 14: 1419 –1426, 2003.
385. Starremans PG, Kersten FF, van den Heuvel LP, Knoers NV,
and Bindels RJ. Dimeric architecture of the human bumetanidesensitive Na-K-Cl co-transporter. J Am Soc Nephrol 14: 3039 –3046,
2003.
386. Stokes GS, Gentle JL, Edwards KD, and Stewart JH. Syndrome of idiopathic hyperkalaemia and hypertension with decreased plasma renin activity: effects on plasma renin and aldosterone of reducing the serum potassium level. Med J Aust 2: 1050 –
1054, 1968.
387. Stokes JB. Effect of prostaglandin E2 on chloride transport across
the rabbit thick ascending limb of Henle. Selective inhibitions of
the medullary portion. J Clin Invest 64: 495–502, 1979.
388. Stokes JB. Passive NaCl transport in the flounder urinary bladder:
predominance of a cellular pathway. Am J Physiol Renal Fluid
Electrolyte Physiol 255: F229 –F236, 1988.
389. Stokes JB, Lee I, and D’Amico M. Sodium chloride absorption by
the urinary bladder of the winter flounder. A thiazide-sensitive,
electrically neutral transport system. J Clin Invest 74: 7–16, 1984.
390. Strange K, Singer TD, Morrison R, and Delpire E. Dependence
of KCC2 K-Cl cotransporter activity on a conserved carboxy terminus tyrosine residue. Am J Physiol Cell Physiol 279: C860 –C867,
2000.
391. Strausberg RL, Feingold EA, Grouse LH, Derge JG, Klausner
RD, Collins FS, Wagner L, Shenmen CM, Schuler GD, Altschul
SF, Zeeberg B, Buetow KH, Schaefer CF, Bhat NK, Hopkins
RF, Jordan H, Moore T, Max SI, Wang J, Hsieh F, Diatchenko
L, Marusina K, Farmer AA, Rubin GM, Hong L, Stapleton M,
Soares MB, Bonaldo MF, Casavant TL, Scheetz TE, Brownstein MJ, Usdin TB, Toshiyuki S, Carninci P, Prange C, Raha
SS, Loquellano NA, Peters GJ, Abramson RD, Mullahy SJ,
Bosak SA, McEwan PJ, McKernan KJ, Malek JA, Gunaratne
PH, Richards S, Worley KC, Hale S, Garcia AM, Gay LJ, Hulyk
SW, Villalon DK, Muzny DM, Sodergren EJ, Lu X, Gibbs RA,
Fahey J, Helton E, Ketteman M, Madan A, Rodrigues S,
Sanchez A, Whiting M, Madan A, Young AC, Shevchenko Y,
Bouffard GG, Blakesley RW, Touchman JW, Green ED, Dickson MC, Rodriguez AC, Grimwood J, Schmutz J, Myers RM,
Butterfield YS, Krzywinski MI, Skalska U, Smailus DE,
Schnerch A, Schein JE, Jones SJ, and Marra MA. Generation
and initial analysis of more than 15,000 full-length human and
mouse cDNA sequences. Proc Natl Acad Sci USA 99: 16899 –16903,
2002.
392. Su W, Shmukler BE, Chernova MN, Stuart-Tilley AK, de
Franceschi L, Brugnara C, and Alper SL. Mouse K-Cl cotransporter KCC1: cloning, mapping, pathological expression, and functional regulation. Am J Physiol Cell Physiol 277: C899 –C912, 1999.
393. Sun A, Grossman EB, Lombardi M, and Hebert SC. Vasopressin
alters the mechanism of apical Cl⫺ entry from Na⫹:Cl⫺ to Na⫹:K⫹:
2Cl⫺ cotransport in mouse medullary thick ascending limb. J
Membr Biol 120: 83–94, 1991.
394. Sung KW, Kirby M, McDonald MP, Lovinger DM, and Delpire
E. Abnormal GABAA receptor-mediated currents in dorsal root
ganglion neurons isolated from Na-K-2Cl cotransporter null mice.
J Neurosci 20: 7531–7538, 2000.
