CALIFORNIA STATE UNIVERSITY, NORTHRIDGE
Epigenetic Regulation of Developmentally Regulated B cell Gene Silencing
and
Specificity of dCK TM for L-FMAU:
A New Reporter Gene for Positron Emission Tomography
A thesis submitted in partial fulfillment of the requirements
For the degree of Master of Science
in Biology
By
Christopher Nosala
August 2012
The thesis of Christopher Nosala is approved:
___________________________________________
____________________
Mary-Pat Stein, Ph.D.
Date
___________________________________________
____________________
Rheem D. Medh, Ph.D.
Date
___________________________________________
____________________
Cindy S. Malone, Ph.D., Chair
Date
California State University, Northridge
ii
TABLE OF CONTENTS
Title Page ......................................................................................................................... i
Signature Page ................................................................................................................ ii
Abstract .......................................................................................................................... iv
CHAPTER 1: Epigenetic Regulation of Developmentally Regulated B cell Gene
Silencing
Introduction ......................................................................................................................1
Materials and Methods ...................................................................................................20
Results ............................................................................................................................27
Discussion ......................................................................................................................50
CHAPTER 2: Specificity of dCK TM for L-FMAU: A New Reporter Gene for Positron
Emission Tomography
Introduction ....................................................................................................................62
Materials and Methods ...................................................................................................73
Results ............................................................................................................................85
Discussion ....................................................................................................................104
References ....................................................................................................................114
iii
ABSTRACT
Epigenetic Regulation of Developmentally Regulated B cell Gene Silencing
and
Specificity of dCK TM for L-FMAU:
A New Reporter Gene for Positron Emission Tomography
By
Christopher Nosala
Master of Science in Biology
Two studies were undertaken that investigate the implications of small
biochemical alterations in living systems. First, epigenetic mechanisms have been shown
to control gene expression and can permanently silence a gene. We investigate the role
of the epigenetic mechanisms DNA methylation and histone deacetylation in the stage
specific silencing of the gene VpreB. This gene must be expressed and extinguished at
specific stages for the healthy development of the B cell. Reactivation of VpreB gene
expression was observed after inhibiting epigenetic mechanisms in Ramos cells in which
VpreB is permanently silenced. Furthermore, no DNA methylation was found within the
promoter region of VpreB in Nalm6 cells in which VpreB is expressed. Therefore, DNA
methylation and histone deacetylation was observed to be correlated with the onset of
VpreB silencing in cell lines.
Next, we explore the effects on substrate specificity of single point mutations
within the active site of the enzyme deoxycytidine kinase (dCK). dCK is the rate limiting
step for the salvage of several nucleosides as an alternate to de novo nucleotide synthesis.
Furthermore, dCK is responsible for the activation of several chemotherapeutic
nucleoside analog prodrugs such as gemcitibine. By making three mutations (A100V,
R104M, D133A) within the active site of dCK, we were able to successfully increase
dCK’s specificity for the thymidine analog 2'-deoxy-2'-5-methyl-1-β-Larabinofuranosyluracil (L-FMAU) that can be used for positron emission tomography
(PET), a medical imaging modality. We also confirmed previous results that the three
mutations can broaden dCK’s specificity for thymidine. These results indicate that
dCK’s activity can be easily manipulated to increase specificity and turnover for
thymidine analogs including L-FMAU.
iv
CHAPTER 1: Epigenetic Regulation of Developmentally Regulated B cell
Gene Silencing
Introduction
Epigenetics
Every cell in a multi cellular organism shares nearly the same set of genetic
instructions yet these cells can vary remarkably at the phenotypic level. This observation
forms the basis for the field of epigenetics as heritable changes in gene expression can be
controlled by mechanisms that act on DNA without changing the actual genetic code of
the DNA (Bonasio, Tu and Reinberg 2010). These epigenetic mechanisms have been
shown to have huge implications in normal eukaryotic development, cell fate, the
incidence of cancer, as well as many other processes and serve as potential targets for
disease therapies (Espino et al. 2005). Current research suggests the effects of epigenetic
changes reach as far as predisposition to stroke, diabetes, food metabolism, memory, and
substance addiction. (Wong, Mill and Fernandes 2011, Ling and Groop 2009, Milagro et
al. 2011, Bali, Im and Kenny 2011, Qureshi and Mehler 2010). The critical role of
epigenetics in normal development and disease is becoming increasingly clear as new
techniques broaden the list of epigenetic implications in eukaryotic life.
Epigenetic mechanisms act to alter expression of genes by moderating the output
of transcriptional, translational, and sometimes post-translational machinery (Bonasio et
al. 2010). Mainly, transcriptional output is controlled epigenetically via chromatin
packaging. Here, transcription can be greatly up regulated or down regulated as a result
of the physical location of a gene or promoter within the nucleus. Depending on the
location and degree of various epigenetic marks, genes and promoters can be rendered
accessible or inaccessible to transcriptional activators that play important rolls in
transcription. Epigenetic control is imposed by the cell through chemical modifications
to the DNA or to the histones that help package the DNA but does not affect the actual
DNA sequence (Figure 1) (Li and Reinberg 2011).
Expression can also be controlled post-transcriptionally by the action of noncoding RNAs (ncRNAs). These transcripts are never translated into protein but function
to foster gene transcript travel through the cell or alter gene transcript stability through
direct interactions. Recently, ncRNAS have been shown to play a larger role than
expected and may even interact with DNA to alter chromatin states (Zhou, Hu and Lai
2010, Cowland, Hother and Grønbaek 2007). Finally, recent research has shown that
prions may alter expression of a gene by affecting the conformation of proteins posttranslationally and thus have great potential to change protein function (Halfmann and
Lindquist 2010). Because greater gene expression can be a direct result of greater
transcript numbers, then epigenetic mechanisms play a crucial role in the cell as these
mechanisms can greatly affect expression prior to transcription, post-transcriptionally,
and post-translationally.
Modes of Transcriptional Epigenetic Control
Epigenetic mechanisms mainly alter transcription by two actions. First, chemical
modifications to the DNA strand itself can result in physical hindrance of DNA/protein
interactions that are required for RNA synthesis and promote a closed chromatin structure
that does not allow for transcription. Second, chemical modifications to the proteins
2
called histones that are responsible for DNA packaging can result in open chromatin
structure that allows for transcription or closed chromatin structure that does not allow
for transcription. The two modes often act in concert and are reversible. It is believed
that modifications to histones are more frequently and more easily reversed than DNA
modifications making these changes less permanent (Li and Reinberg 2011).
DNA Methylation
Perhaps the best understood mode of epigenetic gene regulation is the chemical
modification of the base cytosine by the addition of a methyl group at the fifth carbon
position of this molecule. Methylation of cytosines is facilitated by a class of enzymes
termed DNA nucleotide methyltransferases (DNMTs) and typically occurs in regions of
DNA where the base pair guanine directly follows the base pair cytosine (CpG
dinucleotides, cytosine-phosphate link-guanine). The DNMT enzymes utilize a
[transferase] class reaction to faciliate the transfer of a methyl group from the cofactor Sadenosyl-L-methionine (SAM) creating 5-methylcytosine. S-adenosyl-L-homocysteine
is left over as a byproduct. CpG dinucleotides occur ubiquitously throughout the DNA
however methylation of CpG islands most effectively extinguishes transcription when
occurring in the promoter region directly preceding a gene. Any region of at least 550 bp
in length that has an actual CpG amount/expected CpG amount (genome average is 0.10.2) ratio of 0.65 is defined as a CpG island. As expected, heavily methylated (hypermethylated) CpG islands more effectively silence gene expression than lightly methylated
(hypo-methylated) CpG islands (Jurkowska, Jurkowski and Jeltsch 2011). Only certain
CpG dinucleotides become methylated, determining which genes need to be shut off in a
3
given tissue or cell type. This variable level of methylation adds complexity to the way
by which DNA stores and transmits information for the cell yet simplifies matters for the
cell as particular genes or regions of DNA can be permanently kept off.
DNA nucleotide methyltransferase
DNMTs occur in several different classes, each serving a particular role in the
generation and maintenance of 5-methylcytosine. Typically, the DNMT3 class of
enzymes catalyzes the initial transfer of a methyl group to the cytosine base pair on both
strands of DNA. After semi-conserved replication in cell division is complete, one strand
is left methylated whereas the new strand has not been exposed to the action of the
DNMT enzymes and so is not methylated. This state in which one strand is methylated
and the corresponding strand is unmethylated is termed hemi-methylation. Addition of a
corresponding methyl group to the newly synthesized daughter strand of DNA is
typically catalyzed by the DNMT1 class of enzymes that mainly act in maintenance of a
methylated state by acting on hemi-methylated DNA. The specific action of this enzyme
is interesting in that methylation of sites methylated pre-replication is favored. This is an
important step in cell division as the methylation profile, and therefore the genetic
profile, of a specific cell type is maintained.
In some cases, 5-methylcytosine can be converted back to the unmethylated
cytosine base pair by two methods. First, CpG sites can become unmethylated passively
through several rounds of replication. If the DNMTs are not allowed to interact with the
DNA, then hemimethylated DNA will eventually generate non-methylated sites (Chen
and Riggs 2011). This mode of de-methylation may be facilitated by transcription factors
4
that occupy regions of a gene containing CpG islands however this process is not well
understood and the key players involved in inhibiting this process are not well
characterized. Next, it has been shown that de-methylation by a process termed excision
repair occurs in plants and studies indicate that this method may also apply to mammals
(Zhu 2009). DNA excision repair is a normal process in which regions of DNA damaged
by UV light or other sources are cut out and replaced with non-damaged regions
(Dantuma, Heinen and Hoogstraten 2009). De-methylation is thought to be an
uncommon process occuring genome wide in the zygote and has not been reported
frequently in the mature organism (Chen and Riggs 2011).
DNA Methylation and Gene Extinction
DNA methylation acts to down regulate and extinguish gene expression in three
ways. First, the methyl group (-CH3), when added to the C5 position of cytosine, extends
into the major groove of the DNA molecule. Because many proteins that aid in
transcription utilize the major groove, the methyl group’s location can interfere with
DNA/protein interactions and provide steric hindrance preventing transcription of the
DNA molecule (Jurkowska et al. 2011). Steric hindrance can interfere with transcription
factor and polymerase binding as transcription is down regulated in these cases.
Preventin of transcription factor binding is often the first step in the permanent extinction
of a gene under epigenetic control.
Second, DNA methylation can further down regulate gene expression because this
molecule can recruit methyl-binding proteins (MBPs) that can recruit co-repressors or
promote chromatin compaction. When bound, MBPs downregulate expression by
5
creating a physical blockade between the DNA and transcription factors or other proteins
that would aid in transcription. Some MBPs can even interact directly with nucleosomes
or recruit methylated DNA binding chromatin-associate proteins (CAPs) that directly
compact chromatin or recruit enzymes linked to chromatin compaction making it too
dense to allow for transcription. The recruitment of histone H3 lysine 9 (H3K9)
methyltransferase (SETB1) by the MBP, MBD1, and the involvement of the MBP MBD3
in the nucleosome remodeling and deacetylation corepressor complex (NuRD) that is a
key transcriptional repressor in a wide range of organisms (Adkins and Georgel 2011).
In each of these cases, the presence of a methyl group on the DNA marks a gene for
silencing.
Histone Modifications
Gene suppression can further be enhanced by histone modifications. Chemical
modifications of the spherical proteins termed histones at the nucleosome core set the
stage for higher order chromatin structure that supersedes the action of normal genetic
interactions. A nucleosome is composed of a region of DNA 146 base pairs in length
wrapped around an octamer of histone proteins by 1.7 superhelical twists. Nucleosomes
form the ‘beads’ in the 11nm ‘beads-on-a-string’ fibers of the first level of chromatin
organization. Chromatin is further compacted into 30 nm fibers with the help of two
more linker histone proteins termed H1 and H5. Chromatin compaction beyond this
point becomes even more complex as histone/histone and fiber/fiber interactions aid in
ultimate organization (Li and Reinberg 2011).
6
Transcription can proceed or not depending on the degree of chromatin density
and this process is determined by the chemical interactions at the DNA/histone level. If a
chemical modification to the positively charged histone tails creates a greater affinity of
the histone for the negatively charged DNA, then the DNA is packaged more tightly and
the chromatin compacted more densely. On the other hand, if a chemical modification
decreases the affinity of the histone for the DNA, then the DNA is unraveled and the
chromatin is packed more loosely making these regions more accessible to transcription
factors (Arya and Schlick 2009).
The octameric histone cores are composed of two of each of the following
proteins: H2A, H2B, H3, H4. Covalent chemical modification of histones occurs at the
N-terminus of histone tails that extend outside of the nucleosome. Covalent modification
of the residues on these tails is regulated by addition of large molecules such as ubiquitin
and SUMO or small molecules such as phosphates, methyl and acetyl groups. Histone
modification by the addition of a methyl group can lead to gene activation or gene
suppression whereas modification with an acetyl group is coincident with gene activation
(Blomen and Boonstra 2011).
Histone Methylation
Histone tails can be mono-, di-, or tri-methylated and this transfer is catalyzed by
the enzyme histone methyltransferase (HMT). Whether methylation will cause activation
or suppression of transcription is dependent on which residue is methylated and to what
degree. For example, di- and tri-methylation of histone H3 lysine 9 (H3K9) will lead to
inactive chromatin whereas mono-methylation of the same H3K9 will promote an active
7
state (Nimura, Ura and Kaneda 2010). Histone methylation is more readily reversed than
DNA methylation and can be accomplished by demethylase enzymes. Like DNA
methylation, histone methylation patterns can be conserved throughout cell division
which aids in the maintenance of hereditary expression profiles (Blomen and Boonstra
2011).
Histone Acetylation
Post-translational histone acetylation is a highly regulated and reversible dynamic
process that has a direct effect on chromatin structure. Addition of an acetyl group (COCH3) at the histone tail is facilitated by the histone acetyltransferase (HAT) class of
enzymes and is correlated with gene activation whereas removal of an acetyl group is
facilitated by the histone deacetylase (HDAC) class of enzymes and is correlated with
gene suppression. These enzymes are generally recruited to particular regions by
transcription factors or multiprotein complexes that either promote or suppress
expression. These multiprotein complexes can also interact with chromatin to aid in the
tightening or loosening of chromatin packaging (Peserico and Simone 2011). The
acetylation state of the histones responsible for packaging a particular gene region, and
therefore the region’s expression activity, can be described as a competition between
these enzymes.
HAT enzymes occur in two varieties, HAT A and HAT B, defined by their
mechanism of action and cellular location. The HAT A class of enzymes catalyzes the
transfer of an acetyl group from acetyl-CoA to -NH2 group located at the end of the Nterminus of the histone tails. This transfer is accomplished inside the nucleus of the cell
8
and occurs on histones that have already been compiled into nucleosomes. This is an
important aspect in that HAT A enzymes can affect regions of DNA actively and quickly
(Peserico and Simone 2011).
HAT B enzymes differ from HAT A enzymes in that the transfer of an acetyl
group from acetyl-CoA to the -NH2 group located at the end of the N-terminus of the
histone tails occurs in the cytoplasm and on histones that have not yet been incorporated
into nucleosomes. Recent studies have shown that particular HAT enzymes have specific
cellular implications ranging from cell growth to myotube differentiation and apoptosis
(Peserico and Simone 2011).
HDAC enzymes occur in four isoforms; HDAC I, HDAC II, HDAC III, and
HDAC IV, that vary depending on their mechanism of catalysis and cellular localization.
Most notably, class I, class II, and class IV HDACs all rely on a Zn2+ ion dependent
mechanism of catalysis whereas class III HDACs are NAD+ dependent. The actions of
both HAT and HDAC enzymes has been discovered to extend even further than
nucleosomal DNA as structural proteins, signaling proteins, and chaperones have been
shown to be influenced by acetylation (Peserico and Simone 2011). The widespread
implications of HATs and HDACS on gene expression cannot be understated, as aberrant
acetyl profiles can result in cancer, underlying the importance of specific acetyl profiles
during development (Sharma, Kelly and Jones 2010).
Epigenetics in Development
Epigenetic mechanisms are the cell’s preferred method for long-term gene
extinction because their actions are both enduring and efficient in gene suppression. The
9
role of epigenetics begins early in development as epigenetic profiles are initially
established in cells to promote development and growth. As epigenetic patterns are reestablished to maintain mature states, many of the genes expressed early will be down
regulated whereas lineage-specific genes will be up regulated in the mature cell (Sharma
et al. 2010). The plasticity of epigenetic mechanisms allows for the differentiation of
every cell type in a mammalian body from a single cell while maintaining cellular
diversity. Recent advances in technology have even allowed for the de-differentiation of
mature cells to immature precursors and the maintenance of these states requires the
control of particular epigenetic mechanisms (Lister et al. 2011).
Epigenetics in Stem Cells
The role of stem cells has become increasingly important as biologists hope to
utilize stem cell technology in basic research to clinical applications. Current studies are
underway that utilize stem cells to cure many cancers and neurological disorders (Leeb et
al. 2011). Because of the controversy surrounding the use of stem cells, stem cell
biologists have had to develop alternate methods to produce these life-saving tools and
this requires a firm grasp of the epigenetic control of genetic profiles. Furthermore,
proper differentiation of stem cells into cells with specific functions must be
accompanied by appropriate epigenetic alterations that must be understood and controlled
if these therapies are to be utilized effectively (Shafa, Krawetz and Rancourt 2010).
Epigenetics in Cancer
10
Aberrant epigenetic patterns can initiate, aid in the progression of, and promote
metastasis and malignant cellular transformation. This can occur when erroneous
epigenetic change(s) results in the up regulation of oncogenes and/or the down regulation
of tumor suppressor genes. Normally, pernicious genes within a cell are heavily
methylated and buried deep within heavily compacted chromatin. These genes, however,
can become active if transcription is permitted by changes in epigenetic control
mechanisms. Aberrant DNA methylation states can also lead to genomic instability and
chromosomal rearrangements that add further complications and mutations to the
transformed cell (Sharma et al. 2010).
The huge impact of epigenetic changes in cancer has led many to believe potential
cures lie in drugs that can alter these epigenetic states. Complications may arise due to
the non-specific action of these drugs. However, 5-azacytidine and Trichostatin A have
made it to clinical trials nonetheless. As a nucleoside analog, 5-azacytdine prevents
DNA methylation when incorporated into DNA. The widespread activation of genes is
thought to promote a mature cell state and perhaps up regulate genes that promote a noncancerous state. Trichostatin A is a HDAC inhibitor. Trichostatin A leads to widespread
acetylation of histones by inhibiting the HDAC enzyme and has been shown to promote
growth arrest, differentiation, apoptosis, and the expression of tumor suppressor genes.
Variants of each class of epigenetic altering drugs are being investigated to find the most
efficient, least toxic drug to help fight cancer (Sharma et al. 2010).
The Adaptive Immune System
11
Human immunity can be divided into two categories. First, innate immunity
supports the fight against disease by creating barriers that can be troublesome to
pathogens (i.e. skin, stomach lumen) and non-specifically seeking out pathogens and
substances that are foreign (i.e. macrophages, complement). Some cells of the innate
immune system are capable of a process termed antigen presentation in which a small
piece of the foreign body that has been destroyed is projected on the cell surface to alert
the immune system of a particular danger (Janeway and Medzhitov 2002).
Acquired immunity remembers specific antigens, either on the pathogen itself or
presented to it by immune cells, and destroys anything it recalls as being problematic (i.e.
lymphocyte activation, antibody production). This process adds layers of complexity to
immunity as the generation and persistence of receptors that recognize specific antigens
requires control developmentally and genetically. One key play in acquired immunity is
the T cell that matures in the thymus and is mainly charged with elimination of the
pathogen. Next, the B cell matures in the bone marrow and is charged with remembering
and recognizing antigens of past pathogens (Bonilla and Oettgen 2010).
The Developing B cell
Proper development and receptor formation of B cells is crucial to the function of
the acquired immune system. Development of the B cell begins in the bone marrow with
a hematopoietic stem cell (HSC) and follows a stage-specific path in which each stage
can be defined by changing transcriptional events (Figure 2). The goal of these events is
to create a properly functioning B cell receptor that can recognize a specific antigen that,
12
when bound, leads to activation of the B cell and production of antibodies specific to said
antigen (Bonilla and Oettgen 2010).
