CALIFORNIA STATE UNIVERSITY, NOTHRIDGE
THE USE OF THE WIRE HANG TEST AND A NOVEL GENOTYPING METHOD
TO FURTHER DETERMINE THE M712T MOUSE MODEL
A thesis submitted in partial fulfillment of the requirements
For the degree of Master of Science
in Biology
By
Mirey Qubrosi
August 2013
The thesis of Mirey Qubrosi is approved:
____________________________
______________________
Dr. Steven Oppenheimer
Date
____________________________
______________________
Dr. Stan Metzenberg
Date
____________________________
_______________________
Dr. Aida Metzenberg, Chair
Date
California State University, Northridge
Acknowledgement
Foremost, I would like to express my sincere gratitude to my advisor Dr. Aida
Metzenberg for her continuous support of my masters and research, for her patience,
motivation, enthusiasm, and immense knowledge. Her guidance helped me in all the time
of research and writing of this thesis. She is a jewel. Besides my advisor, I would like to
thank the rest of my thesis committee: Dr. Stan Metzenberg and Dr. Steven Oppenheimer
for their assistance and suggestions throughout my project. Finally, I would like to thank
my parents for their unconditional love and their support throughout my years of
education, both morally and financially.
iii
TABLE OF CONTENTS
Signature page
ii
Acknowledgments
iii
List of Tables
v
List of Figures
vi
Abstract
vii
Chapter 1: Introduction
1
Chapter 2: Materials and Methods
17
Chapter 3: Results
26
Chapter 4: Discussion
39
References
46
Appendix
53
iv
Tables
Table 1: Primers used for sequencing
23
Table 2: PCR reaction mix for the wild-type GNE allele
23
Table 3: PCR reaction mix for the mutant GNE allele
24
Table 4: Average wire hang times for each mouse
26
Table 5: Average wire hang testing values for each group
28
Table 6: Significant value of each wire hang test
28
Table 7: Wire hang testing values for the heterozygous group
29
Table 8: Mean wire hang testing values for the Wild-type group
29
Table 9: Mean wire hang testing values for the Mutant group
30
Table 10: P-values comparison between groups
30
Table 11: The mean value of the beginning weights for each group
31
Table 12: The mean final weights of each group
31
Table 13: P-value between the beginning and final weights of each group 31
v
Figures
Figure 1: Wire hang testing time of each group
28
Figure 2: Hang testing times of each group during each week
29
Figure 3: Beginning and final weights of the mice in each group
30
Figure 4: Results of the gel for genotyping
32
Figure 5: Results of the partial GNE gene amplification
33
Figure 6: Confirmation of the specific GNE genotype
34
Figure 7: Sequence of Mouse ID 8002
36
Figure 8: Sequence of Mouse ID 8010
36
Figure 9: Sequence of Mouse ID 9005
37
Figure 10: Results of the novel genotyping method
37
vi
Abstract
THE USE OF THE WIRE HANG TEST AND A NOVEL GENOTYPING METHOD
TO FURTHER DETERMINE THE M712T MOUSE MODEL
A thesis submitted in partial fulfillment of the requirements
For the degree of Master of Science
in Biology
By
Mirey Qubrosi
Hereditary Inclusion Body Myopathy (HIBM) is a disorder caused by a mutation
in the GNE gene. Although there are 60 known mutations, this research study focused on
the M712T mutation. The mutation causes complications in the production of sialic acid,
and produces skeletal muscle wasting. The next step in the development of a cure is to
produce an animal model. The purpose of this research study was to use the wire hang
test to see if mice heterozygous and homozygous for the disorder developed strength
deficits. I also tested a new method of genotyping that is faster and cheaper to perform
than testing by restriction analysis.
I used an animal model with the M712T mutation that was between 12-16 months of age.
I tested their grip strength through the wire hang test. Also, I used an advanced rapid
method of genotyping the mouse, which included designing two sets of primers specific
for the mice GNE gene to determine which mutation the mice contained.
The wire-hang test showed that the wild-type mice (WT) performed much better than
vii
both the heterozygote (HT) and mutants (MT). On average as a group, mutants performed
the worst (32.62 s), followed by heterozygotes (47.35 s), and then wild-type mice (89.33
s). Moreover, the results show that there is a definite difference between the wild-type
and mutant mice; both the mutant and heterozygous mice showed similar levels of
strength, which indicates that even
heterozygotes for the disorder suffer losses in skeletal muscle. Furthermore, my novel
genotyping method also showed that it can reliably determine the genotype of the mice.
This method is cheaper and quicker to perform
viii
I
Introduction
Hereditary inclusion body myopathy (HIBM) is also referred to as Distal
Myopathy with Rimmed Vacuoles (DMRV), and Quadriceps Sparing Myopathy (QSM).
HIBM is an adult-onset neuromuscular disorder that causes skeletal muscle wasting in
affected individuals , primarily affecting the tibilais anterior muscle, while leaving
smooth and brain muscle tissue unaffected (Paccalet et al., 2010). It is most known for its
unusual phenotype as a quadriceps-sparing myopathy. HIBM can be inherited as an
autosomal dominant or autosomal recessive trait. Some mutations are present as
homozygous alterations, and some affected individuals have compound mutations in this
gene. The affected gene is GNE which encodes a bifunctional enzyme uridine
diphosphate-N-acetylglucosamine (UDP-GlacNAc) 2-epimerase and Nacetylmannosamine kinase (MNK), this enzyme has two separate domains, each of which
play a role in synthesizing sialic acid, which is the chief component implicated in the
development of HIBM. The main HIBM genotype that I focused on in my thesis research
was the M712T mutation that primarily affects Iranian Jews. This disorder has been
spread throughout the population through the founder effect, which is when a small
founding colony spreads a limited number of genes that are carried along to descendants.
Phenotypic Effects
Individuals affected with HIBM worldwide present the same unique phenotype,
but carry different mutations. The homozygous mutation, occurring in all Persian Jewish
1
patients, leads to the same phenotypic disorder as in all the other identified compound
heterozygous mutations in both GNE domains (Salama et al., 2005). HIBM is a
neuromuscular disease that is characterized by slow progressive weakness and wasting of
both distal and proximal muscles of the upper and lower limbs (Amsili et al., 2008). The
onset of the symptoms normally occurs between the ages of 20-30 years. The progression
of muscle weakness continues for one or two decades, and after the second or third
decade of symptom onset, the affected individuals become wheelchair bound. A unique
feature of this disease is sparing of the quadriceps muscles, either partially or completely,
even during the advanced stages of the disease (Huzing et al., 2005).
During the early stages, weakness and atrophy of the foot extensors is observed,
followed by the involvement of forearm flexor muscles, girdle and axial muscles. In
advanced stages, the muscles of the shoulder girdle, as well as the deltoid, biceps, and
triceps muscles become severely affected. Even at the later stages of the disorder, the
ocular, cranial nerves, sensory system and sensation, cognition, coordination, and
pharyngeal muscles are unaffected (Huzing et al., 2009;Malicdan et al., 2008) . However,
HIBM has been associated with cardiac involvement in a small number of patients with
advanced stage HIBM. The early signs of HIBM are difficulty running, walking on heels,
weakening of the index finger, and loss of balance. Individuals with HIBM do not usually
show muscle inflammation; however, a few patients have experienced inflammatory
symptoms. Histological features seen in HIBM patients are muscle fiber degeneration and
the development of cytoplasmic or nuclear filamentous inclusions. Furthermore, no
specific laboratory findings are consistent with HIBM; serum creatine kinase levels are
normal to slightly elevated and myopathic and neuropathic patterns in electomyograms
2
are diverse among patients (Huizing et al., 2005). The majority of HIBM patients are
found among the Middle Eastern, Jewish, or Japanese populations; however some
patients have been identified in the Asian population including Korean, Chinese, Indians,
and others, as well as in European, South American, and African populations.
Cellular Findings
Regarding the cellular findings in most patients affected with HIBM, the cells
typically develop cytoplasmic “rimmed” vacuoles containing amyloid deposits, atrophic
muscle fibers, and filamentous inclusions seen by electron microscopy (Eisenberg et al.,
2002). Cells containing the rimmed vacuoles become supplanted with fat cells, and the
muscles eventually become replaced with fatty deposits (Malicdan and Nonaka, 2008).
Eisenberg et al., have shown that microarray RNA expression and muscle morphology
analysis indicated that mitochondrial processes may be affected in HIBM muscle.
Furthermore, impaired apoptotic signaling in HIBM cells were reported, implicating
involvement of apoptotic pathways in HIBM pathophysiology (Huzing et al., 2009). The
above findings indicate that there is more to be learned about the cellular findings in
degeneration of HIBM, therefore there are ongoing studies to examine cellular structure
and function in HIBM mouse models.
Diagnosis of HIBM
Symptoms and the pattern of the muscle weakness are the most useful indicators
of HIBM. If the skeletal muscles, hamstrings, and iliopsoas are severely affected and
weakened, but the quadriceps are spared in a person between the ages of 20 and 40, it is
likely that he or she is affected by HIBM. Tests to confirm HIBM include a blood test for
serum creatine kinase (CK or CPK). Furthermore, Nerve Conduction Studies
3
(NCS)/Electromyography (EMG), muscle biopsy, Magnetic Resonance Imaging (MRI),
and the Computer Tomography (CT) scan are used to determine true sparing of
quadriceps. In addition, blood tests or buccal swabs are used for genetic testing, and
molecular diagnosis involving GNE allele sequences from the patient are
compared to a sequence with a wild-type GNE gene to search for possible HIBM
mutations. The histological hallmarks of HIBM include the presence of filamentous
nuclear inclusions seen by electron microscopy, sarcoplasmic inclusion bodies, rimmed
vacuoles containing amyloid, and numerous non-specific proteins, including
hyperphosphorylated tau and presenilin (Chai Saechao et al., 2010; Argove and Yarom,
1984; Aska and Engel, 2002; Tseng et al., 2004)
GNE
Mutations in the GNE gene that cause HIBM change single protein building
blocks (amino acids) in several region of the enzyme, and alter their structure. More
specifically, in the homozygous recessive form, HIBM is primarily caused by M712T,
which consists of a T to a C shift at nucleotide position c.2135 of the GNE gene that
results in a methionine to threonine change at codon 712 (p.M712T) (Broccolini et al.,
2011; Argov et al., 1984). HIBM-associated GNE mutations have been shown to reduce
sialic acid production, and evidence suggests that proper folding, stabilization, and
function of skeletal muscle glycoproteins require muscle fiber sialylation (Huizing,
Hermos et al. 2002; Vasconcelos, Raju et al. 2002). Therefore, GNE mutations resulting
in hyposialylation of muscle glycoproteins appear to contribute to myofibrillar
degeneration and loss of normal muscle function (Salama et al. 2004; Hinderlich et al.