395. Syren ML, Tedeschi S, Cesareo L, Bellantuono R, Colussi G,
Procaccio M, Ali A, Domenici R, Malberti F, Sprocati M, Sacco
M, Miglietti N, Edefonti A, Sereni F, Casari G, Coviello DA,
and Bettinelli A. Identification of fifteen novel mutations in the
SLC12A3 gene encoding the Na-Cl Co-transporter in Italian patients
with Gitelman syndrome. Hum Mutat 20: 78, 2002.
396. Tajima T, Kobayashi Y, Abe S, Takahashi M, Konno M, Nakae
J, Okuhara K, Satoh K, Ishikawa T, Imai T, and Fujieda K.
Two novel mutations of thiazide-sensitive Na-Cl cotransporter
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
363. Schultheis PJ, Lorenz JN, Meneton P, Nieman ML, Riddle TM,
Flagella M, Duffy JJ, Doetschman T, Miller ML, and Shull GE.
Phenotype resembling Gitelman’s syndrome in mice lacking the
apical Na⫹-Cl⫺ cotransporter of the distal convoluted tubule. J Biol
Chem 273: 29450 –29155, 1998.
364. Schwiebert EM, Morales MM, Devidas S, Egan ME, and Guggino WB. Chloride channel and chloride conductance regulator
domains of CFTR, the cystic fibrosis transmembrane conductance
regulator. Proc Natl Acad Sci USA 95: 2674 –2679, 1998.
365. Sebastian A. Thiazides and bone. Am J Med 109: 429 – 430, 2000.
366. Shaer AJ. Inherited primary renal tubular hypokalemic alkalosis:
a review of Gitelman and Bartter syndromes. Am J Med Sci 322:
316 –332, 2001.
367. Shen MR, Chou CY, and Ellory JC. Volume-sensitive KCl cotransport associated with human cervical carcinogenesis. Pflügers
Arch 440: 751–760, 2000.
368. Shen MR, Chou CY, Hsu KF, Hsu YM, Chiu WT, Tang MJ,
Alper SL, and Ellory JC. KCl cotransport is an important modulator of human cervical cancer growth and invasion. J Biol Chem
278: 39941–39950, 2003.
369. Shen MR, Chou CY, Hsu KF, Liu HS, Dunham PB, Holtzman
EJ, and Ellory JC. The KCl cotransporter isoform KCC3 can play
an important role in cell growth regulation. Proc Natl Acad Sci USA
98: 14714 –14719, 2001.
370. Shmukler BE, Brugnara C, and Alper SL. Structure and genetic
polymorphism of the mouse KCC1 gene. Biochim Biophys Acta
1492: 353–361, 2000.
371. Shull GE, Lane LK, and Lingrel JB. Amino-acid sequence of the
beta-subunit of the (Na⫹⫹K⫹)ATPase deduced from a cDNA. Nature 321: 429 – 431, 1986.
372. Shull GE, Schwartz A, and Lingrel JB. Amino-acid sequence of
the catalytic subunit of the (Na⫹K⫹)ATPase deduced from a complementary DNA. Nature 316: 691– 695, 1985.
373. Simon DB, Bindra RS, Mansfield TA, Nelson-Williamns C,
Mendonca E, Stone R, Schurman S, Nayir A, Alpay H,
Bakkaloglu A, Rodriguez-Soriano J, Morales JM, Sanjad SA,
Taylor CM, Pilz D, Brem A, Trachtman H, Griswold W, Richard GA, John E, and Lifton RP. Mutations in the chloride channel gene, CLCNKB, cause Bartter’s syndrome type III. Nature Genet
17: 171–178, 1997.
374. Simon DB, Farfel Z, Ellison D, Bia M, Tucci J, and Lifton RP.
Examination of the thiazide-sensitive Na-Cl cotransporter as a
candidate gene in Gordon’s syndrome (Abstract). J Am Soc Nephrol 6: 632, 1995.
375. Simon DB, Karet FE, Hamdan JM, Di Pietro A, Sanjad SA, and
Lifton RP. Bartter’s syndrome, hypokalaemic alkalosis with hypercalciuria, is caused by mutations in the Na-K-2Cl cotransporter
NKCC2. Nature Genet 13: 183–188, 1996.
376. Simon DB, Karet FE, Rodriguez-Soriano J, Hamdan JH, DiPietro A, Trachtman H, Sanjad SA, and Lifton RP. Genetic
heterogeneity of Bartter’s syndrome revealed by mutations in the
K⫹ channel, ROMK. Nature Genet 14: 152–156, 1996.
