CALIFORNIA STATE UNIVERSITY, NORTHRIDGE
THERAPEUTIC RESPONSE OF GBM STEM-LIKE CELLS AND THE GBM CELL
OF ORIGIN
A thesis submitted in partial fulfillment of the requirements
For the degree of Master of Science in Biology
By
Tannaz Faal
August 2012
The thesis of Tannaz Faal is approved:
Dr. Daniel Odom, Ph.D.
Date
Dr. Mary-Patricia Stein, Ph.D.
Date
Dr. Cindy Malone, Ph.D., Chair
Date
California State University, Northridge
ii
ACKNOWLEDGEMENTS
I would like to thank my thesis committee members, Dr. Cindy Malone, Dr. MaryPatricia Stein, and Dr. Daniel Odom for the continual support and guidance. I would like
to thank my lab mentor Dr. Harley Kornblum and members of the Kornblum lab for their
constant support and encouragement. I would like to thank Tiffany Phillips, Jantzen
Sperry, Michelle Shih, Andre Gregorian, Andres Paucar, Dan Laks, Janel Lebelle,
Brigitte Angenieux, Jack Mottahedeh, Yasmin Ghochani, and all past and present lab
members who offered me support and help with troubleshooting during my research. I
would like to especially express my gratitude to my mentor of six years, Dr. Cindy
Malone, for spending time proofreading this thesis and being a constant source of
knowledge and encouragement. This research was funded and supported by CSUNUCLA Bridges to Stem Cell Research, CIRM TB1-01183. This thesis is dedicated to my
loving and supportive parents, Amir and Rowshan Faal. Without their constant and
unconditional encouragement, none of this would have been possible.
iii
TABLE OF CONTENTS
Signature Page
i
Acknowledgements
ii
Abstract
vi
Chapter 1: Thesis Project Introduction
1
Chapter 2: Therapeutic Response of GBM Stem-Like Cells
3
Introduction
3
GBM Histology and Pathology
4
Cancer Stem Cells
7
GBM Subtypes
9
Therapeutic Treatment of GBM
12
Experimental Purpose
21
Materials and Methods
23
Neurosphere Cultures
23
RNA Isolation
24
Reverse Transcription and Quantitative PCR
25
In Vitro Neurosphere Formation Assay
26
Results and Figures
28
Neurosphere Culture Response to TMZ and Radiation
28
MGMT Expression
30
Discussion
39
Neurosphere Culture Response to Treatment
39
MGMT Expression
44
iv
Future Directions
47
Conclusions
48
Chapter 3: GBM Cell of Origin
50
Introduction
50
Materials and Methods
52
Mouse Colony Breeding scheme
52
Genotyping by PCR and gel electrophoresis
52
Results and Discussion
54
Chapter 4: Concluding Remarks
59
Bibliography
61
v
LIST OF FIGURES & TABLES
Section 2.1 Figures
Figure 1. Axial MRI image of WHO grade III anaplastic Astryocytoma
progressing into WHO grade IV GBM
4
Figure 2. Diagram of the brain cancer stem cell model
9
Figure 3. Interaction of MGMT with DNA
15
Figure 4. Effects of TMZ on DNA
17
Section 2.3 Figures
Figure 1. Dose dependent percent sphere formation curves among
neurosphere cultures.
32
Figure 2. Sphere diameter in the high, medium, and low response groups
as seen in ninety six well plates after four to five weeks of growth.
35
Figure 3. 25 uM TMZ response and MGMT expression varies between
three response groups.
36
Section 3.3 Figures
Figure 1. Mouse colony breeding scheme.
55
Table. 1 List of primers used for genotyping mice in
breeding colony.
55
Figure 2. Cre-Lox breeding scheme.
56
Figure 3. PCR analysis of KrasLSL/+ positive mice from
Ptenflox/flox X KrasLSL/+ cross.
57
Figure 4. PCR analysis of Ptenflox/flox positive mice from
Ptenflox/flox X KrasLSL/+ and Ptenflox/flox crosses.
vi
58
ABSTRACT
Therapeutic Response of GBM Stem-Like Cells and the GBM Cell of Origin
By
Tannaz Faal
Master of Science in Biology
Glioblastoma Multiforme (GBM) is the most common and aggressive type of
adult brain cancer that offers only one to two years of survival and results in the growth
of brain tumors. GBM was studied by a group of researchers called The Cancer Genome
Atlas (TCGA). This group identified four distinct types of GBM that differ from each
other based on unique genetic mutations, rate of tumor growth, and response to treatment.
Some cancer cells have stem cell properties such as the ability to give rise to multiple cell
types and maintenance of self-renewal, which may advance the rate of tumor growth. It is
believed that this cancer stem cell population infers resistance to radiation and
Temozolomide (TMZ) chemotherapeutic treatment in GBM. TMZ eradicates cells by
alkylating their DNA to cause cell death. Working with primary patient derived GBM
stem-like cell cultures, we show that the cultures separate into different response groups
that will be used in later studies to classify the cultures into TCGA subgroups.
Additionally, we also show that expression of the DNA repair enzyme, MGMT, which
removes TMZ induced DNA alkylation, infers GBM culture resistance to TMZ.
Though much work has been conducted on the genetic anomalies prevalent and
efficacy of treatment of GBM, little is known about the cell of origin in GBM. In fact, the
cell of origin for GBM has not yet been identified. The main purpose of the second
vii
portion of this research project is to determine the role genetic mutations in the tumor
suppressor gene, PTEN, and the oncogenic gene, KRAS, in specific brain cells and their
potential to produce GBM tumors in mouse brains. We hypothesize that loss of PTEN
and over expression of KRAS in NG2, which is a proteoglycan found on neural
progenitor cells, positive mouse cells will result in tumor formation. A CRE-LOX
breeding system was used to successfully generate genetic mutations in the mice. We
have successfully bred mice that express Pten and contain Kras genetic mutations. We are
currently conducting the final genetic cross to determine whether tumors will form from
the NG2 positive cells.
We have successfully identified groups of our GBM neursophere cultures that
differ from each other based on their response to treatment. This data will be used when
we begin to classify our cultures into one of the four TCGA GBM subgroups.
Additionally, identifying the cell type of origin for GBM will also provide important
insight on how to combat this cancer to develop more targeted cancer therapy in the
future.
viii
CHAPTER 1. THESIS PROJECT INTRODUCTION
Glioblastoma (GBM) is a very common and extremely aggressive type of adult
brain cancer that results in the growth of tumors in the brain. Patients diagnosed with
GBM can expect to live only one to two years upon diagnosis and treatment of GBM
only extends the patients’ survival a short time (Ohgaki and Kleihues, 2005). Within the
GBM tumor, there exists a population of cancer cells that have stem cell properties such
as the ability to give rise to multiple cell types and maintain the ability to self-renew.
These GBM cancer stem-like cells show resistance to cancer treatment and cause
tumorigenesis in mice upon transplantation (Singh et al., 2004, Nakano and Kornblum,
2006 and Laks et al., 2009). Using GBM stem-like cells is commonly used for the in vitro
study of this cancer (Laks et al., 2009). The projects presented in this thesis lay the
groundwork to understand how GBM confers treatment resistance by using a novel in
vitro culture system for GBM stem-like cells and also seeks to identify the cell type from
which GBM arises by using a transgenic and knockout mouse breeding system.
Recently, GBM was classified into four distinct subgroups that differed from each
other based on unique genetic mutations, rate of tumor growth, and response to treatment
(Verhaak et al., 2010). Chapter II describes a project explaining treatment resistance in
GBM that will be used in later studies to classify GBM cultures into the four subgroups.
We hypothesized that our GBM neurosphere cultures would show clear groupings based
on whether cultures were high responders (sensitivity to treatment) or low responders
(resistance to treatment). In order to determine how aggressive the different tumor lines
were, cell survival under drug and radiation treatment conditions was observed over the
span of a month. Samples of these same cells were treated with Temozolomide, which is
1
the chemotherapy drug used in patient treatment, or radiation. Cell growth and survival
were recorded for both treatments. Our data show that in vitro GBM cell cultures separate
into different response groups. This data will later be used in conjunction with microarray
analyses to determine the classification of the GBM cell cultures into the four subgroups.
Chapter III describes a project designed to identify the cellular origin of GBM.
We predict that NG2, which is a proteoglycan expressed on neural progenitor cells,
positive cells in the brain are the tumor initiating cell types for GBM. Specifically, we
believe that Pten and KRAS genetic mutations in NG2 progenitors in the brain will cause
GBM tumorigenesis. Pten and KRAS are phosphatases that regulate cellular pathways.
Previous studies have shown that when the gene controlling Pten is deleted and the gene
expressing KRAS protein is over expressed, tumorigenesis will occur in specific
progenitor cells (Gregorian et al., 2009 and Jackson et al., 2001). By focusing on NG2
cells and inducing mutations therein, we will be able to determine whether the tumor
formed is a glioblastoma or an oligodendrocyte specific tumor.
This thesis provides information to facilitate future studies involving
chemotherapy and radiation resistance in GBM as well as identification of the cell of
origin in GBM. The main goal of this project is to better understand how GBM has
eluded treatment to maintain its malignancy and continued proliferation of cancer cells.
Identifying the GBM cell of origin and understanding how GBM responds to treatment
will help shed some light on how to treat this cancer in a more efficient way in order to
improve patients’ quality of life in the future.
2
CHAPTER 2. THERAPEUTIC RESPONSE OF GBM STEM-LIKE CELLS
Introduction
Glioblastoma (GBM) is an extremely aggressive and fatal cancer that has limited
treatment options with very poor patient prognosis. GBM is a particularly malignant form
of astrocytoma, which is the most common type of tumor in the central nervous system
that typically occurs in males (Ohgaki and Kleihues, 2005). Like most cancers, GBM
results from multiple genetic mutations that delete tumor suppressor genes and promote
the over expression of oncogenic genes. Recent studies have suggested that abnormalities
in neural stem cells, oligodendroglial progenitor cells, or astrocytes may underlie
tumorigenesis of GBM (Assanah et al., 2006, Lindberg et al., 2009 and Belachew et al.,
2003). However, the specific cell type that gives rise to GBM is currently unknown.
Although novel drugs are being developed, treatment of GBM is currently limited
to complete surgical removal of necrotic tissue followed by chemotherapy with
Temozolomide and radiation treatment (Panet-Raymond et al., 2009 and Terasaki et al.,
2010). Despite aggressive treatment strategies, average patient survival is only about one
to two years (Ohgaki and Kleihues, 2005). Patients that are diagnosed with GBM
typically experience headaches, seizures, memory loss, nausea, vomiting, personality
changes, and other neurological abnormalities. Magnetic resonance imaging (MRI) is
used to visualize and diagnose GBM (Figure 1). The highly infiltrative characteristic of
GBM as well as tissue death surrounding the tumor can be observed in MRI images (Wen
and Kesari 2008). It is important to develop an understanding about the molecular
pathways and genetic mutations that cause GBM cancer cells to proliferate as well as to
understand the mechanism of action of treatment, before thinking of new ways to combat
3
GBM. With our research, we want to determine how our primary GBM patient derived
neurosphere cultures would respond to cancer treatment.