HSCs are pluripotent cells that have the capability of becoming any circulating
blood cell and become more distinctly committed at each stage as their transcriptional
output changes. Commitment to the B cell lineage begins as the HSCs differentiate into
multipotent progenitors (MPPs), and then to lymphoid primed monocytic MPPs
(LMPPs), early lymphoid progenitors (ELPs), common lymphoid progenitors (CLPs) and
finally to B-biased cells that then begin the B cell maturation steps. Each step of
differentiation produces a cell that is more specialized and committed to a particular cell
type and this commitment is correlated with particular genetic events. For example, the E
box binding protein 2A (E2A) and Early B cell Factor-1 (EBF1) transcription factors are
required to advance the CLPs along the B-biased pathway. Furthermore, proper
maturation is correlated with particular epigenetic events. For example the gene the mb1, that encodes for an immunoglobulin that is necessary for B cell receptor formation and
B cell function, is epigenetically silenced via DNA hypermethylation in non-B cells yet is
demethylated in the developing B cell making this gene’s promoter region accessible to
transcription factors such as E2A and EBF that are required for B cell commitment and
maturation (Ramírez, Lukin and Hagman 2010).
The up regulation of the genes Rag1 and Rag2 at the LMPP stage is crucial to B
cell maturation. The products of these genes form the somatic recombination machinery
that facilitates rearrangement of regions of the B cells DNA allowing for the vast
repertoire of antibody combinations that make our acquired immune system robust.
Expression of the genes Rag1 and Rag2 continues into the B-cell biased stage and are
13
subsequently down-regulated or up-regulated at different stages in which recombination
is needed (Bonilla and Oettgen 2010).
Stages of B cell Development
The B cell must pass through several stages of development while still in the bone
marrow in order to generate a functioning antigen receptor. First, Pre-Pro B cells are
defined by the rearrangement of proper DH and JH immunoglobulin regions. Next, Pro B
cells are defined by the joining of proper VH immunoglobulin regions with the DH and JH
regions to form the  heavy chain. At this stage, the  heavy chain is retained by the
Binding Immunoglobulin Protein (BiP) complex in the endoplasmic reticulum and will
only be released if the light chain binding determines that the heavy chain is formed
properly for functioning. (Figure 3) (Zhang, Srivastava and Lu 2004).
The surrogate light chain is composed of two immunoglobulin-like proteins,
VpreB (an Ig V-like sequence) and 5 (an Ig C-like sequence), and resembles a normal
light chain immunoglobulin region in its capacity to bind with the  heavy chain. If the
surrogate light chain and the  heavy chain correctly bind then the  heavy chain
complex is released from the BiP binding complex and transported to the cell membrane
to form, together with Ig and Ig, the pre-B cell receptor. At this stage the B cell is
considered a large pre-B cell. Upon successful activation, the Pre-B cell receptor signals
for the maturation of the B cell by down regulating the expression of the VpreB and 5
genes and up regulating the expression of Rag1 and Rag2 (Parker et al. 2005). The genes
VpreB and 5 are silenced and kept silenced for the rest of the B cells existence (Zhang
et al. 2004).
14
Next, the Rag1 and Rag2 gene products help produce the variable region of the
light chain immunoglobulin that, when bound to the aforementioned  heavy chain,
create the complete B cell receptor (IgM) that is posited at the cell surface. These events
mark the small pre-B cell stage of B cell development at which time the cell also
undergoes proliferative expansion. Here the B cells are considered immature B cells and
if the expression at the cell surface of another receptor (IgD) is successful, then the
immature B cell may leave the bone marrow to circulate in the body as a mature B cell.
B cells typically circulate in the lymph and lymph nodes until they encounter a
corresponding antigen to initiate their receptor. If ligand binding to the B cell receptor
occurs, the B cells are activated and become antibody producing plasma cells that are
short-lived. Alternately, mature B cells can become germinal cells in the lymph nodes
and produce memory B cells designated to a specific antigen (Bonilla and Oettgen 2010).
The pre-B cell Receptor
Not much is known about how the pre-B cell receptor functions nor the
mechanisms that control the expression of the genes VpreB and 5. It is believed that
initiation of the pre-B cell receptor can occur in a ligand-dependent and a ligandindependent manner. Studies indicate a ligand crucial to initiation may reside in the
bone-marrow microenvironment however present data is inconclusive. Galectin-1 has
been purported to be able to bind to the pre-B cell receptor but this binding may not be
enough to cause signaling via the Ig/Ig heterodimer. Furthermore, the mere
positioning of the pre-B cell receptor on the cell surface may be enough to cause
signaling and promote maturation of the B cell (Zhang et al. 2004).
15
Expression of the surrogate light chain genes requires the presence of Early B cell
Factor (EBF) and Pax-5 transcription factors, however, their direct role with these genes
is not well characterized as these transcription factors are widely used throughout B cell
development. After pre-B cell receptor initiation, signaling through the Ig/Ig
heterodimer is believed to originate from their immuno-receptor tyrosine-based activation
motifs (ITAMs) activating the tyrosine kinase Syk, protein kinase C, and NF-B.
Maturation may be induced by BLNK transcription factor initiation, a target of Pax-5,
causing an intracellular calcium flux in response to pre-B cell receptor signaling (Zhang
et al. 2004).
Epigenetics during B cell Development
The ambiguity surrounding the presence of particular transcription factors that
silence the VpreB and 5 genes after pre-B cell receptor initiation and the way in which
these genes are silenced for the rest of the B cell’s life support the notion that epigenetic
mechanisms may be major factors controlling the expression of VpreB and 5 in the
developing B cell.
16
Figure 1
Schematic of transcriptionally active euchromatin versus transcriptionally repressed
heterochromatin. The regions of genomic DNA containing the genes VpreB and 5 may
appear as euchromatin when the genes are expressed and as heterochromatin when the
genes are silenced.
17
Figure 2
Schematic of B cell development indicating stage specific expression of the surrogate
light chain genes VpreB and 5.
18
Figure 3
Schematic depicting the role of the surrogate light chain in forming the Pre-B cell
receptor. When expressed, the gene products of VpreB and 5 come together to form the
surrogate light chain. If the  heavy chain is properly formed, the surrogate light chain
binds the  heavy chain releasing the heavy chain from the endoplasmic reticulum and
forming the Pre-B cell receptor. If the surrogate light chain cannot bind the  heavy
chain then the  heavy chain is degraded.
19
Materials and Methods
Media Preparation
Cell Culture
Freezing and Thawing Cells
Growth Curves
RNA Isolation
RT-PCR for Gene Expression
Gel Electrophoresis
Re-activation Experiments
Bisulfite Conversion Experiments
Primer Design for Bisulfite Conversion
Cloning and Sequencing Converted DNA
20
Media Preparation
Cell lines representing pre-defined stages of B cell development were cultured in 1x
HyCLone RPMI-1640 media (Thermo Scientific, Catalogue # SH30027.01) containing
2.05 mM L-Glutamine. Media was supplemented with 10% Fetal Bovine Serum (Omega
Scientific, FB-01), HyClone Penicillin-Streptomycin Solution (Thermo Scientific,
SV30010) to a final concentration of 100 units/mL Penicillin, 100 g/mL Streptomycin,
1x BioWhittaker NEAA Mixture (non-essential amino acids, Lonza, 13-114E) and 1mM
Sodium Pyruvate (CellGro, 25-000-CI). Supplements were added directly to the RPMI
bottle in sterile conditions followed by bottle-top vacuum filtration (Nalgene, 291-3320)
for sterilization. Media was kept at -4C when not in use. Prior to media addition to cell
culture, media was warmed to 37C in a water bath and swirled. Media transfer was
accomplished in sterile conditions by pouring or with a sterile graduated 5mL, 10mL, or
25mL pipette (Fisherbrand). Media used for cell thawing was supplemented with 20%
FBS.
Cell Culture
Nalm6 (kind gift from Dr. Michael Teitell, UCLA) cell lines were chosen to represent the
pro-B cell stage of B cell development. Ramos human Burkitt’s Lymphoma Blymphocytes cells (ATCC, CRL-1596) were chosen to represent the immature B cell
stage. KNS11 (kind gift from Dr. Michael Teitell, UCLA) cells were chosen to represent
the plasma cell stage. 293T human epithelial kidney cells (ATCC, CRL-11268)were
chosen to represent non-B cell lineage. Cells were fed new media at ~5x107 cells/mL by
addition of media straight to the flask. Every week the cells were centrifuged at 300xg
21
for 5 minutes. The old media was decanted and the pellet was resuspended in fresh warm
media prior to re-seeding. Representative cell counts were taken to ensure normal
growth. Cells were grown in 0.2m Vent Cap 75 cm2 flasks (Corning, 21048) and kept
in a 37C incubator with 5% CO2.
Freezing and Thawing Cells
Cells were preserved at -80C or in liquid nitrogen cryotank cold storage in 90%
dimethyl sulfoxide (DMSO, American Bioanalytical, AB03091-00100) supplemented
with 10% FBS (Omega Scientific, FB-01). About 2x10^6 cells at were centrifuged at
300xg for 5 minutes and the pellet was resuspended in 1 mL of freeze media which was
quickly stored in the -80C freezer. After 48 hours, long-term storage Cryovials were
transferred to the liquid nitrogen cryotank. Cell thawing was accomplished quickly by
first warming 20% FBS-RPMI media to 37C in a waterbath which was then poured into
a new sterile culture flask (Corning, 21048). Frozen cryovials were retrieved and placed
in the 37C waterbath until only a small amount of the cell solution remained frozen.
The cryovial was quickly doused in 70% ethanol and a transfer pipette was used to
transfer the cell solution into the new flask containing warm media. The solution was
then swirled and quickly placed into a 37C incubator containing 5% CO2.
Growth Curves
Cell counts were performed on cells over a three or five day period. Cells were swirled
and a small amount decanted into a sterile Microcentrifuge Tube (Costar, 3620). Next,
10 UL of cells were mixed with 10 UL of 0.4% BioWhittaker Trypan Blue (Lonza, 17-
22
942E) and counted on a Bright-Line Improved Neubauer Hemacytometer (Hausser
Scientific). Cell concentrations were calculated as the average of 5 blocks. Counts were
repeated in triplicate and depicted as a function of time in days.
RNA Isolation
Cells grown with or without the addition of drugs were centrifuged at 300xG for 5
minutes and the media decanted. RNA isolation was performed according to the general
instructions for Animal Cells RNA isolation in the RNeasy Plus Mini Kit (Qiagen,
74134) handbook. Following RNA isolation or to correct DNA contamination as
revealed by RT-PCR, RNA samples underwent DNA digestion using an RNase-Free
DNase Set (Qiagen, 79254). Sample concentrations were quantified using a SmartSpec
Plus Spectrophotometer (Bio Rad, 170-2525).
RT-PCR for Gene Expression
The following primers were designed to amplify a 292 bp region of the 438 bp VpreB
gene transcript: Forward: 5’-CCAGGAACAGGGGGTATTTGAG-3’, reverse: 5’CCAATGGGGATTTACAGCAACAC-3’ [Integrated DNA Technologies, Inc.]. The
following primers were used to amplify a 269 bp region of the 5 gene transcript:
Forward: 5’-CAAGGCTACGCTGGTGTGTCTC-3’, reverse: 5’TCGGGGCTGGGAACCTATGAAC-3’ [Integrated DNA Technologies, Inc.]. The
following primers were used to amplify a 179 bp region of the GapDH control gene
transcript: Forward: 5’-GATGACATCAAGAAGGTGGTG-3’, reverse: 5’GTCATACCAGGAAATGAGCTTG-3’[Integrated DNA Technologies, Inc.]. The
23
Verso 1-Step Reddy Mix RT-PCR kit (Thermo Scientific, AB-1545/A) was employed to
amplify isolated RNA. RNA isolated from cells grown in culture was quantified using a
SmartSpec Plus Spectrophotometer (Bio Rad, 170-2525). An RNA concentration of at
least 20 g/mL was required for subsequent use in RT-PCR reactions. RT-PCR was
performed for either 35 cycles or 25 cycles in a GeneAmp PCR System 9700
thermocycler [Applied Biosystems]. The following program was used for all samples:
hold 1 at 50C for 30 minutes, denature at 94C for 30 seconds, anneal at 59C for 30
seconds, extend 68C for 1.5 minutes, hold 68C for 10 minutes, and keep at 4C
thereafter. RT-PCR controls include a no reverse transcriptase (no RT) containing tube
containing only Taq DNA Polymerase (Fisher Scientific, FB600030) to test for DNA
contamination of isolated RNA, a no template containing tube in which no RNA template
was added to test for DNA or primer contamination of enzyme and buffer stocks.
GapDH was used as a control as this gene is normally expressed in each cell line and so
expression was indicative of normal healthy cells and as a loading control.
Gel Electrophoresis
RT-PCR products were run on a 3% MetaPhor Agarose (Lonza, 50184) 1xTBE gel and
stained with 2g/ml ethidium bromide (EMD Chemicals) for analysis. Forty mamp/130
volts was applied to the samples for 3 hours or until sufficient resolution. A 0-X174 RF
DNA HaeIII ladder (Thermo, AB-0389) was used for size comparison.
24
Re-activation Experiments
To test for the ability of particular epigenetic changes to affect gene expression, cells in
culture were treated with the potential cancer therapeutics 5-Aza-2’-deoxycytidine (5aza)
and Trichostatin A (TSA). Cells were cultured in 10%FBS-RPMI media as previously
described supplemented with either 5aza (Sigma, A3656-5MG) at varying concentrations
(5M, 2.5M, 1M, 0.5M), TSA (Sigma, T8552-5MG) at varying concentrations
(200nM, 100nM, 50nM, 25nM, 15nM, 10nM), or a combination of the two at varying
combinations (400nM 5aza + 50nM TSA, 200nM 5aza + 25nM TSA). Cells were
centrifuged at 300xg for 5 minutes, rinsed with 2 mL 1xPBS, and resuspended in fresh
media every day for 3 days. RNA was extracted as previously described.
Bisulfite Conversion Experiments
Bisulfite conversion was performed using the EZ DNA Methylation-Direct Kit protocol
(Zymo Research, D5020). Briefly, 293T, Nalm6, Ramos cells were pelleted, washed in
1x PBS, and 1x104 cells were re-suspended in 10 L 1 x PBS. Next, 13 L M-Digestion
Buffer, 1 L Proteinase K, and 2 L dH20 was added to the cells and incubated for 20
minutes at 50C. The reaction was centrifuged for 5 minutes at 10,000xg and 20 L of
the supernatant was added to 130 L of CT Conversion Reagent in a (large) PCR tube.
The reaction was placed in a thermocycler (Perkin-Elmer/Cetus) for the following
program: 98C for 8 minutes, 64C for 210 minutes, 4C until used. The sample was
then applied to a column and the DNA bound, washed, desulphonated, and eluted into 10
L in a separate tube.
25
Primer Design for Bisulfite Conversion
Primers were designed by submitting the -1000bp to +1bp region of the VpreB promoter
to MethPrimer (Li LC and Dahiya R. 2002) bisulfite converted primer prediction
software. Predicted primers were then edited by hand. The following primers were
designed to amplify a 544 bp region of the bisulfite converted promoter of the VpreB
gene: Forward: 5’-TATAGGTATATTGGGGGTTAGGGTT-3’, reverse: 5’CCATCCCAAACTTTCTTAAATCTAC-3’. The following primers were used as nested
primers to amplify a 410 bp region of the previous PCR to ensure the region amplified
was indeed the bisulfite converted VpreB promoter: Forward: 5’GGAAGGTATTAGGTTTTGGTGTTTT-3’, reverse: 5’CATCAATTACCAAAACAATATC-3’ (Integrated DNA Technologies, Inc.). PCR
products were size verified by gel electrophoresis.
Cloning and Sequencing Converted DNA
Products from the nested PCR reactions were gel purified according to the QIAquick Gel
Extraction Kit protocol (Qiagen, 28704) and ligated into the TOPO vector according to
the TOPO TA for Sequencing protocol (Invitrogen, now Life Technologies, K4595-01).
Two L of the ligation reaction was used to transform electro-competent One Shot DH5
E. coli by electroporation at 2.5 kVolts. Colonies were grown overnight and the plasmid
was purified according to the Mini Prep protocol (Qiagen, 27104). Samples were
sequenced by Laragen Inc.
26
Results
Nalm6 and Ramos Cells Exhibit Stage-Specific Expression of VpreB
In order to determine whether VpreB expression is under epigenetic control in cell lines,
we first verified that these cells exhibited the appropriate stage-specific expression of
VpreB. Nalm6 and Ramos cell lines were chosen because they represent pre-defined
stages of B cell development (Doerr et al. 2005). As expected, Nalm6 cells representing
the pro-B cell stage of B cell development exhibited strong expression of VpreB by RTPCR (Figure 1 lane 6). Ramos cells, a Burkitt’s lymphoma cell line that represents the
immature stage of B cell development, exhibited no detectable expression of VpreB by
RT-PCR (Figure 2 lane 4). Interestingly, some Ramos populations began so show
expression of VpreB and increased expression of VpreB seemed to correlate with
increased culture time by testing stocks frozen at various passages (Figure 3 lanes 4, 8,
12). No strong correlation could be made between VpreB expression and passage time,
however, as RT-PCR performed on RNA isolated from two stocks frozen the same day
exhibited heterogeneity (Figure 4 lanes 4, 8). Only Ramos cells that showed no
detectable levels of VpreB expression by gel electrophoresis after 25 cycles of RT-PCR
were used for the remainder of this study (Figure 5 lane 5).
The gene 5, reported to be activated and silenced coordinately with VpreB as
these genes help compose the pre-B cell receptor, was also tested for stage-specific
expression (Zhang et al. 2004). Unlike VpreB, 5 exhibited strong expression in both
Nalm6 and Ramos cells (Figure 1, 5). We decided to test this gene alongside that of
27
VpreB in other experiments as an internal control for gene expression. Because
epigenetic factors can often impose varying levels of control, we hoped to see some
degree of methylation still present on the 5 promoter however the extent of methylation
should be far less than for the VpreB promoter as the gene is still expressed. We are
testing the hypothesize that 5 re-expression occurred after oncogenic transformation of
the Ramos cell line because 5 is reported to be silenced at the immature B cell stage of
B cell development at the same time as VpreB. Glyceraldehyde 3-posphate
dehydrogenase (GAPDH) expression served as a positive control for gene expression as
this ‘house-keeping’ gene should be expressed at high levels in all the cell types used
(Doerr et al., 2005). We observed similar levels of GAPDH expression in each cell type
tested validating the consistency of our RT-PCR experiment (Figure 1 through 5).
Possible Reactivation of VpreB by Inhibition of Epigenetic Silencers
We adapted previously described reactivation experiments to first test if VpreB was
silenced by epigenetic factors in the pro-B cell to immature B cell transition (Doerr et al.,
2005). Treating cells with compounds that inhibit the action of epigenetic mechanisms
will prevent the effect of epigenetic mechanisms in daughter cells. In this manner, genes
that were silenced in a particular cell line population by particular epigenetic mechanisms
can be expressed once again. Because the inhibitors are purported to act on specific
enzyme classes, the mode of silencing of a re-activated gene can be inferred. Here, 5azacytidine (5aza) was used to prevent DNA methylation by DNA Nucleotide
Methyltransferases (DNMT) and Trichostatin A (TSA) was used to prevent deacetylation of histones by Histone Deacetylaces (HDACs). We predicted that VpreB
28
would be re-activated in VpreB silent Ramos immature B cells when treated with 5aza
and TSA because cells treated with these compounds should no longer have the ability to
methylate DNA nor deacetylate histones, respectively. Successful reactivation of VpreB
mRNA with 5aza or TSA would imply that the epigenetic mechanisms DNA methylation
and histone deactylation are what silenced VpreB gene expression in the Ramos cells
line.
