CALIFORNIA STATE UNIVERSITY, NORTHRIDGE
REGULATION OF GLUCOCORTICOID-EVOKED APOPTOSIS IN HUMAN
LEUKEMIC CEM CELLS BY BCL11B
A thesis submitted in partial fulfilment of the requirements
For the degree of Master of Science in Biology
By
Sara Zabih
August 2014
The thesis of Sara Zabih is approved by:
_____________________________________
Chintda Santiskulvong, Ph.D
__________________
[Date]
_____________________________________
Steven Oppenheimer, Ph.D
__________________
[Date]
_____________________________________
Rheem D. Medh, Ph.D., Chair
__________________
[Date]
California State University, Northridge
ii
ACKNOWLEDGMENTS
I would like to express my deepest gratitude to my advisor, Dr. Rheem Medh, for
her excellent guidance, caring, patience, and providing me with an excellent atmosphere
for doing research. Dr. Medh has been exceptionally patient and understanding
throughout the process of completing this work.
I would like to thank Dr. Steven Oppenheimer for his inspired teaching and
guidance. I would particularly like to thank Dr. Chintda Santiskulvong for being on my
thesis committee, for guiding me throughout the completion of this thesis and for her
encouragement, support and friendship.
I would also like to thank all of Dr. Medh’s laboratory members for their
friendship, individual expertise and motivating me throughout this process. Also, I would
like to extend my gratitude to my loving family and friends for giving me emotional
support and for their encouragement to the end. Thank you all.
iii
TABLE OF CONTENTS
SIGNATURE PAGE ......................................................................................................... ii
ACKNOWLEDGEMENTS............................................................................................... iii
LIST OF FIGURES ...........................................................................................................vi
LIST OF TABLES.............................................................................................................vii
ABSTRACT ................................................................................................................... viii
CHAPTER ONE: INTRODUCTION..................................................................................1
1.1 Apoptosis…………….......................................................................................1
1.2 General Mechanisms of Apoptosis....................................................................3
1.3 The Bcl-2 Family Proteins.................................................................................7
1.4 Leukemia ……...………………………………………………………………9
1.5 Acute Lymphoblastic Leukemia......................................................................10
1.6 Glucocorticoid Hormones……........................................................................12
1.7 Mechanism of Glucocorticoid Action ............................................................15
1.8 E4BP4 Gene……………………………….....................................................17
1.9 Bcl11b Gene………………….........................................................................18
1.10 Bcl11b gene in non-lymphoid tissues............................................................21
1.11 Bcl11b as a Transcription Factor...................................................................21
1.12 Role of Bcl11b in T-cell development and maintenance of T-cell identity...22
1.13 Hypothesis: Bcl11b and Its Relationship with E4BP4..................................24
CHAPTER TWO: MATERIALS & METHODS..............................................................26
2.1 Leukemic Cell Lines........................................................................................26
2.2 Cell Culture……………..................................................................................26
2.3 Cell treatment & reagents……………............................................................27
2.4 Measurement of cell density using Trypan Blue.............................................27
2.5 Cell Viability Assay……………………….....................................................28
2.6 RNA Extraction…………………………..... .................................................28
iv
2.7 Reverse Transcription Reaction…………………...........................................29
2.8 Real-Time Reverse-Transcription PCR: Primer Design ……….....................30
2.9 Real-Time Polymerase Chain reaction & DNA Gel
....................................31
2.10 Quantitative RT-PCR method………………................................................33
CHAPTER THREE: RESULTS........................................................................................37
3.1 Cell Viability Assays ………………... ..........................................................38
3.2 Gel electrophoresis analysis of RT-PCR product…………………................39
3.3 qRT-PCR output……………………………………………..........................40
3.4 LinReg data……………………………………………………......................41
3.5 Pfaffl output and SYSTAT Statistical Analysis...............................................41
CHAPTER FOUR: DISCUSSION & CONCLUSIONS...................................................51
Experimental limitations and Future directions…………………….57
REFERENCES .................................................................................................................58
v
LIST OF FIGURES
Figure 1.1 Extrinsic and intrinsic signaling pathway of apoptosis ……….............………4
Figure 1.2 Bcl2 Family proteins…………………………………………………….…….8
Figure 1.3 The Structural representation of dexamethasone and cortisol………….…….15
Figure 1.4 Bcl11b protein Structure and Splice Variant ………………………………...20
Figure 1.5: Effect of Bcl11b deletion on Pro T cell…………………………………..….24
Figure 2.1: 12-well plate for cell viability assay…………………………………………28
Figure 2.2 Human Bcl11b gene’s coding sequence……………...………………………30
Figure 2.3 Amplifying region of Bcl11b gene with designed primers.………….………32
Figure 3.1: CEM Cells Growth Curve………………………….…………..……………43
Figure 3.2 Gel electrophoresis of RT-PCR products………………….…………..……..44
Figure 3.3 qRT-PCR output for CEM Cell…………………………..……………..……45
Figure 3.4 B-actin and Bcl11b Dissociation Curve………………..………...…………..46
Figure 3.5 LinReg Data Analysis……………………….….……...…….……………….47
Figure 3.6 Statistical data analysis…………………….…………..…….……………….49
Figure 3.7 Individual Statistical Data Analysis………………………………………….50
Figure 4.1 Schematic representation of the regulatory
network of apoptosis in Bcl11b and its related genes………………………..56
vi
LIST OF TABLES
Table 2.1: Example of NanoDrop Data……………………………………….…………35
Table 2.2: Reverse Transcription Reaction…………………………………….………...35
Table 2.3: RT-PCR Primers…………………………………………………….………..35
Table 2.4: PCR reaction……………………………………………………….…………36
Table 2.5: Thermocycler set up………………………………………………………….36
Table 2.6 Quantitative Thermocycler protocol…………………………………………..36
Table 3.1 Data Analysis using Pfaffl method……………………………………….…...48
vii
ABSTRACT
REGULATION OF GLUCOCORTICOID-EVOKED APOPTOSIS IN HUMAN
LEUKEMIC CEM CELLS BY BCL11B
By
Sara Zabih
Master of Science in Biology
Apoptotic cell death is essential for embryonic development, tissue homeostasis,
and a well-functioning immune system. Impaired apoptosis is both critical in cancer
development and is a major barrier to effective treatment. In response to diverse
intracellular damage signals, including those evoked by cancer therapy, the cell's decision
to undergo apoptosis is determined by interactions between pro-survival and proapoptotic proteins and their relative expression levels. Glucocorticoid (GC) are steroid
hormones that provoke a wide array of effects on cells. Synthetic GCs such as
dexamethasone (Dex), serve as therapeutic agents for some lymphoid leukemias because
of their ability to induce transcriptional changes and trigger apoptosis via activation of
the Glucocorticoid Receptor (GR). Using a pair of human leukemic T cell lines: CEMC7-14 (GC sensitive) and CEM-C1-15 (GC-resistant), our laboratory has shown that
Dex-mediated E4BP4 upregulation is a crucial step in activation of apoptosis. Recently,
E4BP4 was shown to be a defining factor for natural killer (NK) cell development. The
B-cell lymphoma 11B (Bcl11b) gene plays a crucial role in thymopoiesis and has been
associated with hematopoietic malignancies. Bcl11b is a lineage-specific transcription
factor expressed in various cell types and its expression is important for development of
viii
T cells, neurons and others, while its deletion is associated with differentiation of T cells
to the natural killer lineage, suggesting that Bcl11b acts upstream from E4BP4. The
hypothesis of my research is that Bcl11b suppression correlates with upregulation of
E4BP4 and apoptosis of leukemic cells in response to anti-leukemic agents. Expression
levels of Bcl11b in response to Dex was evaluated by qRT-PCR in CEM cell lines, and
were correlated with published data on E4BP4 expression. The data confirmed that
Bcl11b is downregulated in CEM sensitive cells upon Dex treatment while Bcl11b
expression was not significantly altered in the GC resistant CEM C1-15 cells.
ix
Chapter One: Introduction
1.1 Apoptosis
Apoptosis is a process of Programmed Cell Death (PCD) which was first
described by Kerr et al. in 1970’s. This phenomenon has been an area of great interest
since early 18th century due to its importance in successful development and maintenance
of cellular homeostasis.1 Death of cells through PCD is prompted by a series of
biochemical reactions and complex events. Through this process there is a transformation
in the cell morphology which involves cell shrinkage, nuclear condensation and
formation of apoptotic bodies.2 Despite the fact that this process is lethal, it has several
advantages throughout the life of the living organism. As an example, this crucial role of
apoptosis is evident during the developmental stages of a human embryo which takes
place in toe and finger cells, resulting in their separation. In the absence of this
mechanism, the toes and fingers would develop in a webbed manner.3
The average number of daily cell deaths caused by apoptosis ranges from fifty
billion to seventy billion in human adults and twenty to thirty billion in children; in one
year, this could equal an individual’s body weight. Since apoptosis is a systematic and
controlled mechanism and involves an evolutionarily conserved pathway, it will preserve
the internal stability of human tissues by maintaining the balance between cell death and
birth.4 In some instances, the process of apoptosis becomes vital to the organism, such as
continuous renewal of blood and skin cells as well as elimination of damaged or infected
tissues, that if left uncontrolled, could be dangerous to an organism.1
There are many genes involved in apoptosis pathway. Any change in their
expression levels can lead to uncontrolled cell death or lack thereof. Too much cell death
1
is evident in degenerative diseases such as Alzheimer;s and Parkinson’s, while too little
cell death is seen in cancer and autoimmune diseases.5 Defects in normal apoptotic
pathway due to genetic mutations can contribute to carcinogenesis and facilitate
metastasis.6 Many chemotherapeutic agents, as well as ionizing radiation therapies have
been designed to target apoptotic pathways with a goal to induce cell death. The p53
gene, also known as the “guardian of genome” involved in tumorigenesis suppression, is
an important target of one such treatments. In tumor cells, p53 gene which is normally
responsible for the induction of apoptosis in response to stresses such as DNA damage,
has been frequently mutated or deleted.7 There are many other genes that control or alter
the cell cycle; among those are a family of proteins called Bcl-2 that are key regulators of
apoptosis. Changes in expression levels of Bcl-2 family proteins have also been
connected to malignant growth and metastasis of cancer cells.8
In the broad field of cancer treatment, one angle of research is focusing on
discovering a means to suppress Inhibitors of Apoptosis Proteins (IAPs).9 In early
neoplastic progression, tumor cells may be more sensitive to agents that induce cell
death; but, as the tumor cells further multiply, they develop resistance to apoptotic
stimuli.6 Thus any mutation in the genes involved in cell proliferation and regulation of
the PCD, further contributes to resistance to chemotherapeutic drugs and radiation; this is
in addition to resistance to immune-based destruction that would normally trigger cell
death. 6 Furthermore, apoptotic cell death is the consequence of a series of precisely
regulated events that are frequently altered in tumor cells. Future research in
identification of target genes for gene therapy could lead to development of a more
2
effective treatments.8 This would mean selective clinical intervention to induce death of
only tumor cells without harming normal cells.
1.2 General Mechanism of Apoptosis
The mechanisms of apoptosis are highly complex and sophisticated, involving an
energy-dependent cascade of molecular events which has been a subject of intense study
for the past 50 years.10 During the apoptotic process, cells exposed to stressful condition
may trigger signals that stimulate internal crosstalk between pro-survival and proapoptotic factors. Cells are continually processing intracellular and extracellular signals
and must make a decision based on the cell type and location to either advance to the cell
cycle or initiate cell death.10 The stressful condition that can kill the are substances such
as glucocorticoids, exposure to electromagnetic radiation, infections, nutritional
deficiency, sudden increase in calcium concentration inside the cells, and hypoxia.10,11
The signals usually result in production of proteins that are responsible for regulation of
apoptotic pathway; this is then followed by a series of enzyme catalysis procedures
resulting into cell death.12
There are two main apoptotic pathways: intrinsic or mitochondrial pathway and
extrinsic or death receptor pathway. Both are associated with various genes that control
the initiation and regulation of apoptosis. 13 In addition, there is a third pathway that
involves T-cell mediated cytotoxicity and perforin-granzyme-dependent killing.
Apoptosis through this pathway can be induced via granzyme B or granzyme A. All three
death signaling pathways are distinctly different at the beginning, but all share the same
“execution” phase, also known as caspase activation phase.11 Important to note that this is
only true of the granzyme B induced pathway. The granzyme A pathway activates a
3
parallel, caspase-independent cell death that involves generating DNA damage through
the protein DNAse NM23-H1.14 Based on stress factors that cause DNA damage and
other factors such as extracellular and intracellular signals, cell type and tissue location,
cells decide which death route to take. Figure 1.1 provides a detailed cross talk between
apoptosis signaling processes.