377. Simon DB, Nelson-Williams C, Johnson-Bia M, Ellison D,
Karet FE, Morey-Molina A, Vaara I, Iwata F, Cushner HM,
Koolen M, Gainza FJ, Gitelman HJ, and Lifton RP. Gitelman’s
variant of Bartter’s syndrome, inherited hypokalaemic alkalosis, is
caused by mutations in the thiazide-sensitive Na-Cl cotransporter.
Nature Genet 12: 24 –30, 1996.
378. Smith HW. From Fish to Philosopher. Boston, MA: Little Brown,
1953.
379. Snouwaert JN, Brigman KK, Latour AM, Malouf NN, Boucher
RC, Smithies O, and Koller BH. An animal model for cystic
fibrosis made by gene targeting. Science 257: 1083–1088, 1992.
380. Song L, Mercado A, Vazquez N, Xie Q, Desai R, George AL,
Gamba G, and Mount DB. Molecular, functional, and genomic
characterization of human KCC2, the neuronal K-Cl cotransporter.
Brain Res 103: 91–105, 2002.
381. Spitzer A, Edelmann CM Jr, Goldberg LD, and Henneman PH.
Short stature, hyperkalemia and acidosis: a defect in renal transport of potassium. Kidney Int 3: 251–257, 1973.
382. Starke LC and Jennings ML. K-Cl cotransport in rabbit red cells:
further evidence for regulation by protein phosphatase type 1.
Am J Physiol Cell Physiol 264: C118 –C124, 1993.
491
492
397.
398.
399.
400.
402.
403.
404.
405.
406.
407.
408.
409.
410.
411.
412.
413.
(TSC) gene in two sporadic Japanese patients with Gitelman syndrome. Endocr J 49: 91–96, 2002.
Takahashi N, Chernavvsky DR, Gomez RA, Igarashi P, Gitelman HJ, and Smithies O. Uncompensated polyuria in a mouse
model of Bartter’s syndrome. Proc Natl Acad Sci USA 97: 5434 –
5439, 2000.
Takeuchi K, Kure S, Kato T, Taniyama Y, Takahashi N, Ikeda
Y, Abe T, Narisawa K, Muramatsu Y, and Abe K. Association of
a mutation in thiazide-sensitive Na-Cl cotransporter with familial
Gitelman’s syndrome. J Clin Endocrinol Metab 81: 4496 – 4499,
1996.
Tamari M, Daigo Y, and Nakamura Y. Isolation and characterization of a novel serine threonine kinase gene on chromosome
3p22–21.3. J Hum Genet 44: 116 –120, 1999.
Taniyama Y, Sato K, Sugawara A, Uruno A, Ikeda Y, Kudo M,
Ito S, and Takeuchi K. Renal tubule-specific transcription and
chromosomal localization of rat thiazide-sensitive Na-Cl cotransporter gene. J Biol Chem 276: 26260 –26268, 2001.
The ALLHAT Officers and Coordinators for the ALLHAT
Collaborative Research Group. Major outcomes in high-risk hypertensive patients randomized to angiotensin-converting enzyme
inhibitor or calcium channel blocker vs diuretic: the Antihypertensive and Lipid-Lowering Treatment to Prevent Heart Attack Trial
(ALLHAT). JAMA 288: 2981–2997, 2002.
Torikai S and Kurokawa K. Effect of PGE2 on vasopressindependent cell cAMP in isolated single nephron segments. Am J
Physiol Renal Fluid Electrolyte Physiol 245: F58 –F66, 1983.
Tovar-Palacio C, Bobadilla NA, Cortes P, Plata C, De los
Heros P, Vazquez N, and Gamba G. Ion and diuretic specificity of
chimeric proteins between apical Na⫹:K⫹:2Cl⫺ and Na⫹:Cl⫺ cotransporters. Am J Physiol Renal Physiol 287: F570 –F577, 2004.
Tran JM, Farrell MA, and Fanestil DD. Effect of ions on binding
of the thiazide-type diuretic metolazone to kidney membrane. Am J
Physiol Renal Fluid Electrolyte Physiol 258: F908 –F915, 1990.