The widespread reactivation of genes can have a profoundly negative effect on a
cell leading to cell death. However, a population of cells needs to be treated with the
epigenetic inhibiting drug long enough for the drug to exert its effect on the whole
population. We adopted a previously described protocol for our gene reactivation
experiments (Doerr et al. 2005). First, a Kill Curve was constructed for both 5aza and
TSA in order to determine the optimal time of drug treatment where cells are not dead,
but the drug concentration is high enough to be effective. Doerr et al. successfully
reactivated epigenetically controlled genes using 2.5 M 5aza and 50 nmol TSA. We
tested a range of concentrations above and below their values. In this experiment, 5 x 106
cells in separate flasks were grown in media supplemented with 5 M, 2.5 M, 1 M, 0.5
M 5aza or 200 nM, 100 nM, 50 nM, 25 nM, 15 nM, 10 nM TSA. Cells were pelleted,
washed, and re-suspended in fresh media containing each drug concentration daily. For
the 5aza treatment, cells showed a sharp decrease in viability for each concentration
tested after 1 day in culture (Figure 6). After 48 hours, the 5 M treatment showed
another decrease in viability whereas the other treatments remained about the same.
After 72 hours, each treatment exhibited a significant decrease in viability and after 96
29
hours cell numbers were too low to count. Based on this data, 72 hours post treatment
was determined to be the optimum time of treatment.
For the TSA treatment, a decrease in cell viability correlated with an increase in
drug concentration although the 10 nM concentration had no noticeable effect (Figure 7).
After 48 hours, only the 200 nM, 100 nM, and 50 nM treatments showed sharp decreases
in viability. At 72 hours, the 25 nM, 15 nM, and 10 nM treatments exhibited high
viability whereas the 200 nM and 100 nM treatments had nearly zero cells. 72 hours post
treatment was determined to be the optimum treatment time and 50 nM was determined
to be the optimum concentration of drug.
After treatment, RNA was isolated and RT-PCR was performed to test for VpreB
gene expression. GAPDH gene expression was used as a positive control as expression of
this gene should remain unchanged. Initial tests showed gene expression of VpreB in
cells that had tested negative for VpreB gene expression indicating re-activation when
treated with 5aza. GAPDH control expression was detected as expected in these cells.
Greater expression of VpreB gene expression seemed to result from treatment with the
lower concentration of drug (0.5 M, 1 M), however, RNA isolated from these flasks
may have contained some DNA contamination (Figure 8).
Results from the TSA treated cells indicated re-activation of VpreB gene
expression, which correlated with the results from the 5aza treatment (Figure 9). The
experiment was repeated for three biological replicates. Interestingly, we observed some
gene expression of VpreB in the 0 M control cells and little to no change in expression
in the treated cells for each repeat (Figure 10, 11). Experiments were performed in which
various concentrations of 5aza and TSA were added in combination that resulted in
30
widespread cell death. Reactivation of VpreB gene expression by treatment of drugs that
inhibit epigenetic mechanisms may have occurred but this result could not be repeated.
Bisulphite Sequencing of Nalm6 and Ramos Cells
In order to further examine the role of epigenetic mechanisms in silencing VpreB we
used Bisulphite Sequencing to examine the methylation state of the VpreB promoter.
Greater promoter methylation was shown to be correlated with diminished gene
expression as this process is used by cells to silence and permanently extinguish a gene
(Doerr et al. 2005). Treatment of DNA with bisulphite results in the replacement of
unmethylated cytidines with uracils. A PCR product of the promoter region will have a
thymidine where an unmethylated cytidine once stood. By comparing the sequencing
results of a particular DNA region before and after bisulphite treatment, the methylation
state of the promoter can be deduced as methylated cytidines will remain as cytidines.
We compared converted sequences of the VpreB promoter between Nalm6 (pro-B
cell, VpreB expression high) (Figure 12) and Ramos (immature B cell, VpreB expression
silenced) cell lines. The VpreB promoter region contains 5 CpG sites in the -553 bp to 143 bp region upstream of the VpreB transcription start site that serve as possible targets
for methylation. We predicted that the VpreB promoter isolated from the Ramos cells
would contain more methylated cytidines than the VpreB promoter isolated from the
Nalm6 cells. 293T human embryonic kidney cells were used as a positive control for
promoter methylation as these cells do not express the B cell specific VpreB gene or any
other B cell specific gene and should exhibit extensive methylation of the VpreB
promoter as has been shown for other B cell specific genes (not published).
31
We performed a nested PCR reaction on the PCR product obtained after bisulfite
conversion of 293T, Nalm6, and Ramos DNA to ensure we had the VpreB promoter
(Figure 13, 14). Bands of the appropriate size were gel extracted and cloned into the
TOPO TA vector. We were able to successfully perform the bisulfite conversion and
clone the 410 base pair region of the VpreB promoter into the TOPO TA vector on
samples from 293T, Ramos, and Nalm6 cells (Figure 15, 16).
Consistent with a permissive transcriptional state, no methylation of CpG
dinucleosides was detected in the VpreB promoter of Nalm6 cells. Successful conversion
of nearly every CpG within the VpreB promoter of Nalm6 cells was detected by
sequencing of bisulfite converted DNA (Figure 17). Sequencing of bisulfite converted
DNA from Ramos and 293T cells is currently underway.
32
Figure 1
Expression of VpreB and 5 in Nalm6 cells representing the pro-B cell stage. Cells
were grown in culture and RT-PCR was performed on isolated RNA after DNase
treatment. Lane 1: GapDH loading control (179 bp), Lane 2: No reverse transcriptase
control indicates no DNA contamination of GapDH sample, Lane 3: No RNA control
indicates no contamination of PCR mix, Lane 4: water, Lane 5: Expression of 5 (269
bp), Lane 6: Expression of VpreB (292 bp), Lane 7: No reverse transcriptase control
indicates no DNA contamination of VpreB sample, Lane 8: No RNA control indicates no
contamination of PCR mix, Lane 9: water, Lane 10: HaeIII Phix Ladder.
33
Figure 2
Expression of 5 and no expression of VpreB detected in Ramos cells representing
the immature B cell stage. Cells were grown in culture and RT-PCR was performed on
isolated RNA after DNase treatment. Lane 1: HaeIII Phix Ladder, Lane 2: Water, Lane
3: GapDH loading control (179 bp), Lane 4: No expression of VpreB detected (292 bp),
Lane 5: No reverse transcriptase control indicates no DNA contamination of GapDH
sample, Lane 6: No RNA control indicates no contamination of PCR mixPCR mix.
34
Figure 3
VpreB expression is found in Ramos stocks. Cells were grown in culture and RT-PCR
was performed on isolated RNA after DNase treatment. Lane 1: HaeIII Phix Ladder,
Lane 2: blank, Lane 3-6: RNA from Ramos stocks frozen 12/28/10, Lane 3: GapDH
loading control (179 bp), Lane 4: Expression of VpreB detected (292 bp), Lane 5: No
reverse transcriptase control indicates no DNA contamination of VpreB sample, Lane 6:
No RNA control indicates no contamination of PCR mix. . Lane 7-10: RNA from
Ramos stocks frozen 07/16/10: Lane 8: Expression of VpreB detected, Lane 11-14: RNA
from Ramos stocks frozen 03/08/10, Lane 12: No expression of VpreB detected.
35
Figure 4
VpreB is expressed in some Ramos populations. . Cells were grown in culture and
RT-PCR was performed on isolated RNA after DNase treatment. Lane 1: HaeIII Phix
Ladder, Lane 2: blank, Lane 3-6: RNA from Ramos stocks frozen 03/08/10, Lane 3:
GapDH loading control (179 bp), Lane 4: Expression of VpreB detected (292 bp), Lane
5: No reverse transcriptase control indicates no DNA contamination of VpreB sample,
Lane 6: No RNA control indicates no contamination of PCR mix. Lane 7-10: RNA from
Ramos stocks frozen 03/08/10: Lane 8: No expression of VpreB detected, Lane 11-14:
RNA from Ramos stocks frozen 07/16/10, Lane 12: Expression of VpreB detected.
36
Figure 5
VpreB expression analyzed on new Ramos stocks. Lane 1: HaeIII Phix Ladder, Lane
2: Water, Lane 3: GapDH loading control (179 bp), Lane 4: Expression of 5 (269 bp),
Lane 5: No expression of VpreB detected (292 bp), Lane 6: No reverse transcriptase
control indicates no DNA contamination of GapDH sample, Lane 7: No RNA control
indicates no contamination of PCR mix.
37
Figure 6
Rates of cell death induced by culture with 5aza. Ramos cells were grown in media
supplemented with 5aza and cell counts were performed by Trypan Blue exclusion
staining on a hemocytometer. : 0.5 ΜM 5aza, : 1 ΜM 5aza, : 2.5 ΜM 5aza, : 5
ΜM 5aza.
38
Figure 7
Rates of cell death induced by culture with TSA. Ramos cells were grown in media
supplemented with TSA and cell counts were performed by Trypan Blue exclusion
staining on a hemocytometer. : 10 nM TSA, : 15 nM TSA, : 25 nM TSA, : 50
nM TSA, : 100 nM TSA, : 200 nM TSA.
39
Figure 8
Possible reactivation of VpreB by culture with 5aza. Ramos cells were grown in
media supplemented with 5aza. RT-PCR was performed on RNA after DNase treatment.
Lane 1: HaeIII Phix ladder, Lane 2-5: 5 M 5aza, Lane 6-9: 2.5 M 5aza, Lane 10:
Blank, Lane 11-14: 1 M 5aza, Lane 15-19: 0.5 M 5aza. Lanes 4 and 8 indicate reexpression of VpreB. Lanes 12 and 16 indicate DNA contamination of RNA from the 1
M and 0.5 M treatments however a stronger band is observed in Lanes 13 and 17,
respectively, indicating re-expression of VpreB.
40
Figure 9
Possible reactivation of VpreB by culture with TSA. Ramos cells were grown in
media supplemented with TSA. RT-PCR was performed on RNA after DNase treatment.
Lane 1: HaeIII Phix ladder, Lane 2-5: 50 nM TSA, Lane 6-9: 25 nM TSA, Lane 10-13:
15 nM TSA. Lanes 12 indicates re-expression of VpreB in the 15 nM TSA treatment.
Lane 11 indicates possible DNA contamination of sample. Lane 13 indicates high
expression of 5 after treatment.
41
Figure 10
Possible up-regulation of VpreB after TSA treatment. Cells were grown in media
supplemented with TSA and RT-PCR was performed on extracted RNA after DNase
treatment. Lane 1: HaeIII Phix ladder, Lane 2: Blank, Lane 3-6: 0 nM control, Lane 710: 15 nM TSA. VpreB expression appears more intense after TSA treatment (Lane 9)
than without treatment (Lane 5) however some of this could be due to DNA
contamination of sample (Lane 8).
42
Figure 11
Changes in VpreB expression after culture with TSA. Cells were grown in media
supplemented with TSA and RT-PCR was performed on extracted RNA after DNase
treatment. Lane 1: HaeIII Phix Ladder, Lane 2-5: 0 nM control, Lane 6-9: 15 nM TSA,
Lane 11-13: 25 nM TSA. Lane 4 indicates expression of VpreB before TSA treatmet.
This expression was not detected after treatment (Lane 8, 12.)
Figure 3
43
Figure 12
-1000bp to +1bp of the VpreB promoter. Red high light: transcription start site, yellow
high light: CpG site, Red arrow and underline: location of forward and reverse PCR
primers. Blue arrow and underline: location of forward and reverse nested PCR primers.
44
Figure 13
Successful nested PCR amplification of the VpreB promoter from bisulfite
converted genomic DNA. Lane 1: HaeIII Phix ladder, Lane 2: blank, Lane 3-4: 293T
DNA, Lane 5-6: Nalm6 DNA, Lane 7-8: Ramos DNA. Bands of 410 bp from lanes 5-8
were excised and extracted for another round of nested PCR.
Figure 14
45
Successful nested PCR amplification of bisulfite converted DNA from Nalm6 and
Ramos cells. Lane 1: HaeIII Phix ladder, Lane 2-3: Nalm6, lane 4-5: Ramos. Bands of
410 bp were excised and extracted to clone for sequencing.
46
Figure 15
Successful nested PCR amplification of bisulfite converted DNA. Lane 1: HaeIII Phix
ladder, Lane 2: Blank, Lane 3-5: 293T, Lane 6: Blank, Lane 7-9: Nalm6, Lane 10: Blank,
Lane 11-13: Ramos. Bands of 410 bp were excised for gel purification (Lane 4, 8, 11,
12, 13).
47
Figure 16
Successful nested PCR amplification of bisulfite converted DNA. Lane 1: HaeIII Phix
ladder, Lane 2-4: 293T, Lane 5-7: Nalm6, Lane 8-10: Ramos. Bands of 410 bp were
excised for gel purification (Lane 4, 8, 11, 12, 13).
48
Figure 17
Amplified region of the VpreB promoter CpG island. Purple high light: C converted
to T in at a CpG dinucleoside. Red high light: ambiguous sequenceing in a CpG
dinucleoside. Successful conversion of C to T at 5 CpG dinucleosides indicates these
sites are not methylated.
49
Discussion
Our observations from gene reactivation experiments and bisulfite sequencing
experiments indicate that the pre-B cell specific gene, VpreB (a pre-B cell receptor gene),
may be silenced by epigenetic mechanisms in the Ramos immature B cell line. Though
epigenetic mechanisms such as DNA methylation and histone deacetylation are well
characterized to silence genes in the developing human embryo, and epigenetics are
known to keep a gene permanently silenced in the adult human, not much is known about
the role these mechanisms play to actively silence genes in adult human cells (Sharma et
al. 2010). The developing B cell respresents a unique model to study the role of DNA
methylation and histone deactylation in gene silencing. In the adult, unlike ‘normal’ cells
such as in the skin, the B cell must complete a full round of differentiation beginning
with the hematopoietic stem cell in the bone marrow all the way to the activated antibody
producing plasma cell (Zhang et al. 2004). In normal cells, silenced genes are kept
silenced by epigenetic mechanisms and these particular epigenetic silencing marks are
passed to the daughter cell after replication (Sharma et al. 2010). In the developing B
cell, however, the stage-specific expression of genes occurs in which expression of a
gene is required for maintenance of, or progression through, a particular developmental
stage. This gene can then be silenced for maturation and kept silenced for the rest of the
B cell’s existence. VpreB fits the model of stage-specific gene expression to study the
role that epigenetic mechanisms play in stage-specific silencing of genes in the
developing B cell because VpreB is expressed in the pre-B cell stage of development yet
silenced and kept silenced thereafter. Our observations indicate that the epigenetic
50
mechanisms DNA methylation and histone deacetylation may be silencing VpreB after
the pre-B cell stage as they do in the developing embryo, and these epigenetic
mechanisms may act to keep VpreB silenced as they do for many genes in the adult
human. Furthermore, our observations support the notion that epigenetic mechanisms, as
in the developing embryo, can be employed by cells in the adult human to silence stagespecific genes during the development of the B cell.
The Ramos cell line exhibits a permanent blockade in development at the
immature B cell stage of B cell development based on surface markers and B cell
receptor (BCR, immunoglobulin) expression (Benjamin et al. 1982). This makes the
Ramos cell line a good model to represent the immature B cell stage as the genes we are
interested in studying are appropriately expressed compared to primary B cell gene
expression. Similarly, the pre-B cell line, Nalm6, serves as a good model for the pre-B
cell stage of B cell development as these cells do not progress beyond expressing the preB cell receptor and do not express the BCR (immunoglobulin) (Hurwitz et al., 1979). We
expect the transcriptional control mechanisms that permit expression of VpreB in Nalm6
and extinguish VpreB in Ramos cells are maintained as in primary B cells of the
corresponding developmental stage.
Using 5aza (inhibitor of DNA methylation) and TSA (inhibitor of histone
deacetylation), that causes the reactivation of genes silenced by DNA methylation and
histone deacytlation, we were able to successfully increase the expression of VpreB
RNA. The re-activation we observed of VpreB by both 5aza and TSA indicates that the
VpreB promoter is not totally methylated but rather methylated to a lesser extent. This is
because DNA methylation and associated chromatin changes occur in varying degrees
51
where re-activation by TSA correlates with less densely methylated DNA and because
DNA methylation is a more permanent epigenetic silencing mechanism than histone
deacetylation (Doerr et al. 2005, Cameron et al. 1999). We expected reactivation by both
5aza and TSA in the Ramos cell line as these cells have not progressed through
development very distantly from the initial silencing event. Promoter methylation is a
progressive process, ultimately leading to the stable and permanent silencing of a gene in
part by widespread methylation of CpG dinucleotides (Bird, 2002). If the VpreB gene is
in fact silenced by methylation of the promoter at the immature B cell stage of B cell
development, then we expect more extensive methylation of the promoter region in more
developmentally mature cells. Therefore, reactivation by TSA is a good indicator that
methylation of the promoter region is recent in regards to the developmental timeline and
supports the notion that methylation is used to silence VpreB (Cameron et al. 1999). This
also lends support to the Ramos cells used in this study as being of the immature B cell
stage.
Further experiments and troubleshooting need to be performed to optimize the
reactivation experiments as these results were not able to be repeated due to the
spontaneous reactivation of VpreB in our frozen stocks. Additional reactivation
experiments using newly purchased immature B cell lines from ATCC will be necessary
to confirm our results. Reactivation by treatment with the DNA methylation inhibitor
5aza and histone deactylase inhibitor TSA is not targeted to any particular gene,
including VpreB, so it is possible that the DNA methylation and histone deacetylation
that we propose act to silence VpreB simply was not affected by treatment in the second
and third replicates. To fix this issue, treatment can be maintained for longer than three
52
days and the concentration of each drug can be increased. 5aza and TSA stocks were
prepared as described by the manufacturer (Sigma-Aldrich) so we don’t believe
degradation of the drugs had occurred. Because inhibition of both DNA methylation and
histone deactylation is widespread, it is possible that we re-activated a transcription factor
that acts as a repressor for VpreB or induced some other event that could cause silencing
of VpreB. It has been shown that TSA treatment of human lung fibroblast 2BS cells
results in the reactivation of the transcription factor HBP1 that is a transcriptional
repressor for many genes involved with oncogenic pathways (Wang et al. 2010).
Reactivation experiments are a good starting point to test epigenetic control of a gene
however the re-expresion of a gene is only correlated with the presence of the drug. Any
reactivation results should be corroborated by more precise molecular analysis of the
gene region considered. If 5aza treatment was shown to reactivate a gene, bisfulfite
treatment can then be used to determine the methylation status of CpG dinucleotides
within the promoter. If TSA treatment was shown to reactivate a gene, ChIP can be then
be used to determine the acetylation status of histones important to packaging of the gene
of interest. Together, this data will more strongly support the notion that the presence of
the DNA methylation or histone deacetylation epigenetic marks is causative of gene
silencing.
We do not expect VpreB reactivation by TSA to work in more developmentally
mature cells of the B cell lineage because DNA methylation of silenced gene promoters is
shown to increase during development leading to hypermethylation. In their paper,
Cameron et al. observed that the genes MLH1 and TIMP3 that are hypermethylated in
colorectal cancer could not be reactivated using TSA treatment alone in the colorectal
53
cancer cell line RKO. They were able, however, to upregulate MLH1 and TIMP3 using
TSA after first treating the cells with 5aza to initiate reactivation by first inhibiting DNA
methylation (Cameron et al. 1999). The cell line KMS11 would serve well for our study
to test for hypermethylation of the VpreB promoter later along the developmental
timeline as this cell line represents the plasma cell stage of B cell development (Namba et
al., 1989). We predict that KMS11 cells exhibit extensive hypermethylation of the
VpreB promoter region and that VpreB expression cannot be detected. Also, because
methylation is predicted to be extensive in these cells, treatment with TSA that only
inhibits deacetylation should not have the effect of reactivating VpreB however treatment
with 5aza should still reactivate VpreB as 5aza inhibits the more permanent process of
DNA methylation (Cameron et al. 1999, Doerr et al. 2005). Furthermore, priming the
reactivation of VpreB by first treating with 5aza should allow for us to test if TSA
treatment can upregulate VpreB expression to test if histone deactylation is implicated in
the silencing of VpreB. As epigenetic mechanisms tend to work in concert and consistent
with our observation that TSA treatment can affect expression of VpreB in the Ramos
cells (pre-B cells), we predict that histone deacetylation is also implicated in silencing of
VpreB in the KMS11 plasma cell cell line (Li and Reinberg 2007).