Figure 1. Axial MRI image of WHO grade III anaplastic astryocytoma progressing
into WHO grade IV GBM . (a) FLAIR MRI imaging reveals lesions consisting of
infiltrating tumor cells indicated by arrow. (c) After one year, tumor progressed to GBM
with widely infiltrating tumor cells indicated by arrows. FLAIR MRI image shows both
increase in tumor size and GBM cancer cell infiltration (Brat and Van Meir, 2004).
GBM Histology and Pathology
In 2010 twenty two thousand new cases of GBM were diagnosed (American
Cancer Society). The World Health Organization (WHO), the leading international
agency whose primary concern is public health, implements a grading system that
classifies tumors in the central nervous system based on their progressive malignancy.
Grade I tumors are considered benign, whereas grade IV tumors are considered
infiltrative and aggressive. Glioblastoma falls under WHO grade IV tumors (Louis et al.,
2007). GBM is a type of glioma, tumors of the brain or spine. Gliomas are so named
because they arise from an unknown glial cell type. There are several types of glial cells
that are found in different regions of the brain. Glial cells have many functions that
included the formation of a layered complex around neurons called the myelin sheath that
4
serves to insulate the neuron to allow propagation of impulses. Glial cells regulate
extracellular ion concentrations, maintain homeostasis, and provide structural support for
neurons.
GBM may develop as either a primary tumor with unknown growth origin or a
secondary tumor that has progressed from a lower grade astrocytoma, a type of brain
cancer that arises from glial cells and affects the cerebrum and spinal cord (Ohgaki and
Kleihues, 1999). Some of the defining features of GBM include a heterogeneous cell
population within the tumor and tissue necrosis. The presence of dead tissue within the
tumor indicates that a patient with lower grade astrocytoma has progressed to the more
aggressive GBM (Goldman et al., 1993, Wen and Kesari, 2008). Response to therapeutic
treatment varies greatly between GBM patients and is made especially difficult due to the
mixed cell types in the tumor population. Having a heterogeneous cell population makes
targeted therapy hard to develop and inefficient in practice.
Primary GBM typically affects older patients and includes mutations in EGFR,
Pten, CDKN2A, and MDM2 genes (Ohgaki and Kleihues, 1999). EGFR is a gene for
epidermal growth factor receptor, which is responsible for cell proliferation.
Amplification of the EGFR gene allows the brain tumor to maintain cell growth (Mariadel-Mar et al., 2010). CDKN2A encodes a gene that suppresses tumor growth. The
deletion of CDKN2A would cause tumor growth (Negrini et al., 2010). MDM2 is a gene
involved in the apoptotic pathway, as described in the following paragraph. This panel of
genes can be used to examine status of GBM malignancy.
Secondary GBMs progress from lower grade astrocytomas into GBM after a
period of time. These GBMs typically affect younger patients and contain tumor protein
5
53 (TP53) mutations (Ohgaki and Kleihues, 1999). TP53 is known as the “guardian of the
genome”, it is a tumor suppresser gene that regulates cell cycle arrest and apoptosis (Lane
1992). Over fifty percent of cancers are known to have mutations in the TP53 gene
(Hollstein et al., 2009). TP53 mutations allow for the proliferation of cancer cells. TP53
is located upstream of two genes called P21 and MDM2, transcriptionally driving their
expression (Chen et al., 1993). P21 regulates cell cycle arrest and induces apoptosis in
cells that contain DNA mutations. MDM2 negatively regulates transcription of TP53. If
TP53 is mutated and, therefore, not expressed, P21 is not expressed and regulation of cell
cycle arrest and apoptosis is hindered. As a result, cancer cells continue to proliferate,
unchecked (Cerami et al., 2010).
Phosphatase and tensin homolog, known as Pten, is a well-known tumor
suppressing gene that plays an important role in the phosphatidylinositol 3-kinase (PI3K)
pathway (Maehama and Dixon, 1998). The PI3K pathway is responsible for the
regulation of important cellular processes such as cell proliferation. The Pten protein
hydrolyzes PI(3)P, which is a protein kinase product of the PI3K signaling pathway.
Deletion of the Pten gene, which encodes a phosphatase protein, is a hallmark of many
cancers including GBM (Maehama and Dixon, 1998). PI(3)P is responsible for cell
proliferation, growth, and survival. Inactivation of PI(3)P prevents signal cascades,
resulting in inactivation of downstream signaling activation of the PI3K pathway
(Maehama and Dixon, 1998). Deletion of Pten has been shown to increase radiation
therapy resistance among GBM cells (Maehama and Dixon, 1998). This is due to the
regulation of the PI3K/AKT pathway and DNA repair mechanisms by Pten.
6
Radiosensitivity increases and cell survival decreases when GBM cells are treated with
inhibitors of the PI3K/AKT pathway (Kao et al., 2007).
Cancer Stem Cells
It has been posited that within the heterogeneous cellular makeup of the GBM
tumor, there exists a subpopulation of cancer stem-like cells (CSCs) (Figure 2) (Singh et
al., 2004, Nakano and Kornblum, 2006, Laks et al., 2009). According to the cancer stem
cell hypothesis, this cell population is capable of self-renewal, growth, and differentiation
into more mature brain cells (Nakano and Kornblum, 2006, Laks et al., 2010). It is
hypothesized that CSCs in the brain arise due to mutations in neural stem cells found
within the subventricular zone of the brain, which is where normal neural stem cells can
be found. These CSCs express neural stem cell markers such as CD133 and nestin (Singh
et al., 2004). Other neural stem cell makers such as c-MYC, OCT-4, and Olig-2 regulate
survival and proliferation of the CSCs (Laks et al., 2010). One study in particular
collected brain tumor cells containing the CD133 marker and xenografted these cells into
severe combined immunodeficient mice (Singh et al., 2004). Injection of as few as one
hundred CD133 positive CSCs into the brains of the mice recapitulated the brain tumor.
However, injection of tens of thousands of CD133 negative cells from the patient tumor,
which are not CSCs, did not result in tumorigenesis. These results indicate the CSCs,
rather than the more differentiated cancer cells, give rise to brain tumors.
The culturing of CSCs from brain tumor samples including GBM is commonly
implemented as an in vitro means to study this brain cancer (Reynolds et al, 1992, Lee et
al., 2006). Neurospheres are neural progenitor cells that are derived from neural stem
cells and form a sphere structure that is free floating in culture and comprised of many
7
cells (Reynolds and Weiss, 1992, Laks et al., 2009, Laks et al., 2010). Neurospheres are
able to self-renew and differentiate into the cells that comprise the tumor of origin. Cells
from patient GBM tumor samples were plated into culture conditions that included
epidermal growth factor (EGF) and fibroblast growth factor (FGF) (Galli et al., 2004).
After a few weeks, neurospheres formed from these cells, which were capable of
prolonged and stable self-renewal. EGF and FGF selected against differentiated cells and
selected for cells that exhibited stem cell markers (Reynolds et al., 1992). Serial
transplantations of these neurospheres were successfully performed in mice in order to
show that these CSCs were capable of tumor formation (Galli et al., 2004). In a similar
study, primary GBM derived neursopheres were xenografted into a mouse brain in order
to observe the potential for these cells to recapitulate the GBM tumor in the mouse (Laks
et al., 2009). The neurospheres produced a tumor that was metastatic and histologically
similar to a typical GBM tumor. Additionally, patients whose tumors formed
neurospheres experienced diminished survival compared to patients whose tumors were
unable to be cultured as neurospheres (Laks et al., 2009). Both studies described above
show that the primary patient GBM tumor samples were capable of both forming a
renewable source of neurospheres under in vitro conditions while also reforming the
tumor using an animal model. These studies both demonstrate that using neurosphere
cultures is an efficient and accurate method of studying GBM and also show that cancer
stem cells give rise to tumors.
8
Figure 2. Diagram of the brain cancer stem cell model. The tumor contains a
subpopulation of CSCs that express stem cell surface markers and are capable of selfrenewing their population, differentiating into mature cell types, and cause tumor growth.
Differentiation is represented by the darker blue colors (Laks et al., 2010).
GBM Subtypes
GBMs have been classified into new categories based on gene expression profiles
from GBM patient tissue samples (Verhaak et al., 2010, Phillips et al., 2006). Each of
these subtypes, proneural, neural, classical, and mesenchymal, contains unique genetic
mutations and cellular signatures. The four different TCGA subgroups have different
prognoses varying in their response to treatment. Many of the genes and pathways that
are repressed or amplified in GBM affect the apoptotic pathway and proliferative
9
capacity, which cause tumors to become more infiltrative overtime (Verhaak et al., 2010,
Phillips et al., 2006).
Patients whose GBM tumors have been classified as proneural have the best
prognosis and longest survival time compared to the other three subgroups (Verhaak et
al., 2010, Phillips et al., 2006). The proneural subtype is associated with an
oligodendrocytic cell signature, which is a more differentiated neuronal cell. The
expression of a more differentiated cell signature produces a less aggressive tumor and a
less severe prognosis of GBM (Phillips et al., 2006). Further, the proneural subtype
commonly occurs in younger patients and, although aggressive treatment does not affect
patient outcome, this subclass is associated with longer survival time (Verhaak et al.,
2010).
The proneural subtype is associated with highly amplified platelet-derived growth
factor receptor alpha (PDGFRA) gene expression and point mutations in isocitrate
dehydrogenase 1 (IDH1) (Verhaak et al., 2010). PDGFRA is a receptor that, like most
mutated genes in GBM, controls cell differentiation and growth. PDGFRA is also
involved in the PI3K/AKT pathway. This pathway is important for tumorigenesis
(Brennan et al., 2009, Cantley et al., 2002). IDH1 is an enzyme that is important for
glucose metabolism and energy production during the citric acid cycle. IDH1 mutations
are hetereozygous, and typically occur in younger patients whose GBM has progressed
from lower grade gliomas (Yan et al., 2009). IDH1 drives the decarboxylation of
isocitrate, an intermediate of the citric acid cycle, while reducing NADP to NADPH and
producing carbon dioxide. Mutations in the IHD1 gene result in a diminished ability to
decarboxylate NADP to NADPH during the citric acid cycle that causes a buildup of
10
NADPH, which increases reactive oxygen species, leading to oxidative stress and DNA
damage that would favor tumorigenesis (Lee et al., 2002, Yan et al., 2009). Studies have
shown that GBM patients having IDH1 mutations experience a longer survival time than
those with wild type IDH1 (Yan et al., 2009). In addition to sharing the same genetic
mutations and characteristics, the TCGA subtypes also share the same cellular signature
within their respective groups.
The second GBM subtype, called classical, contains chromosome 7 amplification,
Pten deletion, and high levels of EGFR amplification (Verhaak et al., 2010). This subtype
does not have the mutated TP53 gene that is common among most GBMs. Additionally,
the Notch pathway, which plays a role in early differentiation of neurons, is activated.
The classical subtype is associated with an astrocytic cell signature and aggressive
treatment is found to reduce mortality of patients (Verhaak et al., 2010).