Figure 1.1 Extrinsic and intrinsic signalling pathway of apoptosis. 15
4
Caspases (cysteine containing-aspartic acid specific proteases) are calcium
dependent cysteine proteases that function by cleaving the C-terminus side of aspartic
acid residues. When there is an apoptotic stimulus, these enzymes that reside in cells in
their inactive form, become activated, cleave at the aspartate residue and initiate the
caspase cascade.16 There are seven major caspases that have been identified and broadly
categorized into initiators (caspase-2,-8,-9,-10) and effectors or executioners (caspase-3,6,-7).17 To coordinate the proteolytic breakdown of the cell, the initiator caspases interact
with specific adapter molecules to facilitate their own auto-processing to form
apoptosome and Death-Inducing Signaling Complex (DISC). These active initiator
caspases in turn cleave and activate the downstream effector caspases to cleave their
target substrates and cause apoptosis. 18
The extrinsic or death receptor pathway begins outside the cell through the
activation of pro-apoptotic receptors on the cell surface which are activated by molecules
known as pro-apoptotic ligands such as hormones and cytokines.15 The interaction
between death receptors and their ligands is best described by Tumor Necrosis Factor
(TNF-R1) receptors with the ligand TNFalpha and Fas receptors with Fas ligand. In these
models, the ligand binds to and induces trimerization of their respective receptors.15
Following the initial ligand binding, the cytoplasmic adapter proteins, which are Death
Domain (DD) containing molecules, are recruited. Binding of Fas ligand to its receptor
results in the binding of the adapter protein FADD; and binding of TNF ligand to its
receptor results in the binding of the adapter protein TRADD.6 Ligation of death
receptors, such as Fas, forms DISC and recruits the FADD and procaspase-8. The
5
downstream effector caspases 3 and 7 are triggered by the activation of caspase-8, which
in turn cleave their target substrates to induce apoptosis.20
The intrinsic pathway triggers apoptosis in response to DNA damage, defective
cell cycle, cytotoxic drugs, hypoxia, and loss of survival factors.19 The mitochondrial
membrane swells up and becomes permeable when it receives signals from proapoptotic
members of the Bcl-2 family and p53. This then results in release of proapoptotic
molecules including cytochrome c, SMAC/DIABLO (Secondary Mitochondrial Activator
of Caspases/ Direct IAP Binding Protein) in the cytosol.19 IAPs inhibit the activity of two
executioner caspases 3 and 7, and two initiator caspases 8 and 9, therefore when
SMAC/DIABLO proteins bind to IAP’s, their capability of stopping the apoptotic process
will be blocked.9
Upon secretion and release of cytochrome c from mitochondria, it combines with
apoptotic protease activating factor-1 (Apaf-1). The bound substances undergo a
secondary binding process with pro-caspase-9 forming a complex called the apoptosome.
This complex activates caspase-9, which then triggers the activation of the effector
caspase-3 and causes cell death.10
The extrinsic and intrinsic pathways are largely independent of each other but
they do interact through a crosstalk when TNF proteins such as TNFSF10 (Tumor
necrosis factor superfamily, member 10) binds to death receptors which results in
activation of caspase-8. The intrinsic pathway gets activated by caspase-8-mediated
cleavage to BID, a pro-apoptotic BCL2 superfamily member. The interaction between
BID and the pro-apoptotic BAX and BAK genes and pro-apoptotic Bcl-2 proteins Bim
and Puma with Bcl-2 and Bcl-XL will cause the release of mitochondrial cytochrome c
6
and SMAC/DIABLO, which then activate caspase-9 and -3 leading to apoptosis.9 BCL-2
family genes and TNFSF10 probably act together through crosstalk between the intrinsic
and death receptor-mediated apoptosis pathways
1.3 Bcl-2 Family proteins
One of the primary regulators of the mitochondria-mediated pathway to apoptosis
is the family of Bcl-2 (B-cell CLL/Lymphoma 2) proteins. The release and activity of
pro-apoptotic factors, such as cytochrome c, into cytosol is due to Mitochondrial Outer
Membrane Permeabilization (MOMP), are under strict regulation by Bcl-2 family of
intracellular proteins.21 These proteins are functionally classified as either anti-apoptotic
or pro-apoptotic based on the presence of Bcl-2 homology domains (BH1–4).22 Major
members of anti-apoptotic Bcl-2 proteins shown in Figure 1.2 are Bcl-2, Bcl-w,
Bcl-xL (Bcl-2 related gene, long isoform), A1 and Mcl-1 (Myeloid Cell Leukemia
1). They contain BH domains 1–4 and are generally integrated within the Outer
Mitochondrial Membrane (OMM) to preserve its integrity by directly binding and
inhibiting the pro-apoptotic Bcl-2 proteins. 22, 25
7
Figure 1.2 Bcl-2 Family of proteins.23
The pro-apoptotic members are functionally divided into two classes: effector and
the BH3-only proteins. The effector molecules are BAK (Bcl-2 Antagonist Killer 1) and
BAX (Bcl-2 Associated X-protein), which contain BH1–3 domains and permeabilize the
OMM to release its apoptotic factors into cytosol.21 BH3-only proteins are BAD (Bcl-2
Antagonist of cell Death), BID (Bcl-2 Interacting Domain death agonist), BIK (Bcl-2
Interacting Killer), BIM (Bcl-2 Interacting Mediator of cell death), BMF (Bcl-2
Modifying Factor), bNIP3 (Bcl-2/adenovirus E1B 19-KD protein-interacting protein 3),
HRK (Harakiri), Noxa and PUMA (p53-Upregulated Modulator of Apoptosis). These
proteins function in specific cellular stress pathways via protein–protein interactions with
the other Bcl-2 family members. BAD and Noxa proteins only bind to death inhibitor
members and are referred to as ‘‘sensitizers’’.24 The proteins that interact with both anti8
apoptotic as well as the effector members are BID and BIM, ‘‘direct activators’’, which
can directly induce BAK and BAX oligomerization and MOMP.22 At the end, it is the
relative amounts of pro- and anti-apoptotic proteins that determine cellular sensitivity to
damage and ultimately, whether a cell will live or die.23
1.4 Leukemia
Leukemia is a progressive, malignant disease marked by distorted proliferation
and development of immature leukocytes in the blood and bone marrow.26 Leukemia like
other cancers, results from mutations in the DNA and can be triggered by activation of
oncogenes or deactivation of tumor suppressor genes, resulting in disruption of cell death,
differentiation or division. These cancerous cells prevent healthy red cells, platelets, and
mature white cells (leukocytes) from being made; these cells then can spread into the
bloodstream, lymph nodes, brain and spinal cord.27 There are several different types of
leukemia but it mainly can be classified into two major categories each with two subcategories. In general, leukemia is grouped by how fast it gets worse and what kind of
white blood cell it affects, it is either chronic (which usually gets worse slowly) or acute
(which usually gets worse quickly). The first major category is known as the
lymphoblastic leukemia, which is subdivided into Acute Lymphoblastic Leukemia (ALL)
and Chronic Lymphoblastic Leukemia (CLL).28 The second category is known as the
Myelogenous Leukemia, which is subdivided into Acute Myelogenous Leukemia (AML)
and the Chronic Myelogenous Leukemia (CML). This thesis will emphasize on the Acute
Lymphoblastic Leukaemia.28
Acute leukaemia usually leads to tremendous increment or multiplication in the
number of immature blood cells. These immature cells obstruct the site at which the
9
healthy cells are produced by the bone marrow, incapacitating the production of the
healthy cells. 29 This condition is best treated immediately or at onset in order to prevent
the malignant cells from rapidly multiplying and accumulating other tissues. Failure to
counteract the effects of acute leukemia could lead to the malignant cells spreading to the
rest of the body organs and tissues via the bloodstream. Acute leukemia is mostly
witnessed in children.29
Chronic leukemia is associated with gradual accumulation of white blood cells
which, although they may be relatively mature, are irregular and highly abnormal.
Production of these cells is rapid and could cause the abnormal white blood cells to
quickly take over the entire body.28 While malignant lymphocytes can be of B-cell or Tcell origin, in this project, we only focus on T-cell acute lymphoblastic leukemia (TALL).
1.5 Acute Lymphoblastic Leukemia (ALL)
This form of leukemia usually manifests in the form of excessive production of
white blood cells (lymphoid progenitor) that constitute both immature and malignant
cells. It affects children more than adults, with peak prevalence of ages 2 to 5 years. The
overproduction of lymphoblasts in the bone marrow hinder its ability to produce normal
and healthy blood cells, leading to tissue damage and eventually death.29
ALL is thought to originate from various important genetic lesions in bloodprogenitor cells that are committed to differentiate in the T-cell or B-cell pathway. 35
These two subtypes are identified by their patterns of gene expression using DNA
microarrays and Flow cytometry. The cells implicated in ALL have clonal
10
rearrangements in their immunoglobulin or T-cell receptor genes and express antigenreceptor molecules and other glycoproteins.30
The precise pathogenetic events leading to development of acute lymphoblastic
leukaemia are unknown. Recent studies investigated the genetic variability in xenobiotic
metabolism, DNA repair pathways, and cell-cycle checkpoint functions that might
interact with environmental, dietary, maternal, and other external factors to affect
development of acute lymphoblastic leukaemia.26, 31
T-cell acute lymphoblastic leukemia (T-ALL) is an aggressive subset of ALL
with poor clinical outcome, therefore, to improve treatment, it is crucial to understand the
molecular pathway of this disease.30 T cells (T lymphocytes) play an important role in
cell-mediated immunity and they can be distinguished from other lymphocytes such as B
cells and natural killer cells (NK cells) by the presence of a T-cell receptor (TCR) on the
cell surface. 32 All T-cells originate from haematopoietic stem cells in the bone marrow
and travel to populate the thymus where they expand by cell division and become
immature thymocytes.33 Thymocytes either express CD4 or CD8 glycoprotein on their
surfaces depending on being T-helper cells or cytotoxic T-cells, respectively. The earliest
thymocytes express neither CD4 nor CD8, and are therefore classed as double-negative
(CD4-CD8-) cells. As they progress through their development they become doublepositive thymocytes (CD4+CD8+), and finally mature to single-positive (CD4+CD8- or
CD4-CD8+) thymocytes that are then released from the thymus to peripheral tissues.63
Apoptosis eliminates about 98% of thymocytes during the development process in the
thymus whereas the other 2% survive and leave the thymus to become mature
immuneocompetent T cells. Although the exact mechanisms through which T cell
11
apoptosis occurs is unknown, studies suggest that sensitivity to endogenous
glucocorticoids (GCs) may be the key.34
1.6 Glucocorticoid Hormone
The development and function of cells that make up the immune system are
subject to regulation by many intrinsic and extrinsic factors. One influential class of
molecules that affect such cells and their responses are steroids that belong to the
neuroendocrine system.36 Steroids are small lipophilic molecules, are transported in the
blood, and participate in an enormous number of normal and pathologic processes.
Glucocorticoids (GCs) are a class of stress-induced, endogenously synthesized, steroid
hormone molecules.36 The synthesis and release of natural GC’s (cortisol) is under
dynamic circadian regulation by the hypothalamic–pituitary–adrenal (HPA) axis. Internal
and external signals trigger the hypothalamus to release corticotropin-releasing hormone
(CRH), which then stimulates the synthesis and secretion of adrenocorticotropic hormone
(ACTH).
Acting on nearly every tissue and organ in the body, natural glucocorticoids
function to maintain homeostasis both in response to normal changes in metabolism and
in stressful situations.37 They regulate essential biological processes including but not
limited to development, immune function, skeletal growth, cardiovascular function,
reproduction, cognition and apoptosis. Imbalance in glucocorticoid levels, that is
elevation or deficiency, can result in pathological conditions known as Cushing’s
syndrome and Addison’s disease, respectively.38
12
Synthetic glucocorticoids (Prednisone and dexamethasone) have similar effects to
natural GC’s. Due to their profound anti-inflammatory and immunosuppressive effects,
synthetic GCs are widely used in the treatment of inflammatory conditions including
allergies, asthma, rheumatoid arthritis, auto-immune diseases and organ transplant
rejection prevetion.41 In addition, due to their anti-proliferative effect on immune cells,
they are used as an adjunct in treatment of cancer of lymphoid origin, such as leukemias,
lymphomas. 39
Their lipophilicity allows them to diffuse freely across the cell membranes and
bind to glucocorticoid receptors (GR) in order to mediate their biological effects. GR is a
member of the nuclear receptor family (NR3C1) of ligand-dependent transcription
factors, which resides in the cytoplasm of every cell in human body.40 This receptor is
composed of 3 major domains: an N-terminal transactivation domain (NTD), a central
DNA binding domain (DBD), and a C-terminal ligand-binding domain. Upon activation
by a ligand binding GC, GR undergoes conformational changes, homodimerizes and
translocates to the nucleus to induce or repress transcription of target genes via
interaction with conserved DNA sequences known as GC responsive elements
(GRE:GGTACANNNTGTTCT). 36
GCs have long been used as anti-inflammatory agents and anticancer treatments
especially in acute lymphoblastic leukemia because of their ability to induce cell cycle
arrest and cell death. It is noteworthy to mention that their precise mechanism of action
has not yet been elucidated. GC-induced apoptosis is initiated by and is strictly dependent
upon the interaction of GC with its receptor, the GR. GC might directly impact the
apoptotic machinery by regulating components of the extrinsic or, more likely, intrinsic
13
pathways.43 There is considerable evidence that GCs up or down-regulate distinct sets of
genes to evoke T-cell apoptosis via the intrinsic pathway.49 GCs can activate cell death
through induction of pro-apoptotic members of the Bcl-2 family, such as Bim, Puma and
Bid and/or repression of anti-apoptotic members, such as Bcl-2, Mcl-1 and Bcl-xL. GCs
are also known to lead to G1 cell cycle arrest in human leukemic T cells and transformed
lymphoid cell lines by repressing cyclin D3 and c-myc.42
Synthetic GCs such as Dexamethasone (Dex) remain critical chemotherapeutic
drugs used in treatment of acute lymphoblastic leukima (ALL). It can induce apoptosis by
arresting the cells in the G0/G1 stage of the cell cycle.50 Dex is used therapeutically to
replace cortisol, the natural GC, due to its higher apoptotic potency, significantly higher
binding efficiency to the GR and relatively low level of binding to plasma proteins.48
Structurally, cortisol and Dex are very similar. The presence of a fluorine atom on
carbon-9, a methyl radical on carbon-16 and an extra double bond in the A-ring on Dex,
mark their difference (Figure 1.3). The development of GC resistance has been suggested
as one of the mechanisms by which a hyper-inflammatory state may be induced under
stress .19 Resistance often develops after long-term treatment with Dex as some cancerous
cells may mutate in ways that help them evade apoptosis.