We observed some effects on VpreB expression after treatment with TSA,
although not always to up-regulate VpreB as we had predicted. Generally, histone
acetylation is correlated with permitting gene expression and de-acetylation with
silencing gene expression, but this is not always the case. It has been proposed that
histone deacetylation is needed for allowing gene expression (Shahbazian and Grunstein,
2007). For example, in yeast the removal of the Hos2 deacetylase results in
54
hyperacetylation of histones H3 and H4 in active regions of the chromosome creating
problems for transcription as histone/DNA interactions are interrupted. Furthermore,
treatment of yeast for only 15 minutes with the histone deactylase inhibitor used in this
study (TSA) can result in the downregulation of several genes (Bernstein et al. 2000). In
addition, whether a deacetylase acts to activate or repress transcription can depend on the
multiprotein complex that contains the deacetylase (Shahbazian and Grunstein, 2007).
For example, the deactylase Rpd3 that can deactylate all four histone components has
been shown to have both activating and repressing capabilities depending on the protein
complex it is embedded in (Carroza et al. 2005). It has been shown that transcriptionally
active regions are associated with rapid histone acetylation turnover in which acetylation
is not maintained but rather is constantly occurring coupled with deactylation. Inhibition
of deactylation in this case can result in the slower turnover of acetylated histones that
does not promote transcriptional activity (Waterborg 2002).
The hypothesis that acetylation of histones is acting to silence a gene fits our
observation that some TSA treatments resulted in VpreB expression below that of the no
treatment control cells. In these cases, GAPDH loading control expression could still be
detected at normal levels when compared to the control (Figure 3E). Epigenetic
mechanisms then, although by a manner we did not anticipate, would still be the mode
through which the developing B cell silences VpreB during development. The
hypothesis that histone acetylation is working to silence VpreB after the pre-B cell stage
of development can be tested by Chromatin Immuno Precipitation (ChIP) analysis (Chen
et al., 1999). Silencing of VpreB via aceytlation would be supported if hyperacetylation
of the histones surrounding VpreB region is detected. This would represent a novel and
55
interesting discovery as acetylation is accepted to promote gene expression in
mammalian cells (Eberharter and Becker 2002, Verdone et al. 2005).
The effect of 5aza on gene reactivation was expected to be dose dependent as
increasing concentrations of 5aza treatments diminish the presence of DNMTs, the
enzymes responsible for methylation of CpG dinucleotides (Palii et al., 2008). We did
not see a dose dependence using either 5aza or TSA. A simple explanation for this
observation is that higher concentrations of the epigenetic altering drugs may have caused
more widespread damage to chromatin stability or widespread gene activation that
resulted in confounding cellular phenomena. One way to circumvent the possibility of
imposing too many negative effects from increasing drug concentration is to treat the
cells with both 5aza and TSA in combination. The effect of gene reactivation should be
additive if both promoter methylaton and histone deacetylation are employed by the
Ramos cell line to silence VpreB. Once again, a kill curve should be constructed in order
to determine the optimal concentration of both drugs used for treatment, as together they
are more likely to kill cells than alone. In their paper, Malone et al. used the same
concentrations of 5aza and TSA separately and in combination however Cameron et al.
used less 5aza and TSA for their combination experiments. Furthermore, Cameron et al.
used different combinations of 5aza and TSA for each cell line tested varying up to ten
fold. Because DNA methylation is more permanent, they first treated their cells with the
DNA methylation inhibitor 5aza for 24 hours before the addition of the deacetylation
inhibitor TSA as TSA generally can only upregulate a gene rather than completely
reverse the silencing event. (Malone et al. 2001, Cameron et al. 1999).
56
We observed conversion of nearly all cytosines to thymidines in the promoter
region of VpreB after bisulfite treatment as evidenced by sequencing indicating that
conversion was successful. Consistent with our hypothesis that DNA methylation can act
to silence VpreB in immature B cells, we observed that cytosines within CpG
dinucleotides were converted to thymidines in Nalm 6 cells (pro-B cell, VpreB
expression high). In their paper, Doerr et al. collected data on ten separate samples for
each promoter region and cell type to determine the methylation status of CpG
dinucleotides in a single promoter because bisulfite conversion is not always complete
and DNA can be degraded from the harsh process of bisulfite treatment (Feil et al. 1994).
For the VpreB promoter region, we have successfully amplified seven samples of DNA
that have undergone bisulfite conversion treatment from Ramos cells, six samples from
Nalm6 cells, and two samples from 293T cells (positive control for promoter
methylation). Because the primers used here are complementary only to the bisulfite
converted DNA and not the normal genomic DNA, then only successfully converted
DNA should be amplified by PCR. Because we observed successful amplification of
bisulfite converted DNA, we expect that these replicates all contain successfully
converted DNA.
In the bisulfite converted VpreB promoter from Nalm6 cells that we were able to
sequence, the majority of cytosines were converted to thymidines including those
contained in CpG dinucleotides further indicating that bisulfite conversion was
successful. We predict that the cytosines in CpG dinucleotides of the Ramos promoter
will not be converted to thymidines indicating DNA methylation at these sites. We do
not expect to see conversion of cytosines to thymidines in the 293T promoter after
57
bisulfite sequencing as these cells do not normally express the B cell specific VpreB and
should have VpreB permanently extinguished with extensive DNA methylation in the
promoter region (not published).
The 410 bp region of the VpreB promoter that we chose to investigate serves as a
good starting point to evaluate DNA methylation of the VpreB promoter. It has been
shown that sequences in this region serve as targets for the B cell specific transcription
factors Early B cell Factor (EBF) and E47, an E2A isoform, that act as transcriptional
activators for VpreB in human cells (Gisler and Sigvardsson, 2002). EBF is reported to
be important in regulating stages of early B cell differentiation and is expressed in pro B,
pre B, and B cells yet is not expressed in plasma cells (Sigvardsson et al., 1997). This
transcription factor plays many roles in the developing B cell and can target several
genes. Our observation of possible DNA methylation in the promoter of VpreB could
serve as the mechanism by which the transcription factors EBF and E47 are inhibited
from activating VpreB in the immature B cell stage of development even though these
transcription factors are still expressed. Thus, DNA methylation would stop EBF and
E47 from activating VpreB while not hindering the action of these transcription factors
on other genes. In their paper, Malone et al. observed that CpG methylation in the
promoter region of the B cell specific gene B29 completely abolished binding of EBF to
the EBF binding site in this promoter indicating that methylation alone was sufficient to
block transcription factor binding (Malone et al. 2001). It would be interesting to test if
DNA methylation can directly inhibit EBF binding to the VpreB promoter and if this
interaction is sufficient to change VpreB expression.
58
VpreB is down regulated after initiation of the pre-B cell receptor at the B cell
surface. This is a necessary step as clonal expansion is induced. Interestingly, initiation
of the pre-B cell receptor down regulates the genes that encode its own surrogate light
chain subunits VpreB and 5 (Hauser et al. 2010). The Ikaros family of transcription
factors establish a possible link between pre-B cell receptor signaling and VpreB
silencing by epigenetic mechanisms. Ikaros is critical for both normal immune and
endocrine development and has been implicated extensively in chromatin remodeling
acting as activators but also as repressors by recruiting genes to heterochromatin
(Sabbatini et al. 2001, Zhu et al. 2007). In their paper, Thomspon et al. observed control
of the Ikaros family protein Aiolos by the pre-B cell receptor thorugh the linker SLP-65
(Thompson et al. 2007). Within the 5 promoter, an Ikaros binding site overlaps an EBF
site that is crucial to 5 gene expression (Sabbatini et al. 2001). In this scenario,
initiation of the pre-B cell receptor may recruit Ikaros, through SLP-65, to the 5
promoter preventing binding of EBF and altering chromatin structure. Furthermore,
Ikaros has been shown to interact with the NuRD histone deaceytlase complex further
implicating Ikaros with epigenetic changes (Thompson et al. 2007). Because Ikaros
isoforms have been shown to bind the VpreB promoter, pre-B cell receptor signaling may
result in Ikaros receruitment to the VpreB promoter (Hahm et al. 1994). The presence of
this transcription factor would be more permissive of the heterochromatic state by either
directly interacting with histone modifying enzymes or maintenance of heterochromatin
already initiated by DNA methylation. The role of Ikaros in the stage specific silencing
of 5 has been well documented yet the role that Ikaros plays in the epigenetic control of
VpreB is not well defined.
59
Methylation can occur at different locations preferred by the cell for gene
silencing. It has been shown that in CpG islands, methylation can begin both upstream
and downstream of the CpG island center and move inward (Graff et al. 1997). For
example, Doerr et al. observed dense methylation of CpGs in the 5’ and 3’ flanking
regions of the B29 and TCL1 promoter’s CpG island but centrally located CpGs were
either minimally methylated or not methylated at all (Doerr et al. 2005). We would
expect the 410 bp region of the VpreB promoter that we chose to be methylated for
silencing as this region is located relatively downstream of the CpG island center in the
VpreB promoter. Still, other regions of the VpreB promoter should be investigated for
methylation status in the Ramos, Nalm6, and 293T cell lines in addition to the region we
amplified.
Because aberrant methylation of CpG dinucleotides can occur in cancer cells and
cells in culture, the results we observed need to be repeated in primary cells. For
example, Esteller et al. found hypermethylation of the promoter for the MGMT gene in
15 of 62 non-Hodgkins’ lympoma cells tested and found that aberrant methylation was
more common in aggressive/high-grade lymphomas (Esteller et al. 1999). Because
Ramos are non-Hodgkins type lymphoma cells (Burkitt’s Lymphoma), aberrant
methylation is a possible source for our observations. In support of our model, Doerr et
al. found no aberrant methylation of the B29 or TCL-1 promoter in Ramos cells. This
supports the view that the methylation we saw was of developmental origin and not due
to the cancerous phenotype or a result of time in culture (Doerr et al. 2005).
We observed changes in gene expression induced by the epigenetic modifiers
5aza and TSA and methylation of the VpreB promoter region by bisulfite sequencing.
60
We conclude that epigenetic changes can be observed in the Ramos cell line and that
these changes may be responsible for silencing VpreB. Because the Ramos cells are
permanently blocked at the immature B cell stage of development, the characteristics we
observed may replicate the molecular events that occur in normal development. Further
testing is needed and validation in primary B cells is required. Our observations are
consistent with literature regarding gene silencing after pre-B cell receptor initiation.
These findings are novel as direct silencing of genes during normal adult development of
the hematopoietic lineage has not been well documented as it has for lineages that
employ these mechanisms in the embryo.
61
Chapter 2: Specificity of dCK TM for L-FMAU:
A new reporter gene for positron emission tomography
Introduction
Function of dCK in the Cell
Deoxycytidine kinase (dCK) has elicited much interest recently because of the
roll nucleotide salvage plays in cell proliferation and because dCK activates a number of
anti-viral (3TC, ddC) and anti-cancer (gemcitibine, AraC) nucleoside analog prodrugs
(McSorley et al. 2008, Hapke et al. 1996). Prodrugs, including AraC, are inactive when
administered and thus are dependent on metabolism in vivo for activation. dCK is a
phosphotransferase that catalyzes the phosphorylation of 2’-deoxyribonucleosides to their
corresponding monophosphates. This reaction is the first step in the nucleotide salvage
pathway that provides an alternative source of nucleotides for DNA synthesis and repair
(Arner and Eriksson 1995). We explore the remarkable effects of single point mutations
within the active site of dCK and the crucial role of the amino acid residues 100, 104, and
133 on substrate specificity towards non-natural thymidine analogs. Specificity was
tested using several deoxyribonucleosides and the nucleoside analogs L-FMAU and
FEAU. These analogs can serve as probes for in vivo imaging using positron emissiong
tomography (PET). We propose dCK triple mutant (dCK TM: A100V, R104M, D133A)
is a superior enzyme for the phosphorylation of L-FMAU, with greater substrate
specificity, compared to dCK double mutant (dCK DM: R104M, D133A).
Generally, nucleotides are supplied to the cell via the de novo nucleotide synthesis
pathway (Figure 1). Purines and pyrimidines are built from readily available materials
62
within the cell. These compounds provide a source of energy for the cell, are used as
cofactors in reactions, and provide the building blocks for DNA and RNA synthesis. The
committed step for a ribonucleotide to be used for DNA synthesis in the de novo pathway
occurs when the enzyme ribonucleotide reductase (RNR) reduces a ribonucleotide
diphosphate to a deoxyribonucleotide diphosphate by removing the 2’-hydroxyl. Pools of
the four deoxyribonucleosides thymidine, deoxycytidine, deoxyguanidine, and
deoxyadenine are maintained within the cell for use in genome replication and DNA
repair (Toy et al. 2010).
Nucleotide salvage provides an alternative source of deoxyribonucleosides by
allowing extracellular deoxyribonucleosides to be recycled when intracellular pools may
not be enough to sustain events such as genome replication during stages of rapid
proliferation (Figure 1). Exogenous deoxyribonucleosides are provided to the
extracellular environment from the break down of polynucleotides left over from dead
cells. These free nucleosides can be brought into the cell via a concentrative nucleoside
transporter (CNT) or an equilibrative nucleoside tranporter (ENT) and are trapped within
the cell by subsequent phosphorylation (Kong et al. 2004). Several deoxyribonucleoside
kinases are expressed in human cells (dCK, TK1, dGK, etc.). dCK is the most
promiscuous deoxyribonucleoside in humans and can phosphorylate and trap
deoxycytosine, deoxyadenosine, and deoxyguanosine after transport across the membrane
(Sabini et al. 2003, Toy et al. 2010).
Altering dCK’s Substrate Specificity
63
Because dCK is crucial to activation of certain nucleoside analog
chemotherapeutic prodrugs, several studies have attempted to create functional mutants
of dCK with the intent to broaden the dCK’s specificity and facilitate improved activation
of prodrugs (Sabini et al. 2003, Iyodigan and Lutz. 2008, Neschadim et al. 2008, Hazra et
al. 2009, Likar et al. 2010). Rational manipulation of the structure of dCK was made
possible after crystallization of dCK binding to deoxycytidine and the prodrugs AraC and
gemcitibine (Figure 2). dCK contains 260 amino acids with a predicted molecular weight
of about 30.4 kDa. The dCK monomer contains ten -helices surrounding a fivestranded parellel -sheet core. These -helices provide an interface for dCK to form the
homodimers of which dCK is reported to normally form in the cell. Motifs within the
active site of dCK that are crucial to it’s function include a P-loop motif at residues
Gly28-Ser35 that facilitates positioning of phosphate groups from the phosphate donor
ATP, an ERS motif at Glu127, Arg128, and Ser129 that interacts with magnesium and
facilitates substrate binding, and a LID region spanning residues Arg188 to Asn195 that
aids binding of ATP for catalysis and contain three arginine residues that stabilize the
ATP/ADP transition state (Sabini et al. 2003) (Figure 2). Thymidine kinase 1(TK1), the
enzyme responsible for phosphorylation of thymidine after transport, is only expressed in
the S-phase, however dCK is expressed throughout the cell cycle and can be up regulated
for stages of high-proliferation (Arner and Eriksson 1995). Post-translational events such
as phosphorylation of Ser74 have been shown to be important for regulating dCK
activity, however, the enzymes responsible for this step are yet to be identified (McSorley
et al. 2008).
64
Introducing mutations into the active site of dCK that mimic nucleoside kinases
found in other species has been proposed to broaden dCK’s specificity and improve
activity. Deoxyribonucleoside kinases exhibit broad conservation among many species.
For example, Gram-negative bacteria are reported to express a single
deoxyribonucleoside kinase that is an analog of the mammalian thymidine kinase 1 and
several viruses carry thymidine kinase analogs such as the Herpes Simplex Virus 1
thymidine kinase (HSV1-TK) (Sandrini et al. 2007, Konrad et al. 2012). One
deoxyribonucleoside kinase that has the ability to phosphorylate all four
deoxyribonucleosides with high activity is the Drosophila melanogaster
deoxyribonucleoside kinase (Dm-dNK) (Munch-Peterson et al. 1999). Dm-dNK shares
homology with the mammalian dCK, thymidine kinase 2 (TK2), and deoxyguanosine
kinase (dGK), yet Dm-dNK contains a unique amino acid sequence at the C-terminal end
that is reported to contribute to catalytic activity. In addition to having broader substrate
specificity, Dm-dNK exhibits a higher catalytic rate than other dNKs (Munch-Peterson et
al. 1999).
After crystallizing dCK, Sabini et al. noted that dCK exhibited cytosine
specificity because of a glutamine at position 97 that acts as both a hydrogen acceptor
and donor for cytosine. Next, dCK discriminates against pyrimidines because of an
asparagine at position 133 that does not permit hydrogen bonding with thymine or uracil
and an arginine at position 104 that disallows thymine occupation of the active site due to
steric hindrance (Figure 2B). By comparing the crystal structure and amino acid
sequence of human dCK and Dm-dNK, they hypothesized that an alanine in place of the
aspartic acid at position 133 (D133A) would reduce negative electrostatic interactions for
65
thymidine in the active site. Furthermore, they predicted that a methionine in place of the
arginine at position 104 (R104M) would result in an increased phosphorylation rate by
reducing active site steric hindrance. A third mutation was made by replacing a valine at
position 100 with an alanine that mimics Dm-dNK at this site. By making three
mutations, D133A, R104M, A100V, Sabini et al. were able to improve dCK catalytic
activity for deoxycytidine 50 fold and broaden dCK’s specificity to include thymidine
(Sabini et al. 2003).
It was proposed that the interactions provided by residues 104 and 133 were
crucial in determining dCK’s specificity for various nucleosides. Iyodigan and Lutz were
able to further modulate dCK’s activity and specificity to thymidine and various prodrugs
with various mutations at sites 133 and 104. Specificity was malleable to the extent that
they were able to completely reverse dCK’s specificity to allow thymidine
phosphorylation and exclude cytidine phosphorylation with the mutations R104M and
D133T. Thus, with only two point mutations they were able to drastically change dCK’s
functionality. Their experiments supported the notion that tailoring of dCK by rational
design in order to meet particular substrate demands was possible and reaffirmed the
critical role of amino acids 133 and 104 to dCK’s substrate specificity (Iyodiang and
Lutz, 2008). dCK thus provides a suitable enzyme for genetic engineering approaches in
which phosphorylation of a specific nucleoside analog is sought.
dCK as a PET Reporter Gene of Stem Cell Transplant
Stem cell transplantation has been proposed as a cure for a wide array of human
ailments because these cells exhibit the capacity to develop into every cell of the human
66
body. Several stem cell therapies are currently in clinical trials that show great promise
to modify or completely replace diseased organs. Of particular interest, hematopoietic
stem cell (HSC) transplant has gained support for both immunological and hematological
applications (Gyurkocza et al. 2010). For example, HSCs can be used for immune cell
reconstitution following the myeloablation that accompanies leukemia treatment and
have been used in gene therapy for genetic blood diseases such as -thalassemia
(Trounson et al. 2011). Combining gene therapy with stem cell transplant is especially
interesting because the replacement of a dysfunctional gene in an organ targets the cause
of the disease rather than just the symptoms. Generally, cells are infected ex vivo with a
viral vector carrying the therapeutic gene of interest. Once transplanted, cells carrying
this gene can re-populate a diseased organ alleviating the disease of interest (Kang and
Chung 2008).
There is still much to be learned about the functional and geographic destinations
of HSC transplants within the body. The ability to safely and sensitively monitor HSCs
after transplant is highly sought after to measure therapeutic progress and detect
malicious events before they become serious problems. Furthermore, the effective
monitoring of HSC transplants in the research setting will allow for better evaluation of
stem cell treatments pre-clinically and provide valuable insight into basic blood and
immune system biology (Kang and Chung 2008, Nair-Gill et al. 2008).