The third subtype, called neural, expresses neuronal markers and is associated
with oligodendrocytic and astrocytic differentiation. The neural subtype does not have
any unique genetic mutations, as seen in the other subgroups. Aggressive treatments in
the neural subgroup somewhat affect survival (Verhaak et al., 2010).
The final subtype, mesenchymal, is the most aggressive form of GBM. Patients
whose tumors have been classified as mesenchymal experience the shortest survival time
(Verhaak et al., 2010). The mesenchymal subtype is associated with expression of
mesenchymal and astrocytic markers. It is strongly associated with an astroglial cell
signature, which is a glial cell type that provides structural support and ion regulation to
surrounding neurons. This subclass contains the highest fraction of necrosis within GBM
tumors and although aggressive treatment reduces mortality, it is still the most aggressive
11
of the subtypes (Verhaak et al., 2010). Studies have shown that GBMs that appear to be
less differentiated and, therefore, contain stem cell markers, tend to produce more
aggressive tumors when compared to subtypes that are associated with more
differentiated markers (Phillips et al., 2006). This explains why the proneural subtype is
less aggressive than the mesenchymal subtype, which contains stem cell markers.
The mesenchymal subgroup contains deletion of neurofibromin 1 (NF1), a protein
that negatively regulates the RAS pathway. When the RAS pathway is constitutively
turned on, tumorigenesis and cancer cell proliferation occurs (Miller and Miller, 2012).
Angiogenic markers are also overexpressed in this subtype. Vascular endothelial growth
factor (VEGF) is an example of an angiogenic factor found in the mesenchymal subtype.
VEGF provides vasculature to the tumor (Phillips et al., 2006). GBM tumors take on the
phenotype of the mesenchymal subtype upon recurrence which results lower survival
time and higher morbidity (Phillips et al., 2006).
Therapeutic Treatment of GBM
GBM is a cancer whose genetic character greatly varies between patients. GBM
elicits different phenotypes and responses to treatment among patients. Treatment plans
are very limited but have been shown to be subtype specific (Verhaak et al, 2010, Phillips
et al., 2006). Resection of the tumor followed by radiation and chemotherapy treatment is
clinically implemented upon diagnosis of GBM. However, current treatment strategies do
not provide long term survival. CSCs are resistant to treatment and cause tumorigenesis
following surgical resection (Reya et al., 2001, Singh et al., 2004, Laks et al., 2009). We
sought to determine how our primary GBM patient derived neurosphere cultures would
respond to cancer treatment. We obtained patient GBM tumor samples, following tumor
12
resection, and cultured them as neurospheres. We treated culture samples with
Temozolomide (TMZ) and radiation, at doses and concentrations that are typically
administered in a clinical setting. We hypothesized that GBM neurosphere cultures would
group as high responders (sensitivity to treatment) or low responders (resistance to
treatment) based on the number of dissociated neurosphere cells that were capable of
forming sphere structures following treatment with TMZ or radiation.
To understand how chemotherapeutic and radiation treatment of GBM may result
in GBMs bypassing treatment, it is important to understand the cell cycle and how it
operates in cancerous cells. Cancer most often arises due to mistakes in the cell cycle
(Hartwell and Weinert, 1989, Groszer et al., 2005). During the G0 phase, cells are at rest
and not dividing. During the G1 phase, cell size increases and the cell enters the G1
checkpoint to determine whether division or senescence should occur. During the S
phase, DNA replication occurs. At the G2 checkpoint, cells are examined to make sure
that the DNA has replicated correctly. This G2 stage of the cell cycle, typically,
experiences the highest number of errors that could lead to tumorigenesis. Typically, cells
that have abnormalities in their DNA will undergo apoptosis at the G1 or G2 checkpoint
(Vaziri et al., 2003). Unfortunately, regulatory pathways are often hindered in cancers,
causing irregular cells to undergo cell division at the mitotic phase of the cell cycle.
TP53, for example, functions at the cell cycle checkpoints (Huang et al., 1996, Vaziri et
al., 2003, Cerami et al., 2010). Before cells are allowed to divide, TP53 examines the
newly synthesized DNA. When errors are identified, TP53 can either repair the DNA or
force the cell to undergo apoptosis. Many cancerous cells have flawed checkpoints,
which may or may not affect clonogenic survival upon irradiation and TMZ treatment
13
(Begg et al., 2011). Cancers such as GBM, which often contain mutations that cause
silencing or abnormal behavior of repair proteins, have defective checkpoints and
incorrect DNA repair functions. The success of TMZ and radiation is contingent upon the
cell’s ability to process and fix DNA damage.
TMZ is a drug that adds alkyl groups to DNA. Alkylation by TMZ impedes DNA
replication and is thought to cause apoptosis of the cell (Villano et al., 2009). TMZ works
best in patients with GBM that have methylated O6-methylguanine-DNA
methyltransferase (MGMT) promoters. MGMT is a gene that encodes a repair enzyme
that is responsible for repairing DNA by removing alkyl groups from the sixth position of
oxygen on the guanine residue of the DNA strand (Figure 3). Thus, expression of the
MGMT protein results in the removal of TMZ-induced alkyl damage, thereby negating
the drug’s effects. MGMT contains two important domains. The first domain is called 6O-methylguanine DNA methyltransferase, ribonuclease-like domain and the second
domain is part of the ATase protein superfamily (Tubbs et al., 2007). Both domains are
responsible for repairing guanine bases that have aberrant alkylation on the sixth oxygen
position of a guanine base. The C-terminal portion of the ATase motif is needed for
binding to the target DNA as well as transferring the aberrant alkyl group onto its own
structure (Tubbs et al., 2007, Villano et al., 2009). Though the function of the N terminal
domain is unknown, its removal results in a loss of function to the ATase domain.
Additionally, the ATase domain includes the active site of the enzyme. This site contains
a tyrosine residue that causes the three prime end of the MGMT protein to flip the
alkylated guanine. In this way, alkylation of the sixth oxygen position is transferred to a
cysteine residue on the active site of the MGMT protein. This reaction causes the enzyme
14
to become permanently inactive and later cleared by the organism’s system (Tubbs et al.,
2007). Silencing of the MGMT gene via methylation is observed in many cases of GBM,
causing sensitivity to TMZ treatment (Hegi et al., 2005).
Figure 3. Interaction of MGMT with DNA. MGMT is an enzyme that removes
aberrant alkylation of the bases on the DNA double helix. The removal of alkyl damage
often causes chemotherapy resistance in GBM patients (Berman et al., 2000, Hegi et al.,
2005).
TMZ is administered orally to patients and it can penetrate the blood-brain barrier
to deliver the therapeutic effects of the drug to tumor cells in the brain (Villano et al.,
2009). However, specific localization of TMZ in the central nervous system is unknown.
After the drug is absorbed in the patient’s body, the aqueous environment causes the
spontaneous hydrolysis of TMZ to the compound methyl-triazeno-imidazolecarboxamide (MTIC). MTIC is then converted to an electrophilic cation called
methyldiazonium, which is responsible for the alkylation of DNA in target tumor cells in
15
the brain. The third nitrogen position on an adenine nucleotide and the seventh nitrogen
position on a guanine nucleotide on the target DNA are alkylated by the drug. However,
it is the alkylation of the sixth oxygen position on the guanine nucleotide on the target
DNA that causes the cytotoxic effects of TMZ. This alkylation causes apoptosis to occur
due to double strand breaks in the DNA strand (Villano et al., 2009).
Some cancer cells might still contain intact base excision repair (BER)
mechanisms that remove DNA damage and allow oncogenic cells to proliferate
(Marchesi et al., 2007, Villano et al., 2009). Poly ADP-ribose polymerase (PARP) is a
protein that changes the structure and function of BER proteins that would repair
methylation of guanine residues (Donawho et al., 2007). Therefore, using PARP
inhibitors would decrease the effects of BER proteins and allow the cytotoxic effects of
TMZ to persist and induce apoptosis of tumor cells. Another compound called O6 benzyl
guanine (O6-BG), transfers its benzyl group to cysteine residues on MGMT in order to
inhibit MGMT functionality. O6-BG is being studied to determine its efficacy in
increasing patient sensitivity to TMZ (Quinn et al., 2005, Broniscer et al., 2007). Figure 4
shows a diagram summarizing the effects of TMZ (Villano et al., 2009).
16
Figure 4. Effects of TMZ on DNA. TMZ adds methyl groups to the sixth oxygen and
seventh nitrogen position of a guanine residue and the third nitrogen position of an
adenine residue. Alkylation of the sixth oxygen position on guanine nucleotides results in
cytotoxicity. Although, methylation of the third position of an adenine base may also
cause cytotoxicity, it is repaired by BER. The addition of PARP inhibitors reduce the
function of BER and mismatch repair so that cells will die. Lomeguatrib is a drug that
diminishes MGMT function in a mechanism similar to O6-BG, but only in some cancers
(Villano et al., 2009).
The relationship between TMZ and MGMT is complex and widely studied (Hegi
et al., 2005, Tubbs et al., 2007, Villano et al., 2009, Shah et al., 2011, Goellner et al.,
2011). MGMT expression is the most commonly used prognostic marker to determine
how a patient will respond to chemotherapy (Hegi et al., 2005). Methylation of the
MGMT promoter results in gene silencing that would cause a patient to exhibit TMZ
sensitivity. Methylation of MGMT occurs on the CpG (cysteine, phosphate, guanine)
islands on its promoter region. Methylation attracts proteins called methyl CpG binding
17
proteins, that block transcription factors from accessing the MGMT gene and, therefore,
impedes gene expression (Tubbs et al., 2007). Given this information, it would be
reasonable to predict that patients who do not express MGMT would respond well to
TMZ therapy and exhibit higher survival compared to patients with MGMT expression
(Kreth et al., 2011, Mellai et al., 2011). Indeed, studies show that GBM patient samples
that do not contain methylation at the MGMT site and, thus, express the protein continue
to proliferate under the administration of the alkylating agent TMZ, exhibiting resistance
to the therapy (Shah et al., 2011, Hegi et al., 2005). Additionally, over time, patients that
were once sensitive to TMZ can develop resistance to the treatment (TCGA, 2008). There
are currently no treatments available to patients that have developed resistance to TMZ.
Resistance to TMZ treatment may come about due to errors in mismatch repair proteins,
expression of other repair enzymes, and failure to induce cell death (Goellner et al.,
2011). Currently, drugs are being developed that can work in conjunction with TMZ to
prevent base excision repair mechanisms (Goellner et al., 2011).
In addition to TMZ drug administration, radiotherapy is especially useful for the
treatment of cancerous cells that have impaired DNA repair mechanisms. Upon radiation
treatment, DNA strands become damaged, eliciting a damage response from affected
cells. Proteins activate signaling pathways that induce DNA repair mechanisms. During
this time of maintenance, the cell cycle is halted to prevent DNA damage from
propagating onto dividing cells. When the DNA is damaged beyond the point of repair,
the cell undergoes apoptosis. In cancerous cells, the repair cycle is often hindered and
tumors experience decreased sensitivity to radiotherapy and continue to proliferate
18
despite DNA damage. A cell’s ability to process and respond to DNA damage is
predictive of its response to varying degrees of radiation therapy.