14
Figure 1.3 The Structural representation of dexamethasone and cortisol.42
1.7 Mechanism of Glucocorticoids
To investigate the mechanism of GC-mediated apoptosis in lymphocytic
leukemia, CEM cell lines were used. These cells are derived from the peripheral blood of
a juvenile female suffering from T-cell acute lymphoblastic leukemia (T-ALL).44 They
have the same surface receptors as normal helper T-cells that support the immune system
by activating other cells involved in the immune response using cell contact and signals.
Two sub clones have been isolated from Parental CEM cells: CEM C7-14 that is GCsensitive, and CEM C1-15 that is GC-resistant; these both have identical GR alleles and
approximately equal amounts of GR.44 The main differences among them exist in their
downstream receptor-mediated transcriptional activity following the binding of the ligand
and receptor.
It has been reported that the CEM cell lines exhibit full tumorigenic phenotype
which has been associated with the mutational inactivation of p53 alleles.79 The tumor
15
suppressor p53 is responsible to regulate the cell cycle and prevent cancer. Initiating
apoptosis and pausing the cell cycle to arrest growth at G1 regulation point are two of this
protein’s functions. When there is a mutation in this gene, it results in uncontrolled cell
proliferation, ensuing oncogenesis.
In order to identify the genes involved in GC-evoked apoptosis in the CEM cell
line, a microarray analysis was performed.45 The microarray screen identified an array of
transcripts: 39 genes induced and 21 repressed in response to Dex treatment in correlation
with apoptosis.46
E4BP4 (or NFIL3), a transcription factor with a role in anti-inflammatory
response and development of natural killer (NK) cells, was identified as a key upregulated gene, and is being studied as a candidate gene that plays a role in the process of
apoptosis. Previous research by Medh et al. established a crucial relationship between
GC-dependent up- regulation of E4BP4 and sensitivity to GC-evoked apoptosis in CEM
C7-14 cells.45 In this study, a potential repressor gene, Bcl11b (B-cell CLL/lymphoma
11b) which is known to play an important role in T cell development, was chosen in
response to Dex mediated apoptosis. It has been shown that Bcl11b and E4BP4 mutually
inhibit each others’ activities.47 As stated before, the exact mechanism and gene
regulation process in GC-evoked apoptosis is still unclear.47 Therefore GC-dependent
transcriptional activation and repression may be critical in apoptotic pathway. We aim to
evaluate the relationships and cross-talk among these genes in an effort to understand
how they coordinately mediate anti-leukemic drug-induced apoptosis.
16
1.8 E4BP4 gene
E4BP4 (Adenovirus E4 Binding Protein 4), a mammalian basic leucine zipper
(bZIP) transcription factor, was first identified due to its ability to bind and repress viral
promoter sequences. Later on, E4BP4 was independently identified in humans as nuclear
factor IL-3 (Nfil3), which binds to the to the 5′ flanking region of interleukin 3.51 Nfil3 is
expressed in activated T cells and mast cell lines, as well as in natural killer (NK) cells to
promote development and functional maturation of cells.52 Nfil3 also belongs to the
proline- and acidic rich (PAR) subfamily of mammalian bZIP transcription factors. Even
though it lacks the PAR region, it shares sequence identity in its basic DNA-binding
domain with members of this group.53 This similarity indicates that mammalian PAR
proteins may be involved in cell fate commitment.54 E4BP4 and it homologues in other
species have been implicated in a diverse range of processes including commitment to
cell survival and apoptosis, anti-inflammatory response and, most recently, in the
mammalian circadian mechanism.55 Our present understanding of the molecular control
of apoptosis and the identification of the cell death machinery has come from genetic and
biochemical studies in C. elegans and D. melanogaster.45 Additionally, the convergence
of these studies has shown that apoptosis has been conserved throughout evolution,
though the process has gained complexity over time. Genes closely related to mammalian
E4BP4 include genes 8 & 9 of Xaenopus laevis, ces-2 of Caenorhabditis elegans, and
vrille of Drosophila melanogaster, all of which are involved in pro-apoptotic events such
as tail resorption, neuronal cell death, and activation of pro-apoptotic signaling
molecules.45 In humans, Nfil3 has been mapped to chromosome 9q22 and is widely
expressed across a range of tissues including nervous, muscle, secretory and immune.56
17
E4BP4 regulates transcription by binding to a specific DNA-binding site called the
E4BP4 response element (EBPRE) as a dimer. In addition, as stated previously, E4BP4 is
involved in the regulation of apoptosis.57 It is proposed that an E4BP4-dependent
pathway is evolutionarily conserved in human lymphoid T cells and acts in a similar
manner to ces-2’s regulation of GC-evoked apoptosis.53 Recent studies reported that
induction of E4BP4 has been linked to GC-dependent gene regulation, indicating its
essential role in GC-evoked apoptosis in T cells. The evidence was presented by Medh
et.al that E4BP4 plays a crucial role in GC-evoked apoptosis of CEM cells by enabling
induction of Bim.45 It has been confirmed by the work of other researchers that the proapoptotic Bcl-2 proteins, Bim and Puma, which are both egl-1 orthologs in C.elagans,
interact with the ced-9 orthologs Bcl-2 and Bcl-XL. Utilizing their BH3 domain, Bim and
Puma supress the effect of these anti-apoptotic proteins by forming heterodimers and
allowing the cascade of cell death to progress.45, 57
1.9 Bcl11b gene
Ed Satterwhite was the first to describe B-cell lymphoma 11B (Bcl11b) in 2001
which is part of the Bcl11 famliy.58 The Bcl11b gene is located on chromosome 12 in
mice and on chromosome 14(q32.1) in humans. At the nucleotide level, murine Bcl11b is
88% identitical to human Bcl11b. In addition, scientists have demonstrated that Bcl11b
begins expression in the early double negative (CD4-, CD8-) cell stage in the thymus, and
is usually expressed in brain tissue, T cells, and thymocytes.59 The Bcl11b gene was
referred to as RIT1, which stands for radiation-induced tumor suppressor gene 1
originally because it was isolated by scanning thymic lymphomas for loss of specific
18
chromosomal DNA. Others have named Bcl11b as CTIP2, that is, COUP-TF-interacting
protein 2, because it was isolated for its relation with the orphan nuclear receptor.60
Bcl11b protein belongs to the Kruppel-like C2H2 type zinc finger transcription factor
family which is the largest family of transcription factors in eukaryotes, and has 6 C2H2
zinc fingers with a proline-acidic rich region.61 This gene comprises of four exons and
two major transcript variants that encode distinctive isoforms either possessing exon 3,
894 amino acid long or lacking it, 823 amino acid long, and a minor isoform containing
exon 1 and 4 only with 700 amino acid.62 (Figure 1.4)
The long exon 4 is made up of all six zinc-finger domains, with the 2nd and 3rd
zinc finger domains being responsible for DNA binding. Studies revealed that mutations
in these two zinc finger domains disrupt the conserved amino acid structure that is
responsible for the stability of DNA binding domain. Bcl11b also has domains
responsible for interaction with proteins and protein complexes. The specific biological
function of this gene has yet to be determined.61
Another member of Bcl11 family is Bcl11a which also belongs to Kruppel-like
C2H2 type zinc finger transcription factors.63 Bcl11a and Bcl11b both share some
sequence homology but are located on different chromosomes and have different exonintron structures. Bcl11a and Bcl11b are referred to as Ctip1 and Ctip2, respectively,
because they were independently isolated for their interaction with the COUP
transcription factor, which plays an important role in development and mediate
transcriptional repression.58 Initially Bcl11a was discovered as a retroviral insertion site
(Evi9) in myeloid leukemia tumors in the BXH-2 recombinant inbred mice. Deletion of
19
Bcl11a in mice caused neonatal lethality and damage in B cells and lymphoid cells,
suggesting Bcl11a’s critical role in their development.63
Figure 1.4 BCL11B gene Structure and Splice Variants
A
5’
1
2
3
58 bp
369 bp
213 bp
4
3’
2045 bp
bp
B
Bcl11b variant 1 (ENST00000357195)
5’
1
2
3
4
3’
Bcl11b variant 2 (ENST00000345514)
5’
1
2
4
3’
4
3’
Bcl11b Variant 3 (ENST00000443726)
5’
1
A: Bcl11b gene structure showing 4 exons and the location of its 6 zinc fingers and
PAR region in exon 4 (highlighted in blue and white respectively). B: 3 alternatively
spliced variants with their accession number from Ensembl. Modified from Huang et.
al, 2012.58
20
1.10 Role of Bcl11b in non-lymphoid tissues
Besides the immune system, Bcl11b is also required in skin, neuron and tooth
development. Bcl11b is highly expressed in mouse skin during embryogenesis, in the
developing epidermis at late stage of fetal development and in the adult skin, Bcl11b
expression decreases and becomes restricted to the proliferating cells of the basal cell
layer.61 Similarly, Bcl11b is expressed in human epidermis, and is linked to disease
progression and/or maintenance in atopic dermatitis and allergic contact dermatitis
patients.64 In the nervous system, Bcl11b is essential for the development of
corticospinal motor neurons in vivo, and is also required the establishment of the cellular
architecture of the striatum. In humans, Bcl11b expression is maintained at high levels in
normal adult striatum but significantly decreased in Huntington disease (HD) cells,
suggesting that low Bcl11b expression is responsible for the deregulation of striatal gene
expression and the specificity of pathology that are observed in HD.65 Bcl11b also
participates in the regulation of epithelial cell differentiation during tooth morphogenesis
and is highly expressed in ectodermic components of the developing tooth including
enamel epithelial cells and cells of the ameloblast lineage. Bcl11b-deficient mice show
multiple defects at the bell stage and have abnormal incisors and molars66. In addition
Bcl11b plays multiple roles in modulating cell migration, cell proliferation and hair
follicle stem cell maintenance during cutaneous wounding.67
1.11 Bcl11b as a Transcription Factor
Ctip2 was initially identified as a repressor protein because of its interaction either
directly via binding to a GC-rich consensus sequence or via COUP-TF and nucleosome
21
remodeling and histone deacetylation complex (NuRD), making it a potent transcriptional
repressor.68 Genes encoding the cyclin-dependent kinase inhibitors, p21/Cip2/Waf1 and
p57/Kip2 are examples of being transcriptionally suppressed by Bcl11b. The interaction
of Bcl11b with the P2 promoter region of HDM2 (Human double minute 2), which is a
ubiquitin ligase that down-regulates tumor suppressor p53, inhibits the HDM2 promoter
activity in a p53-dependent manner and controls responses to radiation induced DNA
damage. 61 Later on Cismasiu et.al, discovered that interaction between Bcl11b and the
p300 coactivator at upstream site 1 (US1) in the IL-2 promoter results in transcriptional
activation of IL-2 expression in activated T cells. This suggests that as a transcription
factor, Bcl11b may be a bi-functional transcriptional regulator that acts as a repressor and
trans-activator. 69
1.12 Role of Bcl11b in T-cell development and maintenance of T-cell identity
Common lymphoid progenitors migrate from the bone marrow to thymus where T
lymphocyte precursors begin the T lineage differentiation before they fully lose
differentiation potentials inherited from their stem cell precursors.70 Thymocytes are
classified into three well known categories as they mature: double negative (DN;CD4CD8-), double positive (DP; CD4+CD8+) and single positive (SP; CD4-CD8+ or
CD4+CD8-). The earliest populations of thymocytes are DN cells and lack T-cell
receptor (TCR), co-receptors CD4 and CD8.MMM The DN thymocyte population can be
further subdivided by cell surface markers CD117 (c-Kit), CD44, and CD25. Negative
selection leads to death by apoptosis, while positive selection leads to thymocyte
activation.63
22
Bcl11b plays a key role in both T-cell development and subsequent maintenance
of T-cell identity [13]. Initially Bcl11b was identified as a tumor suppressor gene in T
cells, because loss of heterozygosity (LOH) contributed to the formation of thymic
lymphomas in γ–ray irradiated mice.71 Additionally Bcl11b was found to be involved in
human T cell leukemia due to mutations or deletion of this gene that was found in
approximately 10%–16% of human T-cell acute lymphoblastic leukemia (T-ALL). In
both the mouse and human, hematopoietic system, Bcl11b was absent in B cells, myeloid
cells and most NK cells, but highly expressed in T cell lineage identity and
commitment.72 For example early thymocytes during the transition from early T cell
precursor to DN2 (CD44+CD25+) stage, start to express Bcl11b. Expression of Bcl11b
remains at high levels in T cells beyond DN2 stage after they gradually lose non-T-cell
potential, by histone 3 methylation (H3) and demethylation,.73
Recent reports in mice showed that overexpression of Bcl11b results in the
differentiation of T helper (Th) cells, whereas down-regulating or knockout of Bcl11b
induces reprogramming from T cell into NK-like cell (Figure 1.6). Studies done by Li
et.al. revealed when Bcl11b was deleted, T cells from all developmental stages acquired
NK cell properties and which led to decrease in the expression of T-cell-related genes
(Notch1,Gata3, Ets1, Tcf1, and Hes1) and a corresponding up-regulation of NKassociated genes (Id2, Il2rb, and Nfil3).74 These induced T-to–natural killer (ITNK) cells,
which were morphologically and genetically similar to conventional NK cells, killed
tumor cells in vitro, and effectively prevented tumor metastasis in vivo. Therefore,
ITNKs may represent a new source for cell-based therapies.74
23
Figure 1.5: Effect of Bcl11b deletion on Pro T cell.92
Researchers reported high expression levels of Bcl11b in many human T cell
tumor lines which is required for cell survival. Suppression of Bcl11b by RNA
interference (RNAi) caused apoptosis in these tumor cells, possibly due to a decrease of a
cell-cycle inhibitor, p27, and an anti-apoptotic protein, BcL-xL.75 This indicates
involvement of the mitochondrial apoptotic pathway. In contrast, normal mature T cells
remained unaffected within the experimental time period. 76, 68 Therefore, Bcl11b could
be an attractive therapeutic RNAi target in T-cell malignancies.75 However, function of
Bcl11b in human T cell requires further investigation.