Positron emission tomography (PET) is a molecular imaging technique that can
be used to monitor HSC transplants in vivo. This technique uses radio-labeled small
molecule probes to visualize and quantify cellular and sub-cellular processes in living
patients. Several PET reporter genes have been constructed to help directly monitor cells
67
of interest. A reporter gene is delivered to the transplant cells ex vivo and transcription of
the reporter allows for selective imaging of the transplant. The most widely used reporter
gene for PET imaging is a derivative of the Herpes Simplex Virus Type 1 Thymidine
Kinase (HSV1-tk). Cells expressing this reporter gene accumulate radiolabeled probe by
phosphorylating, and thereby trap, greater amounts of probe than cells lacking the
reporter gene. HSV1-tk has the additional advantage of acting as a suicide gene that
allows for selective killing of the transplant if complications were to arise. Alternate
reporter genes are needed because HSV1-tk been shown to elicit an immune response
that can result in clearance of transplanted cells by the host immune system (Nair-Gill et
al. 2010).
dCK can phosphorylate and trap its substrate with a comparable specificity to
HSV1-tk and exhibits intrinsic non-immunogenic properties that accompany dCK as a
human-derived protein. In their paper, Likar et al. tested the feasibility of using dCK and
mutants of dCK with a variety of probes for PET reporter imaging. They found that cells
expressing dCK harboring the two mutations D133A and R104M (dCK DM) have an
increased accumulation of the thymidine analogs 2’-fluoro-2’-deoxyarabinofuranosyl-5ethyluracil (FEAU) and 2’-fluoro-2’-deoxy-1-D-arabinofuranosyl-5-iodouracil (FIAU)
compared to the wild type dCK in vitro and in vivo. Furthermore, reporter-labeled cells
were observed to be sensitive to treatment with the chemotherapeutic gemcitibine
supporting the dual role of this gene as a suicide gene (Likar et al. 2010).
dCK TM and L-FMAU as a New Reporter Gene and Probe Combo
68
Our lab has developed a PET reporter gene based off of dCK for use in the
detection of hematopoietic stem cell transplant (McCracken et al. in writing). In this
study, dCK TM (A100V, R104M, D133A) was determined to be the best choice for the
reporter gene because this mutant exhibited broad specificity and increased activity for
thymidine with a previously reported specificity change of 1105 fold over wild type
(Iyodigan and Lutz 2008). Next, L1210-10K cells that lack dCK were used in an in vitro
uptake assay. These cells were generated by successive passages in media containing the
chemotherapeutic gemcitibine that targets the nucleotide salvage pathway. Eventually, a
population of L1210 cells was naturally selected for that overcame sensitivity to
gemcitibine treatment by losing dCK expression (Jordheim et al., 2004). For the uptake
assay, L1210 10K cells were transduced with a retroviral vector carrying dCK WT (wild
type, as normally found in nature) or dCK TM and then incubated with radioactive
nucleosides. Cells carrying dCK TM showed similar uptake of deoxycytidine, thymidine,
and FAC when compared to dCK WT uptake. Uptake of the probes FEAU and 2'-deoxy2'-18F-5-methyl-1-β-L-arabinofuranosyluracil (L-FMAU) was significantly greater in
the cells expressing the dCK TM and L-FMAU showed the greatest difference. Based on
this data, L-FMAU was determined to be the optimal PET probe for imaging with dCK
TM.
A murine xenograft model was employed to validate the use of dCK TM and LFMAU as the candidate PET reporter gene and probe pair in vivo. Tumors composed of
L1210-10K cells transduced with either dCK WT or dCK TM cells were grown in mice
and PET imaging with L-FMAU was performed. Tumors expressing dCK TM showed a
three fold increase in L-FMAU accumulation over tumors expressing dCK WT. Next, a
69
murine adenoviral liver infection model was employed to compare dCK TM sensitivity to
that of HSV1-sr39TK. Based on raw percent-injected dose (p < 0.05), cells
overexpressing dCK TM accumulated twice the amount of L-FMAU compared to FHBG
accumulation by cells overexpressing HSV1-sr39TK.
Specificity of dCK TM and dCK DM for L-FMAU
To help determine which is the superior reporter gene for PET imaging with LFMAU, we sought to compare the specificity of dCK TM (A100V, R104M, D133A) to
the specificity of dCK DM (R104M, D133A) in vitro. Our study will investigate the
importance of the sites sites 100, 104, and 133 for nucleoside specificity of dCK and
explore the concept of guiding dCK specificity towards particular substrates. Previous
studies have used rational design to introduce mutations into the active site of dCK. By
mimicking dm dNK, the most promiscuous deoxyucleoside kinase found in nature,
thymidine specificity can be greatly improved for dCK (Sabini et al. 2003, Iyodigan and
Lutz 2008). We hypothesize that dCK TM will exhibit greater specificity for L-FMAU
compared to dCK DM.
70
Figure 1
Schematic of De Novo Nucleotide Synthesis Pathway and Nucleotide Salvage
Pathway. G6P: glucose-6-phosphate, PRPP: phosphoribosylpyrophosphate, NDP:
nucleoside diphosphate, dNTP: deoxyribonucleoside triphosphate, dN:
deoxyribonucleosides, dNMP: deoxyribonucleoside monophosphate, dNDP:
deoxyribonucleoside diphosphate.
71
Figure 2
A)
B)
C)
Active site of dCK containing deoxycytidine (dCyd). A) ERS: ERS motif, P-loop: Ploop motif, LID: LID region. B) Focus on residues A100, R104, and D133 with
deoxycytidine in the active side of dCK. C) Structure of deoxycytidine.
72
Materials and Methods
Media Preparation and Cell Culture
Cloning for Protein Purification from Bacteria
Cloning for Protein Purification from Mammalian Cells
Gel Electrophoresis, Insert Screening, and Sequencing
Production of Retrovirus
Retroviral Titer, Infection for Overexpression, FACS
Western Blot and SDS-PAGE
Radioactive Uptake Assay
Purification of His-Tagged Protein from Bacteria
Purification of His-Tagged Protein from Mammalian Cells
Kinase Assay
73
Media Preparation and Cell Culture
L1210-10K murine leukemic cells (gift from Charles Dumontet, Université Claude
Bernard Lyon I, Lyon, France) were cultured in RPMI-1640 media (Gibco, 31800-0889)
supplemented with L-Glutamine (Fisher, BP379-100) and 5% Fetal Bovine Serum
(Omega, FB-05). 293T human embryonic kidney cells (ATCC, CRL-11268) and NIH3T3 murine embryonic fibroblast (ATCC, CRL-1658) cells were cultured in Dulbecco’s
Modified Eagle Medium (DMEM) (Gibco, 12100-061) media supplemented with LGlutamine and 5% Fetal Bovine Serum. Recovery media after infection of retrovirus
contained either RPMI or DMEM supplemented with 5% FBS and glutamine. Collection
media for retroviral production contained Iscove’s Modified Dulbecco’s Media (Gibco,
12200-069) with 5% FBS and glutamine. Supplements were added directly to the
autoclaved media solution after cooling in sterile conditions followed by bottle-top
vacuum filtration (Millipore, SCGPT05RE) for sterilization. Media was kept at 4C
when not in use. Before addition to cell culture, media was warmed to 37C in a water
bath and swirled. Media transfer was accomplished in sterile conditions by pouring or
with a sterile graduated pipette (BD Falcon, 357543, 357530, 356535). Cell cultures
were maintained in 10 cm dishes (BD Falcon, 353003) at 37C with 5% CO2. For
transfection for retroviral production, 293T cells were grown in 15 cm dishes (Corning,
430599). For retroviral titer and retroviral infection, cells were grown in 6 well plates
(BD Falcon, 353046). Release of adherent cells from plate surfaces was accomplished by
first washing with 1x PBS (Cellgro, 46-013-CM) followed by incubation in 1 mL 0.05%
74
Trypsin-EDTA (Gibco, 25300) for ~2 minutes at 37C. 10 mL 5%-FBS was added to
stop the action of the trypsin and cells were washed.
Cloning for Purification from Bacteria
The pQE80L vector (Qiagen, 32943) contains six histidine residues upstream of the
multiple cloning site allowing purification by affinity column and codes for -lactamase
for carbenicillin resistance. Deoxycytidine kinase wild type (dCK WT) and
deoxycytidine kinase triple mutant (dCK TM; A100V, R104M, D133A) were previously
cloned into the pQE80L vector in the lab (Mirielle Reidinger). Deoxycytidine kinase
double mutant (dCK DM; R104M, D133A) was generated by site-directed mutagenesis
of the pQE80L vector containing dCK TM to change the residue at position 100 to
alanine (V100A) using using the QuickChange II Site-Directed Mutagenesis Kit (Agilent,
200524) according to the manufacturer’s instructions with the following primers: For: 5’GTTTTACTTTTCAAACCTACGCGTGTCTGTCAATGAT
CAGAGC-3’, Rev: 5’GCTCTGATCATTGACAGACACGCGTAGGTTTGAAAAGTAAAAC-3’ (Integrated
DNA Technologies). A heat-shock transformation was performed for screening of the
pQE80L vector containing the insert in DH5- Escherichia coli (E. coli, in-house). 100
L of E. coli DH5- was thawed on ice for 15 minutes. 2 L of the mutagenesis PCR
product was added to the E. coli, incubated on ice for 30 minutes and the tube was placed
at 42C in a water bath for 30 seconds. Next, 70 L of Super Optimal broth with
Catabolite repression media was added and the tube and shaken at 250 rpm for 30
minutes. 200 L of this solution was added to a petri dish containing tryptic yeast extract
75
media (TYE, tryptone (Fisher, DF0127-07-1), yeast extract (Fisher, DF 0123-07-5))
supplemented with carbenicillin (Novagen, 69101) and evenly distributed by shaking
with glass beads. Colonies were grown overnight at 37C, picked and grown in 5 mL
TYE media containing carbenicillin overnight at 37C for screening of the insert by
sequencing. The plasmid was isolated using Wizard SV Miniprep DNA Purification kit
(Promega, A1460) according to manufacturer’s instructions and stored at 4C.
Cloning for Purification from Mammalian Cells
A retroviral vector containing the murine stem cell virus promoter (MSCV), six residue
histidine tag, dCK WT, yellow fluorescent protein (YFP) color marker, internal ribosome
entry site (IRES) and -lactamase for carbenicillin resistance in bacteria was previously
generated in lab (Mireille Reidinger). dCK WT was excised from this plasmid using the
NcoI restriction enzyme (New England Biolabs, R0193S) and calf intestinal phosphotase
(CIP)(New England Biolabs, M0290S ) was added to prevent re-ligation of the retroviral
vector (MSCV-his). dCK TM and dCK DM were excised from retroviral vectors
previously generated in the lab (Mireille Reidinger, Melissa McCracken) using NcoI.
Gel extraction was performed using the QiaQuick Gel Extraction Kit (Qiagen, 28706)
according to the manufacturer’s instructions after gel electrophoresis separation of the
MSCV-his vector, dCK TM insert, and dCK DM inserts followed by ligation of the
inserts into the MSCV-his vector using the Quick Ligation Kit (New Englands Biolabs,
M2200L) according to manufacturer’s instructions. The ligation product was
transformed into E. coli and screened by sequencing as described.
76
Gel Electrophoresis, Insert Screening and Sequencing
Plasmids isolated by Wizard SV Miniprep were first screened for the presence of the
appropriately sized band (1.4 kb for dCK TM and dCK DM inserts, 4.7 kb for pQE80L
vector, 5.9 kb for MSCV-his vector) by gel electrophoresis. Gels contained 1% agarose
(Sigma-Aldrich, A6877) in 1x TAE (50x stock prepared by dissolving the following in
water: 242 g Tris Base (Fisher, BP-152-10), 57.1 mL glacial acetic acid (Fisher, A38212), 100 mL 500 mM EDTA pH 8.0 (Fisher, S311-500)) solution supplemented with 1x
GelRed (Biotium, 41003) for visualization by UV light. pQE80L ligation products were
digested with EcoRI (Roche, 11175084001) and SalI (New England Biolabs, R0138S),
MSCV-his ligation products were digested with NcoI. The gel was run at 120 volts until
separated. Size-verified minpreps were sequenced by Laragen, Inc. to check for insert
direction and sequence. The primer used to sequence the MSCV-his vector insert was
targeted to the downstream region of the Psi sequence: Forward: 5’TCGATCCTCCCTTTATCCA-3’ (Integrated DNA Technologies).
Production of Retrovirus
Sequence-verified MSCV-his-dCK WT, MSCV-his-dCK TM, and MSCV-his-dCK DM
plasmids were transformed as previously described, grown overnight at 37C in 250 mL
TYE, and Maxi Prep (Invitrogen, K210017) was performed to isolate the plasmids. 293T
cells were grow to 80% confluency before addition of the virus solution. Chloroquine
(Sigma-Aldrich, C6628) was added to the media to a final concentration of 25 M prior
to transfection. 1 mL of virus solution was made in two parts. First, 15 g MSCV-his
plasmid containing dCK WT, dCK TM, or dCK DM, 10 Ug of PCL-II helper plasmid, 50
77
L 2M CaCl2 (Sigma-Aldrich, C7902) and distilled H20 (Gibco, 15230) was added to
bring the solution up to 500 L. Next, 500 L 2x Hank’s Balanced Salt Solution (50 mM
HEPES, 1.5 mM Na2PO4, 280 mM NaCl) was added drop wise with bubbling and the
solution was left at room temperature for 5 minutes. The virus solution was added to the
culture plate drop wise evenly and the mix was placed in the incubator. After 12 hours,
media was aspirated and recovery media was added. After 24 hours, the infection was
verified by YFP expression, media was aspirated, and 2.5 mL of collection media was
added. Collections were performed every 4 hours with the addition of fresh collection
media for 4 iterations. The collected media containing viral supernatant was pooled,
spun at 1500 rpm for 5 minutes, filtered through a 0.45 m filter (Millipore,
SE1M003M00), and kept at -80C until used.
Retroviral Titer, Infection for Overexpression, FACS
50,000 NIH-3T3 cells per well were plated in a 6-well culture dish. 1x polybrene
(Sigma-Aldrich, H9268) was added to each well before infection. Cells were infected by
the addition of four 10x dilutions of virus and a non-infected well was maintained as a
control. Cells were washed with 1x PBS, removed from the plate by addition of Trypsin,
and analyzed by FACS (Becton, Dickinson and Company, BD FACSCanto) for YFP
expression as a measure of infection efficiency. The titer was calculated by the following
formula: ((% YFP+ cells) * (cell number at time of infection))/(mL virus added) = virus
particles/mL. 3 * 106 L1210-10K cells were plated in 2 mL of media in a six well plate.
1 mL of thawed virus was added and the plate was incubated for 12 hours. The cells
were collected, pelleted at 1500 rpm for 5 minutes, and resuspended in 3 mL fresh
78
recovery media. A second infection was performed after 24 hours in culture. YFP+ cells
were sorted in lab (Donghui Cheng) (BD FACSAria II, Becton, Dickinson and
Company). A second sort was performed after 24 hours to match the YFP intensity
among the various L1210-10K cell lines generated. Prior to the Uptake Assay, cell-cycle
determination by FACS was performed. An equal number of each cell line was pelleted
at 1500 rpm for 5 minutes, washed with 1 x PBS, and fixed by the drop wise addition of
70% ethanol (Pharmco AAPER, 111000200) and storage at -20C for 20 minutes. For
staining, cells were washed with 1 x PBS, resuspended in 1 x PBS, propidium iodide
(Sigma-Aldrich: P4170) was added to a concentration of 50 g/mL, and RNase
(Invitrogen, 60216-RN) was added to a final concentration of 1 Ug/mL. After incubating
at 37C for 30 minutes, cell cycle was determined by FACS.
Western Blot and SDS-PAGE
Cell lysates were collected by resuspending ~3 * 106 cells in 200 L
radioimmunoprecipitation assay buffer (1% NP-40 (Sigma-Aldrich, I3021), 1 mM EDTA
(Fisher, S311-500), 0.25% Na-Deoxycholate (Invitrogen, 89904), 0.3% SDS (Fisher,
BP166-5), 1.5 mM NaCl (Fisher, S271-10), 50 mM Tris-HCl pH 6.8 (Fisher, BP-152-10)
with a 30 minute incubation on ice followed by ultracentrifugation at 100,000 rpm for 20
minutes at 4C to remove debris. Total protein concentration was determined by
Bicinchoninic acid assay (BCA assay) (Pierce, 23227) according to the manufacturers
protocol. Protein was diluted to 0.75 g/L with water and Sample Buffer (Fermentas,
R0891). Samples were boiled for 5 minutes and 20 L sample were loaded per lane.
Samples were run at 60 volts until separated on an SDS-HEPES gel (Thermo Scientific,
79
0025204) using SDS-HEPES running buffer (12.1 g/L Tris, 23.8 g/L HEPES (Fisher,
BP410-500), 1 g/L SDS). Western Blot was performed using horseradish peroxide
conjugated antibodies. The gel was sandwiched in the following order: sponge, 3 pieces
Whatman paper (Whatman, 3030917), gel, 0.45 m nitrocellulose (GE Water and
Processes Technologies, WP4HY00010), 3 pieces Whatman paper, and sponge. The
protein was transferred at 55 volts for 2.5 hours in transfer buffer (60% dH20, 20%
methanol (Fisher, A412P-4), 20% tank buffer (29 g/L Glycine (Fisher BP381-5), 6 g/L
Tris, 1 g/L SDS). Blocking was performed for 1 hour using 5% non-fat milk (Kroger,
store bought) in 1x PBS containing 0.005% Tween 20 (Fisher, BP337) (NFM-PBST) and
each antibody was diluted in this same solution. The primary antibody dilutions are as
follows: Mu monoclonal dCK 9D4 (in-house, Mirielle Reidinger) diluted 1:1000, Rbt
monoclonal YFP (in-house, Mirielle Reidinger) diluted 1:300, Rbt polyclonal ERK2
(Santa Cruz, sc-154) diluted 1:5000. The blot was incubated in the primary antibody
solution for 2 hours then the blot was washed three times for 5 minutes with PBST. The
secondary antibody dilutions are as follows: Gt  Mu (BioRad) 1:10,000, Gt  Rbt
(BioRad, 170-6515) 1:15,000. The blot was incubated in the secondary antibody solution
for 1 hour then washed three times for 5 minutes with PBST. Visulation was performed
with photopaper (GE Healthcare, 28906846) after the addition of Immobolin solution
(Millipore, WBKL50500) according to the manufacturer’s instructions. For addition of
the ERK2 loading control, blot were stripped for 10 minutes with Stripping Buffer
(Thermo Scientific, 21059) prior to antibody incubation. For SDS-PAGE, the gel was
stained with Gel-code blue (Thermo Scientific, 24590), according to the manufacturers
protocol, and dried on Whatman paper at 80C for 1 hour and 40 minutes.
80
Radioactive Uptake Assay
~1 * 105 cells were plated in 100 L RPMI media per well for 10K + dCK WT, 10K +
dCK TM, cells 10K+ dCK DM cell lines in a 96-well filter plate (Millipore,
MSGVN2B50). Radioactive tritium labeled probes of the following compounds were
tested for each cell line; deoxycytidine (Moravek, MT673), thymidine (Moravek,
MT6032), FAC (Moravek, MT1001), L-FMAU (Moravek, MT1726), FEAU (Moravek,
MT1701). Each cell line/probe pair was tested in triplicate and this experiment was
replicated 3 times. The cells were incubated at 37C for 1 hour with 0.5 Ci of probe per
well. The media was aspirated by filtration and the wells were washed five times with
RPMI media. Next, the plate was dryed at 65C for 20 minutes and allowed to cool. To
measure radioactivity left within the cells, 150 L BioSafe NA scintillation fluid was
added per well (RPI Inc., 111198) and counts were performed using the BetaMax Plate
Reader (Perkin-Elmer).
Purification of His-tagged Proteins from Bacteria
E. coli was transformed as described and grown overnight. 100 mL of prewarmed TYE +
carbenicillin was innoculated with 5 mL of the overnight culture and grown at 37C with
shaking until an OD600 of 0.6 was reached. Expression of the his-tagged protein was
induced by addition of Isopropyl β-D-1-thiogalactopyranoside (Acros, 302790250) to a
final concentration of 1 mM and incubation for 4 hours. Cells were harvested by
centrifugation at 4000xg for 20 minutes and stored at -20C until use. To clear the lysate
for purification, pelleted cells were thawed on ice for 15 minutes, resuspended in 5 mL
81
lysis buffer (1x PBS, 150 mM NaCl, 10 mM imidazole (Sigma-Aldrich, I-0125), EDTAfree complete protease inhibitors (Roche, 14696300)) with 1 mg/mL lysozyme (SigmaAldrich, L-7001) and incubated on ice for 30 minutes. The solution was sonicated at 10
second on/10 second off intervals for a total on time of 1 minutes 40 seconds with an
output level of 5. The lysate mix was centrifuged at 10,000xg for 30 minutes at 4C to
pellet debris. The supernatant was added to 300 UL Ni-NTA mix (Qiagen, 30410) in a
column and shaken at 4C for 1 hour. The beads were then washed eight times with 500
L wash buffer (1x PBS, 150 mM NaCl, 20 mM imidazole) and the purified protein was
eluted in 150 L portions with elution buffer (50 mM Tris-HCl pH 7.7, 20% glycerol
(Fisher, BP229-1), 0.5% NP-40, 250 mM imidazole). The elutions were stored on ice at
4C and protein concentrations were determined by BCA assay at the time of the
experiment.