Double strand DNA breaks and single strand DNA breaks are the most lethal
effects of radiation. As the names suggest, single and double strand breaks occur when
one or both of the chains in the double helix are severed. In the case of single strand
breaks, the severing process may cause further mutations due to end joining of the
severed strands and recombination events. Base excision repair is utilized to remedy
single strand breaks. In this process, DNA damage by oxidation or hydrolysis is removed
by an enzyme called DNA glycosylase. Endonuclease then cleaves the phosphodiester
bond and the DNA breaks are joined together through the action of DNA polymerase and
ligase. The goal of radiotherapy in the treatment of cancer is to induce DNA damage that
would lead to cell death within a target region in the body. In order to bypass the above
described repair mechanisms, inhibitors of repair proteins have been developed in order
to ensure cell death rather than DNA repair. (Begg et al., 2011)
By administering radiation, the atoms of DNA are ionized, or excited. Radical
formation damages the DNA double strand when it interacts with oxygen. Some patients,
unfortunately, do not respond to ionizing radiotherapy. This is due to the phenomenon of
hypoxia (Brown and Wilson, 2004). Regions of tumors cells that contain very low levels
of oxygen concentration are hypoxic. Because radiation therapy takes advantage of
oxygen as a means of breaking the double stranded DNA, hypoxic tumors are therefore
unaffected by radiation treatment. In addition to conferring radiation resistance, hypoxic
cells are found to resist chemotherapy drugs. This resistance is caused due to hypoxic
cells being located far away from tumor blood circulation, limiting access to drugs and
19
are, therefore, more resistant to treatment. Due to the localization of hypoxic cells and
resulting treatment resistance, hypoxic tumors are more likely to metastasize and produce
a poorer prognosis among patients (Brat and Meir 2004, Brown and Wilson 2004).
Another pathway that causes radiation resistance in cancerous cells is the Notch
pathway (Wang et al., 2010). This Notch pathway is highly conserved among different
organisms and it is important for cell to cell signaling as well as the promotion of stem
cell self-renewal, proliferation, and differentiation (Wang et al., 2010). Inhibition of this
pathway would, therefore, diminish the ability for stem cells to self-renew. When the
Notch pathway is erroneously, constitutively turned on, oncogenic events begin to occur
such as the proliferation of neoplastic cells. Signaling begins when a protein called
Delta/Serrate/Lag-2 (DSL) on a cell binds to the extracellular component of the Notch
receptor on an adjacent cell. This receptor-ligand complex activates a signal cascade that
results in the cleavage of Notch, causing the Notch intracellular domain to localize to the
nucleus where it binds to a DNA binding protein called CBF1, Suppressor of Hairless,
Lag-1 (CSL) to drive transcription of Notch target genes (Sethi and Kang, 2011),
producing oncogenic activities (Ellisen et al., 1991). Studies have shown that inhibition
of the Notch pathway increases GBM cell sensitivity to radiation (Wang et al., 2010).
The Notch pathway is also activated in proneural GBMs, explaining why this subtype
does not respond well to aggressive treatment (Phillips et al., 2006). Hypoxia and
activation of the notch pathway indicate how patients will respond to treatment.
Many chemotherapeutic drugs are inhibitors to specific intermediates in signaling
pathways. Notch and PI3K are just two examples that showcase the multifaceted and
complex nature of GBM and the ways in which it can circumvent cancer treatment.
20
Although TMZ and radiation therapy are the standard in the treatment of GBM, other
treatments are being developed to increase the efficacy of directed cancer cell death. As
described earlier, GBM is a tumor whose cellular makeup is diverse and, as a result, is
difficult to target using chemotherapy and radiation. Tumorigenesis and resistance to
cancer treatment is not due to errors in just one pathway; many pathways and genetic
mutations contribute to the spread of this cancer. Unfortunately, most drugs available for
the treatment of GBM target very few genes and proteins that do not possibly cover the
wide spectrum of genetic error caused by GBM. As a result, combinational drug therapy
is being implemented to target multiple pathways in order to eradicate as much of the
cancer as possible (Laks et al., 2010).
Experimental Purpose
Given that the patient response to treatment tends to be varied and knowing that
GBM has been classified into four distinct subtypes, we were interested in understanding
the mechanisms by which GBM neurosphere cell cultures acquire therapeutic resistance.
We tested our panel of GBM patient derived neurosphere cultures with radiation and
Temozolomide and predicted that the neurosphere cultures would fall into two groups;
high response (treatment sensitivity) or low response (treatment resistance) groups.
Though much clinical work has been done on patient response to radiotherapy and TMZ,
it is unknown whether the in vitro culturing of patient derived GBM neurosphere cultures
mirrors the in vivo responses of tumors to these same treatments. Because our research is
concerned with in vitro cell studies, it is important to be sure that our GBM patientderived cell lines appropriately mimic in vivo GBM cell growth and conditions. Dose
response curves were established for each culture and response groups were determined.
21
Because GBM is an incredibly aggressive cancer that offers a very bleak prognosis to
those diagnosed, downstream application of this study is to determine whether these
response groups adhere to TCGA subtype classifications.
In addition to defining the different treatment response groups, we also predicted
that MGMT gene expression would be related to TMZ drug response. Cultures that
exhibit high resistance to TMZ should express low levels of MGMT, while cultures with
high sensitivity to TMZ should express low levels of MGMT. MGMT gene expression
was quantified and correlated to culture response to TMZ. We found that MGMT gene
expression does seem to cluster according to the TMZ response groups: high, medium,
and low responders.
With this study, we hope to advance the growing field of GBM research. The
results of this study will help to better understand stratification of patient response to
treatment for clinical prognosis. This data will later be used when we subgroup our
neurosphere cultures into the TCGA GBM subtypes.
22
Materials and Methods
Neurosphere Cultures
Primary GBM patient tumors were obtained with patient consent according to the
UCLA Institutional Review Board protocols. Patient GBM tumors were obtained from
the neurosurgery department of the Ronald Reagan UCLA Medical Center just hours
after surgery. Samples were put on ice and immediately washed using 1X PBS and
dissociated using sterile scalpels and treatment with a stable trypsin replacement called
TrypLE Express (Invitrogen). Extraneous cellular debris and erythrocytes were removed
using the Percoll purification protocol, which is performed by another lab member. The
tumor sample was placed onto a petri dish and cut into small pieces with a razor blade.
The sample was moved into a falcon tube where it was washed with a few milliliters of
Dulbecco’s Modified Eagle’s medium (DMEM-F12). Two and a half mLs of TryplE was
added and the sample was subjected to pipetting up and down at room temperature for 15
minutes. After dissociation, sample was moved to a new tube and 2mLs of fresh media
were added to the sample. Using a 1ml pipette, 1 mL of the supernatant was transferred to
another tube. Two mLs of fresh media were added to this tube and the sample was
subjected to pipetting up and down using a 3 mL Pasteur pipette. Then, the sample was
passed through a filter to remove cell debris. The sample was then centrifuged for 5
minutes at 1000 rpm and resuspended in 2 mLs of media. One mL of the sample media
was removed. To remove red blood cells and other cell debris. Percoll solution (GE
Healthcare) was added, drop-wise, to the sample. The Percoll sample mixture was then
centrifuged at 3,500 rcf (3g) for 5 minutes. The red blood cells and cell debris were
pelleted at the bottom of the tube and the supernatant was transferred to a new tube. Five
23
hundred uLs of 4X buffer (comprised of 0.2 M Hepes, 0. 8 M NaCl and 1 M glycerol),
which changes the osmolarity of the solution, was added for every 1 mL of sample mix.
This mixture was centrifuged and the supernatant was aspirated, leaving the cell pellet
intact. The pellet was slowly brought up to volume with neurosphere medium: DMEMF12 cell media plus B27 supplement (Gibco), 50 ng/ml EGF (Pepeotech), 20 ng/ml bFGF
(R&D Systems), 5 ug/ml heparin (Sigma-Aldrich), and penicillin/streptomycin
(Invitrogen). bFGF and EGF are growth factors that promote cell proliferation, survival,
and maintenance of stem-like properties. This conditioned media selected for cells that
expressed the neurosphere phenotype. bFGF, EGF, and heparin were added to all cell
cultures every five days. Cells cultures were passaged into fresh conditioned neurosphere
media every two weeks by enzymatic dissociation with TryplE. After a few passages,
cells were observed to be healthy and proliferated in suspension. Our cells were grown as
unattached neurospheres.
RNA Isolation
RNA isolation was conducted using a standard Trizol (Invitrogen) reagent
protocol. Cell cultures were first centrifuged for 5 minutes at 3000 RPM. Media was
aspirated from tubes, leaving cell pellet intact. One mL of Trizol reagent was added to
each tube and cells were broken up by vortex and vigorous pipetting. Cells were then
incubated at room temperature for 15-30 minutes. Two hundred uLs of chloroform were
added to each tube and cells were shaken vigorously for 15 seconds and incubated at
room temperature for 2-3 minutes. Lysate was centrifuged at 12000 RPM for 15 minutes.
After centrifugation, the top, aqueous phase was transferred to an RNase free tube. Five
hundred uLs of isopropyl alcohol was added to the cells and samples were incubated at -
24
80°C for at least 30 minutes (cells can remain in freezer for a few weeks). Cells were
centrifuged at maximum speed for 15 minutes and supernatant was removed, leaving the
pellet intact. The pellet was washed with 1 mL of 75% ethanol and centrifuged at
maximum speed for 5 minutes. The solution was aspirated and the RNA pellet was air
dried. 10 uL of RNase free water was added to the pellet and incubated for 10 minutes at
55-60 degrees Celsius. RNA was kept on ice or stored at -80 degrees Celsius.
Reverse Transcription and Quantitative PCR
Two ug of total RNA was converted to cDNA by reverse transcriptase. Two ug of
total RNA sample was diluted to a volume of 8 uL with RNase free water. One uL of
10X Sigma reaction buffer and 1 uL of Sigma DNase was added, mixed, and incubated
for 15 minutes at room temperature. One uL of Sigma stop solution was added and mixed
well. Samples were heated to 70 degrees Celsius for 10 minutes to inactivate DNase, and
then chilled on ice for 5 minutes. A reverse transcription mixture was created, which
included the following reagents: Four uL of ImProm 5X buffer, 2.4 uL of 25 mM MgCl2,
1 uL of 10 mM dNTP mix, 0.5 uL of 40 units/uL of RNase out, 1 uL of 500 ng/uL of
primers, and 1 uL of ImProm reverse transcriptase enzyme. 9.9 uL of this reaction
mixture was added to the RNA mixture, to equal a final volume of 20.9 uL for each
sample tube. To control for genomic DNA contamination a negative control sample was
performed using one of the culture samples without adding the RT enzyme. Solution was
mixed in tubes gently and PCR reactions were performed as follows: 25°C for 5 minutes,
40 degrees Celsius for 60 minutes, 70°C for 15 minutes, and 4°C until samples were
moved to -20°C.