2005). However, it has not been experimentally confirmed that hyposialylation is directly
4
responsible for the HIBM pathology (Huzing et al., 2005). Although the role of GNE has
been thoroughly recognized as a key enzyme in the biosynthetic pathway of sialic acid,
the process by which HIBM mutations in the enzyme lead to this muscle disease is not
yet understood (Hinderlich et al., 2004).
GNE is expressed in all tissues of the body. The levels of expression, however,
differ in each tissue. Liver cells contain relatively high levels of GNE expression
compared to skeletal muscles that express relatively low levels. Previous studies
conducted by Krause et al., 2007 have shown the GNE protein is expressed in skeletal
muscle tissue similarly in both HIBM patients and normal control subjects. Furthermore,
no mislocalizations of GNE in skeletal muscle of HIBM patients have been revealed by
immunofluorescence detection of GNE (Eisenberg et al., 2008). Therefore, most in the
field conclude that the key pathologic factor in HIBM is impaired GNE function, not lack
of expression (Eisenberg et al., 2008).
The mutations that cause HIBM occur on the short arm of chromosome 9 at
position 9p13.2 (Appendix, Figure 1). The GNE genome total size is approximately 44 kb
(GenBank accession no. NM_005476) (Huizing et al., 2009). It consists of 13 exons;
exon 1 and 13 are non-coding. The GNE mRNA is translated into a 722 amino acid
bifunctional protein, GNE/MNK, which contains the UDP-GlcNAc 2-epimerase catalytic
activity at the N-terminal end (amino acid 1-303), and has the ManNAc kinase catalytic
activity at the C-terminal portion (amino acid 410-722); the exact locations of the active
sites within these domains remains to be determined (Huzing et al., 2009).
GNE activities rely in two functional domains, controlling respectively the
epimerase and the kinase activities. Over 60 different mutations spread out over both
5
domains of GNE can cause HIBM (Paccalet et al., 2010). For example, the most
prevalent mutation of the GNE gene, M712T and V572L respectively in the Middle
Eastern community and in Japanese patients, are both located at the kinase domain of the
GNE, but other mutations have been identified in its epimerase domain. All these
mutations of the GNE gene result in different altered enzymatic activities, which lead to
lessened status of cellular sialylation or at least reduced sialylation of specific
glycoproteins, such as alpha-dystroglycan, and NCAM. However, the impact of HIBM
mutations on the overall sialylation in humans remains unclear. (Paccalet et al., 2010).
GNE is the only human protein that contains a kinase domain belonging to the
ROK (repressor, ORF, kinase) family. The GNE/MNK protein is evolutionarily
conserved in eukaryotes. Prokaryotes have separate epimerases and kinases with high
homology to GNE/MNK, suggesting that GNE has evolved into a bifunctional gene.
There is a 27% amino acid sequence similarity in the GNE/MNK protein between the
human and Vibrio cholera genes (Kruchhkina et al., 2009). The GNE/MNK protein
contains an allosteric site within its epimerase domain (amino acids 263-266), where the
downstream product CMP-sialic acid can bind, resulting in feedback inhibition of GNEepimerase activity (Huizing et al., 2005)
The GNE protein has two domains  and , which form a cleft at the interface
forming an active site. The dimensions of both the domains are similar to that of the
Rossmann fold motif (Rap and Rossman, 1973). There are 7-stranded parallel -sheets
and 7 -helices in the N-terminal region, with  7 located between the -helices. The
C-terminal region contains a -sheet that is 6 stranded, 8 13, and surrounded by 7 helices, 8- 15. Interfaces between secondary structure elements of 2-epimerase consist
6
of -  (between a pair of -helices) and - (between -helix and -sheet) types. The
overall similarity between the H. sapiens’ 2-epimerase domain and bacterial 2-epimerase
domain is low (18-27%), but the similarity at the helix-helix interface is much higher
(42%) suggesting a conservation of secondary structure elements. (Kurochkina et al.,
2010).
Sialic Acid
Sialic acid is a derivative of neuraminic acid and most commonly is known as Nacetylneuraminic acid (Neu5Ac) (Chefalo et al., 2011). Sialic acid is one of several
sugars that are often attached to proteins and is involved in mediating cellular functions.
In addition, sialic acid is located on the distal side of glycan chains and plays a role in
regulating glycoprotein stability (sabine et al., 2004). Sialic acids are the most abundant
terminal monosaccharides on glycoproteins and glycolipids in eukaryotic cells, and
comprise a family of more than 50 naturally occurring carboxylated amino sugars with a
scaffold of nine carbon atoms. Sialic acid is a negatively charged acidic sugar. Due to its
negative charge, it normally functions in physiological processes such as cell-cell
interactions, signal transduction, and embryogenesis. It also functions under abnormal
conditions such as pathological processes: microbe binding, inflammation, immune
response, wound healing, and cancer (Salma et al., 2005).
The GNE gene produces the GNE/MNK enzyme that is responsible for the
production of sialic acid. Studies have shown that the impairment of the activity of the
GNE enzyme is due to mutations in the GNE gene in HIBM is thought to affect the
synthesis of sialic acid and interfere with normal process of sialylation of
glycoconjugates. Studies by Paccalet et al., have shown that the knock-out of the GNE
7
gene causes embryonic lethality in mice at day 8.5, highlighting the importance of
sialylation (Paccalet et al., 2010). In addition, Salama et al, examined myoblasts carrying
a mutated GNE gene, in either of the two GNE domains, the epimerase or kinase, and
their result suggested that these mutations conferred impaired enzymatic activity, but did
not equally affect the overall sialylation of muscle cells (Salama et al., 2004). In 2007,
two genetically engineered mouse lines of mutations in the GNE gene were described
that harbored either the M712T or D176V mutation. Both of these models aimed at
mimicking the HIBM phenotype in animals, yet M712T mouse mutation lead to
glomerular proteinuria, a pathology not described in human HIBM patients. However, the
M712T strain of mice helped to understand specific alterations in muscles (Paccalet et al.,
2010).
Sialic Acid Synthesis
The synthesis of sialic acid is initiated in the cytosol of the cell by the
GNE/MNK enzyme, where glucose undergoes many conversions, but in this particular
pathway, it becomes UDP-GlcNAc. The first committed step of sialic acid is the
conversion of UDP-GlcNAc to ManNAc; this is mediated by the epimerase domain of
the complex bifunctional enzyme called UDP-N-acetylglucosamine 2-epimerase. The
next step in the pathway is the conversion of ManNAc to ManNAc-6-p by the MNK
catalytic kinase domain (N-acetylmannoseamine acid). ManNAc-6P is then further
converted by sialic acid 9-phosphate synthase to sialic acid-9-phosphate synthase, which
subsequently undergoes dephosphorylation by an unidentified phosphatase to be
converted to sialic acid. Sialic acid is then imported into the nucleus (probably through a
nuclear pore), where it is converted to CMP-sialic acid by the enzyme CMP-sialic acid
8
synthetase. CMP-sialic acid exits the nucleus via an unknown mechanism (probably
through a nuclear pore) into the cytosol. The role of GNE/MNK in the nucleus remains
elusive. The golgi CMP-sialic acid transporter allows cytosolic CMP-sialic acid to enter
the golgi compartment, where CMP-Sialic acid is utilized as the substrate for
sialytransferases in glycoconjugate biosynthesis. Cytosolic CMP-sialic acid displays
strong feedback inhibition of GNE enzymatic activity by binding to its allosteric site,
thereby contributing to the tight regulation of sialic acid biosynthesis. Even more
complexity is added to this pathway by the presence of ancillary epimerases and kinases
(besides GNE and MNK), which can convert UDP-GlcNAc to ManNAc, and ManNac to
ManNAc-6, respectively. GlcNAC 2-epimerase catalyzes the reversible epimerization of
GlcNAc and ManNac, and GlcNAc kinase has high intrinsic MNK activity. Degradation
of sialylated glycoconjugates occurs within lysosomes by removal of sialic acid residues
by the acidic enzyme neuraminidase. Free sialic acid exits the lysosome through the sialic
acid transporter sialin. Cytosolic free sialic acid can be reutilized or degraded by Nacetylneuraminate pyruvate-lyase. Activity of this enzyme is controlled at the
transcriptional level and can affect both sialylation and function of specific cells.
Therefore, mutations in the bifunctional enzyme can cause a decreased level of sialic acid
production, which results in hyposialiation. (Huzing et al., 2005)
Treatments
Currently there is no effective treatment for HIBM. Modifications in the diet were
proposed which includes reduced consumption of ethanol (ethanol promotes hydrolysis
of sialoconjugates), avoiding excess amounts of selenium, copper and zinc, which are
inhibitors of GNE/MNK activity, and promotion of dietary magnesium, which is an
9
essential co-factor of GNE/MNK. Avoiding consumption of ethanol is suggested as
ethanol causes hydrolysis of sialoconjugates (Huizing et al., 2009). Furthermore,
providing patients with free sialic acid, or sialic acid bound to high sialylated compounds,
has been shown to improve HIBM symptoms. For example, in culture, hyposialylated
cells appear to efficiently take up the negatively charged sialic acid from the medium and
incorporate it into glycoconjugates. However, the effect of dietary sialic acid overload on
a whole body is unknown. The type of ingested sialic acid might also be effected level of
sialic acid in the body.