Turban S, Wang XY, and Knepper MA. Regulation of NHE3,
NKCC2 and NCC abundance in kidney during aldosterone-escape
phenomenon: role of NO. Am J Physiol Renal Physiol 285: F843–
F841, 2003.
Turner RJ and Geroge JN. Solubilization and partial purification
of the rabbit parotid Na/K/Cl-dependent bumetanide binding site. J
Membr Biol 113: 203–210, 1990.
Ushiro H, Tsutsumi T, Suzuki K, Kayahara T, and Nakano K.
Molecular cloning and characterization of a novel Ste20-related
protein kinase enriched in neurons and transporting epithelia. Arch
Biochem Biophys 355: 233–240, 1998.
Vargas-Poussou R, Feldman D, Vollmer M, Konrad M, Kelly L,
Van der Heuvel LPWJ, Tebouri L, Brandis M, Karolyi L, Hebert SC, Lemmink HH, Deschênes G, Hildebrandt F, Seyberth
HW, Guay-Woodford LM, Knoers NVAM, and Antignac C.
Novel molecular variants of the Na-K-2Cl cotransporter gene are
responsible for atenatal Bartter syndrome. Am J Hum Genet 62:
1332–1340, 1998.
Vargas-Poussou R, Huang C, Hulin P, Houillier P, Jeunemaitre X, Paillard M, Planelles G, Dechaux M, Miller RT, and
Antignac C. Functional characterization of a calcium-sensing receptor mutation in severe autosomal dominant hypocalcemia with
a Bartter-like syndrome. J Am Soc Nephrol 13: 2259 –2266, 2002.
Vazquez N, Monroy A, Dorantes E, Munoz-Clares RA, and
Gamba G. Functional differences between flounder and rat thiazide-sensitive Na-Cl cotransporter. Am J Physiol Renal Physiol
282: F599 –F607, 2002.
Velazquez H, Bartiss A, Bernstein P, and Ellison DH. Adrenal
steroids stimulate thiazide-sensitive NaCl transport by rat renal
distal tubules. Am J Physiol Renal Fluid Electrolyte Physiol 270:
F211–F219, 1996.
Velazquez H, Good DW, and Wright FS. Mutual dependence of
sodium and chloride absorption by renal distal tubule. Am J
Physiol Renal Fluid Electrolyte Physiol 247: F904 –F911, 1984.
Velazquez H, Naray-Fejes-Toth A, Silva T, Andujar E, Reilly
RF, Desir GV, and Ellison DH. Rabbit distal convoluted tubule
coexpresses NaCl cotransporter and 11 beta-hydroxysteroid dehydrogenase II mRNA. Kidney Int 54: 464 – 472, 1998.
Physiol Rev • VOL
414. Velazquez H and Silva T. Cloning and localization of KCC4 in
rabbit kidney: expression in distal convoluted tubule. Am J Physiol
Renal Physiol 285: F49 –F58, 2003.
415. Verissimo F and Jordan P. WNK kinases, a novel protein kinase
subfamily in multi-cellular organisms. Oncogene 20: 5562–5569,
2001.
416. Verlander JM, Tran TM, Zhang L, Kaplan MR, and Hebert SC.
Estradiol enhances thiazide-sensitive NaCl cotransporter density in
the apical plasma membrane of the distal convoluted tubule in
ovariectomized rats. J Clin Invest 101: 1661–1669, 1998.
417. Vetter DE, Mann JR, Wangemann P, Liu J, McLaughlin KJ,
Lesage F, Marcus DC, Lazdunski M, Heinemann SF, and Barhanin J. Inner ear defects induced by null mutation of the isk gene.
Neuron 17: 1251–1264, 1996.
418. Vibat CR, Holland MJ, Kang JJ, Putney LK, and O’Donnell
ME. Quantitation of Na⫹-K⫹-2Cl⫺ cotransport splice variants in
human tissues using kinetic polymerase chain reaction. Anal Biochem 298: 218 –230, 2001.
419. Vollmer M, Koehrer M, Topaloglu R, Strahm B, Omran H, and
Hildebrandt F. Two novel mutations of the gene for Kir 1.1
(ROMK) in neonatal Bartter syndrome. Pediatr Nephrol 12: 69 –71,
1998.
420. Vu TQ, Payne JA, and Copenhagen DR. Localization and developmental expression patterns of the neuronal K-Cl cotransporter
(KCC2) in the rat retina. J Neurosci 20: 1414 –1423, 2000.