25
Gene expression levels were quantified by qPCR using the PlusOnePlus system
with SYBR Green method (Applied Biosystems). A qPCR reaction mixture was made
with 1 uL of reverse and forward primers, 10 uLs of SYBR Green reagent, and 7 uLs of
RNAse free water. 18 uLs of this mix was added to the appropriate wells on a ninety six
well PCR plate. 2 uLs of the resulting cDNA from the reverse transcription reaction was
added to the wells. Expression levels of the MGMT gene were normalized to the
housekeeping gene 18S. The following table shows the primer sequences for the MGMT
and 18S genes:
Gene
MGMT
18S
Primer Type
Forward
Reverse
Forward
Reverse
Sequence (5' to 3')
CCTGGCTGAATGCCTATTTC
CAGCTTCCATAACACCTGTGTG
AGTCCCTGCCCTTTGTACACA
GATCCGAGGGCCTCACTAAAC
In Vitro Neurosphere Formation Assay:
Cultures were centrifuged, dissociated with TrypLE Express, and proper plating
density on a ninety six well plate was determined. Cells were plated at twenty, fifty, or
one hundred cells per well, depending on known growth rates. A portion of these cells
were left untreated while others were treated with Temozolomide at increasing serial
dilutions of 25uM, 50uM, or 100uM that were diluted into cell media. The DMSO
concentration for control or drug was maintained at 0.05 -0.025%, so as not to affect cell
growth and sphere formation.
Another portion of our cells were treated with increasing dosages of radiation
(Cesium-137 source) at 1GY, 2GY, 4 GY, or 6G. Neurospheres were supplemented with
FGF, EGF, and heparin once a week and incubated for a total of three to four weeks.
26
Sphere counts were made by eye using an inverted microscope after this period of time.
Cell clumps were counted as spheres if they were at least 40 uM in diameter.
27
Results and Figures
Neurosphere cultures show different treatment response patterns
The formation of neurospheres from single cells is a defining feature of brain
cancer stem cells and is related to tumor progression. Therefore, the ability for single
cells to form spheres indicates resistance to treatment (Laks et al., 2009). In this study,
dose dependent response experiments were conducted on the neurosphere cultures within
each response group. Neurosphere cultures were centrifuged and the pellets were broken
down into single cells with a stable trypsin replacement called TrypLE Express. The
single cells were counted and plated onto ninety six well plates at clonal density. For
TMZ treatment, cells were dosed with 25uM, 50uM, or 100uM concentrations of TMZ.
For radiation treatment, cells were treated with 1GY, 2GY, 4GY, or 6GY doses of
radiation. These cells were allowed to grow for three to five weeks and resulting spheres
were counted by eye using an inverted microscope. The number of neurospheres present
in the treated conditions was compared to the untreated controls in order to determine
survival. Figure 2 shows graphs that plot percent neurosphere formation for each
concentration of TMZ or radiation. Each line on the graph represents a neurosphere
culture that fell under low, medium, or high responders. Response groups were
determined based on the number of spheres formed after drug treatment. TMZ high
responders were comprised of cultures that exhibited less than forty percent sphere
formation at 25uM TMZ treatment. TMZ medium responders exhibited more than forty
but less than seventy percent sphere formation at 25uM TMZ. TMZ low responders
exhibited more than seventy percent sphere formation at 25uM TMZ. Radiation high
responders exhibited less than forty percent sphere formation at 1GY dose of radiation.
28
Radiation medium responders exhibited more than forty but less than sixty percent sphere
formation at 1GY dose of radiation. Finally, radiation low responders exhibited more
than sixty percent sphere formation at 1GY dose of radiation.
We found that the neurosphere cultures responded differently to TMZ than to
radiation treatment (Figure 1a and 1c). A general downward trend in sphere formation, as
the concentration of TMZ or radiation is increasing, for most of the cultures are observed
(Figure 1a and 1b). The summary graphs show three different response groups that
respond to treatment uniquely (Figure1b and Figure 1d). Percent sphere formation
between neurosphere cultures within the same group did not differ greatly from each
other. There was no overlap in percent sphere formation between the different response
groups, showing that the different groups responded differently from each other, as
predicted. A single factor Anova test was performed and p values were well below 0.05
suggesting that cultures within the same response groups had percent sphere formation
values that were similar. Figure 1e shows that TMZ response and radiation response
occur independently of each other. Each neurosphere culture did not respond to the two
treatment types similarly. We had originally predicted that cultures that exhibited high
response to treatment would do so for both TMZ and radiation. We can see that the
majority of the neurosphere cultures do not cluster in groups that are response specific
between both treatments. For example, one line that showed less than one percent
survival in the presence of 25uM TMZ showed forty two percent survival when treated
with a 1GY dose of radiation.
With regard to TMZ response, sphere size varied under treated conditions
between the different response groups. High responders exhibited very little to no sphere
29
formation in the presence of TMZ (Figure 2a-d), medium responders exhibited spheres
with diameters that were smaller in the treated conditions when compared to the
untreated control (Figure 2e-h), and low responders showed no difference in sphere
formation or diameter between the treated and untreated conditions (Figure 2i-l). Since
low responders display resistance to treatment, resulting spheres, as shown in Figure 2i-l
should not have different sphere diameters. It is also important to report that different
cultures have different sphere formation capabilities regardless of response groups. Some
cultures can from spheres that are large, such as neurosphere culture 316 (Figure 2e),
while other cultures such as 217 and 312 form spheres that are not as large (Figure 2a and
2i).
Expression of MGMT reflects neurosphere culture response groups
We predicted that neurosphere cultures exhibiting TMZ sensitivity should have
the lowest expression of MGMT. Conversely, we also predicted that cultures exhibiting
TMZ resistance (meaning that cells survive) should have high expression of the MGMT
gene. Quantitative polymerase chain reaction using SYBR Green reagent was used to
measure MGMT expression in the GBM neurosphere cultures. Figure 3a shows relative
MGMT expression for all of the tested neurosphere cultures. The mean percent sphere
formation at 25 uM TMZ and mean percent MGMT expression for cultures falling under
one of the three response groups is presented in Figure 3b. A clear difference between the
different response groups is present. The low response groups shows nine-fold and sixtyfive-fold increases in MGMT expression compared to the medium and low response
groups, respectively (Figure 3b). In addition to having different percent sphere formation
values, all three of the response groups also showed MGMT mRNA expression levels
30
that differed from each other and did not overlap. A single factor Anova test was
performed to compare the three response groups’ levels of MGMT expression. The p
value from this test was 0.0015, which indicates a significant difference in the expression
levels of MGMT between the three response groups. Despite this, there are a few
examples in which TMZ response does not show a clear relationship to MGMT
expression. Figure 3c shows relative MGMT expression for seven neurosphere cultures
and percent survival of the same seven cultures at 25uM TMZ. As expected, cultures 157
and 218, showed little no sphere formation in the presence of 25uM TMZ treatment and
low expression of MGMT, whereas cultures 177 and 347 show resistance (high survival)
to 25uM TMZ and high expression of the MGMT gene (Figure 3c). A few cases where
resistance and high survival in the presence of TMZ did not correspond to high levels of
MGMT gene expression were observed (neurosphere cultures 254, 312, and 316 (Figure
3c)). Results suggest that another mechanism, other than MGMT methylation, confers
TMZ resistance in these cultures.
31
%sphere formation
TMZ Response is Varied by High, Medium,
and Low Responders
120
100
80
60
40
20
0
Low Responder, n=9
Medium Responder n=4
High Responder, n=14
0
25uM
50uM 100uM
[TMZ]
Figure 1a
%sphere formation
120
Response to TMZ for each Response Group
100
80
Low Responder, n=9
60
Medium Responder
n=4
High Responder, n=14
40
20
0
0
25uM
50uM
[TMZ]
Figure 1b
32
100uM
Radiation Response is Varied by High,
Medium, and Low Responders
%sphere formation
120
100
80
Low Responder, n=11
60
Medium Responder
n=12
40
High Responder, n=5
20
0
O
1GY
2GY
4GY
6GY
Radiation (GY)
Figure 1c
120
Response to Radiation for each Response
Group
%sphere formation
100
80
Low Responder, n=11
60
Medium Responder
n=12
High Responder, n=5
40
20
0
O
1GY
2GY
4GY
Radiation (GY)
Figure 1d
33
6GY
TMZ and Radiation response are not
the same within cultures
Radiation (1GY)
100
80
60
40
NS
20
R² = 0.1716
0
0
20
40
60
80
100
TMZ (25uM)
Figure 1e
Figure 1. Dose dependent percent sphere formation curves among neurosphere
cultures. (a) Temozolomide was added to twenty seven neurosphere cultures
immediately following single cell plating on a 96 well plate. Each line represents a
neurosphere culture and each color represents a different response group. The y axis
shows percent sphere formation, while the x axis shows treatment concentration. (b)
Twenty eight cultures were dosed with radiation (Cesium-137 source) immediately
following plating on a 96 well plate. The y axis shows percent sphere formation, while
the x axis treatment concentration. (c and d) Summary of therapeutic response between
response groups reveals, as expected, little variation within groups. Each line in these
graphs represents the percent sphere formation for each response group, which was found
by calculating the average percent sphere formation of the cultures within a group. Each
color (blue, red, green) represents one of three response groups. Error bars were
calculated using mean ± standard error, which compared the percent sphere formation
numbers of the cultures within the three groups (p value < 0.005). (e) Percent sphere
formation for both radiation (y axis) and TMZ (x axis) were plotted for each neurosphere
culture. No relationship was detected between the two treatments.
34
Untreated
25uM TMZ
50uM TMZ
100uM TMZ
High
Resp.
217NS
Med.
Resp.
316NS
Low
Resp.
312NS
Figure 2. Sphere diameter in the high, medium, and low response groups as seen in
ninety six well plates after four to five weeks of growth. (a-d) High response
neurosphere culture 217 shows no sphere formation in treated conditions. (e-h) Medium
response neurosphere culture 316 shows diminished sphere diameter in treated
conditions. (i-j) Low response group 312 shows no difference in sphere formation or
sphere diameter in treated and untreated conditions.
35
1
0.9
0.8
0.7
0.6
0.5
0.4
0.3
0.2
0.1
0
146
157
177
211
213
217
218
227
233
244
248
254
277
282
296
301
305
309
312
316
336
347
SG233
SG268
Relative Expression of MGMT
MGMT mRNA Expression Levels
GBM Neurosphere Cultures
%sphere formation or rel. MGMT
expr
Figure 3a
100
90
80
70
60
50
40
30
20
10
0
MGMT Expression Differs Between
Response Groups
%sphere formation
%MGMT expression
Low
Medium
Response Groups
Figure 3b
36
High
Relative MGMT Expression
% Relative MGMT Expression
100
90
80
70
60
50
40
30
20
10
0
157
177
218
312
316
GBM Neurosphere Cultures
254
347
% Sphere formation at 25uM TMZ
100
80
70
60
50
40
30
20
10
0
347
254
316
312
218
GBM Neurosphere Cultures
Figure 3c
37
177
157
%Sphere Formation
90
Figure 3. 25 uM TMZ response and MGMT expression varies between three
response groups. (a) qPCR relative expression values for all of the tested neurosphere
cultures. Relative MGMT expression as compared to the housekeeping gene 18S is
plotted on the y axis and neurosphere cultures numbers are plotted on the x axis. 1
represents the highest level of MGMT expression. (b) Means for %sphere formation and
%relative MGMT expression were calculated for each response group. Error bars were
calculated using standard error. (c) A few neurosphere cultures (157, 177, 218, and 347)
showed a strong relationship between TMZ response (red bar graph) and MGMT gene
expression (blue bar graph). Other cultures, 312, 316, and 254, indicated by , showed
high resistance to TMZ but low expression of MGMT.