The notion that hyposialylation is the basis of the pathophysiology in HIBM
affected indivduals leads to development of strategies for curing HIBM by increasing
total body sialic acid by exogenous means (Huizing et al., 2009). However,
administration of sialic acid in the body is not as affective as expected in treating HIBM.
Immunhistochemical staining and Immunoblotting of muscle biopsies for the detection of
alpha-dystroglycan muscle protein and NCAM did not show evidence of increased
sialylation.
Mice
Animal Model
Mice serve as a model organism to study many human diseases. Mice are
considered an ideal model to study because they are small, easy to maintain in the
laboratory (compared to most mammals), and have a short breeding cycle. They can
produce 10-15 offspring per litter and approximately one litter every month, which allow
many experiments to be repeated and conducted multiple times. Since mice are closely
related to humans, many mutations that cause diseases in humans often cause similar
10
diseases in mice. Importantly, mice have genes that are not represented in other animal
models such as the fruit fly and nematode worm. Advanced breeding strategies can be
used to make specialized strains, and genes can be deliberately mutated in a precise
manner. This means it is possible to create exact replicas of the genetic defects that cause
diseases in humans.
The mice conducted in this study served as our model organism to study the effect
of HIBM. There were two mouse models generated: the knock-in mouse model
expressing the mutation p.M712T, and the transgenic mouse bearing the p.D176V
mutation. The transgenic mice expressing the p.D176V mutation showed myopathy after
the age of 40 weeks that resembles HIBM in human patients, and the mouse model
expressing the p.M712T mutation, the phenotype varies depending on the mouse strain
(Valles-Ayoub et al., 2013). Furthermore, in the C5BL/6 mouse strain, homozygous for
the M712T mutation, the mice developed severe kidney disease, glomerular hematuria,
hyposialylation of podocalyxin, and showed partial formation of podocyte foot processes
in the glomerular filatration barrier (Valles-Ayoub et al., 2012). In addition, most effected
mice fail to survive beyond the first three postnatal days of life. To evaluate the
phenotypic affects of HIBM caused by GNE expressing p.M712T, Valles-Ayoub et al.,
selected the FVB background mouse strain for cross breeding with the FVB mouse model
to increase the lifespan and birth survival rates of effected mice.
Mouse Strains
C57BL/6
The C57 black 6, standard abbreviation as B6 is a common inbred strain of
laboratory mice. It is the most widely used, because it is the second mammalian species
11
to have its entire genome sequenced. According to the Jax mice database, the B6 strain is
generally used for the generation of congenics carrying both spontaneous and induced
mutations. In addition this strain is resistant to audiogenic seizures, has a relatively low
bone density, and develops age-related hearing loss. These mice served as our controls
for my research project as no mutant mice were produced in this strain.
The albino C57BL/6J strain also known as B6-albino contains a mutation in the C
(tyrosinase) gene (Jax mice database). When homozygous for this mutation the coat color
of the mouse is albino rather than black. Pigment is completely absent from skin, hair,
and eyes in mice. These mice exhibit retinal degeneration into young adulthood, but the
degeneration stops when the mice mature into adults.
FVB
The Friend Virus B (FVB) strains of mice carry the FV1b allele for sensitivity to
the B strain of Friend leukemia virus (Jax mice database). These mice are great
candidates for producing large litters. Their fertilized eggs contain large and prominent
pronuceli, which makes it easier to facilitate the microinjection of DNA. Although, this
strain does not develop spontaneous tumors, it is highly susceptible to chemically
induced squamous cell carcinomas. (Jax mice database). These mice have impaired
vision due to the homozygosity of the recessive rd (retinal degenerations) mutation.
FVB.B6
To produce the mixed B6;FVB mouse strain, Valles-Ayoub et al., crossed the
heterozygous M712T mutated mice with the FVB mice in different inbred mouse strains
to evaluate the effect of the most common mutation seen in HIBM patients (M712T). In
the B6; FVB strain, the number of homozygous pups that survived was increased, and
12
showed moderate to severe kidney disease, and HIBM like pathology seen in skeletal
muscles (Valles-Ayoub et al., 2012). This hybrid model was used in my research to
conduct studies on the mouse behavior using the wire hang test.
Studies involving knock-in mice bred with the M712T missense mutations are
commonplace, but the exact protocol for developing these mice remains unknown.
Studies, such as those conducted by Valles-Ayoub et al., only describe the mice as being
purchased from Jackson laboratories. It is known that the C57Bl/6 mouse model has been
developed with the HIBM mutation, and Valles-Ayoub et al. has found increased rates of
survival if the C57Bl/6 HIBM strain is backcrossed with the FVB mouse model.
Furthermore, within the first 2 generations, 26% of the homozygous mice survived past
the age of 40 weeks, and those that lived past the age of 42 weeks began to show similar
muscle pathology to HIBM patients. (Valles-Ayoub et al., 2012). While, these findings
suggest that the mouse background strain affects the disease phenotype, more research
needs to be done in this area.
Wire Hang Test
The wire hang test is primarily used in many animal model systems to monitor
muscle strength, coordination, and neuromuscular impairment over time. The test is
based on the latency of a mouse to fall off a metal wire upon exhaustion. The test begins
with the animal hanging from an elevated wire cage top. The animal is placed on the cage
top, which is then inverted and suspended above the home cage; the latency to when the
animal falls is recorded. This test is performed three days per week with three trials per
session. The average performance for each session is presented as the average of the two
13
trials. This test is used to determine the phenotype strains of transgenic mice and
evaluates novel chemical entities for their effect on motor performance.
Because of the nature of the test, it is not possible to relate the outcome to a sole
neuromuscular defect. In particular, animal weight, balance, and behavior can influence
the results of the test. Mice need to be randomized for weight, and the investigator
conducting the test must be consist through the study in order to account for variation.
Since the behavior of the mice clearly indicates that they do not want to fall off the wire,
the test provides an accurate tool for evaluation of maximum performance.
Unfortunately, some mice find ways to avoid hanging by balancing on the wire or falling
off it on purpose, but it may be difficult to determine. The test can be used as early as
weaning age.
PCR Technique
A novel technique, the polymerase chain reaction (PCR), was developed for in
vitro amplification of the DNA or RNA of an organism or gene defect. PCR is now a
common technique used in medical and biological research laboratories for a variety of
applications. The method relies on thermal cycling consisting of cycles of repeated
heating and cooling of the reaction for DNA melting and enzymatic replication of the
DNA, using thermal stable polymerases. PCR takes advantage of an enzyme that uses a
defined segment in a strand of DNA as template for assembling a complementary strand.
PCR requires a three-step cycling process: denaturation of double-stranded DNA,
annealing of primers, and primer extension. A cycle typically takes approximately 3-5
minutes and is repeated 20-40 times. The PCR reaction contains a mixture of buffers,
nucleotides, primers, enzyme, and nucleic acid from the specimen of interest.
14
Denaturation separates the complementary strands of DNA held together in the duplex by
hydrogen bonds. Although there are several physical and chemical means of dissociating
the duplex, heating it to 95-100°C is simple, and efficient and effective. In the annealing
process, the temperature is lowered to 50-65°C which allows the primers to attach to the
dissociated DNA strands. A primer is a single stranded sequence of nucleotides known as
an oligonucleotide. Each primer is complementary to the 5’ and of each of the two
original DNA strands. These are usually referred to as the “forward” and “reverse”
primer, respectively. The primers are present in molar excess; so that they are more likely
to anneal to the dissociated strands than the strands are to reanneal to each other.
Once annealing has occurred, the temperature is then raised to 75-80°C, which
allows the enzyme to catalyze the synthesis of new strands of DNA. The enzyme is a
DNA polymerase that adds nucleotides complementary to those in the unpaired DNA
strand on to the 3’ end of the annealed primer. To ensure that any remaining singlestranded DNA is fully extended the final elongation step is performed at a temperature of
70-74°C for 5-15 minutes after the last PCR cycle. The last step is the final hold, which is
a short-term storage of the reaction, and the temperature is between 4-15°C. The number
of DNA strands nearly doubles upon completion of each cycle. Since the efficiency
usually results a less than 2-fold increase, after 30 cycles, a single copy of DNA can be
increased up to 1,000,000 copies. The replication of a discrete strand of DNA is being
manipulated in a tube under controlled conditions.
In early PCR experiments, the enzyme Klenow fragment of Escherichia coli DNA
polymerase I was used, however due to the heat-labile character of the enzyme it had to
be added in each subsequent cycle; this enzyme was inactivated during each denaturation
15
step (Schochetman et al., 1998). The Klenow fragment now has been replaced by the
thermostable DNA polymerase of Thermus aquaticus (Taq), a development that has
permitted the automation of the procedure because all reaction components can be
combined at the beginning. In addition, use of Taq polymerase has improved the
specificity, yield, sensitivity, and length of target DNA that can be amplified. Amplified
sequences of target DNA can be detected by a variety of methods, if enough amplified
DNA is present, it can be visualized after gel electrophoresis and ethidium bromide
staining. The size of the PCR product is determined by comparison with a DNA size
maker, which contains DNA fragments of known size, run on the gel alongside the PCR
product. This method was used to genotype the mice provided by the HIBM research
group.
Hypothesis & Purpose of Statement
The author hypothesizes that the wire hang test will correctly identify skeletal
muscle wasting in the mutant mice. Furthermore, the author will use a novel PCR method
will reveal the correct allelic inheritance pattern of the mice animal models. Therefore,
the purpose of this research project is to incorporate the wire hang test to measure the
skeletal muscle strength of mutant, heterozygote, and wild type mice; in addition, the
novel PCR method was incorporated to identify the genotype of the animal models.
16
II
Materials and Methods
Mice Care and Keep
All mice were sent from HIBM Research Group (Reseda, California) with an
original founding colony consisting of mice homozygous for the M712T mutation,
heterozygous carriers for the M712T mutation, or wild-type mice. These mice were
stored in the CSUN vivarium. The vivarium staff was responsible for the daily
maintenance of the mice, which included food, water, fresh cages, and regular health
checks from a veterinarian. The mice were fed mouse chow, which is a nutritious blend
of food product specially formulated for mice; they were administered clean water from
the tap, and they were provided wood shavings for their bedding. Up to four mice were
placed in the cage, and they were identified ear cut (N= no cut, L= left cut, R=right cut,
B= both cut). Each cage was marked by a card which included each mouse, which
allowed for quick identification. The mice for our research were kept in their own module
and were kept isolated from other animals in the facility. If mice became diseased or
incapacitated, then they were killed with Carbon Dioxide (CO2) in the most humane
manner possible. If mice were found deceased then they were placed in a Ziploc
container and placed in the dead animal freezer.