1.13 Hypothesis: BCL11B and Its Relationship with E4BP4
Apoptosis of lymphoid cell plays an imperative role in developing and operating
the immune system. Potential anti-leukemic agents including antineoplastic drugs,
topoisomerase toxicants and steroids trigger the immune cells’ apoptotic pathway. As
previously described induction of proapoptotic Bcl-2 family members expedite drug-
24
induced apoptosis of T-lymphocytic leukemia cells. As transcriptional regulators, E4BP4
and Bcl11b are vital in regular immune cell development and have similar effects on the
survival and differentiation of T-cell. While E4BP4 is required for development of
activated T-cells and natural killer cells, Bcl11b expression is necessary to maintain Tcell lineage identity and lineage commitment. Both E4BP4 upregulation as well as
Bcl11b repression have been linked to T-cell apoptosis.47
Bcl11b deficiency leads to increased levels of Nfil3 in early thymocyte precursors,
indicating that a cross-inhibitory regulatory loop might exist between these two factors.
Up-regulation of Bcl11b at the DN2 stage might inhibit Nfil3 expression, resulting in the
suppression of the NK fate, while up-regulation might counter Bcl11b-induced T-cell
potential by suppressing activity and thereby promoting NK fate. The relative levels of
Bcl11b versus Nfil3 in DN2 cells would therefore be major determinants of the T versus
NK cell fate.71
The aim of this work is to examine the relationships between Bcl11b and E4BP4
genes in CCRF-CEM cells and understand how they mediate anti-leukemic drug-induced
apoptosis. The ultimate goal of my research was to evaluate the expression pattern of
Bcl11b in CEM cell lines. In response to anti-leukemic agent Dex, test the hypothesis that
Bcl11b suppression correlates with up-regulation of E4BP4 and apoptosis of leukemic
cells. Unraveling the exact role and mechanism of Bcl11b and its regulation of the
apoptotic process would be a promising step towards its use as a therapeutic target for Tcell malignancy therapy.
25
Chapter 2: MATERIALS AND METHODS
2.1: Leukemic Cell Lines
The CCRF-CEM cell line is an immature T lymphoblastic cell line derived from
the peripheral blood of a female child with acute lymphoblastic leukemia. 44 The CEM
cell line has been used widely in cancer research as a model, examining drug action in
cancer treatment research and the mechanisms of gene regulation in the apoptotic
pathway.78
In order to conserve the least amount of phenotypic changes, from the parental
CEM cell line, two subclones were obtained. The continuous growth of these cells in
culture showed genetic and phenotypic drift, so the CEM cells were recloned to establish
CEM-C7-14 line, which is the prototype of GR-sensitive clone, and the CEM-C1-15 line
which is the prototype of the GR-resistant clone.46
To examine the regulation of glucocorticoid evoked apoptosis by Bcl11B and
establish the relationship between E4BP4 and Bcl11b, GC-sensitive and resistant cell
lines were used: CEM C7-14 and C1-15, respectively. Currently there are no published
reports on the effects of GCs on Bcl11B expression in the CEM cell lines.
2.2 Cell Culture:
CEM Cell lines were kindly provided by Dr. EB Thompson, UTMB (Galveston,
TX). They were grown in suspension in RPMI 1640 media from Cellgro (Manassas, VA,
Catalog #50-020-PB) and supplemented with 5 % heat-inactivated FBS from Atlanta
Biologicals (Cat #S11150) and kept at 37°C in a humidified 5% CO2 incubator. Cells
26
were maintained in log phase at concentration of 1x105 cells/ml to 1 x 106 cells/mlby
passaging every 2 to 3 days.
RPMI 1640 supplemented with L-glutamine was prepared by addition of
deionized water and 2.0g/L of sodium bicarbonate to adjust the pH at 7.2. In order to
sterilize the media, it was filtered through a 0.22μm cellulose acetate filter from Corning
(Lowell, MA, Cat #430521); this process raised the pH to be at the optimal pH of 7.4.
The media was stored at 4ºC for future use.
2.3 Cell treatment & reagents
Dex was used at a concentration of 1µM to treat the cells. Dex powder was
obtained from Calbiochem (cat#265005) and diluted with 100% absolute ethanol; this
solvent was also used as "negative" treatment or control.
2.4 Measurement of cell density using Trypan blue
Cells were counted to obtain the starting concentrations for cell viability assays
and to normalize the density of cells to be used for passaging and RNA extraction via
visualization of Trypan blue dye exclusion. To determine the cell density, 100 μL of cell
culture was mixed with 100μL of 0.4% Trypan Blue (Cellgro, cat# 25-900-Cl) and 200μL
of 1X phosphate buffered saline (PBS), resulting in a mixture of 1:4 dilution. 10 µl of the
mixture was then loaded onto a Bright-Line hemacytometer (Fisher Scientific, cat#
0267110), and the cells were counted using a microscope at 200X total magnification.
The following calculation was used to determine the density of viable cells/ml: (Total
number of cells that excluded the dye/4) X (4x104).
27
2.5 Cell Viability Assay
During the log phase of CEM-C7-14, CEM-C1-15, two ml of cells at a density of
1x105 cells/ml were placed in wells of a 12-well plate; they were treated with 100%
ethanol as control or 1µM Dex in duplicate. Every 24 hours over a period of 3 days, cells
were counted by trypan blue exclusion using the hemacytometer. The general
experimental layout is depicted schematically in Figure 2.1.
Figure 2.1: 12-well plate for cell viability assay
2.6 RNA Extraction
Aliquots of 20 ml of CEM C7-14 and C1-15 cells, at density of 5x105 (cell/ml)
were treated with 20 µl of 100% ethanol or 1.0 µM Dex as negative control and treatment
respectively. Flasks of cell suspensions were stored in 5% CO2 incubator at 37°C for 24hours. Cell suspensions at approximate density of 1x107 (cells/ml) were harvested and the
pellets were washed with 1X PBS. RNA was extracted from the cell pellets using 1 mL
TRIzol reagent (Invitrogen Life Technologies, Cat# 15596018) per sample. TRIzol is a
28
monophasic solution, which lyses the cells and dissolves cellular components but
preserves RNA. The phase separation was done by adding 200 µl of chloroform per 1mL
TRIzol, and then RNA was precipitated by addition of 100% isopropyl alcohol. The RNA
pellet was dissolved in 25 µl of PCR grade-nuclease free water (Genemate, cat#G-325550) after it was washed with 75% ethanol. The total RNA was incubated in 55-60 °C for
10 minutes and then stored in -20°C for future use.
Nano drop 2000c spectrophotometer (Thermo Scientific, Wilmington, DE) was
used to measure the RNA concentration at absorbance of 260 nm. RNA samples were
diluted 1:1 in RT-PCR grade water to ensure that sample concentrations did not exceed
the instrument determination limit of 3000 ng/μL. Absorbance at 280 nm and 230 nm
were also measured to determine the purity of the RNA extract, the (A260/ A280) ratio
was used. Samples with a ratio of 1.8 or higher were used for reverse transcription
reaction (RT) since pure RNA has a ratio of 2. Table 2.1 shows one example of this
experiment.
2.7 Reverse Transcription Reaction (RT)
Reverse transcription was used to make a complementary DNA (cDNA) strand
from an RNA template. Seven µg of RNA was prepared and 1µl of Oligo (dT)15 primer
(Promega,
Madison, WI, Cat #27628) was added to each sample.RNA was incubated at 70°C for 5
minutes and cooled on ice afterwards. The cocktail of RT reaction, 13 µl, was prepared
for each sample (Table 2.2). The reaction was reverse transcribed at 42°C for about 3
hours, then samples were stored at -20°C for future use.
29
2.8 Real-Time PCR (qRT-PCR): Primer Design
To obtain human Bcl11b gene sequence, we used Ensembl website, a project that
provides centralized resource to study the genomes of our own species as well as many
other organisms. The data that was provided through Ensembl verified that Bcl11b gene
has 4 exons, but it only showed 2 alternatively spliced transcript variants instead of 3, as
has been reported in recent studies. 61 As shown in Figure 1.4, these variants differ by
either possessing or lacking exon 2 or 3. Set of primers were designed close to the
previous research done by Huang et al. 81 across exon 2 and 4 to amplify both transcript
variant 1 and 2 of human Bcl11b. Figure 2.2 shows the coding sequence of the gene and
where the primers overlay. Primer3, an online program90, was used to design Bcl11b
primers. Primers were obtained from Sigma Genosys (St. Louis, MO) and were
reconstituted to 50 µM stock solutions. They were checked for comparable melting
temperature (Tm), GC-content, possible hairpin turns, and other negative interactions
using PCRDESNA Primer Design software. Primer sequences are listed in Table 2.3 with
schematic diagram in Figure 2.3.
Figure 2.2 Human Bcl11B gene’s coding sequence.