421. Waldegger S, Jeck N, Barth P, Peters M, Vitzthum H, Wolf K,
Kurtz A, Konrad M, and Seyberth HW. Barttin increases surface
expression and changes current properties of ClC-K channels.
Pflügers Arch 444: 411– 418, 2002.
423. Wang J, Pravenec M, Kren V, and Kurtz TW. Linkage mapping
of the Na-K-2Cl cotransporter gene (Slc12a1) to rat chromosome 3.
Mamm Genome 8: 379, 1997.
424. Wang XY, Masilamani S, Nielsen J, Kwon TH, Brooks HL,
Nielsen S, and Knepper MA. The renal thiazide-sensitive Na-Cl
cotransporter as mediator of the aldosterone-escape phenomenon.
J Clin Invest 108: 215–222, 2001.
425. Wang Z, Yang CL, and Ellison DH. Comparison of WNK4 and
WNK1 kinase and inhibiting activities. Biochem Biophys Res Commun 317: 939 –944, 2004.
426. Ward DT, Yau SK, Mee AP, Mawer EB, Miller CA, Garland HO,
and Riccardi D. Functional, molecular, and biochemical characterization of streptozotocin-induced diabetes. J Am Soc Nephrol 12:
779 –790, 2001.
427. Warnock DG and Eveloff J. K-Cl cotransport systems. Kidney
Int 36: 412– 417, 1989.
428. Wasnich R, Davis J, Ross P, and Vogel J. Effect of thiazide on
rates of bone mineral loss: a longitudinal study. Br Med J 301:
1303–1305, 1990.
429. Watanabe S, Fukumoto S, Chang H, Takeuchi Y, Hasegawa Y,
Okazaki R, Chikatsu N, and Fujita T. Association between
activating mutations of calcium-sensing receptor and Bartter’s syndrome. Lancet 360: 692– 694, 2002.
430. Weil-Maslansky E, Gutman Y, and Sasson S. Insulin activates
furosemide-sensitive K⫹ and Cl⫺ uptake system in BC3H1 cells.
Am J Physiol Cell Physiol 267: C932–C939, 1994.
431. Weinstein SF, Allan DM, and Mendoza SA. Hyperkalemia, acidosis, and short stature associated with a defect in renal potassium
excretion. J Pediatr 85: 355–358, 1974.
432. Williams JR and Payne JA. Cation transport by the neuronal K-Cl
cotransporter, KCC2: thermodynamics and kinetics of alternate
transport modes. Am J Physiol Cell Physiol 2004.
433. Wilson FH, Disse-Nicodeme S, Choate KA, Ishikawa K, Nelson-Williams C, Desitter I, Gunel M, Milford DV, Lipkin GW,
Achard JM, Feely MP, Dussol B, Berland Y, Unwin RJ, Mayan
H, Simon DB, Farfel Z, Jeunemaitre X, and Lifton RP. Human
hypertension caused by mutations in WNK kinases. Science 293:
1107–1112, 2001.
434. Wilson FH, Kahle KT, Sabath E, Lalioti MD, Rapson AK,
Hoover RS, Hebert SC, Gamba G, and Lifton RP. Molecular
pathogenesis of inherited hypertension with hyperkalemia: the
Na-Cl cotransporter is inhibited by wild-type but not mutant WNK4.
Proc Natl Acad Sci USA 100: 680 – 684, 2003.
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
401.
GERARDO GAMBA
ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS
Physiol Rev • VOL
444. Yamauchi K, Rai T, Kobayashi K, Sohara E, Suzuki T, Itoh T,
Suda S, Hayama A, Sasaki S, and Uchida S. Disease-causing
mutant WNK4 increases paracellular chloride permeability and
phosphorylates claudins. Proc Natl Acad Sci USA 101: 4690 – 4694,
2004.
445. Yan GX, Chen J, Yamada KA, Kleber AG, and Corr PB. Contribution of shrinkage of extracellular space to extracellular K⫹
accumulation in myocardial ischaemia of the rabbit. J Physiol 490:
215–228, 1996.
446. Yang CL, Angell J, Mitchell R, and Ellison DH. WNK kinases
regulate thiazide-sensitive Na-Cl cotransport. J Clin Invest 111:
1039 –1045, 2003.