38
Discussion
TCGA neurosphere culture response to treatment:
GBM is one of the most prevalent and aggressive cancers affecting adults.
Despite undergoing complete removal of the tumor, TMZ chemotherapy treatment, and
radiation therapy, patients only live for six months to two years (Rearden et al., 2006).
Unfortunately, there are no known cures or treatment plans that provide individuals with
a significant extension of life. Given the invasive nature of this cancer, previous studies
have been conducted to identify specific pathways and genes that confer resistance to
treatment (Phillips et al., 2006, TCGA 2008, and Verhaak et al., 2010). One seminal
study conducted in 2010 by The Cancer Genome Atlas (TCGA), identifies four
categories of GBM determined based on genomic profiling via microarray experiments
based on a classification scheme that identified several genes widely expressed in the
subtypes (Verhaak et al., 2010). According to this study, the proneural, neural, classical,
and mesenchymal subtype classifications of GBM contain unique genetic characteristics
and different clinical patient outcomes. The mesenchymal subtype is considered to be the
most aggressive, resulting in the lowest survival time with treatment, while the proneural
subtype exhibits longer survival times (Phillips et al., 2006, Cooper et al., 2010). The
2010 TCGA study is a starting point to begin the in depth classification of GBM tumors.
Though previous research provided information concerning the categorization of
GBM into different subgroups based on genetic characteristics, long term in vitro
analysis experiments remain to be performed to determine whether or not classification of
cultures matches corresponding patient tumors. My study is the first of its kind to
examine a large number of primary GBM neurosphere cultures’ response to TMZ and
39
ionizing radiation treatment based on TCGA classifications. We hypothesized that GBM
neurosphere cultures would respond to treatment as high responders (sensitivity to
treatment) or low responders (resistance to treatment). We plated single cells from
neurosphere cultures at clonal density and dosed them with increasing concentrations of
TMZ or radiation. Experiments were replicated at least three times. The number of
spheres were counted in treated conditions and compared to untreated conditions to
obtain percent sphere formation. Percent sphere formation in treated conditions for
neurosphere cultures within a response group were similar to each other. As predicted,
neurosphere cultures responded to radiation or TMZ treatment based on their respective
response groups.
It is not surprising to find that when culturing any kind of tissue sample,
especially those of cancerous origins, culture conditions may or may not select for certain
phenotypes. Are these cultures really indicative of the cells in the tumor mass in vivo?
Cancerous cells, which already exhibit abnormal genetic character, could continue to
acquire more mutations during the culture’s lifetime that were not seen in the patient
tumor. To account for this possibility we are working in collaboration with the Steve
Horvath research laboratory to confirm that our neurosphere cultures and their parent
tumors have similar genetic characteristics.
Our neurosphere cultures experienced a downward trend in sphere formation as
the concentrations of TMZ or radiation increased (Figure 2b, 2d). Separation into high,
medium, and low response groups is statistically significant for both types of treatment.
Percent sphere formation under treated conditions did not overlap between the three
response groups. This indicates that the percent sphere formation between neurosphere
40
cultures within the same group did not differ greatly from each other, validating our
results.
This study provides data that will later be used when we classify our cultures into
the TCGA GBM classified subgroups. We believe that the response groups will be
indicative of what TCGA subgroups our neurosphere cultures will be classified into. The
proneural subgroup, though presenting longer survival times for patients, exhibits
resistance to treatment while the mesenchymal and classical subgroups show sensitivity
to treatment with shorter survival times (Phillips et al., 2006 and Verhaak et al., 2010).
Since our results indicate high response groups and low response groups it would be
reasonable to predict that high and low response neurosphere cultures would fall under
the mesenchymal and classical or proneural classifications, respectively. For example, the
proneural subclass has overexpression of the PDGFRA gene. PDGFRA is involved in
cell differentiation and proliferation (Brennan et al., 2009, Cantley et al., 2002). Other
studies have found that PDFR causes CSC self-renewal which could, in turn, cause
resistance to treatment and tumorigenesis (Lokker et al., 2002 and Kim et al., 2012). It
would be interesting to determine whether or not our high response groups overexpress
PDGFRA because that would indicate not only that they are proneural subgroup
candidates, but that PDGFRA expression may confer resistance to treatment.
More recent studies have identified different proteins and pathways that are
TCGA subtype specific and confer resistance to treatment (Duarte et al., 2012 and Kaur
et al., 2012). One such study identified the interferon (IFN)/STAT1 pathway as being a
potential cause of chemotherapy and radiation resistance in GBM (Duarte et al., 2012).
This study showed that IFN/STAT1 upregulation resulted in a poorer clinical prognosis
41
of GBM. Interestingly, IFN/STAT1 is normally responsible for anti-tumor and antipathogen activity in cells. However, IFN/STAT1 has also been found to be involved in
therapeutic resistance in other kinds of cancer such as breast and squamous cell cancer
(Khodarev et al., 2010). Since IFN/STAT1 was shown to cause treatment resistance it
might be a potential gene mutation occurring in proneural classified GBM tumors
(Verhaak et al., 2010).
Another studied identified Cadherin-11 as a potential therapeutic target in the
treatment of mesenchymal classified GBM (Kaur et al., 2012). Cadherins are proteins
that regulate cell to cell attachment in a calcium dependent manner, mediating cell
adhesion and migration (Angst et al, 2001 and Li et al., 2011). Cadherin interactions
regulate intracellular cytoskeletal attachment via actin filaments and selective adhesion
allows for the assembly of organized tissue structures, especially during development.
Cadherin-11 is expressed in mesenchymal stem cells and in breast and prostate cancer
(Farina et al., 2009). Over expression of cadherin-11 has been associated with a poorer
prognosis in these cancers. The knockdown of cadherin expression in mesenchymal
classified GBM cell lines both in vivo and in vitro resulted in decreased tumor size and
diminished cell survival (Kaur et al., 2012). Thus, cadherin-11 could be another gene
that, when expressed, causes treatment resistance in our neurosphere cultures.
Many of the genes identified in TCGA subgroup classification study affect
tumorigenesis and cancer cell proliferation (Cantley et al., 2002, Lee et al., 2002, Phillips
et al., 2006, Brennan et al., 2009, Yan et al., 2009, and Miller and Miller, 2012). CSCs
are able to bypass the effects of cancer treatment, continuing to proliferate, differentiate,
and propagate the tumor population. This being the case, it would be interesting to
42
determine whether or not CSCs express the same genes as their parent tumors. Further, it
would be worthwhile to determine whether the TCGA classifications can be applied to
the CSCs, since they represent a unique population separate from the proliferating tumor
cells.
Our study is testing treatment response in a subpopulation of GBM neurosphere
cancer stem cells (CSCs). In addition to causing tumor progression (Reynolds et al, 1992,
Singh et al., 2004, Nakano and Kornblum, 2006, Laks et al., 2009, and Laks et al., 2010),
CSCs have also been attributed with causing chemotherapy and radiation resistance in
tumors (Reya et al., 2001, Bao et al., 2006, and Beier et al., 2011). Resistance is believed
to be due to chemotherapy drugs targeting the differentiated cancer cell population rather
than the CSCs. CSCs are able to display radiation resistance by causing cell cycle arrest
and activating DNA damage checkpoints (Bao et al., 2006). Thus, CSCs repaired the
DNA damage caused by radiation rather than activation apoptosis or cell death.
Specifically CD133-positive cells, a stem cell marker, rather than CD133- negative cells,
representing a differentiated cell population, survived after irradiation (Singh et al., 2001
and Bao et al., 2006). Radiation resistance of CD133-positive cells was confirmed in both
in vitro cell cultures experiments and in vivo mouse brain tumors. Due to treatment
resistance of CSCs, the use of drugs that inhibit DNA damage checkpoints could be
effective in the treatment of GBM (Bao et al., 2006).
Different treatment responses might also make TCGA subgroup classifications
difficult to achieve. Figure 2e suggests that there is no relationship between TMZ
response and radiation response for our cultures. In other words, the majority of our
neurosphere cultures responded to the two treatments in dissimilar ways. Radiation and
43
TMZ target different pathways and proteins, explaining the dissimilar responses to the
two treatment types.
The difference between TMZ and radiation response of our neurospheres brings
into question whether or not classifying our cultures into one of the four subgroups based
on response to treatment is practical. Based on preliminary TCGA subgroup
classifications of our neurosphere cultures, we found that treatment response was not
subgroup specific. As perviously mentioned, the proneural subgroup exhibits high
resistance to treatment while the mesenchymal subgroup is resistant to treatment
(Verhaak et al., 2010). We have examined ten proneural classified subgroups, of which
only two cultures showed high resistance to treatment, contrary to our expectations. We
have identified only two neurosphere mesenchymal subgroup cultures, both show high
resistance to TMZ treatment. Similar observations were made for radiation response,
suggesting that subgroup classifications did not reflect response to treatment in our work.
However, our TCGA classifications results were based on preliminary microarray
analysis that still needs troubleshooting. We are currently working to reclassify our
neurosphere cultures.
MGMT Analysis:
MGMT expression is the most commonly used prognostic marker to predict how
a GBM patient will respond to TMZ (Hegi et al., 2005, Tubbs et al., 2007, Villano et al.,
2009, Kreth et al., 2011, Mellai et al., 2011, Shah et al., 2011, and Goellner et al., 2011).
MGMT is a repair enzyme that removes aberrant alkylation on DNA strands. TMZ is a
chemotherapeutic drug that adds alkyl groups to DNA in order to cause DNA alkylation
leading to cellular apoptosis of cancerous cells. Thus, patients who have MGMT
44
expression, producing a functional MGMT, protein will not respond to TMZ treatment.
Conversely, patients that have methylated, and, therefore, silenced MGMT gene, will not
express the repair enzyme allowing for TMZ sensitivity, and apoptosis of cancer cells.
(Hegi et al., 2005)
When MGMT does not repair alkyl damage on the DNA, the alkylation of the
sixth oxygen position on the guanine nucleotide causes the nucleotide to base pair with
thymine (Kaina et al., 2007). This mismatch is recognized by proteins that bring about
the mismatch repair cycle by binding and creating a complex with DNA. However,
mismatch repair is faulty in GBM and leads to lesions on the DNA strands that cause
double strand breaks, leading to activation of apoptosis mechanisms and cell death. The
C terminal domain of the MGMT protein contains an ATase motif that binds the target
DNA. The ATase motif is the active site of the enzyme, containing a tyrosine residue that
causes the protein, through a balanced chemical interaction, to move alkylation onto the
guanine nucleotide on the target DNA. Alkylation of the sixth oxygen position is
transferred to a cysteine residue on the active site within the ATase domain of the
MGMT protein (Tubbs et al., 2007).