1 ATGTCCCGCCGCAAACAGGGCAACCCGCAGCACTTGTCCCAGAGGGAGCTCATCACCCCA
61 GAGGCTGACCATGTGGAGGCCGCCATCCTCGAAGAAGACGAGGGTCTGGAGATAGAGGAG
121 CCAAGTGGCCTGGGGCTGATGGTGGGTGGCCCCGACCCTGACCTGCTCACCTGTGGCCAG
181 TGTCAAATGAACTTCCCCTTGGGGGACATCCTGGTTTTTATAGAGCACAAAAGGAAGCAG
241 TGTGGCGGCAGCTTGGGTGCCTGCTATGACAAGGCCCTGGACAAGGACAGCCCGCCACCC
301 TCCTCACGCTCCGAGCTCAGGAAAGTGTCCGAGCCGGTGGAGATCGGGATCCAAGTCACC
361 CCCGACGAAGATGACCACCTGCTCTCACCCACGAAAGGCATCTGTCCCAAGCAGGAGAAC
421 ATTGCAGGGCCGTGCAGGCCTGCCCAGCTGCCAGCGGTGGCCCCCATAGCTGCCTCCTCC
481 CACCCTCACTCATCCGTGATCACTTCACCTCTGCGTGCCCTGGGCGCTCTCCCGCCCTGC
541 CTCCCCCTGCCGTGCTGCAGCGCGCGCCCGGTCTCGGGTGACGGGACTCAGGGTGAGGGT
601 CAGACGGAGGCTCCCTTTGGATGCCAGTGTCAGTTGTCAGGTAAAGATGAGCCTTCCAGC
661 TACATTTGCACAACATGCAAGCAGCCCTTCAACAGCGCGTGGTTCCTGCTGCAGCACGCG
721 CAGAACACGCACGGCTTCCGCATCTACCTGGAGCCCGGGCCGGCCAGCAGCTCGCTCACG
781 CCGCGGCTCACCATCCCGCCGCCGCTCGGGCCGGAGGCCGTGGCGCAGTCCCCGCTCATG
30
841 AATTTCCTGGGCGACAGCAACCCCTTCAACCTGCTGCGCATGACGGGCCCCATCCTGCGG
901 GACCACCCGGGCTTCGGCGAGGGCCGCCTGCCGGGCACGCCGCCTCTCTTCAGTCCCCCG
961 CCGCGCCACCACCTGGACCCGCACCGCCTCAGTGCCGAGGAGATGGGGCTCGTCGCCCAG
1021 CACCCCAGTGCCTTCGACCGAGTCATGCGCCTGAACCCCATGGCCATCGACTCGCCCGCC
1081 ATGGACTTCTCGCGGCGGCTCCGCGAGCTGGCGGGCAACAGCTCCACGCCGCCGCCCGTG
1141 TCCCCGGGCCGCGGCAACCCTATGCACCGGCTCCTGAACCCCTTCCAGCCCAGCCCCAAG
1201 TCCCCGTTCCTGAGCACGCCGCCGCTGCCGCCCATGCCCCCTGGCGGCACGCCGCCCCCG
1261 CAGCCGCCAGCCAAGAGCAAGTCGTGCGAGTTCTGCGGCAAGACCTTCAAGTTCCAGAGC
1321 AATCTCATCGTGCACCGGCGCAGTCACACGGGCGAGAAGCCCTACAAGTGCCAGCTGTGC
1381 GACCACGCGTGCTCGCAGGCCAGCAAGCTCAAGCGCCACATGAAGACGCACATGCACAAG
1441 GCCGGCTCGCTGGCCGGCCGCTCCGACGACGGGCTCTCGGCCGCCAGCTCCCCCGAGCCC
1501 GGCACCAGCGAGCTGGCGGGCGAGGGCCTCAAGGCGGCCGACGGTGACTTCCGCCACCAC
1561 GAGAGCGACCCGTCGCTGGGCCACGAGCCGGAGGAGGAGGACGAGGAGGAGGAGGAGGAG
1621 GAGGAGGAGCTGCTACTGGAGAACGAGAGCCGGCCCGAGTCGAGCTTCAGCATGGACTCG
1681 GAGCTGAGCCGCAACCGCGAGAACGGCGGTGGTGGGGTGCCCGGGGTCCCGGGCGCGGGG
1741 GGCGGCGCGGCCAAGGCGCTGGCTGACGAGAAGGCGCTGGTGCTGGGCAAGGTCATGGAG
1801 AACGTGGGCCTAGGCGCACTGCCGCAGTACGGCGAGCTCCTGGCCGACAAGCAGAAGCGC
1861 GGCGCCTTCCTGAAGCGTGCGGCGGGCGGCGGGGACGCGGGCGACGACGACGACGCGGGC
1921 GGCTGCGGGGACGCGGGCGCGGGCGGCGCGGTCAACGGGCGCGGGGGCGGCTTCGCGCCA
1981 GGCACCGAGCCCTTCCCCGGGCTCTTCCCGCGCAAGCCCGCGCCGCTGCCCAGCCCCGGG
2041 CTCAACAGCGCCGCCAAGCGCATCAAGGTGGAGAAGGACCTGGAGCTGCCGCCCGCCGCG
2101 CTCATCCCGTCCGAGAACGTGTACTCGCAGTGGCTGGTGGGCTACGCGGCGTCGCGGCAC
2161 TTCATGAAGGACCCCTTCCTGGGCTTCACGGACGCACGACAGTCGCCCTTCGCCACGTCG
2221 TCCGAGCACTCGTCCGAGAACGGCAGCCTGCGCTTCTCCACGCCGCCCGGGGACCTGCTG
2281 GACGGCGGCCTCTCGGGCCGCAGCGGCACGGCCAGCGGAGGCAGCACCCCGCACCTGGGC
2341 GGCCCGGGCCCCGGGCGGCCCAGCTCCAAGGAGGGCCGCCGCAGCGACACGTGCGAGTAC
2401 TGCGGCAAGGTGTTCAAGAACTGCAGCAACTTGACGGTGCACCGGCGGAGCCACACCGGC
2461 GAGCGGCCTTACAAGTGCGAGCTGTGCAACTACGCGTGCGCGCAGAGCAGCAAGCTCACG
2521 CGCCACATGAAGACGCACGGGCAGATCGGCAAGGAGGTGTACCGCTGCGACATCTGCCAG
2581 ATGCCCTTCAGCGTCTACAGCACCCTGGAGAAACACATGAAAAAGTGGCACGGCGAGCAC
2641 TTGCTGACTAACGACGTCAAAATCGAGCAGGCCGAGAGGAGCTAA
Figure 2.2: Human Bcl11b sequence (ENSG00000127152) with 4 exons that are
separated by black and blue colors. First primer sequence has been highlighted in
red and second primers sequence has been underlined. (Reverse primers for both
set are sharing similar sequence.) Length of each exon: Exon 1: 1-58, Exon 2: 59427 (missing in transcript variant 3), Exon 3: 428-640 (missing in transcript
variant 2 & 3), Exon 4: 641-2685.
2.9 Real-Time Polymerase Chain Reaction (RT-PCR) & DNA Gel
To distinguish which transcript variant of Bcll1b has been expressed and is more
abundant in CEM cell lines, end point PCR assay was performed on applied biosystems
(GeneAmp, PCR system 9700) using the primers listed in table 2.3. To normalize
between samples, β-actin was used as a control. Two µl of each RT product was
amplified in PCR machine and DNA was analyzed on 2% agarose gel. Forty eight µl of
31
PCR cocktail listed in table 2.4 was added to each RT sample. The PCR thermocycler set
up protocol is listed in table 2.5. DNA gel was prepared by boiling 0.8g of Agarose
(Rpicorp, cat# A20090-500) with 80 mL of 0.5X TBE (Tris base buffer). Once Agarose
was in solution, one µl Ethidium bromide was added for staining and solution was added
to the gel tray to solidify. Ten µl of PCR product mixed with 2µl of 6X loading dye
(Promega, Cat #G190A) was loaded in each well. The container was filled with 0.5XTBE
and the gel was run at 150 volts for approximately 30-45 minutes or until the dye was
two-thirds through the gel.
100bp DNA ladder (Promega, Cat #G190A) was used as a molecular weight marker.
Figure 2.3 Amplifying region of BCL11B gene with designed primers.
5’
1
2
3
4
3’
Primers in blue arrows
2.10 Quantitative RT-PCR method (QPCR)
To quantitatively analyze the expression levels of Bcl11b in CEM cell lines, qRTPCR method was used. This method allows for a more precise quantification of cDNA
levels verses traditional end-point PCR that uses agarose gel for detection.82 In qPCR
instead of taq polymerase (Promega), SYBR® JumpStart ™ Taq Ready Mix was used
(Sigma, #S-4438), this DNA-binding fluorescent dye is measured in exponential phase
32
and is correlated to the amount of double stranded DNA present in the amplification
reaction.83
In this method, after reverse transcription, 1µl of RT samples were mixed with
12.5 µl of SYBR mix, 0.25 µl of each forward and reverse primer of Bcl11b or actin,
0.25 µl of ROX (reference dye) and 10.75 µl of PCR-Grade water. The product was
amplified using a 96 well plate in Applied Biosystems 7300 machine. The PCR protocol
used is listed in Table 2.6
LinRegPCR (11.0) program was used to analyze the qPCR data. This program
performs a baseline correction on each sample separately, determining a window-oflinearity using four points and then using linear regression analysis to fit a straight line
through the PCR data set. By using the slope of the line, the PCR efficiency of each
individual sample is calculated.84 Threshold cycle (Ct) value is measured in QPCR as
relative measurement of concentration of target in the reaction. Ct value comes from the
intersection between an exponential amplification phase and fluorescent threshold line. 83
The four points that are selected in the window-of- linearity need to have correlation
coefficient greater than 0.99 and amplification efficiency close to 2. Data is exported to
an excel spreadsheet.
The Pfaffl method was used to calculate fold induction/repression of the gene in
each sample. This method uses the assumption that amplification efficiencies are
different between genes. PCR efficiency (E) per amplicon (set of samples with same pair
of primer) and Ct value per sample were used in Pfaffl method equation: (E) ΔCT target
(control-sample)
/ (E) ΔCT reference (control-sample) .84Cells treated with ethanol were used as control
33
and cells treated with Dex are samples in this equation. β-actin was the reference gene
and was used to normalize between samples and Bcl11b was the target gene.
The data from these calculations are shown as a mean with standard deviation for
fold repression. Statistical analysis was calculated in SYSTAT 12 using a two sample ttest. Less than 0.05 of a probability value was considered to be statistically significant.
34
Table 2.1: Example of Nano Drop Data
Sample ID
Blank*
C7-14 Etoh
C7-14 Dex
C1-15 Etoh
C1-15 Dex
Nucleic
acid Conc.
ng/µl
-0.1
1357.2
1681.95
2544.35
2344.2
A260
A280
260/280
260/230
Sample
type
Factor
-0.001
33.95
42.1
63.6
58.6
-0.009
17.1
21.1
32.2
29.9
0.16
1.99
1.99
1.98
1.96
-0.22
1.88
1.83
1.80
1.81
RNA
RNA
RNA
RNA
RNA
40
40
40
40
40
* Blank is PCR grade water used as a control.
Table 2.2: Reverse Transcription Reaction
Volume Per Sample
(µl)
5.00
M-MLV reaction buffer (5X)
1.25
PCR nucleotide mix (10 mM)
1.00
RNasin (RNase inhibitor)
4.75
Nuclease free RT-PCR water
1.00
M-MLV Reverse Transcriptase
Table 2.3: RT-PCR Primer
Transcript
(Primer
name)
Forward Primer
Reverse Primer
Product
Size
Bcl11b*
5’-AGGCATCTGTCCCAAGCAGGA-3’
5’-CCACGCGCTGTTGAAGGGGCT-3’
307bp
94bp
β-actin
(B-ACTIN130 SENSE
& ANTI)
5’-AGTCCTCTCCCAAGTCCACA-3’
5’-CACGAAGGCTCATCATTCAA-3’
130bp
* Primer sequences, amplifying variant 1 and 2 resulting in 2 products, 307bp larger product
of Bcl11b (variant 1) and 94bp smaller product of Bcl11b (variant 2, missing exon 3)
35
Table 2.4: PCR reaction
Volume Per Sample (µl)
5.00
10X PCR Buffer (5X)
1.25
10mM dNTP
3.00
25mM MgCl2
0.50
5’ Bcl11b or B-actin primer
0.50
3’ Bcl11b or B-actin primer
37.50
RT-PCR grade water
0.25
Taq DNA polymerase
Table 2.5: PCR Machine set up
Denaturation
Temperature
Time
94°C
5 min
94°C
Amplification
30 sec
40 Cycles
61.5°C
45 sec
72°C
1 min
Detection
72°C
7 min
Hold
4°C
∞
Table 2.6 QPCR machine protocol
Stage 1
1 Cycle
Stage 2
40 Cycles
Stage 3
Dissociation Stage
Temperature
94°C
94°C
61.5°C
72°C *
95°C
60°C
95°C
Time
2:00
0:30
0:45
1:00
0:15
0:30
0:15
* Data collection happens at stage 2, step 3.
36
Chapter 3: RESULTS
As stated earlier, CEM cells provide a system to study the process of apoptosis,
specifically the GC induced transcriptional changes that cause apoptosis. Through a
microarray analysis that was done by Medh et al, an array of induced and repressed genes
were identified.46 Among these genes, E4BP4 is one of the genes that was chosen and its
expression pattern was analyzed. E4BP4/Nfil3 promotes apoptosis and has been upregulated in CEM C7-14 cells via glucocorticoid treatment. In addition, the ectopic
expression of mouse E4PB4 caused GC-evoked apoptosis in the resistant cell line, CEM
C1-15.45, 80
Recent research on Bcl11b gene, the protector of cell growth and contributor to
chemo-resistance in immature leukemic T-cells, has suggested that up-regulation of
E4BP4 in GC-sensitive CEM cells might be related to repression of Bcl11b. 45, 63 The
exact role and mechanism of how Bcl11b functions in apoptotic pathway and in human
leukemic cells, is still unknown. Current studies have suggested that Bcl11b in a normal
tissue could act as a tumor suppressor gene and control proliferation, but in the
environment of a tumor tissue, it could act as an oncogene.59 To evaluate how Bcl11b
operates in CCRF-CEM cells upon treatment with glucocorticoids, a series of
experiments were done. The purpose of my study was to understand the expression
pattern of Bcl11b after Dex induced apoptosis in CEM cells, and to explain its
significance in apoptotic pathway and its relationship to E4BP4.
37
3.1 Cell Viability assay
Cancer cells are prone to genetic alterations over time especially when they
become drug resistant following treatment with chemotherapeutic agents. To ensure that
the frozen culture of CEM C7-14 sub clones, GC sensitive cells, are still receptive to Dex
treatment, a cell viability assay was done.
Prior work done in this lab has established the effective concentration of Dex
triggering apoptosis in CEM C7-14 through a Dex dose dependent cell viability assay.