447. Yang T, Huang YG, Singh I, Schnermann J, and Briggs JP.
Localization of bumetanide- and thiazide-sensitive Na-K-Cl cotransporters along the rat nephron. Am J Physiol Renal Fluid Electrolyte Physiol 271: F931–F939, 1996.
448. Yerby TR, Vibat CRT, Sun D, Payne JA, and O’Donnell ME.
Molecular characterization of the Na-K-Cl cotransporter of bovine
aortic endothelial cells. Am J Physiol Cell Physiol 273: C188 –C197,
1997.
449. Yoo TH, Lee SH, Yoon K, Baek H, Chung JH, Lee T, Ihm C, and
Kim M. Identification of novel mutations in Na-Cl cotransporter
gene in a Korean patient with atypical Gitelman’s syndrome. Am J
Kidney Dis 42: E11–E16, 2003.
450. Zade-Oppen AM and Lauf PK. Thiol-dependent passive K:Cl
transport in sheep red blood cells. IX. Modulation by pH in the
presence and absence of DIDS and the effect of NEM. J Membr
Biol 118: 143–151, 1990.
451. Zhou GP, Wong C, Su R, Crable SC, Anderson KP, and Gallagher PG. Human potassium chloride cotransporter 1 (SLC12A4)
promoter is regulated by AP-2 and contains a functional downstream promoter element. Blood 103: 4302– 4309, 2004.
452. Ziyadeh FN, Kelepouris E, and Agus ZS. Thiazides stimulate
calcium absorption in urinary bladder of winter flounder. Biochim
Biophys Acta 897: 52–56, 1987.
85 • APRIL 2005 •
www.prv.org
Downloaded from http://physrev.physiology.org/ by 10.220.33.5 on July 4, 2017
435. Winters CJ, Reeves WB, and Andreoli TE. A survey of transport
properties of the thick ascending limb. Semin Nephrol 11: 236 –247,
1991.
436. Wolf K, Castrop H, Riegger GA, Kurtz A, and Kramer BK.
Differential gene regulation of renal salt entry pathways by salt
load in the distal nephron of the rat. Pflügers Arch 442: 498 –504,
2001.
437. Woo NS, Lu J, England R, McClellan R, Dufour S, Mount DB,
Deutch AY, Lovinger DM, and Delpire E. Hyperexcitability and
epilepsy associated with disruption of the mouse neuronal-specific
K-Cl cotransporter gene. Hippocampus 12: 258 –268, 2002.
438. Wu Q, Delpire E, Hebert SC, and Strange K. Functional demonstration of Na⫹-K⫹-2Cl⫺ cotransporter activity in isolated, polarized choroid plexus cells. Am J Physiol Cell Physiol 275: C1565–
C1572, 1998.
439. Xu B, English JM, Wilsbacher JL, Stippec S, Goldsmith EJ,
and Cobb MH. WNK1, a novel mammalian serine/threonine protein kinase lacking the catalytic lysine in subdomain II. J Biol Chem
275: 16795–16801, 2000.
440. Xu JC, Lytle C, Zhu TT, Payne JA, Benz E Jr, and Forbush B
III. Molecular cloning and functional expression of the bumetanide-sensitive Na-K-Cl cotransporter. Proc Natl Acad Sci USA 91:
2201–2205, 1994.
441. Xu JZ, Hall AE, Peterson LN, Bienkowski MJ, Eessalu TE,
and Hebert SC. Localization of the ROMK protein on apical
membranes of rat kidney nephron segments. Am J Physiol Renal
Physiol 273: F739 –F749, 1997.
442. Yahata K, Tanaka I, Kotani M, Mukoyama M, Ogawa Y, Goto
M, Nakagawa M, Sugawara A, Tanaka K, Shimatsu A, and
Nakao K. Identification of a novel R642C mutation in Na/Cl cotransporter with Gitelman’s syndrome. Am J Kidney Dis 34: 845–
853, 1999.
443. Yamada J, Okabe A, Toyoda H, Kilb W, Luhmann HJ, and
Fukuda A. Cl⫺ uptake promoting depolarizing GABA actions in
immature rat neocortical neurones is mediated by NKCC1.
J Physiol 557: 829 – 841, 2004.
493