Purification of His-tagged Proteins from Mammalian Cells
293T cells at ~80% confluency were transfected with MSCV-his-dCK WT vector as
described for retroviral production. After 3 days in culture, cells were scraped into 1x
PBS, washed, resuspended in 1x PBS and kept at -20C until use. Cells were lysed in 1
mL mammalian lysis buffer (50 mM Tris-HCl pH 7.7, 20% glycerol, 0.5% NP-40,
EDTA-free complete protease inhibitors, phosphatase inhibitor cocktail 2 (SigmaAldrich, P5726), phosphatase (Sigma-Aldrich, P0044)) by 2 cycles of freezing on dry ice
followed by thawing on ice. BCA assay was performed to determine protein
concentration and 1600 g of total was applied to Ni-NTA agarose beads in an eppendorf
tube. Each sample was adjusted to the same volume with co-immunoprecipitation buffer
82
(co-IP buffer: 1x PBS, 20% glycerol, 130 mM NaCl, 0.55% NP-40, phosphatase inhibitor
cocktail 2, phosphatase inhibitor cocktail 3, 10 mM imidazole) and rotated overnight at
4C. Samples were then centrifuged for 2 minutes at 6000 rpm to pellet the beads. The
supernatant was removed, the beads washed 4 times with co-IP buffer, and the beads
resuspended in 1 mL co-IP buffer. 100 L of this solution was pelleted and resuspended
in elution buffer to release the purified proteins to the supernatant. SDS-PAGE was
performed to verify purification and quality.
Kinase Assay
A spectrophotometric kinase assay was adapted to determine dCK TM and dCK DM
kinetcs for L-FMAU (Moravek, M 1885) (Iyodigan and Lutz 2008, Shu et al. 2010).
Troubleshooting was performed using deoxycytidine (Sigma-Aldrich, D3897), thymine
(Sigma-Aldrich, T1895), ADP (Sigma-Aldrich, A2754), or pyruvate (Sigma-Aldrich,
P2256) as substrates. We chose to use the ability of NADH to fluoresce to determine
enzyme velocity rather than absorption. Protein concentration was quantified using the
BCA assay and a master mix was made for 1 g enzyme per reaction. The master mix
contained the following in addition to dCK TM or dCK DM: 50 mM Tris-HCl pH 7.6, 50
mM KCl (Fisher, BP366), 10 mM MgCl2 (Sigma-Aldrich, M8266), 1 mM DTT (Roche,
10197777001), 1 mM ATP (Sigma-Aldrich, A6459), 1 mM PEP (Sigma-Aldrich,
P7252), 0.1 mM NADH (Sigma-Aldrich, N4505), ~10 units/mL pyruvate kinase, ~15
units/mL lactate dehydrogenase (Sigma-Aldrich, P0294). PEP and NADH were prepared
in 50 mM Tris HCl pH 7.6 at the time of the assay. Kinase substrate ranged from 6.125
M to 300 M. The reaction was compiled in a total of 150 L as this amount was
83
shown to help decrease the degradation of NADH by UV light (Kiianitsa et al. 2003).
Each concentration was tested in triplicate using a 96-well black UV-optical plate
(Thermo-Nunc, 265301) on the Wallac Victor3 V plate reader (Perkin-Elmer, 1420-041).
The plate containing the master mix was placed in the reader for 5 minutes at 37C to
warm the mix and the reaction was initiated by the addition of L-FMAU substrate. Reads
were performed in ~30 second intervals at 37C by exciting at 355 nm and reading at 460
nm for 30 minutes. An NADH standard curve was constructed using the following
concentrations of NADH: 0.1 mM, 0.05 mM, 0.025 mM, 0.0125 mM, 0.0063 mM
NADH. Nonlinear regression analysis and Michaelis-Menten determination of Km
values was performed using the Prism 5 software (GraphPad Software).
84
Results
Protein Purification for Enzyme Kinetics in a Coupled Enzyme Assay
To determine if deoxycytidine kinase triple mutant (A100V, R104M, D133A;
dCK TM) or deoxycytidine kinase double mutant (R104M, D133A; dCK DM) exhibited
greater specificity for L-FMAU, we evaluated the steady state kinetics of each enzyme
for L-FMAU. A spectrophotometric coupled enzyme assay was adapted in order to
determine the Km (a measure of enzyme/substrate affinity) of dCK TM and dCK DM for
L-FMAU. In this assay, the ability of NADH to fluoresce is harnessed to measure
enzyme activity as a function of NADH consumption by coupling dCK activity to the
enzymes pyruvate kinase (PK) and lactate dehydrogenase (LDH) (Figure 1). Briefly,
dCK phosphorylates its substrate through the phosphate donor adenosine triphosphate
(ATP). Adenosine diphosphate (ADP) generated from this reaction is used to accept the
transfer of phosphate from phosphoenol pyruvate (PEP) by pyruvate kinase (PK).
Pyruvate generated from this reaction is reduced to lactate by lactate dehydrogenase
(LDH) that oxidizes nicotinamide adenine dinucleotide (NADH) to NAD+. Because
NAD+ does not fluoresce at the same wavelength as NADH, the measurable decrease in
NADH can be used to determine dCK velocity. Only the activity of dCK is measured
because dCK is the rate limiting step. This assay has the advantage of providing a
precise determination of enzyme velocity because the phosphorylation of substrate by
dCK is coupled to the consumption of NADH in a stoichiometric 1:1 ratio. Furthermore,
the reaction can be measured in real time providing a more precise determination of
steady state kinetics than stop-time assays (Schelling et al. 2001, Kiianitsa et al. 2003).
85
dCK WT and dCK TM were previously cloned into the pQE80L vector that adds
six histidine residues to the 5’ end of the cloned gene allowing for purification by affinity
column (Mirielle Riedinger, Figure 2). To generate pQE80L + his-dCK DM, pQE80L +
his-dCK WT was digested and the vector was isolated by gel purification. Next, MSCV
+ dCK DM was digested and after gel purification, dCK DM was ligated into pQE80L.
The three vectors (pQE80L + his-dCK WT, pQE80L + his-dCK DM, pQE80L + his-dCK
TM) were transformed into E. coli and induced for expression of the his-tagged protein
that was isolated and subjected to SDS-PAGE (Figure 3). Indicating successful
purification, a strong band at ~31 kDa for dCK could be seen in the induced control lane
(lane 3), the whole lysate lane (lane 4), and the elution lanes (lanes 6-12). This band was
not evident in the not-induced (lane 2) and flow through lanes (lane 5).
Enzyme purification through E. coli is routinely used because bacterial
purification can yield far greater enzyme quantity than purification from mammalian
cells. However, post-translational modifications such as glycosylation patterns can differ
from bacteria to mammalian cells that can have an affect on protein solubility and activity
(Schein et al. 1989). To test if the source of our recombinant enzyme had any effect on
enzyme activity, a retroviral vector containing the Murine Stem Cell Virus (MSCV)
promoter and a histidine tag at the 5’ end of the multiple cloning site for purification from
mammalian cells was previously generated containing dCK WT (Figure 4). We cloned
dCK DM and dCK TM into this vector and successfully isolated >16ng/L from
transfected 293T cells determined by western blot (Figure 5). This data demonstrates the
feasibility of isolating dCK DM and dCK TM from mammalian cells to test if any
86
differences in protein activity occur between recombinant protein production systems and
tests are currently underway.
The Coupled Assay Efficiently Measures Enzyme Velocity
Each component of the coupled reaction was tested to ensure that the assay was
functioning properly. First, a radioactive kinase assay was employed to test our purified
protein for kinase activity. We detected increasing levels of phosphorylated 3Hdeoxycytidine when increasing levels of dCK WT were added indicating that the enzyme
was active (Figure 6).
Next, a pyruvate standard curve was generated to test the activity of LDH, the last
enzymatic step of the coupled enzyme assay. As expected, addition of pyruvate was able
to drive consumption of NADH by LDH. The amount of NADH consumed was
stoichiometrically equivalent to the amount of pyruvate added (Figure 7). An ADP
standard curve was generated in order to test PK, the second step of the coupled reaction.
Addition of ADP successfully drove NADH consumption stoichiometrically equivalent
to the amount of ADP added (Figure 8). Finally, the assay was performed using an
excess of deoxycytidine substrate with two-fold dilutions of dCK. We observed about a
two-fold change in NADH consumption indicating the reaction was proceeding
efficiently (Figure 9). Each reaction thus operates at maximum velocity with saturated
substrate (dCyd) (Figure 10).
We next determined the Km of dCK WT, dCK TM, and dCK DM with
deoxycytidine and thymidine to verify that our purified enzymes retained kinase activity
consistent with previously published work. First, the Km of dCK WT for deoxycytidine
87
has been shown to range from 1 to 9 M (Krenitsky et al. 1975, Usova and Eriksson
1997, Shafiee et al. 1998, Sabini et al. 2003, Iyodigan and Lutz, 2008). In two separate
runs using independently purified batches of enzyme, we observed Km values of 5.2 and
5.4 indicating that our purified enzyme was functional and that our assay was consistent
with previously published work (Table 1).
dCK TM has a Higher Specificy for L-FMAU than dCK DM
L-FMAU is a thymidine analog and dCK TM has been shown to have a greater
activity for thymidine than dCK DM. We predicted that dCK TM would have a lower
Km for L-FMAU than dCK DM. A lower Km for dCK DM compared to dCK TM would
indicate that L-FMAU more readily binds dCK TM than dCK DM (Iyodigan and Lutz
2008). For each replicate, dCK TM and dCK DM were freshly purified and the protein
concentration was determined at the time of the assay (Figure 11). dCK TM exhibited a
Km of 13.997  4.344 M for L-FMAU and dCK DM exhibited a Km of 55.970 
6.8890 M for L-FMAU indicating that dCK TM has a higher binding specificity for LFMAU (Figure 12, 13, Table 1).
Successful Generation of 10K + dCK Cell Lines
A retroviral vector containing the MSCV promoter was chosen because this
promoter is known to be highly active (Jones et al. 2009). Previously in lab, dCK WT
dCK TM, and dCK DM were cloned into retroviral plasmids containing the MSCV
promoter, YFP color marker, and an IRES site (Melissa McCracken) (Figure 14). To
produce intact retrovirus for infection of L1210-10K cells, 293T cells were transfected
88
with the MSCV retroviral plasmids containing dCK WT, dCK DM, and dCK TM along
with the helper plasmid PGL-II for viral packaging. Similar amounts of MSCV + dCK
TM and MSCV + dCK DM virus were produced (Table 2).
To ensure that each cell line received sufficient viral load, two rounds of infection
were performed. YFP expression was used as an indicator of dCK expression levels as
this gene is also transcribed from the MSCV promoter in the retroviral vector. We
observed similar YFP expression by FACS in each cell line indicating that each cell line
had received similar viral loads (Figure 15). We observed similar YFP expression and
dCK expression in each of the cell lines used for expression by western blot for each
replicate (Figure 16).
Greater Accumulation of L-FMAU in 10K + dCK TM compared to 10K + dCK DM
Nucleosides that are phosphorylated by dCK are trapped intracellularly. To test if
dCK TM exhibited greater specificity for L-FMAU than dCK DM within the cell, we
employed a radioactive uptake assay that measures the accumulation of a radioactive
substance within cells over a set period of time. Based on our kinase assay where dCK
TM exhibited a greater affinity for L-FMAU than dCK DM, we predicted that cells over
expressing dCK TM would accumulate more L-FMAU than cells over expressing dCK
DM.
For the radioactive uptake assay, we over expressed dCK TM and dCK DM in the
L1210-10K cell line. This cell line is deficient in dCK as a result of selection based on
low gemcitibine treatment (Jordheim et al., 2004). L1210-10K cells are an ideal system
for studying dCK activity within the cell because any concerns with the contribution of
89
endogenous dCK activity to the results are alleviated. Furthermore, L1210-10K cells are
of the hematopoietic lineage that we aim to target with our reporter gene in lab.
An equal amount of cells were plated for each cell line and probe tested. Total
radioactivity accumulated was measured after 1 hour of incubation. Each cell line was
assayed in triplicate for all substances tested. This assay was then repeated in triplicate
for biological replicates. Because uptake of nucleosides can vary with cell cycle, cell
cycle analysis was performed prior to each experiment to ensure similar phase
distribution (Figure 15). Furthermore, a western blot for dCK was performed before each
assay to ensure similar expression levels (Figure 16). In each replicate, the cell lines 10K
+ dCK WT, 10K + dCK DM, and 10K + dCK TM all accumulated similar amounts of
radiolabeled deoxycytidine.
Salvage of thymidine is regulated by thymidine kinase 1
and not dCK. Therefore, thymidine salvage should be consistent among all the cell lines
used. Radiolabeled thymidine was used as a positive control and each cell line
accumulated similar amounts of thymidine.
Next, 1-(2'-deoxy-2'-fluoro-beta-D-arabinofuranosyl)cytosine (FAC) is shown to
have activity with dCK WT so we wanted to see if dCK TM and dCK DM exhibited
greater activity for this PET probe. Cell lines overexpressing dCK TM and dCK DM
accumulated similar amounts of FAC with dCK WT accumulating the most. FEAU has
been proposed to have high activity with dCK DM so we wanted to see if the A100V
mutation increased activity for FEAU as well (Nair-Gill et al. 2010, Likar et al. 2010).
Both 10K + dCK DM and 10K + dCK TM accumulated more FEAU and L-FMAU than
10K + dCK WT. 10K + dCK DM accumulated more FEAU (4.15 fold greater FEAU
trapped than L1210-10K ) compared to 10K + dCK TM (3.45 fold greater FEAU trapped
90
than L1210-10K ) and 10K + dCK WT (1.27 fold greater FEAU trapped than L1210-10K
uptake)(Figure 17).
In support of our hypothesis that dCK TM will exhibit greater activity for LFMAU than dCK DM, we observed the greatest uptake of L-FMAU in the L1210-10K +
dCK TM cell line (8.07 fold greater L-FMAU trapped than L1210-10K ) compared to the
L1210-10K + dCK DM cell line (6.02 fold greater L-FMAU trapped than L1210-10K)
and the L1210-10K + dCK WT cell line (0.96 fold greater L-FMAU trapped than L121010K ) (Figure 17).
91
Figure 1
Schematic of NADH coupled enzyme assay. Phosphorylation of substrate
(deoxycytidine shown) by dCK results in the production of ADP that can then be used by
PK to convert PEP to pyruvate that is converted to lactate by LDH requiring the
oxidation of NADH to NAD+. NADH levels are read directly by fluorescence and a
decrease in NADH over time is used to determine enzyme velocity. ATP is continuously
regenerated. ATP: adenosine triphosphate, ADP adenosine diphosphate, dCyd:
deoxycytidine, dCMP: deoxycytidine monophosphate, PEP: phospho-enol pyruvate, PK:
pyruvate kinase, LDH: lactate dehydrogenase, NADH: reduced nicotinamide adenine
dinucleotide, NAD+: oxidized nicotinamide adenine dinucleotide, P: phosphate.
92
Figure 2
Schematic of pQE80L vector containing his-tagged dCK WT (shown), dCK TM, or
dCK DM for purification from E. coli. pT5/lac O: T5 promoter containing lac operator
element, RBS: ribosome binding site, 6x His: 6-histidine residue repeat, lac: lac repressor
coding sequence, Col E1: origin of replication, amp: -lactamase (carbenicillin
resistance). Addition of six histidine residues upstream of dCK WT for affinity column
purification.
Figure 3
Successful purification of dCK WT from E. coli assessed by SDS-PAGE. Lane 1:
molecular weight ladder in kilodaltons, lane 2: non-induced control, lane 3: induced
control, lane 4: whole lysates, lane 5: flow through, lane 6-12: dCK WT elutions by 250
mM imidazole. Bright band ~30 kDa indicates presence of dCK WT in lanes 3, 4, 6-12.
93
Figure 4
Schematic of retrovirus containing his-tagged dCK WT (shown), dCK TM, or dCK
DM for overexpression of each dCK varient in L1210-10K cells. MSCV LTR:
Murine Stem Cell Virus long terminal repeat (promoter), PSI (packaging element), IRES:
internal ribosome entry site (for translation of transcript), YFP (color marker). Addition
of six histidine residues upstream of dCK WT for affinity column purification.
Figure 5
Successful purification of dCK WT from mammalian cells analyzed by Western
blot. Compared to 1 ng dCK WT standard, at least 1 ng dCK WT was purified per
elution. Band at ~30 kDa in lanes 9-11 indicates some dCK WT left over in flow
through. Lane 1: 1 ng dCK WT standard, lane 2: 0.1 ng dCK WT standard, lanes 3-5:
dCK WT elutions by 250 mM imidazole, lanes 6-8: whole cell lysates, lanes 9-11: flow
through. 293T cells were transfected with MSCV-his-dCK WT vector and grown for 72
hours prior to purification.
94
Figure 6
dCK WT purified from E. coli is active. Serial dilutions of dCK WT were performed
prior to incubation with radioactive substrate (3H-dCyd) and phosphate capture onto
Whatman paper. Addition of increasing amounts of enzyme (0, 1, 10, and 100 ng)
correlates with increase in total phosphorylated substrate over 20 minutes. The
experiment was performed in triplicate.
Figure 7
NADH is consumed by LDH for the conversion of pyruvate to lactate. Addition of
increasing amounts of pyruvate directly to the coupled enzyme assay (0, 0.001, 0.01, 0.1,
1, and 10 nmol) correlates with increase in total NADH consumed. The LDH step of the
enzyme coupled assay is functional.
95
Figure 8
Addition of ADP allows for conversion of PEP to pyruvate by PK resulting in
NADH consumption. Addition of increasing amounts of ADP (0, 0.1, 1, 2.5, 5, 7.5
nmol) correlates with increase in total NADH consumed. The PK and LDH steps of the
enzyme coupled assay are functional.
Figure 9
Enzyme coupled assay is sensitive to changes in dCK WT concentrations. Changes
in NADH consumption over 5 minutes after addition of 2x dilutions (0, 0.25, 0.5, 1, 2, 4
g) of enzyme. The coupled enzyme assay can be used to measure changes in
phosphorylation of deoxycytidine by dCK WT. Two fold dilutions of dCK WT resulted
in about two fold changes in total NADH consumed over 5 minutes.
96
Figure 10
Enzyme concentration does not have a significant effect on enzyme velocity.
Addition of 2x dilutions of dCK WT (0, 0.25, 0.5, 1, 2, 4 g) to the enzyme coupled
assay did not significantly change the rate of NADH consumption by 1 g dCK WT over
five minutes indicating the assay is sensitive across a range of enzyme concentrations.
Significance determined by a two-way ANOVA test.
Table 1
Determination of dCK WT, dCK TM, and dCK DM activity for deoxycytidine
(dCyd), thymidine (Thy) and L-FMAU. The reaction was initiated by the addition of
substrate and the velocity was determined by steady-state turnover within the first 3
97
minutes. Each substrate concentration was performed in triplicate. dCK TM experiments
for L-FMAU were repeated for n = 3. dCK TM experiments for dCyd and dCK DM
experiments for L-FMAU were repeated for n = 2.
Figure 11
Purification of dCK TM and dCK DM from E. coli prior to kinase assay for LFMAU analyzed by SDS-PAGE. Lane 1: Molecular weight ladder in kilodaltons, lane
2: whole lysates, lane 3: flow through, lane 4-10 dCK TM elutions with 250 mM
imidazole. Bright band ~30 kDa indicates presence of dCK WT in lanes 2, 4-10.
98
Figure 12
Michaelis-Menten curve of L-FMAU phosphorylation by dCK TM. The reaction was
initiated by the addition of substrate and the velocity was determined by turnover within
the first 3 minutes. Each L-FMAU concentration was performed in triplicate and the
experiment was performed in triplicate. A single run is shown.
Figure 13
Michaelis-Menten curve of L-FMAU phosphorylation by dCK DM. The reaction
was initiated by the addition of substrate and the velocity was determined by turnover
within the first 3 minutes. Each L-FMAU concentration was performed in triplicate and
this experiment was repeated. A single run is shown.