These cells are more susceptible at a final concentration of 1µM Dex.80 As it was shown
in figure 2.1, duplicate wells of each CEM cells were treated with 1µM Dex or 100%
ethanol for 96 hours, and as a measure of cell viability assay cells were counted using
Trypan blue dye exclusion method every 24 hours. The result from this analysis is
summarized in figure 3.1. Both CEM C7-14 and C1-15 cells grew at a modest rate when
treated with ethanol over a period of 4 days; CEM C7-14 cell line reached a density of
2.0 x 106 cells/ml while CEM C1-15 cells reached 2.8 x 106 cells/ml. These data also
provides information about when these cells need to be passaged in order to keep them in
log phase (1x105 cell/ml). As it was expected, the GC sensitive CEM cell line, C7-14,
showed marked sensitivity after they were exposed to Dex; more than 50% decrease in
number of viable cells compared to the control cells was seen after 48 hours and
approximately a 95% decrease in viable cells after 96 hours. On the other hand the GC
resistant cells, CEM C1-15, continued their exponential growth and did not show any
significant sensitivity to 1µM Dex treatment. The cell viability assay was done multiple
times in various stages of the project to validate GC susceptibility in CEM cells and it
established the basis to continue with the rest of the experiments. Figure 3.1 is a
38
representative growth curve showing the GC sensitivity in CEM C7-14 and GCresistance in CEM C1-15.
3.2 Gel electrophoresis analysis of RT-PCR product
As it was discussed in Chapter 1, Bcl11b has 4 exons and two alternatively
spliced transcript variants. These variants differ in amino acid lengths where variant 1 is
longer (894 a.a) and has all 4 exons, while variant 2 is shorter (823 aa) and is missing
exon number 3. For RT-PCR experiment, primers were designed (M&M table2.3) across
exon 2 to 4 to amplify both transcript variants of Bcl11b. CEM cells were treated with
100% ethanol or 1µM Dex for 24 hours, then RNA was extracted and reverse transcribed.
RT products were amplified in the PCR machine following the protocol listed in table
2.5. In order to check if any specific transcript variant of Bcl11b is being differentially
amplified/repressed in response to Dex treatment, gel electrophoresis was done as shown
in figure 3.2. β-actin was amplified using specific primers (Table 2.3) for normalization
between samples.
Amplification of multiple products is not desirable for relative quantification of
qRT-PCR. Results from the gel picture revealed that only one transcript variant of Bcl11b
is being expressed in CEM cell lines; and one band is present for the RT-PCR product for
β -actin and Bcl11b. This means that amplification of variant number 2 with 94bp using
the designed primers demonstrated dominance over the variant number 1 with 307 bp
(Figure 3.2).
We hypothesized that Bcl11b will be down-regulated in GC-sensitive cells (CEM
C7-14) after Dex treatment and there will be no change in GC resistant cell (CEM C1-
39
15). Agorose gel results did not show any change in Bcl11b expression in either CEM
cells when they were treated with 1µM Dex or control. This might be due to limitations
of end point PCR and Agarose gel which are not sensitive enough to detect low fold
changes in expression levels. To examine the results more thoroughly, qRT-PCR method
was used.
3.3 qRT-PCR output
Once the outcome from gel electrophoresis confirmed the generation of a single
product from Bcl11b primers, the experiment was able to advance to the next step. To
quantitatively analyze the expression of Bcl11b in CEM cells upon GC treatment, qRTPCR method was used. As explained in M&M section 2.6 and 2.7, RNA was extracted
and reverse transcribed. The product of RT was amplified in Applied Biosystem 7300
thermalcycler following the protocol listed in table 2.6. Sample amplification output of
qRT-PCR data is shown in figure 3.3. This method uses the exponential phase of PCR
reaction as an optimal point for data analysis. The Amplification Plot contains valuable
information for the quantitative measurement of cDNA. The Threshold line shows the
level of detection when a reaction reaches a fluorescent intensity above background
noise. The cycle when the sample reaches this line that is set in the exponential phase of
the amplification, is called the Cycle Threshold (Ct). This value reveals initial amount of
cDNA in each sample, and a higher Ct value means smaller amount of DNA. As the
reaction continues, it will advance to linear phase where it slows down as products start
to degrade, and then moves to plateau phase where the reaction stops and there will be no
increase in fluorescence.
40
In the QPCR method, annealing of the primers to the target sequence is a critical
step. For the primers to anneal efficiently, the process needs to take place at the right
temperature in order to prevent primer–dimer formation. To confirm this specificity, a
dissociation curve analysis was performed at the end of the PCR cycles to display a
single sharp peak for a single product (Figure 3.4). Between samples there is a difference
of peak size which correlates with the amount of fluorescence generated from that
individual sample. B-actin was used as a control to normalize the data by correcting for
differences in quantities of cDNA used as a template.
3.4 LinReg data
Quantitative data was obtained from the Applied Bioscience 7300 RT-PCR
thermo-cycler and was analyzed using LinReg software. This program runs a baseline
correction on each sample separately and finds subset of data points in exponential phase
to calculate PCR amplification efficiencies per sample using linear regression analysis.
Through this analysis, base lines were adjusted to make sure the points in exponential
phase have a correlation coefficient (R2) value greater than 0.99 and PCR efficiencies
close to 2. Figure 3.5 shows an example of LinReg data. The output from this program
was analyzed further using Pfaffl method to calculate relative gene expression.
3.5 Pfaffl output and SYSTAT Statistical Analysis
A total of 11 independent experiments were performed for the gene of interest. 6
experiments displaying a high variability due to contamination between duplicate set of
samples or low minimal amounts of target nucleic acid were omitted (n=5); either the Ct
41
values were over 32, meaning that the amount of cDNA template was low, or the
difference between the delta Ct values for β -actin was over 0.5. Since B-actin was used
as a reference gene, it should not exhibit changes in expression between samples from
various experimental conditions or time points.
Table 3.1 displays an example output of Pfaffl calculation for relative gene
expression. The data supported the hypothesis that Bcl11b will be down regulated in
CEM sensitive cells upon Dex treatment. As shown in Figure 3.6, CEM C7-14 Bcl11b
gene expression was repressed when these cells underwent apoptosis via GC treatment,
showing an average of 2.3 fold decrease compared to β-actin. Additionally, as we
expected, Dex did not have an effect in CEM C1-15 cells; Bcl11b expression was not
significantly altered; and there was a minimal decrease of 0.9 fold on average across all 5
sets of data. The differences in fold regulation when comparing the responses were
statistically significant (p=0.04). Statistical calculations, a two-sample t-test, were done
by SYSTAT, Version 12. The obtained P-value was less than 0.05 and considered to be
statistically significant.
42
Figure 1.3: CEM Cells Growth Curve
Figure 1.3 is the representative growth curve is demonstrating the GC sensitivity in CEM C7-14 and
GC-resistance in CEM C1-15 cells. Two mL of each CEM cell line in duplicates at concentration of
1x10^5 (cell/ml) were treated with 1 micro molar Dex or 100% ethanol in a 12 well plate. Cells were
counted every 24 hour using a hemacytometer. Each data point represents +/- standard deviation from
the mean.
43
Figure 3.2 Gel electrophoresis of RT-PCR products.
DNA
C7-14
C1-15
Ladd
er
500 bp
Bcl11b 307 bp
100 bp
Bcl11b 94 bp
ß-actin 130 bp
Etoh
Dex
Etoh
Dex
Figure 3.2 is the representative of Gel electrophoresis of RT-PCR products for
Bcl11b and ßactin in CEM cell lines.
44
Figure 3.3 RT-qPCR output for CEM Cell
Figure 3.3 is a representation of RT-qPCR output (Delta rxn vs Cycle) for Bcl11b in
CEM cell lines.
45
Figure 3.4 ß-actin and Bcl11b Dissociation Curve
A
B
Figure 3.4 A and B shows the dissociation curve for β-Actin and Bcl11b.
Both dissociation curves imply that only one product was generated from the
PCR phase.
46
Figure 3.5 LinReg Data Analysis
Figure 3.5 shows the LinReg data analysis of ßactin and Bcl11b in CEM
cell lines
47
Table 3.1 Data Analysis using Pfaffl method
Well
14
15
26
27
38
39
50
51
62
63
16
17
28
29
40
41
B2
B3
C2
C3
D2
D3
E2
E3
F2
F3
B4
B5
C4
C5
D4
D5
Treatment
C7 - ETOH
C7 - ETOH
C7 - DEX
C7 - DEX
C1 - ETOH
C1 - ETOH
C1 - DEX
C1 - DEX
C7 - ETOH
C7 - ETOH
C7 - DEX
C7 - DEX
C1 - ETOH
C1 - ETOH
C1 - DEX
C1 - DEX
Detector
b-Actin
b-Actin
b-Actin
b-Actin
b-Actin
b-Actin
b-Actin
b-Actin
bcl11b
bcl11b
bcl11b
bcl11b
bcl11b
bcl11b
bcl11b
bcl11b
Primer efficiency
2.251
2.082
2.157
2.244
2.145
2.207
2.217
2.226
1.989
1.945
1.978
1.952
1.928
1.924
1.978
2.005
Av E
2.184
2.199
1.966
1.959
Ct-Value
12.591
12.897
11.921
12.580
12.205
12.330
12.561
12.603
24.710
24.677
25.208
25.205
23.808
23.925
24.083
24.452
Av Ct
D Ct
(efficiency)D Ct
0.493
1.470
-0.314
0.781
-0.513
0.707
0.481
-0.401
0.764
0.978
Tar/Ref
12.744
12.251
12.268
12.582
24.694
25.207
23.866
24.268
Table 3.1 is the data output from Pfaffl calculation. It shows that the target over reference value
(relative gene expression) is below one in CEM C7-14 cells, meaning that Bcl11b was down regulated
upon Dex treatment, but in CEM C1-15 cells this value is close to one, which indicates there was not
any significant change in Bcl11b expression.
48
Figure 3.6 Statistical data analysis
Figure 3.6 shows a representation of the expression of Bcl11b normalized to β-Actin. Each cell line
underwent treatment with Dex. The figure shows that cells that undergo apoptosis upon Dex treatment
have BCL11B expression decreased (CEM C7-14) compared to cells that do not undergo apoptosis
(CEM C1-15).
49
Figure 3.7 Individual Statistical Data Analysis
Figure 3.7 represents individual expression levels of Bcl11b in CEM GC-sensitive C7-14
and CEM GC-resistant C1-15 cells.
*Note the scale difference in CEM C7-14 versus C1-15.
50
Chapter 4: Discussion & Conclusions
Apoptotic cell death is a critical cellular process for eliminating diseased and
aberrant cells in body tissues and organs. From the surveyed literature, it is also evident
that GCs can induce apoptosis through direct or indirect alteration of gene transcription
related to programmed cell death. The activity of GCs in lymphoid cells is of therapeutic
value in the treatment of lymphoid malignancies, particularly ALL. Synthetic GCs such
as Dex have the ability to induce transcriptional modifications of key pro- and antiapoptotic genes via the GR and subsequently evoke apoptosis of human lymphoid cells.
This underlies the basis for the use of synthetic GCs as therapeutic agents for treatment of
some lymphoid leukemias.45, 63
While GC-evoked apoptosis of T-lymphocytes is extensively studied, the
molecular components involved in the signaling cascades leading to apoptosis have
remained poorly understood. Identification of the genes involved in apoptosis of
lymphoid cells is important in identifying an efficient therapeutic target for the treatment
of certain human lymphoid leukemias. BCL11B and E4BP4 are possible gene
components involved in the signaling cascade leading to apoptosis in leukemic CEM
cells.63, 85 As a result, the present study investigated the GC-evoked apoptosis of the
human leukemic CEM cells as mediated by Bcl11b.
The CEM-C7-14 cells exhibited Increased Sensitivity to Dex Treatment
Dex was efficient in mediating GC-induced apoptosis of the human CEM cells
and turning on transcription of pro-apoptotic genes PCD pathway.60. In the present study,
the viability assay showed, CEM C7-14 sub-clone had significantly high sensitivity to
51
Dex treatment when compared to the CEM C1-15 sub-clone, as expected. As stated
before both cell lines have similar GR and binding activity, however the GC resistance
CEM C1-15 cells exhibited exponential growth which can suggest silenced GR
expression or defects in ligand binding affinity at the GR sites.60
Dex-induced apoptosis in CEM cells also lead to down regulation of Bcl11b
While the specific functions of Bcl11b gene are yet to be completely elucidated, a
number of studies have suggested that this gene is possibly involved in the activation of
the mitochondrial signaling cascade leading to apoptosis of lymphoid cells.60, 63 In the
present study, Dex-induced apoptosis in GC-sensitive cells (CEM C7-14) was
accompanied by down regulation of the Bcl11b. Statistical analysis of qRT-PCR data
revealed CEM C7-14 cells that underwent apoptosis had significantly reduced expression
of Bcl11b (P = 0.04), when compared to cells that did not undergo apoptosis C1-15. We
can conclude that the expression levels of the Bcl11b gene was largely repressed in GCsensitive cells upon Dex treatment. Two recent studies demonstrated down-regulation of
the Bcl11b gene activity through siRNA silencing, led to the growth and proliferation
inhibition and eventually apoptosis of the malignant human T-ALL cells but not normal
mature T-cells.60,85 This strongly indicates that Bcl11b is the key regulator of the
signaling cascades leading to apoptosis of the human leukemic CEM cells upon treatment
with the GC. However, it was also reported that Bcl11b conferred protection of cell
growth and proliferation and contributed to chemo-resistance in immature leukemic Tcells. This could suggest that Bcl11b is a negative regulator of GC-evoked apoptosis and
acts as an anti-apoptotic gene in leukemic CEM cells.86, 87. Given this information,
52
repression of the BCL11B through RNA interference (RNAi), should block proliferation
of immature leukemic T-cells and ultimately induce apoptosis and cpuld provides a novel
therapeutic approach to target T-cell malignancies.60, 85
GC-evoked down-regulation of Bcl11b results in up-regulation of the E4BP4
The relationship between the Bcl11b and E4bp4 gene activities in mediating GCevoked apoptosis is not well delineated. Research done by Beach et.al identified some
pro-apoptotic genes that act as positive regulators of GC-evoked apoptosis. E4bp4 has
been found to be among approximately 40 genes that are up-regulated in GC-sensitive
cells and respond to GC-evoked apoptosis following Dex treatment.45 As previously
stated, Bcl11b deficiency leads to increased levels of Nfil3 in early thymocyte precursors,
which indicates that Bcl11b and E4BP4 are mutually inhibiting each others’ activities.