Wire Hang Test
Six mice were selected from each group: HT, WT, and MT. This was because
only 6 homozygous mice were available for testing, and I wanted to keep the groups as
comparable as possible. Immediately before the testing period, each mouse was weighed
(precision scale) and examined for any abnormalities that would impact testing, such as
17
tumors. The test preparation included stacking two sets of three containers, which created
a platform to suspend the wire lined cage top. This created a height of 24 inches from the
tabletop. Each mouse was picked up by the base of its tail, and placed on the cage top.
The mouse was allowed 10 seconds to acclimate itself to its new environment, and then
the cage top was turned upside down, and suspended by the stacked containers; the
mouse’s cage was directly underneath the mouse, so the mouse would have a place to fall
when its grip failed. Time was started as soon as the cage top was inverted, and time was
stopped when the mouse dropped from the cage top. Furthermore, time was stopped if the
mouse climbed over the cage top. The mouse was given 60 seconds of rest in order for its
energy to regenerate, and then the process was repeated. The test was performed twice a
week, and each mouse was given two trials. For data collection purposes, the average of
the two trials was taken. Immediately after the testing period, each mouse was reweighed
to determine if there was any loss of mass during the testing period.
Genotyping
DNA Extraction
Mouse tails were collected by grabbing the mouse by the scruff of its neck,
inverting the mouse then clipping its tail (2-3 mm) directly into a 1.5 ml vial. Following
this, 500 uL of Lysis Buffer (Promega) and 5 uL of proteinase K (20 ug/uL) were added
to the vial containing the mouse tail. It was then placed on the vortex (Fisher vortex
Genie 2, Fisher Scientific) for 11 seconds to provides enough time to bring the vortex up
to full speed for 5 seconds, allowing thorough mixing of the buffer. The tube was
incubated overnight in a 55°C water bath to dissolve the tail tissue into the solution. Once
the tail was dissolved, the solution was vortexed for 11 seconds, the supernatant was
18
pipetted into a new vial, and the old tube was discarded. After collecting the supernatant
into a fresh vial, it was spun in a centrifuge (Eppendorf centrifuge 5417C) at room
temperature for 7 minutes at 13000 RPM. This step is essential for removing any tissue
residuals from the solution. The supernatant was then collected into a fresh tube.
Following this, a 1:1 ratio of isopropanol was added to the supernatant, which was
usually less than 500 uL. The vial was placed on the vortex for 11 seconds, and placed in
the centrifuge at 13000 RPM for 20 seconds. The next step was to carefully decant the
supernatant and keep the pellet. The pellet was precipitated in 70% ethanol in the same
ratio 1:1, most likely below 500 uL. The solution was placed on the vortex for 11
seconds, and centrifuged at 13000 RPM for 20 seconds. The next step was to carefully
decant the supernatant and keep the pellet. The tube containing the pellet was placed
upside down on a paper towel, to allow it to dry for 7 minutes in room temperature.
When the pellet was dry and no ethanol residuals were left, the pellet was resuspended in
150 uL of 3D water, and was vortexed for 11 seconds. The solution was incubated in a
55°C water bath for 5 minutes. After the incubation, it was vortexed for 11 seconds.
Quantification of the DNA in each sample was performed by spectrophotometry reading
optimal density at λ 260nm, and 280nm using NanoDrop 2000c, Thermoscientific; this
was done to determine the nucleic acid concentrations.
Nanodrop Spectrophotometry
The optical density readings for nucleic acid was 260 nm. The nanodrop
contained its own software which automatically computed the concentrations of our
samples, and the purity of each sample was visualized through the graphs that were
automatically generated by the software. Before making measurements, the first sample,
19
which was a “blank” of 2uL of dI water, was added to the pedestal and measured. Since
the nanodrop can read a wide range of absorbance spectrums, there is often no need to
dilute the samples. 2 uL of each DNA sample was added directly onto the pedestals using
a micropipette, and this was measured to detect the concentration of each sample to
produce a 260/280 nm ratio. A ratio absorbance of 260nm and 280nm was used to assess
the purity of each DNA sample. A ratio of ~ 1.8 is generally accepted as “pure” for DNA.
The absorbance of each sample was analyzed two times for accuracy. Cleaning required
wiping the sample loading surface with low lint labwipes after each reading.
PCR Amplification
The most common method of determining the genotype of a mouse involves
several steps. The first step was to amplify the DNA using the polymerase chain reaction
method. After quantification of isolating DNA by using a spectrophotometer, the DNA
was diluted to a concentration of 20ng/ul, from which 2.0 ul of the DNA template was
added to a labeled PCR tube (200 ul thin-walled). The PCR “master mix” contained the
following reagents per sample: 5.0 ul of PCR quality H2O, 10.0 ul of 2X Buffer A
(Epicentre), 2.0 ul of 10uM primer mix (mUae1-1895 Forward:
5’CTGGAACTGCTTTGGGACTT; mUae1-2200 Reverse:
5’ATTTGCCTTCGCAGAAACACTGA), and 1.0 ul of RedTaq DNA polymerase
(Sigma). Next, 18 ul of this master mix was added to each 2.0 ul sample of DNA
template; thus, a total of 20 ul of PCR reaction per sample was added to the thermocycler
(Geneamp PCR system 2400, Perkin Elmer).
The PCR conditions, temperature, and time for each run are as follows: 1. An
initial denaturation at 95°C for 60 seconds. 2. 35 cycles at 95°C (melting) for 10 seconds,
20
60° C (annealing) for 8 seconds, and 72°C (extension) for 60 seconds. 3. Cycling was
followed by a final extension step at 72°C for 10 minutes. This reaction took an
approximately 3.5 hours. The approximate amplicon size to be amplified is around 325
base pairs.
NlaIII Digestion
After PCR amplification was complete, the DNA was digested with the restriction
enzyme NlaIII (Thermo Scientific, 10units). The following reagents were mixed in a 1.5
ml tube (per tube): 1. 5.0 uL H20, 2.0 uL 10X Buffer # 4, 2.0 ul BSA (100 ug/ml), 4.0 ul
PCR product, 1.0 ul (10 units) NlaIII. This was repeated for each PCR product obtained
from the previous step. The digestion was carried out at 37°C in a heat bath for a period
of 3 hours to allow enzyme digestion, and then it was placed in a 65°C temperature heat
block for 20 minutes to inactivate the restriction enzyme. NlaIII functions as follows;
NlaIII recognizes sequence 5’-CATG-3’ in double stranded DNA. NlaIII cuts the wildtype allele at locations 265bp and 354bp, and mutated allele at 354bp only.
Gel Electrophoresis
A polyacrylamide gel electrophoresis (PAGE) 7.5% was chosen instead of
agarose because it is a better matrix for isolating fragments of less than 500 base pairs. In
the first lane of each gel, I loaded 1 uL of a DNA size marker GeneRuler(Thermo
Scientific 1kb GeneRuler, 50ug/ul). In the next 3 lanes I loaded PCR products from mice
with a homozygous recessive, heterozygous, and homozygous wildtype genotype. The
gel ran at 80 V for 75 minutes. The gel was then stained with ethidium bromide
(10mg/ml) for 5 minutes at room temperature, de-stained in water for 2 minutes. The gel
was then visualized under a UV transilluminator (Cell Biosciences, FluorChem HD2).
21
Alternative Genotype Method
Genotyping was eventually conducted using PCR alone instead of PCR
followed by restriction digest. Primers were planned an obtained that were specific
to the wild-type and mutant alleles of the GNE gene:
Amplification of the GNE for differential PCR
An advanced, rapid method of genotyping included primer-specific PCR
annealing. This principle is based on well-designed oligonucleotide primers that have a
perfect match for a single allele. If there are any mismatched primer pairs, it will not
result in amplification. PCR primers were designed using OligoCalc (melting temperature
ranged between 60-64 °C; CG content, 60–68%; primer length of 19–20 nt). The primer
pairs were designed to hybridize as close as possible to the single nucleotide polymorphic
sites in the GNE gene, amplifying a maximum product length of ~200 base pairs.
Through the use of the NCBI database, I performed a nucleotide blast search of the
partial GNE gene provided by HRG labs (Accession number: NC000070); this allowed
me to find the complete mouse GNE sequence. The Primers I designed were based off
this sequence, and the primers contained specific sites to anneal to the wild-type and
mutant alleles of the GNE gene. Each forward primer contained either a “C” for the
mutant allele or a “T” for the wild-type allele at the 3’ prime end. Primers were identified
by their names; forward primers were given names such as M1mutF1 for the mutant
allele, M1wtF for the wild-type allele. For the reverse primer, I designed one universal
primer named M1-R.
Primers
Sequence
Tm
M1wtF
5’TGCTTGGCGCAGCCAGCAT’3
63.8°C
22
M1mutF1
5’GCTTGGCGCAGCCAGCAC’3
M1-R
5’AGGAGCAGGGCAGGCTCTTA’3 60.7°C
63.5°C
Table 1: Names and sequences of the primers used for GNE gene amplification. The
oligonucleotide primers (XX IDT, Integrated DNA technologies) were dissolved in nano
pure water and diluted to the desired concentrations of 20 pmol/ul.
Amplifying the Wild-type Allele of the GNE gene:
After performing a DNA isolation procedure that was similar to what was
described in the previous section, quantification of isolated DNA was performed by using
a spectrophotometer. Then, the PCR of GNE gene was amplified using two reactions; the
first reaction contained 10 ul of XP, 10ul of 60% sucrose, 5 ul of M1wtF at 20pmol/ul,
5ul of M1-R at 20pmol/ul, 0.5 ul of Taq75 (375 units, 75ul), and 68.5 ul of dI H2O. Then,
9 ul of each PCR mixture was added to each labeled PCR tube (200 ul thin-walled), and 1
ul of each template DNA (20ng/ul) was added to the appropriate labeled PCR tube
(promega). This makes a total of 10ul reaction volume per PCR tube (Table 2).