Two studies found that hypermethylation of the MGMT gene predicts survival
better than methylation of MGMT (van den Bent et al., 2011, Cahill et al., 2007).
Genome-wide methylation profiling was conducted to determine MGMT gene silencing
in a number of anaplastic oligodendroglial brain tumors. Oligodendroglial tumors arise
from oligodendrocytes in the brain and are histologically similar to GBM (Louis et al.,
2007). Results showed that patients having a hypermethylated MGMT gene promoter had
a better prognosis and responded to radiation treatment better than patients’ with a
45
methylated promoter. Thus, hypermethylation of the MGMT promoter provides a more
favorable clinical outcome.
Methylation of DNA occurs normally in healthy cells, on cytosine residues that
are adjacent to guanine nucleotides (CpGs). CpG regions are strategically placed in
regions of DNA that are responsible for regulation of various genes. Methylation
provides transcriptional regulation, controlling for the expression of certain genes at the
correct time. Given its regulatory role, it is no surprise that methylation activity is often
altered in cancer cells. Many cancers display hypermethylation, resulting in
transcriptional silencing of genes that, for example, affect cell cycle regulation,
angiogenesis, and apoptosis (Esteller 2008). Hypermethylation of repair enzymes would
impede normal repair mechanisms and while also causing the proliferation of abnormal
cancer cells. Ironically, patients that have hypermethylation of the MGMT gene are not
expressing this important repair enzyme, yet their prognosis is more favorable than those
who have MGMT expression. Specifically, MGMT gene silencing actually causes the
patient to respond to TMZ with heightened sensitivity (Cahill et al., 2007, Hegi et al.,
2005, Kreth et al., 2011, van den Bent et al., 2011). Another study showed that measuring
mRNA expression levels of MGMT in GBM was a good predictor of outcome without
considering methylation status (Kreth et al., 2011). That hypermethylation of DNA more
stringently prevents transcription of genes than methylation, which explains why it offers
a better clinical outcome for GBM patients.
In this present study, quantitative polymerase chain reaction of our primary GBM
neurosphere cultures was performed. We predicted that resistance to TMZ would
correlate with high expression of MGMT and that sensitivity to TMZ would correlate
46
with low MGMT expression. Figure 3b shows that most high responders to TMZ had low
MGMT mRNA while most low responders to TMZ had very little expression. However,
a few neurosphere cultures that exhibited resistance to TMZ showed low expression of
MGMT. This seems to suggest that, although MGMT is not being expressed, there might
be another mechanism in place that is conferring resistance to TMZ treatment.
MSH6 gene has also been identified as a possible agent able to confer resistance
to TMZ in GBM (Cahill et al., 2007). MSH6 encodes a mismatch repair protein that
recognizes mismatches on a DNA strand and forms a complex on the DNA to begin the
repair process. MSH6 was originally studied in connection to colorectal cancer;
mutations that silenced the MSH6 gene caused a susceptibility to colorectal cancer
(Miyaki et al., 1997). It was then determined that mutations causing lack of expression of
this MSH6 were found in TMZ resistant primary patient GBM tumors (Cahill et al.,
2007). Furthermore, MSH6 loss was found to be independent of MGMT promoter
methylation status. Thus, MSH6 can be considered a separate predictor of TMZ response
which provides an important example that MGMT is not the only marker of TMZ
response and that other pathways and proteins may be involved in the resistance to TMZ
treatment. The identification of other genes such as MSH6 that cause TMZ resistance
might explain why some of our neurosphere cultures did not show a strong relationship
between TMZ response and expected expression of MGMT.
Future directions:
Currently, our laboratory, in collaboration with the Steve Horvath’s research
laboratory, is developing a system by which to classify our neurosphere cultures into the
four TCGA GBM subgroups. We are interested in determining what other genes and
47
molecular pathways, such as MSH6 and YKL40 (causes radiation resistance as discussed
in introduction) might be conferring resistance to treatment. Once identified, knock
down experiments will be utilized to measure cell response to treatment. A better
understanding of the mechanisms by which certain strains of GBM have higher survival
rates while others offer more dismal prognoses is important in better understanding and,
therefore, treating GBM in a clinical setting.
We have also developed a new technique to record survival of our drug treated
neurosphere cultures. In addition to visually counting spheres, this new method also
measures sphere diameter and fluorescence output. This new technique will eliminate
human error that is inherent in counting neurospheres by eye, providing an automated
system with increased accuracy.
Finally, although MGMT mRNA expression levels have been examined in the
neurosphere cultures in this study, protein expression assays need to be conducted.
Transcription of the MGMT gene into mRNA does not necessarily mean that the protein
will be successfully expressed. Mistakes in translation and post-translation could prevent
the actual MGMT protein from functioning correctly and efficiently.
Conclusion:
Though this study does not examine specific genes, other than MGMT, and
signaling pathways that have been previously identified in TCGA GBM subgroup
classification, it is an important starting point to determine whether or not our GBM
neurosphere cultures group according to response patterns. Previous studies have not
tested GBM cell response to treatment. Instead, tissue samples from GBM patients were
obtained to uncover the genetic anomalies that existed therein. The entire purpose of this
48
project is to acquire a better understanding of the mechanisms by which GBM
neurosphere cultures exhibit resistance to treatment in order to provide insight on how to
treat patients in a clinical setting.
49
CHAPTER 3: GBM CELL OF ORIGIN
Introduction
Though much work has been conducted on the genetic anomalies prevalent and
efficacy of treatment of GBM, the most common and aggressive form of brain cancer in
adults, little is known about the cells of origin of GBM. In fact, the cell of origin for
GBM has not yet been identified. The brain is mostly comprised of a cell population that
does not actively divide. There are a few cell types that are capable of division including
astrocytes, oligodendroglial progenitors, and neural stem cells. Since neural stem cells are
capable of self-renewal and share similar makers with cancer stem cells, the cancer cell
of origin in GBM might be a progenitor of some kind that is capable of tumorigenesis and
differentiation into other cell types. One study showed that transduction of a virus that
expressed an oligodendrocyte progenitor cell (OPC) growth factor into a rat brain caused
tumorigenesis of a mass that was very similar to a GBM tumor (Assanah et al., 2006).
NG2 cells were commonly affected by this virus, leading us to speculate that NG2 cells
of the mouse brain could be a progenitor cell for GBM tumorigenesis (Assanah et al.,
2006). We believe that a GBM progenitor cell that is proliferative in nature and is found
in the human brain might be the much speculated glioma cell. In humans, this cell
expresses the stem cell marker A2B5 and in mice this cell expresses NG2, a proteoglycan
that can be found on neural progenitor cells. NG2 positive cells have been shown to give
rise to neurons in mice (Belachew et al., 2003, Nunes et al., 2003, Rivers et al., 2008, Zhu
et al., 2008). Another similar study showed tumorigensis in mice that were of
oligodendrocyte lineage, and not GBM (Lindberg et al., 2009).
50
In this study, we used a mouse model to determine whether or not our hypothesis
that the NG2 progenitor cell is, in fact, the cell of origin in GBM. Previous studies have
reported that the deletion of Pten induces and maintains stem-like behavior in progenitor
cells (Gregorian et al., 2009) and overexpression of KRAS causes tumorigenesis in
different cancers (Jackson et al., 2001). Given this information, we have implemented a
number of genetic crosses in our mouse colony to delete the tumor suppressor Pten and
over express the oncogene KRAS in order to determine whether tumorigenesis will
occur. Pten is a crucial intermediate in the PI3K/AKT pathway responsible for
proliferation and renewal of cells, especially those that are stem-like (Maehama and
Dixon, 1998 and Kao et al., 2007). Additionally, Pten deletion was performed in this
study because this kind of mutation is very common in glioma and neural stem cells.
KRAS, which is a well-known oncogene, would increase the chances the occurrence of
tumor growth in the mice. More specifically, KRAS is part of the RAS GTPase family of
proteins. GTPases can bind and hydrolyze GTP into GDP driving downstream signal
activation. For example over expression of KRAS causes cell proliferation and survival
(Karnoub and Weinberg, 2008). KRAS is most mutated in lung, pancreatic, and colon
cancer (Uhrbom et al., 2002, Karnoub and Weinberg, 2008, Baines et al., 2011) and we
believe it is a candidate for brain cancer tumorigenesis. The main goal of this project is to
generate a new murine model to study high grade gliomas and to use this model for future
therapeutic research applications.
51
Materials and Methods
Mouse Colony Breeding scheme:
We are using a CRE-LOX breeding system to produce an increase in KRAS
expression as well as knockdown of Pten in NG2 cells in mice. Pten and KRAS
transgenic mice were purchased from Jax Mice (Bar Harbor, Maine). The Pten mice
contain loxP sites that are flanked around on the fifth exon of the Pten gene. These
mutant mice are homozygous for this loxP allele and are crossed to NG2-CRE transgenic
mice, which were obtained as a kind gift from Dr. Jean de Vellis’s research laboratory.
The NG2-CRE mouse contains a CRE recombinase-expressing strain that, when crossed
to the PtenloxP mouse, will cause the specific deletion of the Pten gene in NG2 cells. The
CRE recombinase system expresses the enzyme CRE, causing site specific recombination
of the target gene, flanked by loxP sites. The KRAS mice contain a heterozygous
mutation containing a lox stop lox (LSL) site (homozygotes die in utero), preventing the
expression of the KRAS oncogene. When this KRAS mouse is bred to a NG2-CRE
mouse, the CRE enzyme removes the stop codon, resulting in the overexpression of
KRAS. Since CRE is being expressed in NG2 cell only, Pten deletion and KRAS
overexpression will be NG2 cell-specific. Figure 1 summarizes our mouse colony
breeding scheme.
Genotyping by PCR and gel electrophoresis:
Genotyping is conducted using mouse tail samples and a Genomic DNA Kit
(Invitrogen). DNA was purified from the mouse tail tissue samples and PCR reactions
were set up followed by gel electrophoresis to determine whether KrasLSL/+ or Ptenflox/flox
were expressed in our mice. Primers for KrasLSL/+ and Ptenflox/flox were purchased from
52
Jax Mice. The KRAS primers consisted of wild type forward, common, and mutant
forward primers. The Pten primers consisted of wildtype forward and mutant forward
primers. Table 1 shows the sequences for each primer. A PCR mix consisting of the
following was added to each DNA sample: 3 uL of 10X PCR buffer without MgCl2
(Invitrogen), 3 uL of 25mM MgCl2 (Invitrogen), 2.4 uL of 2.5 mM dNTP (of each
dNTP), 0.12 uL of Taq DNA polymerase, 18.98 uL of RNAse/DNAse free water, 1.5 uL
of primers, and 2 uL of cDNA mixture. Total volume in each tube was 30 uL.
Standard PCR reactions were performed. The reactions were cycled 35 times
under the following conditions: 94°C for 3 min, 69°C for 1 minute, 72°C for 1 minute.