Nfil3 expression, resulting in the suppression of the
NK fate, while up-regulation of Nfil3 might counter Bcl11b-induced T-cell potential by
and promoting NK cell fate. The primary aim of the present study was based on the
hypothesis that there exists a relationship between the degree of Bcl11b repression and
up-regulation of the E4BP4 gene. It is plausible that there exist a state of balance in
expression levels between pro- and anti-apoptotic genes in the human leukemic CEM
cells. Given that the anti-apoptotic Bcl11b was down regulated in Dex-treated CEM cells,
is it plausible that the pro-apoptotic E4bp4 was up-regulated to facilitate completion of
the apoptosis.
It has been demonstrated that E4BP4 facilitates GC-evoked apoptosis in human
leukemic CEM cells via up-regulation of the pro-apoptotic BCL-2 protein, Bim.45
Knockdown of Bim expression through RNAi gene silencing technique was found to
53
diminish Dex-evoked apoptotic cell death, suggesting that Bim is required for GC-evoked
apoptosis of the CCRF-CEM cells.87 Another question that can be asked is that if Bcl11b
regulates Bcl-2 family of genes including Bim, Bcl-xL, Bax and Bak directly or via
E4BP4.
Interestingly, it was previously shown that the E4BP4 mediated GC-evoked
apoptosis of human leukemic CEM cells was calcium-dependent since two calcium
chelators: ethylene glycol tetraacetic acid (EGTA) and 2-bis (2-aminophenoxy)-ethaneN,N,N1,N1-tetraacetic acid-acetoxymethyl (BAPTA), were observed to protect CEM-C714 cells from GC-evoked apoptosis. 89 By this account, it is plausible that Bim is involved
in calcium homeostasis. This also indicates that the GC-evoked induction of
accumulation of Ca2+ in CEM cells results in up-regulation of the E4BP4, which
subsequently mediates apoptotic cell death.
Through ongoing research, Bcl11b gene is known to plays a crucial role in T-cell
development but the precise function of Bcl11b remains unclear. Previous studies showed
that the inhibition of Bcl11b expression by siRNA selectively inhibited proliferation and
effectively induced apoptosis in human T-cell acute lymphoblastic leukemia (T-ALL)
cell lines (Jurkat, Molt-4).81Additionally, global gene expression profiling revealed that
Bcl11b siRNA-mediated cell apoptosis may be related to BCL-2 family genes of the
mitochondrial pathway, and the TNFSF10 gene in the death receptor signaling pathway.
Figure 4.1 shows a hypothetical schematic representation of the regulatory network of
apoptosis in Bcl11b and its related genes. TNFSF10 gene, which belongs to tumor
necrosis factor superfamily, induces apoptosis through its interaction with death
receptors.81 Up-regulation of this gene activated the death receptor signaling pathway,
54
whereas up-regulation of the two mitochondrial BCL-2 family genes (the BH3-only
domain proteins BIK and BIM) enhanced their binding to BCL-2, with a reduction in the
anti-apoptotic gene BCL2L1, thereby inhibiting the anti-apoptotic function and
promoting Bax and Bak activation. This in turn activates the downstream caspases 3, 6,
and 7, leading to increased apoptosis, however the exact mechanism of this pathway is
still under investigation.60
From the above account it appears that cross-talk between the anti-apoptotic
Bcl11b and the pro-apoptotic E4BP4 gene activities in mediating GC-evoked apoptosis in
CEM cells is still not clear.45 Future experiments are necessary to understand the
contribution of E4BP4 and Bcl11b in drug-induced apoptosis of leukemic cells, shed
light on the causes of chemoresistance, and integrate apparently isolated gene regulatory
changes through a better understanding of their interrelationships. The future directions
that could unravel the relationship between Bcl11b and E4BP4 in the context of druginduced leukemic cell apoptosis include experiments such as: utilizing overexpression
and knockdown strategies to determine whether E4BP4 expression is down-regulated by
Bcl11b and also evaluate whether Bcl11b regulates Bcl-2 family genes including Bim,
Bcl-xL, Bax and Bak either directly or via E4BP4. The ultimate goal of these strategies is
to identify novel therapeutic approach to target genes directly in apoptotic pathway and to
overcome chemoresistance leukemic cells.
55
Figure 4.1 schematic representation of the regulatory network of apoptosis in
Bcl11b and its related genes
Bcl11b
Intrinsic Pathway
Bid,Bim
Extrinsic Pathway
BH3
TNFSF10
Bcl-2
Death Receptors
Bax
cytC
Apaf-1
FADD
Caspase-9
Caspase-8
Caspase 3,6,7
Apoptosis
Figure 4.1 is the proposed global gene expression profile which suggest that the
molecular mechanisms of BCL11B mediated cell death may involve BCL-2 family
genes in the intrinsic mitochondrial pathway as well as the TNFSF10 gene in the
death receptor signaling pathway. Modified from Huang et. al, 2011. 91
56
Experimental Limitations
Throughout the experiments, many inconsistencies arose that caused problems,
which could have altered the outcome of the results. One major inconsistency that came
up repeatedly was the variability among qPCR sample sets which led to elimination of 6
data sets. For example, contamination between duplicate set of samples for β -actin or
high CT values, indicative of minimal amounts of target nucleic acid for Bcl11b were
seen in these samples. Since B-actin was used as a reference gene, it should not exhibit
changes in expression between samples from various experimental conditions or time
points. These discrepancies could have been due to pipetting errors, improper RNA
extraction, limited Bcl11b gene expression in CEM cell lines or the reagents used.
Future Experiments
Future studies in this area include measuring the basal expression levels of Bcl11b
gene in CEM cell lines and other leukemic cell lines and western blots to evaluate
expression levels of Bcl11b in response to anti-leukemic agents. Future experiments such
as overexpression and gene knockdown are necessary to understand the contribution of
E4BP4 and Bcl11b in drug-induced apoptosis of leukemic cells. These strategies will
help to determine whether E4BP4 expression is down-regulated by Bcl11b and also
evaluate whether Bcl11b regulates Bcl-2 family genes including Bim, Bcl-xL, Bax and
Bak either directly or via E4BP4. The ultimate goal of these experimments is to identify
novel therapeutic approach to target genes directly in apoptotic pathway and to overcome
chemoresistance leukemic cells.
57
References:
1. Lawen A. Apoptosis—an introduction. Bioessays. 2003; 25, 888-896.
2. Kerr JFR, Wylie AH and Currie AR. Apoptosis: a basic biological phenomenon
with wide-ranging implications in tissue kinetics. Br. J. Cancer. 1972; 26, 239257.
3. Alt, Frederick W. Advances in Immunology. Burlington: Elsevier Science; 2011.
4. Alberts B, Johnson A, Lewis J, Raff M, Roberts K and Walter P. Molecular
biology of The Cell. London: Garland Science; 2002.
5. MacFarlane M and Williams A. Apoptosis and disease: a life or death decision.
EMBO reports. 2004; 5, 674-678.
6. Reed J. Dysregulation of apoptosis in cancer. Journal of Clinical Oncology. 1999;
17: 9, 2941
7. Attardi L and Brown M. The role of apoptosis in cancer development and
treatment response. Nat Rev Cancer. 2005; 5:3 231.
8. Bold RJ, Termuhlen PM, McConkey DJ. Apoptosis, cancer and cancer therapy.
Surgical Oncology. 1997; 6, 133-142.
9. Gewirtz DA, Holt SE, and Grant S. Apoptosis, Senescence, and Cancer. Humana
Press; 2007.
10. Kasibhatla S and Tseng B. Why target apoptosis in cancer treatment. Mol Cancer
Ther. 2003; 2:573-580.
11. Elmore S. Apoptosis: A review of programmed cell death. Toxicol Pathol. 2007;
35:495-516.
12. Booth C, Potten CS and Wilson JW. Apoptosis Genes. Boston: Kluwer
Academic; 1998.
13. Caplin DE. Trends in Cellular Signalling. New York: Nova Biomedical; 2006.
14. Igney FH, K. P. Death and anti-death: tumour resistance to apoptosis. Nat Rev
Cancer. 2002; 2(4):277-88.
15. Ashkenazi A. Targeting death and decoy receptors of the tumour-necrosis factor
superfamily. Nat Rev Cancer. 2002; 2(6):420-30.
16. Cho SG, Choi EJ. Apoptosis signaling pathways: caspases and stress-activated
protein kinases. J Biochem Mol Biol. 2002; 35, 24-27.
58
17. Hyman B.T and Yuan J. Apoptotic and non-apoptotic roles of caspases in
neuronal physiology and pathophysiology. Nat Rev Neurosci. 2012; 13(6):395406.
18. Zimmermann, K.C. and Green, D.R. How cells die: Apoptosis pathways. J
Allergy Clin Immunol. 2001; 108, 99-103.
19. Adam JM. Ways of dying: multiple pathways to apoptosis. Genes and
Development. 2003; 17: 2481-2495.
20. Kumar S. Apoptosis: mechanisms and role in disease. Berlin: Springer; 1998.
21. Czabotar P E, Lessene G, Strasser A and Adams J M. Control of apoptosis by the
BCL-2 protein family: implications for physiology and therapy. Nat Rev Mol Cell
Biol. 2014; 15, 49–63
22. Chipuk JE, Moldoveanu T, Llambi F, Parsons MJ and Green DR. The BCL-2
family reunion. Mol Cell. 2010; 12;37(3):299-310
23. Anvekar R, Asciolla J, Missert D and Chipuk J. Born to be alive: a role for the
BCL-2 family in melanoma tumor cell survival, apoptosis, and treatment. Front.
Oncol. 2011; 10.3389
24. Ola M.S, Nawaz M and Ahsan H. Role of Bcl-2 family proteins and caspases in
the regulation of apoptosis. Mol Cell Biochem. 2011; 351(1-2):41-58
25. Chipuk JE and Green DR. How do BCL-2 proteins induce mitochondrial outer
membrane permeabilization. Trends Cell Biol. 2008; 18(4):157-64
26. Appelbaum FR. The acute leukemias. In: Goldman L, Schafer AI, eds. Goldman's
Cecil Medicine. 24th ed. Philadelphia, PA: Elsevier Saunders; 2011: chap 189.
27. Pui CH, Robison LL and Look T. Acute lymphoblastic leukaemia. Lancet. 2008;
371: 1030–1043.
28. Masters JRW and Palsson B. Leukemias and Lymphomas. New York: Kluwer
Academic; 2000.
29. McGrath P. Living with Leukaemia, Lymphoma and Myeloma: A Guide for
Patients and Their Families. Toowong, Qld: Researchman Australia; 2007.
30. Chiaretti S and Foa R. T-cell acute lymphoblastic leukemia.
Haematological.2009; 94(2): 160-2.
31. Mughal TI and Goldman JM. Understanding Leukaemia and Related Cancers.
Oxford: Blackwell Science Ltd; 1999.
32. Boehm T. Thymus Development and Function. Current Opinion in Immunology.
2008; 20, 178-184.
59
33. Schwarz BA and Bhandoola A. Trafficking from the bone marrow to the thymus:
a prerequisite for thymopoiesis. Immunol. Rev. 2006; 209: 47–57
34. Ashwell JD, Lu FWM and Vacchio MS. Glucocorticoids in T cell Development
and Function. Annual Rev Immuno. 2000; 18:309-345.
35. Schuler S and Szende B. Apoptosis in acute leukemia. Leuk Res. 2004;
28(7):661-6
36. Herold MJ, McPherson KG and Reichardt HM. Glucocorticoids in T cell
apoptosis and function. Cell Mol Life Sci. 2006; 63(1):60-72
37. Vilasco, M. et al. (2011) Glucocorticoid receptor and breast cancer.Breast Cancer
Res. Treat. 130, 1–10
38. Biddie, S.C. et al. (2012) Dynamic regulation of glucocorticoid signalling in
health and disease. Rheumatology (Oxford) 51,403–412
39. Buttgereit, F. (2012) A fresh look at glucocorticoids how to use an old ally more
effectively. Bull. NYU Hosp. Jt. Dis. 70
40. Barnes PJ. Anti-inflammatory actions of glucocorticoids: molecular mechanisms.
Clin Sci (Lond) 1998;94:557-72.