99
Figure 14
Schematic of retrovirus containing dCK WT (shown), dCK TM, or dCK DM for
overexpression of each dCK variant in L1210-10K cells. MSCV LTR: Murine Stem
Cell Virus long terminal repeat (promoter), PSI (packaging element), IRES: internal
ribosome entry site (for translation), YFP (color marker).
Table 2
100
Figure 15
Similar YFP expression and cell cycle of L1210-10K cells carrying the dCK WT,
dCK TM, or dCK DM over expression vectors. YFP: yellow fluorescent protein, PI:
propidium iodide. Cells lines were tested prior to uptake assay to ensure differences in
radioactive probe uptake were not a result of diminished expression or cell phase
distribution. L1210-10K cells do not contain vector carrying YFP.
101
Figure 16
Expression of YFP and dCK in L1210-10K cells lines of whole cell lysates analyzed
by Western blot. Representative dCK expression is shown for L1210-10K cell lines at
time of one uptake assay. Lane 1: L1210-10K cells (dCK deficient), lane 2: 10K + dCK
WT, lane 3: 10K + dCK TM, lane 4: 10K + dCK DM. Blot indicates similar expression
of YFP (A) (~29 kDa ) and each dCK variant (B) (~ 31 kDa) in 10K + dCK WT, 10K +
dCK TM, and 10K + dCK DM cell lines.
102
Figure 17
L-FMAU accumulation is greatest in L1210-10K cell lines over expressing dCK TM.
Accumulation of radioactive probe in 1 hour by L1210-10K cells over expressing dCK
WT, dCK TM, dCK DM from the MSCV promoter expressed as fold change in counts
per minute (CPM) over L1210-10K cells. dCyd: deoxycytidine, Thy: thymidine, FAC: 1(2'-deoxy-2'-fluoroarabinofuranosyl) cytosine, FEAU: 2’-fluoro-2’deoxyarabinofuranosyl-5-ethyluracil, L-FMAU: 2'-deoxy-2'-5-methyl-1-β-Larabinofuranosyluracil. Deoxycytidine and thymidine are controls for normal uptake of
extracellular nucleosides. Out of the L1210-10K cells lines generated, L-FMAU
exhibited the greatest accumulation in L1210-10K + dCK TM cells (8-fold over L121010K uptake).
103
Discussion
The data from our biochemical analysis of deoxycytidine kinase triple mutant
(dCK TM: A100V, R104M, D133A) and deoxycytidine kinase double mutant (dCK DM:
R104M, D133A) suggest that catalytic specificity can be improved with single point
mutations within the active site of dCK. We demonstrate that L-FMAU binding to dCK
DM can be improved 4-fold (Figure 4) by including the A100V mutation and that this
can result in greater uptake of L-FMAU within the cell. In their paper, Sabini et al.
identified the alanine at site 100 to be partially responsible for side chain flexibility in the
binding site of dCK contributing to dCK WT’s inability to phosphorylate thymidine. The
mutation A100V was made to mimic the amino acid sequence seen in the Drosophila
melanogaster deoxynucleotide kinase (dm dNK) that has the capability of
phosphorylating all four deoxyribonucleosides that compose DNA (Sabini et al 2003).
We confirm that the A100V mutation can be used to broaden dCK’s specifity for
thymidine and demonstrate that the A100V mutation can be used to increase dCK’s
specificity for the thymidine analog L-FMAU. These data show that dCK’s specificity
can be easily manipulated. Our findings confirm the importance of the sites 100, 104,
and 133 for nucleoside specificity of dCK and have implications with gene therapy and
cancer treatment in which tailoring of specific nucleoside kinase/nucleoside analog
interactions is sought.
dCK is a relatively inefficient enzyme with a 2500-fold lower turnover than that
of dm dNK for deoxycytidine. After crystallization of dCK, Sabini et al. proposed that
104
dCK’s efficiency could be improved with three mutations within the active site at
positions 100, 104, and 133 to mimic the active site of the more promiscuous and
efficient dm dNK. These sites were observed to be important to hydrogen bonding of
substrate and cause steric hindrance of some nucleosides within the active site of dCK
(Sabini et al 2003). The importance of these three sites to dCK’s kinase activity was
further validated by the two groups Iyodigan and Lutz and Knecht et al. who showed that
various substitutions at these sites can directly influence dCK specificity (Iyodigan and
Lutz 2008, Knecht et al. 2002). We have used the substitutions R104M and D133A to
greatly improve dCK’s specificity. Using a kinase assay, dCK’s specificity for thymidine
was improved 15–fold with the R104M and D133A mutations. This specificity was
further improved 89-fold with the A100V substitution.
In their paper, Iyodigan and Lutz incorporated the A100V mutation into
deoxycytidine kinase mutants generated from site-saturated libraries. Two mutants that
exhibited increased thymidine activity, ssTK1 (R104M, D133S) and ssTK2 (R104M,
D133T), were discovered and A100V was introduced to see if this point mutation could
broaden their specificity for various nucleosides. A100V had the effect of increasing the
activity of ssTK1 for pyrimidines (dCyd, Thy). The effect of increased activity for
pyrimidines by A100V was confirmed by our observations. Next, A100V had the effect
of decreasing or not affecting ssTK1 activity for purines (dAde, dGua). Interestingly,
introduction of A100V into ssTK2 (ssTK2A100V) that only differs from ssTK1 by a
threonine (nucleophilic residue) at site 133 instead of a serine (nucleophilic residue) had
the effect of decreasing deoxycytidine activity by 8 fold compared to ssTK1A100V. This
mutation increased thymidine activity of ssTK2 and decreased purine activity similarly to
105
ssTK1A100V. They hypothesized that the bulky valine together with the bulky threonine
increases the rigidity of the active site of dCK in such a way that deoxycytidine binding is
inhibited whereas thymidine binding is promoted. We propose that active site rigidity is
also relevant to L-FMAU occupation of the active site of dCK and that increased rigidity
promoted L-FMAU binding (Iyodigan and Lutz, 2008).
Another way in which dCK specificity for L-FMAU was increased is by
expansion of the active site binding pocket of dCK TM. The mutation R104M can
function to decrease the steric clashes observed in the crystal structure (Sabini et al.
2003). If binding pocket size plays a large role in guiding dCK specificity for
nucleosides, it seems then that purine binding would improve as purines are larger than
pyrimidines. Counter intuitively, the R104M mutation has been shown to have a
negative affect on purine binding within the active site of dCK mutants (Iyodigan and
Lutz 2008). Although binding pocket expansion most likely plays a large role in
improving thymidine specificity, binding pocket expansion probably does not play as
large of a role as hydrogen bonding for purine binding. The crystal structure of dCK
shows that deoxycytidine binding within the active site most likely benefits from
hydrogen bonding between the exocyclic amino group and D133 of dCK. The disruption
of hydrogen bonding between D133 of dCK and the exocyclic amino group of
deoxyadenosine can explain why deoxyadenosine specificity is decreased for dCK DM
(Sabini et al. 2003, Iyodigan and Lutz 2008). Thus, we do not expect dCK TM, nor dCK
DM, to have increased specificity for purine analogs and predict that introduction of the
A100V into dCK variants with poor affinity for purines will only enhance this effect.
106
We observed Km values for L-FMAU of 13.997 M from dCK TM and 55.970
M from dCK DM. These proteins were purified by nickel affinity column via a his-tag
from E. coli using the pQE80L expression system. It has been shown that in some cases,
the six added histidine residues used for affinity column purification can interfere with
enzymatic reactions despite their small size and charge (Terpe 2002). Our observed Km
value of 5.276 M from dCK WT for deoxcytidine falls in the range of what is reported
in the literature (1 – 9 M) so it is unlikely that the his-tag interfered with our
measurements. Furthermore, our Km value of 5.276 M most closely resembled that of
Sabini et al. (6.2 M) who used a thrombin cleavage site to remove the his-tag prior to
performing their kinase assay.
Recombinant protein purification from bacteria is widely used and studies on
dCK have employed this purification method. One question is if data from recombinant
proteins would remain consistent in vivo. Mammalian cells and bacterial cells have been
shown to differ in their post-translational modifications such as glycosylation and
phosphorylation patterns that may have an effect on catalytic activity (Mehta et al 2009).
One possibility is that a post-translational modification occurs within the mammalian cell
that is critical to dCK activity for a given substance intracellularly and that this
modification does not occur in bacteria. For example, it has been shown that
phosphorylation of serine 74 can upregulate dCK activity and this event can be detected
in vivo (Amsailale et al 2012). Generally, phosphorylation does not occur in bacteria so a
modification critical to dCK TM and dCK DM activity may not have occurred when
expressed in E. coli. Therefore, dCK TM and dCK DM may exhibit altered activity from
what we observed in the kinase assay when introduced into mammalian cells. This could
107
explain why we saw a 4-fold increase in L-FMAU specificity in dCK TM compared to
dCK DM yet only saw a slight increase in total accumulated radioactive L-FMAU in our
uptake assay (Figure 8). We have shown that we can successfully purify recombinant
dCK WT from transfected 293T cells, a human embryonic kidney cell line (Figure 2B).
Kinase assay results from mammalian derived dCK TM and dCK DM for L-FMAU are
to be determined. In their paper, McSorley et al. demonstrated that phosphorylation of
serine 74 results in increased activity for deoxycytidine and deoxycytidine analogs. dCK
derived from mammalian cells may exibit greater activity for thymidine analogs (LFMAU) compared to dCK derived from bacterial cells as a result of the phosphorylation
at serine 74 (McSorley et al. 2008).
Because phosphorylation of serine 74 has been shown to upregulate dCK’s
activity, it would be interesting to see if substitutions at site 74 could further enhance the
activity of dCK TM for L-FMAU or other nucleosides. In their paper, McSorley et al.
successfully raised dCK activity 11-fold for deoxycytidine by introducing the substituion
S74E that mimics the phosphorylated serine (McSorley et al. 2008). We hypothesize
that a deoxycytidine quadruple mutant (dCK QM: S74E, A100V, R104M, D133A) will
exhibit broad substrate specificity and a higher turnover rate than dCK DM and dCK TM.
It has been proposed that phosphorylation of S74 results in a conformational change in
dCK, and so it will be important to test if this change has a drastic effect on substrate
specificity (Keszler et al. 2004).
Results from the kinase assay raised the question of whether or not greater
activity of dCK TM compared to dCK DM for L-FMAU translates to greater uptake of LFMAU within the cell. Furthermore, we wanted to know if non-his-tagged dCK mutants
108
would act drastically different than what we observed in the kinase assay. We addressed
both of these questions using a radioactive uptake assay. In support of our kinase assay
results in which dCK TM was determined to exhibit greater specificity for L-FMAU than
dCK DM, we observed greater uptake of L-FMAU in L1210-10K cells over expressing
dCK TM compared to L1210-10K cells over expressing dCK DM (Figure 9). The
difference between uptake of L-FMAU was not to the extent that we had hoped. dCK
TM exhibited 4-fold greater specificity over dCK DM yet only a 1.3-fold increase in LFMAU uptake. The difference in uptake was determined to be not significant with a pvalue of 0.0988 using a one-tailed unpaired student’s t test. One explanation for why we
did not see as great of an uptake of L-FMAU as we expected is that dCK DM exhibited a
greater turnover rate than dCK TM for L-FMAU. dCK DM showed a maximum velocity
(1.671 nmol/min/g) over twice that of dCK TM (0.724 nmol/min/g). Although
binding specificity was not as great, dCK DM could phosphorylate L-FMAU more
quickly which can result in increased accumulation of L-FMAU.
In our lab, dCK TM has been investigated as a new reporter gene for monitoring
of stem cell transplants with positron emission tomography (PET) (McCracken et al. in
writing). In this study, a murine xenograft model was employed to test dCK TM and
dCK DM specificity in vivo. Tumors composed of L1210-10K cells transduced with
either dCK TM or dCK DM were grown in mice and PET imaging with L-FMAU was
performed. In support of our in vitro experiments, tumors expressing dCK TM were
shown to take up two fold more L-FMAU over tumors expressing dCK DM.
Interestingly, the in vivo uptake difference between dCK TM and dCK DM was
greater than the uptake seen in vitro. dCK has been shown to be upregulated and greater
109
phosphorylation of S74 has been detected in rapidly proliferating lymphoid cells (Arner
and Eriksson 1995, Nair-Gill 2010 ). We do not believe the difference in uptake
observed between transduced L1210-10K cells in culture and transduced L1210-10K
cells in the mouse xenograft is a result of differing proliferation rates because L1210 cells
grown in culture have a similar doubling time (8-10 hours) to L1210 cells grown in subcutaneous xenografts (11-13 hours) (Teicher B.A. 2006, Dykes 2008). One possible
explanation for the observed difference is that the experimental techniques are not the
same. In the in vitro uptake assay, cells are incubated with probes and then washed
several times so that only probe that is contained inside the cells is counted. During the
wash steps, cells can be ruptured and some cells may even escape the filter leading to a
decrease in total radioactivity measured. In the in vivo assay, total radioactivity is
measured by ROI analysis of the PET image taken while the mouse is still alive and
quantified as fold change over L1210-10K signal. Therefore, the in vitro assay is a less
accurate determination of uptake because some signal may be lost leading to a decrease
in total radioactivity measured.
dCK DM has been demonstrated as a reporter gene for PET imaging by Likar et
al. in combination with the probe FEAU. Consistent with our in vitro uptake assay
results, they observed greater accumulation of FEAU in cells transduced with dCK DM
compared to dCK WT. They determined that dCK DM phosphorylates FEAU at levels
comparable to one of the most commonly used reporter genes, HSV-TK1. FEAU and LFMAU are both thymidine analogs. FEAU differs from the unnatural analog L-FMAU
by an ethyl group in place of the methyl group at the 5’ carbon of the nucleobase. As
stated earlier, the R104M mutation in dCK TM opens up the active site making it larger
110
and this change generally enhances specificity rather than altering specificity. We would
expect R104M to enhance binding for FEAU as this molecule is slightly larger than LFMAU. Furthermore, we would expect the A100V mutation to hinder FEAU as the
larger valine residue would favor the smaller L-FMAU molecule. We observed greater
uptake of FEAU in dCK DM and greater uptake of L-FMAU in dCK TM.
Different turnover rates between dCK TM and dCK DM can also explain the
observed differences in uptake for L-FMAU and FEAU. The efficiency of enzyme
catalysis for a particular substrate can be explained by taking into account both the
binding efficiency (Km) and the turnover rate (velocity, Vmax). For example, for
thymidine we observed a lower Km from dCK TM (31.490 M) than from dCK DM
(185.600 M), a 6-fold difference, however, L1210-10K cells over expressing dCK TM
or dCK DM both accumulated similar amounts of thymidine in our uptake assay (Figure
9). This inconsistency can be explained by dCK DM’s higher turnover rate (6.408
nmol/min/g) for thymidine compared to dCK TM (3.623 nmol/min/g) resulting in
equal uptake despite poorer specificity. We hypothesize that dCK DM will exhibit
poorer binding specificity (larger Km value) for FEAU than dCK TM but a much greater
turnover rate (larger Vmax) enabling the enhanced accumulation seen in our in vitro
assay.
The high turnover rate of phosphorylated substrate imparted by the dCK mutants
may have implications when introduced into the cell. We noticed deoxycytidine uptake
was 100-fold greater than thymidine uptake in cells overexpressing dCK TM and dCK
DM in our radioactive uptake assay. Furthermore, L-FMAU uptake was ~10-fold greater
than thymidine uptake in cells over expressing dCK TM and dCK DM. This is expected
111
as the presence of over expressed dCK mutants should phosphorylate and trap far more
substrate than the endogenous TK1 can phosphorylate thymidine. In their paper, Austin
et al. measured a greater quantity of thymidine triphosphate than deoxycytidine
triphosphate in wild type murine thymocytes indicating that these cells normally maintain
slightly more thymidine than deoxycytidine. Using a genetic knockout approach for dCK
and TK1, they observed that unnatural nucleotide pool imbalances induced by
preferential salvage of either thymidine or deoxycytidine can result in DNA replication
stress. The question of whether over expression of a highly active deoxyribonucleoside
kinase will have negative implications in the cell will need to be addressed (Austin et al.
in print).
Rational design of dCK has been implicated in a variety of applications in
addition to PET imaging of transplanted cells. In the cell, dCK is responsible for the
phosphorylation and therefore the activation of several pyrimidine-based prodrugs used
for anti-viral (3TC, ddC) and anti-cancer (gemcitibine, AraC) therapies (Hapke et al.
1996). Cells lacking dCK become resistant to a variety of nuceloside analogs including
AraC that can lead to diminished tumor response. In vivo retroviral gene transfer studies
in mice have shown that introduction of dCK into these resistant tumors can result in
prodrug accumulation and tumor response (Blackstock et al 2001). Thus, retroviral gene
transfer serves as a potential tool for the treatment of resistant tumors. As we have seen,
the rational design of dCK by introduction of point mutations within the active site can
increase the specificity and uptake of thymidine and thymidine analogs including LFMAU. The effect of the mutations A100V, R104M, and D133A on dCK activity should
be investigated for increased specificity of thymidine based prodrugs.
112
dCK is the most promiscuous of the human deoxynucleoside kinases because it
can phosphorylate deoxycytidine, deoxyguanosine, and deoxyadenosine. As we have
shown, the residues at sites 100, 104, and 133 are particularly important to dCK substrate
specificity and mutation of these sites can be used to guide substrate specificity. By
making the mutations A100V, R104M, and D133A, we were able to increase specificity
for thymidine and the thymidine analog L-FMAU. The R104M mutation can decrease
steric hindrance of substrate occupation within the active site of dCK and the D133A
mutation can increase hydrogen bonding of thymidine analogs within the active site of
dCK. Finally, the A100V mutation is particularly important to improving activity for
thymidine and can help broaden dCK specificity. Introduction of single point mutations
to the active site of dCK is an easy and effective way to alter and guide dCK’s substrate
specificity.
113
Works Cited
Adkins, N. L. & P. T. Georgel (2011) MeCP2: structure and function. Biochem Cell Biol,
89, 1-11.
Amsailale R., E. Van Den Neste, A. Arts, E. Starczewska, F. Bontemps, C. Smal (2012)
Phosphorylation of deoxycytidine kinase on Ser-74: Impact on kinetic
properties and nucleoside analog activation in cancer cells. Biochem
Pharmacol. 84(1):43-51.
Arner E.S., S. Eriksson (1995) Mammalian deoxyribonucleoside kinases. Pharmacol
Ther. 67(2):155-86.
Arya, G. & T. Schlick (2009) A tale of tails: how histone tails mediate chromatin
compaction in different salt and linker histone environments. J Phys Chem A, 113,
4045-59.
Austin W.R., A.L. Armijo, D.O. Campbell, A.S. Singh, T. Hsieh, D. Nathanson, H.R.
Herschman, M.E. Phelps, O.N. Witte, J. Czernin, C.G. Radu (2012) A critical
role for deoxycytidine kinase in protecting T cell precursors from thymidineinduced DNA replication stress. In print.
Bali, P., H. I. Im & P. J. Kenny (2011) Methylation, memory and addiction. Epigenetics,
6, 671-4.Benjamin D., Magrath I.T., Maguire R., Janus C., Todd H.D., Parsons
R.G. (1982) Immunoglobulin secretion by cell lines derived from African and
American undifferentiated lymphomas of Burkitt's and non-Burkitt's type. J
Immunol, 129 (3), 1336-42.
Berger C., M.E. Flowers, E.H. Warren, S.R. Riddell (2005) Analysis of transgenespecific immune responses that limit the in vivo persistence of adoptively
transferred HSV-TK-modified donor T cells after allogeneic hematopoietic cell
transplantation. Blood. 107(6):2294-302.
Bernstein B.E., J.K. Tong, S.L. Schreiber (2000) Genomewide studies of histone
deacetylase function in yeast. Proc Natl Acad Sci U S A., 5;97(25):13708-13
Bird A. (2002) DNA methylation patterns and epigenetic memory. Genes and
Development, 16:6-21.
Blackstock A.W., H. Lightfoot, L.D. Case, J.E. Tepper, S.K. Mukherji, B.S. Mitchell,
S.G.
uptake and elimination of 2',2'-difluoro-2'-deoxycytidine (gemcitabine) after
deoxycytidine kinase gene transfer: correlation with in vivo tumor response.
Clin Cancer Res. 7(10):3263-8.