Reagents
10XP1
60% sucrose1
M1wtF (20pmol/ul)
Volume (ul)
10
10
5
M1-R (20pmol/ul)
Taq75 (375 units, 75ul)
dI H2O
Template DNA (20ng/ul)
Total
5
0.5
68.5
1
100 ul
Table 2: PCR reaction mix for the amplification of the wild-type GNE allele.
23
1. 10XP contained a proprietary blend of the following reagents: 10mM Tris HCl (pH
8.3), 20mM KCl, 1mM MgCl2, 1 mg/ml Gelatin, 0.25mM dNTP set. Also, 60% sucrose
contained a proprietary blend of 600ug of sucrose, and 20ug of Cresol Red.
Amplifying the Mutant allele of the GNE gene:
The second PCR reaction was performed using 10 ul of XP, 10ul of 60% sucrose,
5 ul of M1mtF at 20pmol/ul, and 5ul of M1-R at 20pmol/ul, 0.5 ul of Taq75 (375 units,
75ul), and 68.5 ul of dI H2O. Then, 9 ul of each PCR mixture was added to labeled PCR
tubes (200 ul thin-walled), and 1 ul of each template DNA (20ng/ul) was added to the
appropriate labeled PCR tube (promega). This makes a total of 10ul reaction volume per
PCR tube. (Table 3).
Reagents
10XP1
60% sucrose1
Volume (ul)
10
10
M1mtF (20pmol/ul)
M1-R (20pmol/ul)
Taq75 (375 units, 75ul)
dI H2O
Template DNA (20ng/ul)
Total
5
5
0.5
68.5
1
100 ul
Table 3: PCR reaction mix for the amplification of the mutant GNE allele.
1. 10XP contained a proprietary blend of the following reagents: 10mM Tris HCl (pH
8.3), 20mM KCl, 1mM MgCl2, 1 mg/ml Gelatin, 0.25mM dNTP set. Also, 60% sucrose
contained a proprietary blend of 600ug of sucrose, and 20ug of Cresol Red.
PCR was carried out in 10 tubes each with 10ul system. The PCR conditions,
temperature, and time for each run were as follows: 1. An initial denaturation at 96°C for
2 minutes. 2. 10 cycles at 96°C for 10 seconds and 63°C for 1 minute. 3. 20 cycles of 96°
C for 10 seconds, 59 °C for 50 seconds, and 72°C for 30 seconds, and an infinity hold of
24
4°C. The samples were subjected to 30 cycles of PCR total (Perkin Elmer, Geneamp PCR
system 2400). The approximate amplicon size to be amplified is around 200 base pairs.
Agarose Gel Electrophoresis
The PCR products were loaded side by side, on Seakem LE Agarose gel (2.0%) in
1XTBE buffer containing 50 ug/ml of ethidium bromide. The first lane contains 5ul of
tridye 2 log DNA size marker (100ug/ml). In the next three lanes, 10ul of each PCR
products from mice with a heterozygous, homozygous wild-type genotype, and
homozygous recessive, respectively were loaded on the gel. The gel was electrophoresed
at 150V for 15 minutes. The gel was observed under UV transilluminator (Cell
Biosciences, FluorChem HD2) and the desired band of size ~200bp was observed.
25
III
Results
Mouse Weights and Wire Hang times
Mice were being tested on the wire hang test over six separate times, and the
average was taken of each testing period. Table 4 contains the mouse ID, sex of each
mouse, its mutation, average of each trial, and the starting and concluding weights of the
mice. A trial represents the number of seconds a mouse was able to hang onto the wire
cage top. Each mouse was given two trials per testing period. Two periods were
conducted each week. This table is showing the average of each trial and how each
mouse, depending on its genotype, performed during each testing period. The change in
weight from the beginning of the testing period until the end is also shown; this was done
to determine if there was any significant loss of mass during the course of the study. The
wire hang test was accomplished by placing each mouse on an inverted wire cage top,
flipping it over and suspending the mouse from a height of 24 inches. The time taken was
the amount of time that the mouse was able to hang on to the cage top. Column 1
contains the
Mouse
ID
Sex
Mutation
#1
#2
#3
#4
#5
#6
Total
Starting Ending
Average Average Average Average Average Average Average Weight Weight
(sec)
(sec)
(sec)
(sec)
(sec)
(sec)
(sec)
(g)
(g)
16.50
104.50
20.00
92.50
35.00
35.10
67.00
22.00
53.75
16.50
54.00
37.50
57.00
18.00
45.00
38.00
30.50
30.10
6.00
10.00
22.50
47.50
9.00
12.50
17.92
40.30
39.20
17.00
65.50
25.00
22.00
35.50
42.00
34.50
37.50
35.80
66.00
144.50
180.00
24.00
36.00
105.00
92.58
29.30
28.50
7088L
7079N
7178R
9003N
8002L
M
F
M
M
M
HT
HT
HT
HT
HT
7082R
8003B
8010L
7315R
7314N
M
M
M
M
M
W
W
W
W
W
41.00
76.00
225.50
106.00
30.85
29.50
121.00
319.50
34.59
17.60
5.00
180.00
180.00
173.00
15.50
15.50
90.00
180.00
67.00
21.00
19.50
78.00
180.00
49.00
27.50
5.50
67.50
180.00
96.50
48.00
19.33
102.08
210.83
87.68
26.74
35.50
28.80
19.60
28.90
30.50
35.70
29.00
21.00
29.90
30.90
8006N
8008L
7075B
9005L
9001R
M
M
M
M
M
M
M
M
M
M
30.00
66.50
15.00
5.50
5.50
76.00
110.50
54.50
10.00
70.50
103.00
109.00
64.50
7.00
27.00
26
44.50
90.50
75.50
6.50
7.50
47.50
12.50
101.00
3.00
2.00
40.50
40.50
46.00
7.00
5.00
56.92
71.58
59.42
6.50
19.58
33.90
35.50
30.70
32.60
30.40
32.40
33.60
30.60
31.60
28.80
Mouse Data and Wire Hang Test Endurance
Table 4: This table is a collection of data that show the average wire hang times for each
mouse, as well as the beginning and concluding weights for each mouse.
identification number of each mouse. Column 2 shows the sex of each mouse. Column 3
shows the GNE genotype of each mouse. Column 4 shows the average of the data
collected during the first testing session. Column 5 shows the average of the data
collected during the second testing session. Column 6 shows the average of the data
collected during the third testing session. Column 7 shows the average of the data
collected during the fourth testing session. Column 8 shows the average of the data
collected during the fifth testing session. Column 9 shows the average of the data
collected during the sixth testing session. Column 10 shows the mean of all 12 trials for
each mouse. Column 11 shows the beginning weights for each mouse, and column 12
shows the concluding weights for each mouse.
Total Average Wire Hang Time per Group during the Three Week Testing Period
Figure 1 was accomplished by taking the average time of each group over the
course of all three week. The blue bar represents the heterozygote group; the purple bar
represents the wild type group; and the yellow group represents the homozygous mutant
group. The results overall weeks 1 through 3 show that there is a significant difference
between the wild-type and the homozygous mutant groups, as well as the wild-type and
heterozygous groups. However, there is no significant difference between the
heterozygous and homozygous mutant groups.
27
Figure 1: This figure shows the average of the wire hang testing time of each group over
the entire three week testing period. The error bars contain the standard error of each
value. The results show that there is a significant difference between the wild-type and
mutant groups, along with the heterozygous and wild-type groups. However, there is no
significant difference between the heterozygous and mutant groups.
HT
WT
M
Population
5
5
5
Mean
47.35
89.33
42.80
St Dev
47.62
96.26
42.60
St Error
21.30
43.05
19.05
Table 5: This table shows the mean wire hang testing values for each group, along with
the accompanying standard deviations and standard errors. Each testing population
contained five mice per group.
Population
5
Probability (p value)
HT/WT
MT/WT
M/HT
0.0032
0.0009
0.5823
Table 6: This table shows the p values of each group compared with the other. This is a
numeric representation of the significance of each wire hang testing value.
28
Total Average Wire Hang Time of each Group during each Week
Figure 2: This figure shows the wire hang testing times of each group during each week.
This was done to determine if the difference between each group grew during the testing
period. The results show that the difference between the experimental groups and the
control group became more significant during the third testing week.
Week
1
2
3
Heterozygous Group
Population
Mean St Dev
5
50.05
51.38
52.80
52.68
5
39.20
38.97
5
St Error
22.98
23.56
17.43
Table 7: This table shows the mean wire hang testing values for the heterozygous group,
along with the accompanying standard deviations and standard errors. Each testing
population contained five mice per group
Week
1
2
3
Wild-Type Group
Population
Mean St Dev
5
100.15 134.16
92.70
77.99
5
75.15
65.90
5
St Error
60.00
34.88
29.47
Table 8: This table shows the mean wire hang testing values for the Wild-type group,
along with the accompanying standard deviations and standard errors. Each testing
population contained five mice per group.
29
Week
1
2
3
Mutant
Population
Mean
5
44.40
53.50
5
30.50
5
St Dev
47.06
46.30
31.54
St Error
21.05
20.71
14.11
Table 9: This table shows the mean wire hang testing values for the Mutant group, along
with the accompanying standard deviations and standard errors. Each testing population
contained five mice per group.
week 1
week 2
week 3
Probability (p value)
Population HT/WT MT/WT
5
0.13
0.09
0.07
0.06
5
0.04
0.01
5
MT/HT
0.74
0.71
0.66
Table 10: This table shows the p values of each group compared with the other. This is a
numeric representation of the significance of each wire hang testing value.
Overall Beginning and Final Weight per Group
Figure 3: This figure shows the mean beginning and final weights of the mice in each
experimental group. The error bars represent the standard error of each value. The blue
bar represents the heterozygous group; the magenta bar represents the wild-type control
group; and the yellow bar represents the homozygous mutant group.