41. Rhen T, Cidlowski JA. Anti-inflammatory action of glucocorticoids—new
mechanisms for old drugs. N Engl J Med 2005;353:1711-23.
42. Greenstein S, Ghias K, Krett NL and Rosen ST. Mechanisms of Glucocorticoidmediated Apoptosis in Hematological Malignancies. Clin Cancer Res. 2002;
8:1681-1694.
43. Schmidt S, Rainer J, Ploner C, Persul E, Riml S and Kofler R. Glucocorticoidinduced apoptosis and glucocorticoid resistance: molecular mechanisms and
clinical relevance. Cell Death and Differentiation. 2004; 11, S45–S55
44. Foley GE, Lazarus H, Farber S, Uzman BG, Boone BA and McCarthy RE.
Continuous culture of a human lymphoblasts from peripheral blood of a child
with acute leukemia. Cancer (1965) 18: 522-529.
45. Beach JB, Nary LJ, Hirakawa Y, Holland E, Hovanessian R and Medh RD.
E4BP4 facilitates glucocorticoid-evoked apoptosis of human leukemic CEM cells
via upregulation of Bim. Journal of Molecular Signaling. (2011) 6:13.
46. Medh, R.D., Webb, M.S., Miller, A.L., Johnson, B.H., Fofanov, Y., Li, T.,
Wood, T.G., Luxon, B.A., and Thompson, E.B. Gene expression profile of human
lymphoid CEM cells sensitive and resistant to glucocorticoid-evoked apoptosis.
Genomics (2003) 81, 543-555.
60
47. Klein Wolterink RG, García-Ojeda ME, Vosshenrich CA, Hendriks RW and Di
Santo JP.The intrathymic crossroads of T and NK cell differentiation. Immunol
Rev. 2010; 238(1):126-37.
48. Schlossmacher G, Stevens A and White A Glucocorticoid receptor-mediated
apoptosis: mechanisms of resistance in cancer cells. Journal of Endocrinology.
2011; 211, 17–25
49. Ploner C, Schmidt S, Presul E, Renner K, Schrocksnadel K, Rainer J, Riml S and
Kofler R. Glucocorticoid-induced apoptosis and glucocorticoid resistance in acute
lymphoblastic leukemia. J Steroid Biochem & Mol Biol. 2005; 153–160
50. Inaba H and Pui Ch. Glucocorticoid use in acute lymphoblastic leukemia:
comparison of prednisone and dexamethasone. Lancet Oncol. 2010; 11(11):
1096–1106
51. Kamizono S, Duncan GS, Seidel MG, Morimoto A, Hamada K, Grosveld G,
Akashi K, Lind EF, Haight JP, Ohashi PS, Look AT and Mak TW. Nfil3/E4bp4 is
required for the development and maturation of NK cells in vivo. J Exp Med.
2009; 206(13):2977-86
52. Gascoyne DM1, Long E, Veiga-Fernandes H, de Boer J, Williams O, Seddon B,
Coles M, Kioussis D, Brady HJ. The basic leucine zipper transcription factor
E4BP4 is essential for natural killer cell development. Nat Immunol. 2009;
10(10):1118-24
53. Zhang W, Zhang J, Kornuc M, Kwan K, Frank R and Nimer SD. Molecular
cloning and characterization of NF-IL3A, a transcriptional activator of the human
interleukin-3 promoter. Mol Cell Biol. 1995; 15(11):6055-63.
54. Cowell IG. E4BP4/NFIL3, a PAR-related bZIP factor with many roles. Bioessays.
2002 Nov;24(11):1023-9.
55. Ohno T, Onishi Y, Ishia N. A novel E4BP4 element drives circadian expression
of mPeriod2. Nucleic Acids Research (2007) 35, 648-655
56. Ikushima S, Inukai T, Inaba T, Nimer SD, Cleveland JL, Look AT. Pivotal role
for the NFIL3/E4BP4 transcription factor in interleukin 3-mediated survival of
pro-B lymphocytes. Proc. Natl. Acad. Sci. USA. (1997) 94, 2609-2614.
57. Priceman SJ1, Kirzner JD, Nary LJ, Morris D, Shankar DB, Sakamoto KM, Medh
RD. Calcium-dependent upregulation of E4BP4 expression correlates with
glucocorticoid-evoked apoptosis of human leukemic CEM cells. Biochem
Biophys Res Commun. 2006; 344(2):491-9.
58. Huang X, Du X and Li Y. The role of BCL11B in hematological malignancy. Exp
Hematol Oncol. 2012; 1(1):22.
61
59. Grabarczyk P, Nahse V, Delin M, Przybylski G, Depke M, Hildebrandt P, Volker
U, Schmidt CA: Increased expression of bcl11b leads to chemoresistance
accompanied by G1 accumulation. PLoS One. 2010; 5(9).
60. Huang X, Chen S, Shen Q, Chen S, Yang L, Grabarczyk P, Przybylski GK,
Schmidt CA, Li Y: Down regulation of BCL11B expression inhibits proliferation
and induces apoptosis in malignant T cells by BCL11B-935-siRNA. Hematology
(Amsterdam, Netherlands), 16:236-242.
61. Kominami R. Role of the transcription factor Bcl11b in development and
lymphomagenesis. Proc Jpn Acad Ser B Phys Biol Sci. 2012; 88(3):72-87.
62. Karlsson A, Nordigården A, Jönsson JI and Söderkvist P. Bcl11b mutations
identified in murine lymphomas increase the proliferation rate of hematopoietic
progenitor cells. BMC Cancer. 2007; 7:195.
63. Liu P, Li P and Burke S. Critical roles of Bcl11b in T-cell development and
maintenance of T-cell identity. Immunol Rev. 2010; 238(1):138-49.
64. Golonzhka O, Leid M, Indra G, Indra AK: Expression of COUP-TF-interacting
protein 2 (CTIP2) in mouse skin during development and in adulthood. Gene
expression patterns: GEP 2007; 7:754–760.
65. Arlotta P, Molyneaux BJ, Jabaudon D, Yoshida Y, Macklis JD: Ctip2 controls the
differentiation of medium spiny neurons and the establishment of the cellular
architecture of the striatum. J Neurosci. 2008; 28:622–632.
66. Golonzhka O, Metzger D, Bornert JM, Bay BK, Gross MK, Kioussi C, Leid M:
Ctip2/Bcl11b controls ameloblast formation during mammalian odontogenesis.
Proc Natl Acad Sci U S A 2009, 106:4278–4283.
67. Liang X, Bhattacharya S, Bajaj G, Guha G, Wang Z, Jang HS, Leid M, Indra AK,
Ganguli-Indra G: Delayed cutaneous wound healing and aberrant expression of
hair follicle stem cell markers in mice selectively lacking Ctip2 in epidermis.
PLoS One. 2012; 7:e29999.
68. Shen Q, Huang X, Chen S, Yang L, Chen S, Li B, Wu X, Grabarczyk P,
Przybylski GK, Schmidt CA, Li Y. BCL11B suppression does not influence
CD34(+) cell differentiation and proliferation. Hematology. 2012; 17(6):329-33
69. Cismasiu VB, Ghanta S, Duque J, Albu DI, Chen HM, Kasturi R, Avram D.
BCL11B participates in the activation of IL2 gene expression in CD4+ T
lymphocytes. Blood 2006; 108(8):2695-2702
70. Li p,Xiao Y, Liu Z and Liu P. Using mouse models to study function of
transcriptional factors in T cell development. Cell Regeneration 2012; 1:8.
71. Wakabayashi Y, Inoue J, Takahashi Y, Matsuki A, Kosugi-Okano H, Shinbo T,
Mishima Y, Niwa O, Kominami R: Homozygous deletions and point mutations of
62
the Rit1/Bcl11b gene in gamma-ray induced mouse thymic lymphomas. Biochem
Biophys Res Commun. 2003; 301:598–603.
72. Li L, Leid M and Rothenberg EV. An early T cell lineage commitment
checkpoint dependent on the transcription factor Bcl11b. Science. 2010;
329(5987):89-93.
73. Kastner P, Chan S, Vogel WK, Zhang L-J, Topark-Ngarm A, Golonzhka O, Jost
B, Le Gras S, Gross MK, Leid M: Bcl11b represses a mature T-cell gene
expression program in immature CD4(+)CD8(+) thymocytes. Eur J Immunol.
2010; 40:2143-2154.
74. Li P, Burke S, Wang J, Chen X, Ortiz M, Lee SC, Lu D, Campos L, Goulding D,
Ng BL, et al: Reprogramming of T cells to natural killer-like cells upon Bcl11b
deletion. Science. 2010; 329:85–89
75. Li L, Zhang JA, Dose M, Kueh HY, Mosadeghi R, Gounari F and Rothenberg
EV. A far downstream enhancer for murine Bcl11b controls its T-cell specific
expression. Blood. 2013; 122(6):902-11.
76. Karanam NK, Grabarczyk P, Hammer E, Scharf C, Venz S, Gesell-Salazar M,
Barthlen W, Przybylski GK, Schmidt CA, Volker U: Proteome analysis reveals
new mechanisms of Bcl11b-loss driven apoptosis. J Proteome Res. 2010; 9:3799–
3811.
77. Mitsui, Shigeru, Shun Yamaguchi, and Takuya Matsuo. "Antagonistic role of
E4BP4 and PAR proteins in the circadian oscillatory mechanism." Genes
Development 15 (2001): 995-1006
78. Anagnostopoulos AK, Vougas K, Kolialexi A, Mavrou A, Fountoulakis M and
Tsangaris GT. The protein profile of human immature T-cell line CCRF-CEM.
Cancer genomics & Proteomics (2005) 2:271-300
79. Chang J and Hass M. Frequent mutations in P53 tumor suppressor gene in human
leukemia T-cell lines. Mol.Cell. Biol. (1990) 10(10):5502.
80. Nary LJ. Role of E4BP4 in regulation of apoptosis in human leukemic CEM cells.
MS Thesis, California State University, Northridge (2007).
81. Huang X, Chen S, Shen Q, Yang L, Li B, Zhong L, Geng S, Du X, Li Y: Analysis
of the expression pattern of the BCL11B gene and its relatives in patients with Tcell acute lymphoblastic leukemia. J Hematol Oncol, 3:44.
82. Applied biosystem, Real-time PCR vs Traditional PCR.
83. Karlen Y, McNair A, Perseguers S, Mazza C and Mermod N: Statistical
significance of quantitative PCR. BMC Bioinformatics. (2007) 8:131.
63
84. Ramakers, E. Assumption-free analysis of Quantitative Real-Time PCR Data.
NeuroscienceLetter. (2003) pp. 62-66
85. Grabarczyk P, Przybylski GK, Depke M, Völker U, Bahr J, Assmus K, Bröker
BM, Walther R, Schmidt CA: Inhibition of BCL11B expression leads to apoptosis
of malignant but not normal mature T cells. Oncogene 2007, 26:3797–3810.
86. Hala M, Hartmann BL, Bock G, Geley S, Kofler R. Glucocorticoid-receptor-gene
defects and resistance to glucocorticoid-induced apoptosis in human leukemic cell
lines. International journal of cancer Journal international du cancer.
1996;68(5):663-8.Nn
87. Lu J, Quearry B, Harada H. p38-MAP kinase activation followed by BIM
induction is essential for glucocorticoid-induced apoptosis in lymphoblastic
leukemia cells. FEBS Letters (2006) 580, 3539-3544
88. Albu DI, Feng D, Bhattacharya D, Jenkins NA, Copeland NG, Liu P, Avram D:
BCL11B is required for positive selection and survival of double-positive
thymocytes. J Exp Med 2007, 204:3003-3015.
89. Priceman SJ, Kirzner JD, Nary LJ, Morris D, Shankar DB, Sakamoto KM, et al.
Calcium-dependent upregulation of E4BP4 expression correlates with
glucocorticoid-evoked apoptosis of human leukemic CEM cells. Biochem
Biophys Res Commun. 2006; 344(2):491-9.
90. Rozen S, Skaletsky H. Primer 3 on the WWW for general user and for biologist
programmers. In: Krawetz S, Misener S (eds). Bioinformatics Methods and
Protocols: Methods in Molecular Biology. Human Press, Totowa, NJ, p 365-386,
August 1999.
http://biotools.umassmed.edu/bioapps/primer3_www.cgi. June, 2011.
91. Huang X, Shen Q, Chen S, Chen S, Yang L, Weng J, Du X, Grabarczyk P,
Przybylski GK, Schmidt CA and Li Y. Gene expression profiles in BCL11BsiRNA treated malignant T cells. J Hematol Oncol. 2011; 4:23.
92. Kruger RP. Leading Edge, Stem Cell Select. Cell. Volume 142, Issue 3, August
2010, Pages 339, 341.
http://www.sciencedirect.com/science/article/pii/S009286741000841X. May,
2014.
64