Blomen, V. A. & J. Boonstra (2011) Stable transmission of reversible modifications:
maintenance of epigenetic information through the cell cycle. Cell Mol Life Sci,
68, 27-44.
Bonasio, R., S. Tu & D. Reinberg (2010) Molecular signals of epigenetic states. Science,
330, 612-6.
Bonilla, F. A. & H. C. Oettgen (2010) Adaptive immunity. J Allergy Clin Immunol, 125,
S33-40.
Cameron E.E., K.E. Bachman, S. Myohanen, J.G. Herman, S.B. Baylin (1999) Synergy
of demethylation and histone deacetylase inhibition in the re-expression of genes
silenced in cancer. Nature Genetics. 21, 103-107.
114
Carrozza M.J., B. Li, L. Florens, T. Suganuma, S.K. Swanson, K.K. Lee, W.J. Shia, S.
Anderson, J. Yates, M.P. Washburn, J.L. Workman (2005) Histone H3
methylation by Set2 directs deacetylation of coding regions by Rpd3S to suppress
spurious intragenic transcription. Cell, 123:581–92
Chen, H., R. J. Lin, W. Xie, D. Wilpitz, R. M. Evans (1999) Regulation of HormoneInduced Histone Hyperaceytlation and Gene Activation via Acetylation of an
Acetylase. Cell, 98, 675-686.
Chen, Z. X. & A. D. Riggs (2011) DNA methylation and demethylation in mammals. J
Biol Chem, 286, 18347-53.
Cheng Y. (2001) Potential use of antiviral L(-)nucleoside analogues for the
prevention or treatment of viral associated cancers. Canc Let. 162(1):S33-S
37.
Cowland, J. B., C. Hother & K. Grønbaek (2007) MicroRNAs and cancer. APMIS, 115,
1090-106.
Dantuma, N. P., C. Heinen & D. Hoogstraten (2009) The ubiquitin receptor Rad23: at the
crossroads of nucleotide excision repair and proteasomal degradation. DNA
Repair (Amst), 8, 449-60.
Department of Health and Human Services (DHHS) (2001). Expanded coverage of
positron emission tomography (PET) scans and related claims processing
changes. Health Care Financing Administration Publication 60AB. Transmittal
AB-01-54. April 10
Doerr J.R., Malone C.S., Fike F.M., Gordon M.S., Soghomonian S.V., Thomas R.K., Tao
Q., Murray P.G., Diehl V., Teitell M.A., Wall R. (2005) Patterned CpG
methylation of silenced B cell gene promoters in classical Hodgkin lymphomaderived and primary effusion lymphoma cell lines. J Mol Biol, 350(4):631-40
Dykes D.J., W.R. Waud (2008) Murine L1210 and P388 Leukemias. Pharm Drug Disc
Dev. 8(2)23-40.
Eberharter A., P.B. Becker (2002) Histone acetylation: a switch between repressive and
permissive chromatin. Second in review series on chromatin dynamics. EMBO
Rep. 3(3):224-9.
Espino, P. S., B. Drobic, K. L. Dunn & J. R. Davie (2005) Histone modifications as a
platform for cancer therapy. J Cell Biochem, 94, 1088-102.
Esteller M., S. R. Hamilton, P. C. Burger, S. B. Baylin, J. G. Herman (1999) Inactivation
of the DNA repair gene O6-methylguanine DNA methyltransferase by promoter
methylation is a common event in primary human neoplasia. Caner Res.,
59(4):793-7.
Feil R., J. Charlton, A.P. Bird, J. Walter, W. Reik (1994) Methylation analysis on
individual chromosomes: improved protocol for bisulphite genomic
sequencing. Nucleic Acids Res. V.22(4), PMC307863.
Gambhir S.S., J.R. Barrio, L. Wu, M. Iver, M. Namayari, N. Sayamurthy, E. Bauer, C.
Parrish, D.C. MacLaren, A.R. Borghei, L.A. Green. S. Sharfstein, A.J. Berk, S.R.
Cherry, M.E. Phelps, H.R. Herschman (1998) Imaging of adenoviral-directed
herpes simplex virus type 1 thymidine kinase reporter gene expression in mice
with radiolabeled Gancyclovir. J Nucl Med. 39(11):2003-11.
Gambhir S.S., E. Bauer, M.E. Black, Q. Liang, M.S. Kokoris, J.R. Barrio, M. Iyer, M.
115
Namayari, M.E. Phelps, H.R. Herschman. (200) A mutant herpes simplex virus
type 1 thymidine kinase reporter gene shows improved sensitivity for imaging
reporter gene expression with positron emission tomography. Proc Natl Acad Sci
USA, 97(6):2785-90.
Gisler R., M. Sigvardsson (2002) The Human V-PreB Promoter Is a Target for
Coordinated Activation by Early B Cell Factor and E47. J. Immnol.,
168(10):5130-8.
Graff J.R., J. G. Herman, S. Myöhänen, S. B. Baylin, P.M. Vertino (1997) Mapping
Patterns of CpG Island Methylation in Normal and Neoplastic Cells Implicates
Both Upstream and Downstream Regions in de Novo Methylation. J Biol Chem.
272(35):22322-9.
Gyurkocza, B., A. Rezvani, R. F. Storb (2010) Allogenic hematopoietic cell
transplantation: the state of the art. Expert Rev Hematol. 3, 285-299.
Hahm K., P. Ernst, K. Lo, G. S. Kim, C. Turck, S. T. Smale (1994) The lymphoid
transcription factor LyF-1 is encoded by specific, alternatively spliced
mRNAs derived from the Ikaros gene. Mol. Cell. Biol., 11-7111-7123
Halfmann, R. & S. Lindquist (2010) Epigenetics in the extreme: prions and the
inheritance of environmentally acquired traits. Science, 330, 629-32.
Hapke D.M., A.P. Stegmann, B.S. Mitchell (1996) Retroviral transfer of deoxycytidine
kinase into tumor cell lines enhances nucleoside toxicity. Cancer Res.
56(10):2343-7.
Hauser J., A. Wallenius, N. Syeshnikova, J. Saarikettu, T. Grundström (2010)
Calmodulin inhibition of E2A stops expression of surrogate light chains of the
pre-B-cell receptor and CD19. Mol Immunol., 47(5):1031-8
Holland J.P., V. Divilov, N.H. Bander, P.M. Smith-Jones, S.M. Larson, J.S. Lewis (2010)
89Zr-DFO-J591 for immunoPET of prostate-specific membrane antigen in
vivo. J Nucl Med. 51(8):1293-300.
Hurwitz R., J. Hozier, T. LeBien, J. Minowada, K. Gajl-Peczalska, I. Kubonishi, J.
Kersey
(1979) Characterization of a leukemic cell line of the pre-B phenotype. Int J
Cancer, 23(2): 174-80.
Iyodigan P. and S. Lutz (2008) Systematic exploration of active site mutatins on
human deoxycytidine kinase substrate specificity. Biochemistry.
47(16):4711-20.
Janeway C.A. Jr., Medzhitov R. (2002) Innate immune recognition. Annu Rev Immunol.
20:197-216.
Jones S., P.D. Peng, S. Yang, C. Hsu, C.J. Cohen, Y. Zhao, J. Abad, Z. Zheng, S.A.
Rosenberg, R.A. Morgan (2009) Lentiviral vector design for optimal T cell
receptor gene expression in the transduction of peripheral blood l
ymphocytes and tumor-infiltrating lymphocytes. Hum Gene Ther. 20(6):63040.
Jordheim L.P., E. Cros, M.H. Gouy, C.M. Galmarini, S. Peyrottes, J. Mackey, C.
Perigaud,
C. Dumontet (2004) Characterization of a gemcitabine-resistant murine
leukemic cell line: reversion of in vitro resistance by a mononucleotide
prodrug. Clin Cancer Res. 10(16):5614-21.
116
Jurkowska, R. Z., T. P. Jurkowski & A. Jeltsch (2011) Structure and function of
mammalian DNA methyltransferases. Chembiochem, 12, 206-22.
Kang, J.H., J.K.Chung (2008) Molecular-Genetic Imaging Based on Reporter Gene
Expression. J Nucl Med, 2:164S-79S.
Keszler G., T. Spasokoukotskaja, Z. Csapo, I. Taliandis, S. Eriksson, M. Staub,M.
Sasvari-Szekely (2004) Activation of deoxycytidine kinase in lymphocytes is
calcium dependent and involves a conformational change detectable by
natice immunostaining. Biochem Pharmacol. 67(5):947-55.
Kiiamitsa K., J.A. Solinger, and W. Heyer (2003) NADH-coupled microplate
photometric assay for kinetic studies of ATP-hydrolyzing enzymes with low
and high specific activities. Anal Biochem. 321(2):266-71.
Kong W., K. Engel, J. Wang (2004) Mammalian nucleoside transporters. Curr Drug
Metab. 5(1):63-84.
Konrad A., E. Yarunova , T. Tinta, L. Piskur, D.A. Liberles (2012) The global
distribution and evolution of deoxyribonucleoside kinases in bacteria. Gene.
492(1):117-20
Laing R.E., M.A. Walter, D.O. Campbell, H.R. Herschman, N. Satyamurthy, M.E.
Phelps,
J. Czernin, O.N. Witte, C.G. Radu (2009) Noninvasive prediction of tumor
responses to gemcitibine using positron emission tomography. Proc Natl Acad Sci
U S A. 106(8):2847-52.
Leeb, C., M. Jurga, C. McGuckin, N. Forraz, C. Thallinger, R. Moriggl & L. Kenner
(2011) New perspectives in stem cell research: beyond embryonic stem cells. Cell
Prolif, 44 Suppl 1, 9-14.
Li, G. & D. Reinberg (2011) Chromatin higher-order structures and gene regulation. Curr
Opin Genet Dev, 21, 175-86.
epigenomic reprogramming in human induced pluripotent stem cells. Nature, 471, 68-73.
Likar Y., J. Zurita, K. Dobrenkov, L. Shenker, S. Cai, A. Neschadim, J. A. Medin, M.
Sadelain, H. Hricak, V. Ponomarev (2010) A new pyrimidine-specific reporter
gene: a mutated human deoxycytidine kinase suitable for PET during
treatment with acycloguanosine-based cytotoxic drugs. J Nucl Med.
51(9):1395-403.
Ling, C. & L. Groop (2009) Epigenetics: a molecular link between environmental factors
and type 2 diabetes. Diabetes, 58, 2718-25.
Lister, R., M. Pelizzola, Y. S. Kida, R. D. Hawkins, J. R. Nery, G. Hon, J. AntosiewiczBourget, R. O'Malley, R. Castanon, S. Klugman, M. Downes, R. Yu, R. Stewart,
B. Ren, J. A. Thomson, R. M. Evans & J. R. Ecker (2011) Hotspots of aberrant
Malone C. S., M.D. Miner, J.R. Doerr, J.P. Jackson, S.E. Jacobsen, R. Wall, M.
Teitell (2001) CmC(A/T)GG DNA methylation in mature B cell lymphoma gene
silencing. Proc Natl Acad Sci U S A. 98(18): 10404-9.
McSorley T., S. Ort, S. Hazra, A. Lavie, M. Konfrad (2008) Mimicking phosphorylation
of Ser-74 on human deoxycytidine kinase selectively increases catalytic
activity for dC and dC analogues. FEBS Lett. 582(5):720-4.
Mehta K., Ozpolat B., Gohil K., Aggarwal B. B. (2009) Recombinant proteins and
genomics in cancer therapy. Prin of Canc Biother. 53-83.
117
Milagro, F. I., J. Campión, P. Cordero, E. Goyenechea, A. M. Gómez-Uriz, I. Abete, M.
A. Zulet & J. A. Martínez (2011) A dual epigenomic approach for the search of
obesity biomarkers: DNA methylation in relation to diet-induced weight loss.
FASEB J, 25, 1378-89.
Nair-Gill, E.D., C.J. Shu, C.G. Radu, O.N. Witte (2008) Non-invasive imaging of
adaptive immunity using positron emission tomography. Immunol Rev. 221:21428
Nair-Gill, E., S.M Wiltzius, X.X. Wei, D. Cheng, M. Reidinger, C.G. Radu, O.N. Witte
(2010) PET probes for distinct metabolic pathways have different cell
specificities during immune responses in mice. J Clin Invest. 120(6):2005-15
Namba M, Ohtsuki T, Mori M, Togawa A, Wada H, Sugihara T, Yawata Y, Kimoto T.
(1989) Establishment of five human myeloma cell lines. In vitro Cell Dev Biol,
(8):723-9.
Neschadim A., J.A. McCart, A. Keating, J.A. Medin (2007) A roadmap to safe, efficient,
and stable lentivirus-mediated gene therapy with hematopoietic cell
transplantation. Biol Blood Marrow Transplant. 12(12):1407-16.
Nimura, K., K. Ura & Y. Kaneda (2010) Histone methyltransferases: regulation of
transcription and contribution to human disease. J Mol Med, 88, 1213-20.
Palii S.S., B.O. Van Emburgh, U.T. Sankpal, K.D. Brown, K.D. Robertson (2008)
DNA methylation inhibitor 5-Aza-2'-deoxycytidine induces reversible genomewide DNA damage that is distinctly influenced by DNA methyltransferases 1 and
3B. Mol Cell Biol. 28(2):752-71.
Parker, M. J., S. Licence, L. Erlandsson, G. R. Galler, L. Chakalova, C. S. Osborne, G.
Morgan, P. Fraser, H. Jumaa, T. H. Winkler, J. Skok & I. L. Mårtensson (2005)
The pre-B-cell receptor induces silencing of VpreB and lambda5 transcription.
EMBO J, 24, 3895-905.
Patterson, J.C. and M. L. Mosley (2005) How Available is Positron Emission
Tomography in the United States? Mol Imaging Biol. 7(3):197-200.
Peserico, A. & C. Simone (2011) Physical and functional HAT/HDAC interplay regulates
protein acetylation balance. J Biomed Biotechnol, 2011, 371832.
Qureshi, I. A. & M. F. Mehler (2010) Emerging role of epigenetics in stroke: part 1:
DNA methylation and chromatin modifications. Arch Neurol, 67, 1316-22.
Radu C.G., C.J Shu, E. Nair-Gill, S.M. Shelly, J.R. Barrio, N. Satyamurthy, M.E. Phelps,
O.N. Witte (2008) Molecular imaging of lymphoid organs and immune
activation by positron emission tomography with a new [18F]-labeled 2’deoxycytidine analog. Nat Med. 14(7):783-8
Ramírez, J., K. Lukin & J. Hagman (2010) From hematopoietic progenitors to B cells:
mechanisms of lineage restriction and commitment. Curr Opin Immunol, 22, 17784.
Sabbattini P., M. Lundgren, A. Georgiou, C. Chow, G. Warnes, N. Dillon (2001) Binding
of Ikaros to the 5 promoter silences transcription through a mechanism that does
not require heterochromatin formation. EMBO J., 20(11):2812-22.
Sabini E., S. Ort, C. Monnerjahn, M. Konrad, A. Lavie (2003) Structure of human dCK
suggests strategies to improve anticancer and antiviral therapy. Nat Struct
Biol. 10(7):513-9.
Sandrini M.P., O. Shannon, A.R. Clausen, L. Bjorck, J. Piskur (2007)
118
Deoxyribonucleoside kinases activate nucleoside antibiotics in severely
pathogenic bacteria. Antimicrob Agents Chemother. 51(8):2726-32
Shafa, M., R. Krawetz & D. E. Rancourt (2010) Returning to the stem state: epigenetics
of recapitulating pre-differentiation chromatin structure. Bioessays, 32, 791-9.
Sharma, S., T. K. Kelly & P. A. Jones (2010) Epigenetics in cancer. Carcinogenesis, 31,
27-36.
Schein, C.H. (1989) Production of soluble recombinant proteins in bacteria. Nat
Biotech. (7)1141-1149.
Schelling P., G. Folkers, and L. Scapozza (2001) A spectrophotometric assay for
quantitative determination of kcat of herpes simplex virus type 1 thymidine
kinase substrates. Anal Biochem. 295(1):82-87.
Shafiee M., J. Griffon, G. Gosselin, A. Cambi, S. Vincenzetti, A. Vita, S. Eriksson, J.
Imbach, G. Maury (1998) A comparison of the enantioselectivities of human
deoxycytidine kinase and human cytidine deaminase. Biochem Pharmacol.
56(9):1237-42.
Shahbazian M.D., Grunstein M. (2007) Functions of site-specific histone acetylation and
deacetylation. Annu Rev Biochem, 76:75-100.
Shu, C.J., D. O. Campbell, J. T. Lee, A. Q. Tran, J. C. Wengrod, O. N. Witte, M. E.
Phelps,
N. Satyamurthy, J. Czernin, C. G. Radu (2010) Novel PET Probes Specific for
Deoxycytidine Kinase. J Nucl Med. 51(7):1092-8
Sigvardsson M., M. O’Riordan (1997) EBF and E47 Collaborate to Induce Expression
of the Endogenous Immunoglobulin Surrogate Light Chain Genes. Immunity,
7(1):25-36.
Teicher B.A. (2006) Tumor models for efficacy determination. Mol Cancer Ther.
5(10):2435-43.
Terpe K. (2002) Overview of tag protein fusions: from molecular and biochemical
fundamentals to commercial systems. Appl Microbiol Biotechnol. 60(5):52333.
Thompson E.C., B.S. Cobb, P. Sabbattini, S. Meixlsperger, V. arelho, D. Liberg,
B. Taylor, N. Dillon, K. Georgoplous, H. Iumaa, S.T. Smale, A.G. Fisher, M.
Merkenschlagerr (2007) Ikaros DNA-binding proteins as integral compnents of B
cell developmental-stage-specific regulatory circuits. Immunity, 26(3):335-44.
Toy G., W.R. Austin, H.I. Liao, D. Cheng, A. Singh, D.O. Campbell, T.O Ishikawa, L.W.
Lehmann, N. Satyamurthy, M.E. Phelps, H.R. Herschman, J. Czernin, O.N.
Witte, C.G. Radu (2010) Requirement for deoxycytidine kinase in T and B
lymphocyte development. Proc Natl Acad Sci U S A, 107(12):5551-6
Traversari C., S. Marktel, Z. Magnani, P. Mangia, V. Russo, F. Ciceri, C. Bonini, C.
Bordignon (2007) The potential immunogenicity of the TK suicide gene does not
prevent full clinical benefit associated with the use of TK-transduce donor
lymphocytes in HSCT for hematologic malignancies. Blood. 109(11):4708-15
Trounson A., R. G. Thakar, G. Lomax, D. Gibbons (2011) Clinical trials for stem cell
therapies. BMC Med. 10;9:52.
Usova E.V., S. Eriksson (1997) The effects of high salt concentrations on the
regulation of the substrate specificity of human recombinant deoxycytidine
kinase. Eur J Biochem. 248(3):762-6.
119
Verdone L., M. Caserta, E. Di Mauro (2005) Role of histone acetylation in the control
of gene expression. Biochem Cell Biol. 83(3):344-53.
Waterborg J.H. (2002) Dynamics of histone acetylation in vivo. A function for
acetylation turnover? Biochem. Cell Biol, 80:363–78.
Waerzeggers Y., P. Monfared, T. Viel, A. Winkeler, J. Voges, A. H. Jacobs (2009)
Methods to monitor gene therapy with molecular imaging. Methods. 48(2):146-60
Wang W., K. Pan, Y. Chen, C. Huang, X. Zhang. (2012) The acetylation of transcription
factor HBP1 by p300/CBP enhances p16INK4A expression. Nucleic Acids Res.
40(3): 981-995.
Wong, C. C., J. Mill & C. Fernandes (2011) Drugs and addiction: an introduction to
epigenetics. Addiction, 106, 480-9.
Zhang, M., G. Srivastava & L. Lu (2004) The pre-B cell receptor and its function during
B cell development. Cell Mol Immunol, 1, 89-94.
Zhou, H., H. Hu & M. Lai (2010) Non-coding RNAs and their epigenetic regulatory
mechanisms. Biol Cell, 102, 645-55.
Zhu, J. K. (2009) Active DNA demethylation mediated by DNA glycosylases. Annu Rev
Genet, 43, 143-66.
Zhu X., L. A. Sylvia, E. Shereen (2007) Ikaros is Regulated through Multiple Histone
Modifications and Deoxyribonucleic Acid Methylation in the Pituitary. Mol
Endocrinol. 21(5):1205-15.
120