30
HT
WT
MT
Beginning weight
Population
Mean St Dev
5
34.52
4.15
5
28.66
5.14
5
32.62
1.93
St Error
1.85
2.30
0.86
Table 11: This table shows the mean beginning weights of each group along with the
standard deviation and standard error of each mean value.
HT
WT
MT
Final weight
Population
Mean St Dev
5
33.74
3.91
5
29.30
4.75
5
31.40
1.63
St Error
1.75
2.12
0.73
Table 12: This table shows the mean final weights of each group along with the standard
deviation and standard error of each mean value.
Beginning weight
Final weight
Probability (p value)
Population HT/WT
5
0.12
5
0.19
MT/WT
0.21
0.44
M/HT
0.44
0.32
Table 13: This table shows the p value between the beginning and final weights of each
group, and the purpose of this was to see if exercise caused loss of mass in one group
over the other. Each group was compared against the other in order to generate the p
value. The p values provide evidence that weight is not a reliable value to differentiate
the groups.
Gel Results
Figure 4 contains a gel result (7.5% PAGE) that we used to determine the
mutation of each mouse. Using the procedure described in chapter 2, each sample was
amplified using this set of primers: mUae1-2200 Reverse, and mUae1-1895 forward.
Each sample was then digested with Nla III. The first lane contains 5 ul of a DNA size
marker GeneRuler (Thermo Scientific 1kb gene ruler, 50ug/ul). The second lane contains
the PCR product for a positive control, and lanes three to six contain PCR products for
mouse with number ID 9000-9004, respectively. Lanes 3,5 and 6: GNE partial gene
31
digested with Nla III, bands are approximately at 120, 200, and 280 base pairs. Lane four
and seven show a cut at around 280 base pairs. Mouse ID 9000. 9002, 9003 were
determined to be heterozygous due to the positive bands at 120, 200, and 280 base pairs.
Mouse ID 9001, and 9004 were determined to be mutant based on the positive bands
revealed at 280 base pairs.
Lane 1
Lane 2
Lane 3
Lane 4 Lane 5
Lane 6
Lane 7
Figure 4: Graphical representation of a gel used for genotyping. Lane 1 shows the
ladder; lane 2 is the positive control, the next five lanes are where the restriction enzyme
32
cut the DNA. NlaIII cuts the wild-type allele at 365 and 254 bp. NlaIII cuts the mutant
allele at 354.
Figure 5: GNE gene amplified with mUae1-1895 and mUae1-2200 primers
Lane 1
Lane 2
Lane 3
Lane 4
In Figure 5, shows the results of the detection of the presence of the GNE gene in the
mouse samples. The partial GNE gene was amplified using one set of primers; mUae12200 reverse
, and mUae1-1895 forward. The first lane contains a Tridye 2 log DNA size marker
(100ug/ml). Lanes 2-4 show the amplicon size of the partial GNE gene from mouse ID
8002, 9010, and 9005. The amplified fragment was 350 base pairs long and the size was
confirmed with gel electrophoresis. This shows evidence that the mice did contain the
partial GNE gene.
33
Figure 6: Novel genotyping method to confirm the detection of the specific GNE
genotype.
Lane 1
Lane 2
Lane 3 Lane 4
Lane 5
Lane 6 Lane 7
Figure 6 contains the results of the novel genotyping method to confirm the
detection of the specific GNE genotype. Each lane contains samples from each PCR
product. Lane one contains 5ul of Tridye 2 log DNA size marker (100ug/ml). Lanes 2
and 3 contain the same template DNA from mouse ID 8002, but lane two contains the
mutant primer set (M1mutF1 and M1-R) and lane three contains the wild-type primer set
(M1wtF and M1-R). Lanes 4 and 5 contains the same template DNA from mouse ID
34
8010, but lane 3 contains the mutant primer set (M1mutF1 and M1-R) and lane 4 contains
the wild-type primer set (M1wtF and M1R). Lanes 6 and 7 contain the same template
DNA from mouse ID 9005, but lane 6 contains the mutant primer set (M1mutF1 and M1R) and lane 7 contains the wild-type primer set (M1wtF and M1-R). Mouse ID 8002 was
confirmed to be heterozygous by the presence of each band in the mutant and wild-type
primer set. This was confirmed by the HRG lab. Mouse ID 8010 was confirmed to be
wild-type due to the presence of the band in the wild-type primer set, and the absence of
the band in the mutant primer set. This was further verified by the HRG lab. Mouse ID
9005 was confirmed to be mutant due to the presence of the band in the mutant primer
set, and the absence of the wild-type primer set. This was further confirmed by the HRG
labs. Each amplicon size is around 200 base pairs. Primer dimers were always seen at the
bottom of each lane; however this did not affect our results in genotyping.
Figure 7-9: Sequencing
Three samples were subjected to full nucleotide sequence determination for
verification (8002, 8010, and 9005). Electropherograms were compared against partial
GNE gene; sequence alignments were then performed. Guanine is characterized by a
black peak; Thymine is characterized by a pink peak; Cytosine is characterized by a
green peak; and Adenine is characterized by a green peak. The acronym Y stands for
either a Thymine or a Cytosine.
35
8002:

Figure 7: Sequence of Mouse ID 8002. The Y pyrimidine, which is at position M264T
indicates a base pair of either a Thymine or Cytosine. This is evident of 8002 being
heterozygous for the HIBM mutation. This sequence is confirmed on an agarose gel in
figure 10.
8010:

Figure 8: Sequence of Mouse ID 8010. The T, which is at position M264T indicates a
base pair of Thymine. This is evident of 8010 having non-mutated GNE alleles. This
sequence confirmed my agarose gel results in figure 10.
36
9005:

Figure 9: Sequence of Mouse ID 9005. The C, which is at position M264T indicates a
base pair of Cytosine, which has been mutated from methionine to threonine
(ATGACG). This sequence confirms that 9005 had the mutated alleles. This was
confirmed by the agarose gel results in figure 10.

Figure 10: Results of the novel genotyping method to confirm the detection of the
specific GNE genotype.
Figure 10 contains the results of the novel genotyping method to confirm the
detection of the specific GNE genotype. The genotypes for these mice were previously
known, but the goal was to see if my results matched the actual genotype of the mice. All
of the DNA samples shown have been amplified using the two sets of primers: Mutant
37
and Wild-type. Mouse ID 9023 M was amplified using the mutant primer set (M1mutF1
and M1-R), and 9023 W was amplified using the wild-type primer set (M1wtF and M1R). Following that, each sample was amplified using both set of these primers, which
amplified a 200 base pair region. Mouse samples 9023, 9024, 9027, and 9028 was all
confirmed to be heterozygous due to the presence of the 200 base pair amplicon in both
the wild-type and mutant primer set; this was confirmed by the HRG lab. However, the
mouse samples for 9025 and 9026 were confirmed to be wild-type due to the presence of
the band in the wild-type primer set, and the absence of the 200 base pair bands in the
mutant primer set. This was further verified by the HGR lab.
38
IV
Discussion
Wire Hang Performance Test
The wire hang test results added great credence to my hypothesis. Table 1
contains a summary of the average for each individual mouse’s performance. This shows
that the wild-type mice either gained strength during this time, or stayed the same. The
real reduction occurred in the heterozygous and mutant groups. Figure 1 shows a bar
graph that shows the greatest representation of the difference between the control and
experimental groups; the control group had a mean average time of 89.33, whereas the
heterozygous group had an average of 47.35, and the homozygous mutant group had an
average time of 42.80. Table 6 shows the P values, which reveal that the wire hang test
times are significant. Table 7 shows a breakdown of the heterozygous group by week.
Weeks one and two showed means times of 50.05 and 52.80. Week three showed the
greatest difference; the average time of the heterozygous group was 39.20. This reduction
can be attributed either to fatigue, or the mice realizing that there was no danger in falling
off the bar. Table 8 shows a breakdown of the wild-type control group by week. Week
one showed a mean time of 100.15; week two showed a mean time of 92.70; and week
three showed a mean time of 75.15. The reductions that occurred during the course of the
study can be attributed either to fatigue, or becoming familiar with the test. Table 9
shows a breakdown of the mutant group by week. Week one showed a mean time of
44.40; week two showed a mean time of 53.50; and week three showed a mean time of
30.50. The reduction in week three can be attributed either to fatigue, or increased
39
familiarity with the test. The accompanying p values show that during all weeks, the wire
hang testing times were significant between the heterozygous and wild-type groups,
along with the mutant and wild-type groups. However, weekly comparisons with the
mutant and heterozygous groups showed that the values were not significant. Figure three
shows a bar graph comparing the beginning and final weights of the mice used in the
experiment. For the beginning weights, Table 11 shows that the heterozygous mice had a
mean weight of 34.52; the wild-type mice had a mean weight of 28.66; and the mutant
mice had times of 32.62. For the final weights, the heterozygous group had a mean
weight of 33.74; the wild-type group had a mean weight of 29.30; the mutant group had
mean weight of 31.40. However, the p values show that these weights are not significant,
and the testing appears to have no effect on animal mass.
There are variable ways to interpret the wire-hang test results. First, I postulate
that these performance differences are due to a loss of skeletal muscle mass; however,
histology studies were not performed. If there were, I would have been able to compare
the skeletal muscle studies from before the study to after the study. Because I did not
have this, I cannot say for sure the true source of the performance decline. Research by
Valles-Ayoub et al. (2013) showed that mice with the M712T mutation can suffer from
kidney disease, it is unknown if the mice in my study sample suffered from kidney
disease. Histology studies should have been an important part of this study, but because
of equipment and time restrictions, I was not able to conduct any histology studies.
There is also the question of why the mice heterozygous for the M712T mutation
suffered similar performance differences as the MT mice . In humans, individuals who
are heterozygous for HIBM still exhibit some symptoms of muscle weakness, according
40
to Valles-Ayoub (personal communication, 2013). Therefore, it is not necessarily
surprising that the murine model also suffers from some weakness. If it is indeed true that
it is muscle wasting and not kidney disease that is responsible for these deficits, then
evidence suggests that mice heterozygous for the disorder suffer from a similar
phenotype as the homozygous recessive mice. Since heterozygous mice exhibited similar
performance numbers as the homozygous mice, further studies should be conducted to
see if this result can be replicated in a study with larger numbers of mice. If so, it may be
worthwhile to use heterozygous mice, as they appear to have a longer lifespan and are
more robust than their homozygous counterparts.
It is also worth noting the differences that I observed in robustness between the
mice in different groups. The FVB.B6.GNE strain, which are identified by their 6000 or
8000 colony tag, were much more lively and appeared to have a greater rate of
survivability than the FVB-GNE mice, which are identified by the 7000 and 9000 tag.
During observations, I noticed that the FVB.B6.GNE mice were smaller on average,
moved around more fluidly, and had better grooming habits. These are all signs of
optimal health for mice (Uhlendorf, personal communication, 2013). On the other hand, I
observed that the FVB-GNE mice were more lethargic, had higher mortality rates, and
had poorer grooming habits. These observations are partly reflected on the performance
assessments highlighted in chapter 3 ;the 8000 mice had greater performance times than
their FVB-GNE counterparts in the HT and WT groups, but not in the MT group. This
adds further evidence that the mice do exhibit the skeletal muscle wasting phenotype, as
this is the MT group is the only group where the 8000 colony failed to thrive.
41
Summary of Gel Results
PAGE results were difficult to read because alterations had to occur in the process
due to material deficits that prevented us from obtaining a clear reading. The bands were
difficult to interpret because of the presence of non specific primer annealing, along with
bands not at their expected locations. According to the protocol provided by HRG group
using PCR followed by restriction digest, I expected to see bands at the following sizes
due to Nla III restriction digest: 33, 89, and 265 base pairs. However, as shown in Figure
8, I observed bands at different locations, and it was difficult to determine the true
genotype of the mice based on the gels that were created. This was probably due to a fault
in the PCR program annealing temperatures. The primers were likely not given enough
time to anneal to the template DNA strands or primers were annealing to nonspecific sites
on the template DNA strands. Because I was not able to obtain suitable results with the
recommended protocol by HRG lab, I developed my own method with the intention of
saving time and resources, which this method has shown to accomplish.
Amplification of the GNE for Differential PCR
Regarding my novel genotyping method, I wanted to use a less expensive
technique by using PCR alone instead of PCR followed by restriction digest. My first
goal was to ensure that the partial GNE gene sequence was around 350 base pairs. This
number was determined by amplifying the GNE partial gene sequence using the primer
set mUae1-2200 reverse, and mUae1-1895 forward; both the primers and the primer
sequence were provided by HRG labs. The GNE partial gene was amplified with this set
of primers and was subjected to my designed PCR program.. I designed my own PCR
program based on the length and melting temperature of each primer. Each template
42
DNA sample was subjected to two primer sets; M1wtF and M1-R, along with M1mutF1
and M1-R. Both sets of primers were used with each sample to determine whether the
sample was mutant or wild-type. These samples were subjected to the PCR program that
I designed. . Samples that contained the same DNA template, but with different primer
sets were loaded side-by-side on the gel to determine the GNE genotype of that sample.
This method showed to be a more efficient alternative to restriction enzyme digest
genotyping. I was able to clearly observe the bands that determined the GNE genotype of
the mice. This result is significant because not only does it reduce the time needed to
genotype the mice, but it saves significant laboratory funds on restriction enzymes, which
are often expensive.
Limitations of the study
As previously stated, I lacked the necessary access to machinery that would have
allowed me to perform histology studies. Time restraints prevented me from learning the
proper procedures as well. This prevented me from stating concretely that the
performance deficits are the result of muscle wasting because mice with this mutation
also suffer from kidney disease.
Another significant limitation was sample size. Mice that are homozygous for the
mutation are difficult to breed due to their low rates of survivability (Valles et al, 2012).
Our original founding colony suffered losses due to premature mouse deaths, as well as a
situation where several of our mice went missing. Since advanced statistical methods,
such as the t-test, become more accurate with an increased sample size, I recommend a
larger sample size for future testing.
43
Future Directions
Further studies should include histology studies, so the presence of muscle
wasting can be confirmed. Since aforementioned studies identified kidney disease in the
M712T animal model, it is integral to determine if this is present in the mice that we have
at the CSUN colony. Doing so would go a long way in showing whether or not the
performance deficits of the heterozygous and homozygous mice are due to kidney disease
or skeletal muscle wasting. There should also be significantly larger sample size to
perform statistical analyses on. My recommendation is that the CSUN colony is
expanded immediately to supply more mutant mice, since it is common knowledge that
the T-test becomes more reliable with a greater sample size. Uhlendorf (personal
interview, 2013) suggests a sample size of eight for statistical analyses, so there should be
at least this many mice available before further research endeavors are performed.
Although I was able to use qualitative measures to make connections, they are not as
infallible as quantitative measures are. Also, Ideally, the FVB-GNE and FVB.B6.GNE
mice should be tested separately as field studies have demonstrated that there are
differences in their behaviors. The FVB.B6.GNE mice are different enough from the
FVB.GNE mice that testing them in separate groups are warranted.
Regarding the novel GNE genotyping method, it is suggested that more graduate
students are trained in this technique. It has been shown that this method is quicker and
less expensive to use when genotyping mice. This method is more straightforward to
implement than regular restriction enzyme analysis. However, they must be trained by
someone with significant experience; this method is very sensitive to contamination, and
instructions must be perfectly followed precisely in order to create the desired result.
44
Also, one must be trained to interpret the results correctly. Because of the high cost of
NlaIII, it is my belief that this method could serve as the template for a more costefficient and reliable genotyping method.
45
References
Amsili, S., Zer, H., Hinderlich, S., Krause, S., Becker-Cohen, M., MacArthur, D. G., ... &
Mitrani-Rosenbaum, S. (2008). UDP-N-acetylglucosamine 2-epimerase/Nacetylmannosamine kinase (GNE) binds to alpha-actinin 1: novel pathways in
skeletal muscle?. PLoS One, 3(6), e2477.
Amsili, S., Shlomai, Z., Levitzki, R., Krause, S., Lochmuller, H., Ben-Bassat, H., &
Mitrani-Rosenbaum, S. (2007). Characterization of hereditary inclusion body
myopathy myoblasts: possible primary impairment of apoptotic events.Cell Death
& Differentiation, 14(11), 1916-1924.
Argov, A., & Yarom, R. (1984). Rimmed vacuole myopathy sparing the quadriceps: A
unique disorder in Iranian Jews. J. Neurol. Sci., 64, 33-43.
Bork, K., Reutter, W., Gerardy-Schahn, R., & Horstkorte, R. (2005). The intracellular
concentration of sialic acid regulates the polysialylation of the neural cell
adhesion molecule. FEBS letters, 579(22), 5079-5083
Broccolini, A., Gidaro, T, Morosetti, R., Sancricca, C, Mirabella, M., (2011). Hereditary
inclusion-body myopathy with sparing of the quadriceps: the many tiles of an
incomplete puzzle. Acta Myologica, 30(2), 91.
Brooks, S. P., & Dunnett, S. B. (2009). Tests to assess motor phenotype in mice: a user's
guide. Nature Reviews Neuroscience, 10(7), 519-529.
Eisenberg, I., Avidan, N, Potikha, T., Hochner, H., Chen, M., Olender, T., MitraniRosenbaum,
46
S. (2001a). The UDP-N-acetylglucosamine 2-epimerase/Nacetylmannosamine
kinase gene is mutated in recessive hereditary inclusion body myopathy. Nature
Genet., 29, 83 87.
Eisenberg, I., Grabov-Nardini, G., Hochner, H., Korner, M., Sadeh, M., Bertorini, T.,
Bushby, K., Castellan, C., Felice, K., Mendell, J., Merlini, L., Shilling, C.,
Wirguin, I., Argov, Z. and Mitrani-Rosenbaum, S. (2003), Mutations spectrum
of GNE in hereditary inclusion body myopathy sparing the quadriceps. Hum.
Mutat., 21: 99. doi: 10.1002/humu.9100
Eisenberg, I., Hochner, H., Shemesh, M., Levi, T., Potikha, T., Sadeh, M., MitraniRosenbaum, S. (2001b). Physical and transcriptional map of the hereditary
inclusion body myopathy locus on chromosome 9p12-p13. Europ. J. Hum. Genet.,
9, 501-509.
Galeano, B., Klootwijk, R. Manoli, I., Sun, M., Ciccone, C., Darvish, D., …Huizing, M.
(2007). Mutation in the key enzyme of sialic acid biosynthesis causes severe
glomerular proteinuria and is rescued by N-acetylmanoosamine. J Clin Invest.,
117(6), 1585-1594.
Greenberg, S. A., Pinkus, J. L., & Amato, A. A. (2006). Nuclear membrane proteins are
present within rimmed vacuoles in inclusion‐ body myositis. Muscle &
nerve, 34(4), 406-416.
HIBM.org. (2008). About HIBM: Living with HIBM. Retrieved March 1, 2013 from
http://www.hibm.org/arm/about_hibm:living_with_hibm.
47
Hinderlich, S., Salama, I., Eisenberg, I., Potikha, T., Mantey, L. R., Yarema, K. J., ... &
MitraniRosenbaum, S. (2004). The homozygous M712T mutation of UDP-Nacetylglucosamine 2-epimerase/ N-acetylmannosamine kinase results in reduced
enzyme activities but not in altered overall cellular sialylation in hereditary
inclusion body myopathy. FEBS letters, 566(1), 105-109.
Huizing, M., Krasenwich D.M., Hereditary Inclusion Body Myopathy: a decade of
progress, Biochim. Biophys. Acta, 1792 (2009) 881-887.
Huizing, M., Rakocevic, G., Sparks, S.E., Mamali, I., Shatunov, A., Goldfarb,L.,
Dalakas, M.C. (2004). Hypoglycosylation of alpha-dystroglycan in patients with
hereditary IBM due to GNE mutations. Mol Genet Metab., 81(3), 196–202.
Khademian, H., Mehravar, E., Urtizberea, J. A., Sagoo, S., Sandoval, L., Carbajo, R., ...
& Darvish, D. (2013). Prevalence of GNE p. M712T and hereditary inclusion
body myopathy (HIBM) in Sangesar population of Northern Iran. Clinical
genetics, 9999.
Krause S, Hinderlich S, Amsili S, Horstkorte R, Wiendl H, Argov Z, Mitrani-Rosenbaum
S, Lochmuller H. Localization of UDP-GlcNAc 2-epimerase/ManAc kinase
(GNE) in the Golgi complex and the nucleus of mammalian cells. Exp Cell Res.
2005 Apr 1;304(2):365-79. Epub 2004 Dec 19. PMID: 15748884.
Krause S., Hinderlich S, Merlini L, Tournev I, Walter MC, Argov Z, Mitrani-Rosenbaum
S, Lochmüller H. GNE protein expression and subcellular distribution are
unaltered in HIBM. Neurology. 2007 Aug 14;69(7):655-9. PMID: 17698786
48
Krause, S., Schlotter-Weigel, B., Walter, M. C., Najmabadi, H., Wiendl, H., MüllerHöcker, J., ... & Lochmüller, H. (2003). A novel homozygous missense mutation
in the GNE gene of a patient with quadriceps-sparing hereditary inclusion body
myopathy associated with muscle inflammation. Neuromuscular
Disorders, 13(10), 830-834.
Kurochkina, N., Yardeni, T., & Huizing, M. (2010). Molecular modeling of the
bifunctional enzyme UDP-GlcNAc 2-epimerase/ManNAc kinase and predictions
of structural effects of mutations associated with HIBM and
sialuria.Glycobiology, 20(3), 322-337.
Malicdan, M. V., & Nonaka, I. (2008). Distal myopathies a review: Highlights on distal
myopathies with rimmed vacuoles. Neurology India, 56(3), 314.
Malicdan, M. C. V., Noguchi, S., Hayashi, Y. K., & Nishino, I. (2008). Muscle weakness
correlates with muscle atrophy and precedes the development of inclusion body or
rimmed vacuoles in the mouse model of DMRV/hIBM.Physiological
Genomics, 35(1), 106-115.
Malicdan, M. C. V., Noguchi, S., Hayashi, Y. K., Nonaka, I., & Nishino, I. (2009).
Prophylactic treatment with sialic acid metabolites precludes the development of
the myopathic phenotype in the DMRV-hIBM mouse model.Nature
medicine, 15(6), 690-695.
Malicdan M.C.V., Noguchi S, Nonaka I, Hayashi YK, Nishino I .A GNE knockout
mouse expressing human GNE D176V mutation develops features similar to
distal myopathy with rimmed vacuoles or hereditary inclusion body myopathy.
49
Hum Mol Genet. 2007 Nov 15;16(22):2669-82. Epub 2007 Aug 18. PMID:
17704511
Mori-Yoshimura, M., Monma, K., Suzuki, N., Aoki, M., Kumamoto, T., Tanaka, K., ... &
Nishino, I. (2012). Heterozygous UDP-GlcNAc 2-epimerase and Nacetylmannosamine kinase domain mutations in the GNE gene result in a less
severe GNE myopathy phenotype compared to homozygous Nacetylmannosamine kinase domain mutations. Journal of the neurological
sciences.
Mouse Mutant Resource Web Site, The Jackson Laboratory, Bar Harbor, Maine. World
Wide Web (http://mousemutant.jax.org/). March 2013.
Noguchi, S., Keira, Y., Murayama, K., Ogawa, M., Fujita, M., Kawahara, G., Nishino,
(2004). Reduction of UDP-N-acetylglucosamine 2
epimerase/Nacetylmannosamine kinase activity and sialylation in distal myopathy
with rimmed vacuoles. J Biol Chem, 279(12), 11402-7.
Paccalet, T., Coulombe, Z., & Tremblay, J. (2010). Gangliosside gm3 levels are altered in
a mouse model of HIBM: Gm3 as a cellular marker of the disease. PloS One,
5(4), e10055.
Ricci, E., Broccolini, A., Gidaro, T., Morosetti, R., Gliubizzi, C., Frusciante, R.
Mirabella, M. (2006). NCAM is hyposialylated in hereditary inclusion body
myopathy due to GNE mutations. Neurology, 66, 755-758.
Saito F, Tomimitsu H, Arai K, Nakai S, Kanda T, Shimizu T, Mizusawa H, Matsumura
K. A Japanese patient with distal myopathy with rimmed vacuoles: missense
50
mutations in the epimerase domain of the UDP-N-acetylglucosamine 2epimerase/N-acetylmannosamine kinase (GNE) gene accompanied by
hyposialylation of skeletal muscle glycoproteins. Neuromuscul Disord. 2004
Feb;14(2):158-61. PMID: 14733963
Salama I, Hinderlich S, Shlomai Z, Eisenberg I, Krause S, Yarema K, Argov Z,
Lochmuller H, Reutter W, Dabby R, Sadeh M, Ben-Bassat H, MitraniRosenbaum S. Abstract No overall hyposialylation in hereditary inclusion body
myopathy myoblasts carrying the homozygous M712T GNE mutation. Biochem
Biophys Res Commun. 2005 Mar 4;328(1):221-6. PMID: 15670773
Tajima, Y., Uyama, E., Go, S., Sato, C., Tao, N., Kotani, M., ... & Sakuraba, H. (2005).
Distal myopathy with rimmed vacuoles: impaired O-glycan formation in muscular
glycoproteins. The American journal of pathology, 166(4), 1121-1130.
Vasconcelos, O. M., Raju, R., & Dalakas, M. C. (2002). GNE mutations in an American
family with quadriceps-sparing IBM and lack of mutations in s- IBM. Neurology,
59, 1776-1779.
Valles-Ayoub, Y., Haghighatgoo, A., Saechao, C., Khokher, Z., & Creencia, C. (2012).
Mixed Inbred FVB; B6 Background Strain Attenuates Kidney Disease and
Improves Survival of Gne M712T/M712T Mice. Molecular Biology, 1, 104.
Valles-Ayoub, Y., Khokher, Z., Sandoval, L., Haghighatgoo, A., & No, D. (2013).
Background Strain and Natural Selection Improves Survival of HIBM Murine
Model. Mol Biol, 2(109), 2.
51
Weidemann, W., Reinhardt, A., Thate, A., & Horstkorte, R. (2011). Biochemical
characterization of the M712T-mutation of the UDP- N-acetylglucosamine 2epimerase/N-acetyl-mannosaminekinase in hereditary inclusion body
myopathy. Neuromuscular Disorders, 21(12), 824-831.
52
Appendix
Figure 1: Diagram of chromosome 9, with a GNE gene shown via arrow. Bands are
indicated with vertical stripes. Location of GNE gene is 9p 13.3
Figure 2: Secondary structure of GNE enzyme. Yellow arrows are the -sheet and red
spirals are -helices. Figure adapted from the database of secondary structures (DSSP)
53
Figure 3: Diagram showing intracellular sialic acid metabolism. The synthesis of sialic
acid (Neu5Ac) is initiated in the cytosol, where glucose undergoes several modifications
to eventually become sialic acid. The UDP-GlcNAc 2-epimerae GNE/ManNAc kinase
(MNK) enzyme is the central and rate-limiting enzyme in this cytosolic process. GNE
activity is feedback inhibited by the downstream product CMP-sialic acid. Sialic acid is
converted in the nucleus to CMP-Sialic acid, which is utilized by the Golgi complex to
sialylate oligosaccharides (OGS). Sialylated OGS are degraded in lysosomes. Adapted
from Huzing et al., 2005.
Figure 4: Schematic of the GNE/MNK protein structure (not to scale). GNE/MNK is a
722 amino acid (aa) bifunctional enzyme. The N-terminal GNE epimerase catalytic
domain (aa 1-303) contains an allosteric site at 263-266, and a putative nuclear export
54
signal at 121-140. The C-terminus harbors the MNK kinase catalytic domain (410-722).
Adapted from Huzing et al., 2005
Figure 5: A. structure of the active site of epimerase domain of GNE/MNK enzyme,
comparing E. coli GNE epimerase domain with the human GNE epimerase domain. The
wire model shows the side chains of the active site residues. B. Primary sequence
alignment of the active-site region of the human (GNE/MNK) and E. coli (Mlc) genes.
Adapted from Kurochkina et al., 2010.
Figure 6: The N-acetylmannosamine kinase (MNK) domain of the human GNE/MNK
enzyme. Methionine 712 is at the interface of the -helices shown in green and -sheets
55
shown in blue. Proposed glucose binding residues Asn516, Asp517, Glu566, are shown.
The two ATP binding motifs characteristic for sugar kinases are in magenta. Adapted
from Kurochkina et al., 2010.
Figure 7: Set up showing the wire hang test assembly. This assembly can be simply
reproduced in most labs. The test allows mice to lift its body above the wire axis. In this
position the animal reduces the hanging force on its front paws.
Figure 8: Partial GNE provided by HRG lab
1 agcacttcct ggagtttgat gtaaagtttc ctggaaatgt ctctgctttt
51 accctcctgc agctggaact gctttgggac ttggggttgt gaacatcctc
101 cacactatga atccttccct ggtgatcctg tctggagtcc tggccagtca
151 ctacatccac atcgtgaagg acgtcatccg ccagcaagcc ttgtcctccg
201 tgcaggatgt ggacgtggtg gtctcagact tggtggaccc ggccctgctt
251 ggcgcagcca gcaYggttct ggactacaca acgcgcagga tccactaggt
301 ctcccgggaa cggacacgga cagagactcg ggagctgctt agagtggaac
56
351 catgctcttc tagatcagtg tttctgcgaa ggcaaat
Mice
Figure 9: FVB-GNE Mice
57
FVB.B6.GNE
58
Housing, Mouse Chow, and Bedding
Identification Card
59
DNA Extraction Protocol
60
Polymerase-Chain-Reaction and Restriction Enzyme Digestion
61
62