Samples were kept at 4°C for immediate use. DNA samples were electrophoresed on 2%
agaraose gels that included ethidium bromide. Samples were electrophoresed at 140 volts
for an hour. Expected PCR products from the Kras wildtype are 507 base pairs, while
PCR products from the KRAS mutant mice are 600 base pairs. PCR products from the
Pten mutant and wildtype are 328 and 156 base pairs, respectively. PCR products from
the heterozygous Pten mice are 156 and 328 base pairs. The Invitrogen 100 bp DNA
ladder (0.5ug/lane) was used electrophoreses to determine base pair location of target
genes.
53
Results and Discussion
Thus far, from our breeding scheme, we have successfully produced mice
expressing Ptenflox/flox ; KrasLSL/+ and Ptenflox/flox ;NG2CRE/+ and identified their genotype
using tail samples and performing PCR. The last cross to produce the final genotype in
the mice is shown in Figure 2. The Cre enzyme will bind regions of the DNA that contain
LoxP sites resulting in site specific recombination of the LoxP sites. Thus, genes that are
between two LoxP sites will be deleted. Each lane in Figure 3b represents a different
mouse from the breeding colony. Bands seen in Figure 3b indicate the presence of the
KrasLSL/+ gene in the Ptenflox/flox ;KrasLSL/+ cross. Figure 4 shows PCR results testing for
the presence of Ptenflox/flox in our Ptenflox/flox ; KrasLSL/+ mice. The final cross between
mice expressing Ptenflox/flox ; KrasLSL/+ X Ptenflox/flox ;NG2CRE/+ remain to be performed.
Spontaneous tumor formation in the Ptendeletion ;KrasLox/+; NG2CRE/+ mice would
indicate NG2 as possible cell of origin for high grade gliomas. If tumor formation occurs,
we would then section the brains and stain for cell surface markers indicating what kind
of tumor has formed. It is important to consider that tumor formation may not occur.
Lack of tumor formation does not necessarily mean that the NG2 cell type is not the
cancer cell of origin for gliomas; it might indicate that other oncogenic mutations maybe
necessary to cause tumorigenesis. For example, mutations in NF1 and P53, as discussed
previously, might result in tumorigenesis while KRAS overexpression might not. This
study will also develop a new mouse model to study GBM in the research setting. The
importance of this project lies in the fact that uncovering the cell of origin will allow
further research to target specific cells that would allow for more personalized approach
to treating patients afflicted with GBM.
54
Figure 1. Mouse colony breeding scheme. Pten deletion is indicated by “delta 5”.
Gene
KrasLSL/+
Primer Type
Sequence (5' to 3')
Wildtype Forward
GTC GAC AAG CTC ATG CGG G
Common
CGC AGA CTG TAG AGC AGC G
Mutant Forward
CCA TGG CTT GAG TAA GTC TGC
flox/flox
Pten
Forward
CAA GCA CTC TGC GAA CTG AG
Reverse
AAG TTT TTG AAG GCA AGA TGC
Table 1: List of primers used for genotyping mice in breeding colony.
55
Mouse 1: Ptenflox/flox ;NG2CRE/+
Mouse 2: Ptenflox/flox ; KrasLSL/+
Mouse 3 (in NG2 cells only):
Figure 2. Cre-Lox breeding scheme. Mouse 1 and Mouse 2, when mated together,
should produce litters that have Ptendeletion ;KrasLox/+; NG2CRE/+. The Cre enzyme will bind
regions containing LoxP sites, causing deletion of both the stop site located on KRAS
promoter and also the Pten gene, both flanked by LoxP sites. Over expression of KRAS
and deletion of Pten in NG2 mouse cells should be observed in final cross (Mouse 3).
56
Figure 3a. Wildtype KRAS
2072bp
600bp
100bp
Figure 3b. Mutant KRAS
2072bp
600bp
100bp
Figure 3. PCR analysis of KrasLSL/+ positive mice from Ptenflox/flox X KrasLSL/+ cross.
(a) Wildtype Kras gene at 507 base pairs and (b) mutant Kras gene at 600 base pairs. Due
to primer dimerization, the wildtype and mutant primers were separate PCR and gel
electrophoresis reactions were performed.
57
Ptenflox/flox X KrasLSL/+
Ptenflox/flox
.
1
2
3
4
5
6
7
8
9 10 11 12 13
2072bp
600bp
300 bp
100bp
Figure 4. PCR analysis of Ptenflox/flox positive mice from Ptenflox/flox X KrasLSL/+
(lanes 1-7) and in Ptenflox/flox crosses (lanes 8-13). Red boxes indicates homozygous
mutant Ptenflox/flox. Pten wildtype bands can be observed at 156 base pairs, heterozygous
Pten bands can be observed at 156 and 328 base pairs, and Pten mutant bands are
observed at 328 base pairs.
58
CHAPTER 4: CONCLUDING REMARKS
With this work, we have successfully identified groups of our GBM neursophere
cultures that differ from each other based on their response to treatment. This data will be
used in order to determine differential gene expression, revealing genes and pathways
that might be conferring resistance to radiation and TMZ treatment. Additionally,
identifying the cell type of origin for GBM will provide important insight on how to
combat this cancer by developing a more targeted cancer therapy.
GBM is an aggressive and highly proliferative cancer that often results in poor
prognoses and short survival times (Ohgaki and Kleihues 2004). Though much research
has been done and is currently being conducted to elucidate the ways in which GBM
persists despite aggressive treatment, this cancer remains elusive. Treatment resistance of
GBM has been suggested to occur due to the highly heterogeneous cell population of the
tumors, making targeted therapy difficult. Most drugs target one or two pathways in cells.
However, multiple disparate pathways may be causing proliferation and tissue necrosis in
GBM. The emerging field of cancer stem cell biology also provides insight on GBM
tumor growth and persistence. Cancer stem cells are capable of self-renewal,
differentiation, tumorigenesis, and have been suggested to be resistant to chemotherapy
treatment (Singh et al., 2004, Nakano and Kornblum, 2006 and Laks et al., 2009). A
better understanding of the mechanisms by which clinical cases of GBM show higher
survival rates while others offer more dismal prognoses is important. Information on
novel pathways and mutations can lead to more specific clinical treatment of GBM. The
goal of this research is to add to the growing field of GBM knowledge, perhaps leading to
59
more efficient treatment of GBM that could provide a higher standard of living and
increased survival times for patients.
60
BIBLIOGRAPHY
American Cancer Society: Cancer Facts and Figures 2010. Atlanta, GA: American
Cancer Society, 2010.
Angst, B.D., Marcozzi, C. & Magee, A.I. 2001. The cadherin superfamily: diversity in
form and function. J Cell Sci 114: 629–641.
Assanah, M. , Lochhead, R. , Ogden, A. , Bruce, J. , Goldman, J., & Canoll, P. 2006.
Glial progenitors in adult white matter are driven to form malignant gliomas by
platelet-derived growth factor-expressing retroviruses. Journal of Neuroscience,
26(25), 6781-6790.
Baines, A.T., Xu, D., & Der, C.J. 2011. Inhibition of Ras for cancer treatment: the search
Continues. Future Med Chem. 3(14): 1787–1808.
Bao, S., Wu, Q., McLendon, R.E., Yueling, H., Qing, S., Hjelmeland, A.B., Dewhirst,
M.W., Bigner, B.B & Rich, J.N. 2006. Glioma stem cells promote radioresistance
by preferential activation of the DNA damage response. Nature. 444(7120):75660.
Begg, A.C., Stewart, F.A. & Vens, C. 2011. Strategies to improve radiotherapy with
targeted drugs Nat Rev Cancer. (4):239-53.
Belachew, S., Chittajallu, R., Aguirre, A., Yuan, X., Kirby, M., Anderson, S. & Gallo, V.
2003. Postnatal NG2 proteoglycan-expressing progenitor cells are intrinsically
multipotent and generate functional neurons. J Cell Biol 161(1):169-186
Berman, H.M., Westbrook, J., Feng, Z., et al. 2000 The Protein Data Bank Nucleic Acids
Research, 28: 235-242.
Bernd, K., Christmann, M., Naumann, S. & Roos, W. 2007. MGMT: Key node in the
battle against genotoxicity, carcinogenicity and apoptosis induced by alkylating
agents DNA Repair. 6:1079-99.
Brat, D.J. & Van Meir, E.G., 2004. Vaso-occlusive and prothrombotic mechanisms
associated with tumor hypoxia, necrosis, and accelerated growth in glioblastoma.
Laboratory Investigation. 84:397-405.
Brennan, C., Momota, H., Hambardzumyan, D., Ozawa, T., Tandon, A., Predraza, A. &
Holland, E. 2009. Glioblastoma subclasses can be defined by activity among
signal transduction pathways and associated genomic alterations. PLoS
One. 4(11):e7752
61
Broniscer, A., Gururangan, S., MacDonald, T.J., Goldman, S., Packer, R.J., Stewart, C.F.,
Wallace, D., Danks, M.K., Friedman, H.S., Poussaint, T.Y., et al. 2007. Phase I
trial of single-dose temozolomide and continuous administration of o6benzylguanine in children with brain tumors: a pediatric brain tumor consortium
report. Clin Cancer Res 13:6712–6718.
Brown, J.M. & Wilson, W.R., 2004. Exploiting tumour hypoxia in cancer treatment.
Nat Rev Cancer. 4(6):437-47.
Cahill, D.P., Levine, K.K., Betensky, R.A., Codd, P.J., Romany, C.A., Reavie, L.B.,
Batchelor, C.T., Futreal, P.A., Stratton, M.R., Curry, W.T., Iafrate, A.J. & Louis,
D.N. 2007. Loss of the mismatch repair protein msh6 in human glioblastomas is
associated with tumor progression during temozolomide treatment. Clin Cancer
Res. 17(22):7148-55.
Cantley, L.C. 2002. The phosphoinositide 3-kinase pathway. Science. 296(5573):1655-7.
Cerami, E., Demir, E., Schultz, N., Taylor B.S. & Sander, C. 2010. Automated
network analysis identifies core pathways in glioblastoma. PLoS
ONE. 5(2):e8918.
Chen, J., Marechal, V. & Levine, A. 1993. Mapping of the p53 and mdm-2 interaction
domains. Molecular and Cellular Biology, 13(7), 4107-4114.
Donawho, C.K., Luo, Y., Luo, Y., Penning, T.D., Bauch, J.L., Bouska, J.J., BontchevaDiaz, V.D., Cox, B.F., DeWeese, T.L., Dillehay, L.E., et al. 2007. ABT-888, an
orally active poly(ADP-ribose) polymerase inhibitor that potentiates DNAdamaging agents in preclinical tumor models. Clin Cancer Res 13:2728–2737.
Duarte, C.W., Willey, C.D., Zhi,D., et al. 2012. Expression Signature of IFN/STAT1
Signaling Genes Predicts Poor Survival Outcome in Glioblastoma Multiforme in a
Subtype-Specific Manner PLoS One. 7(1): e29653.
Esteller, M. 2008. Epigenetics in cancer. N Engl J Med. 352:1148-59.
Farina, A.K., Bong, Y., Feltes, C.M. & Byers, S.W. 2009. Post-Transcriptional
Regulation of Cadherin-11 Expression by GSK-3 and β-Catenin in Prostate and
Breast Cancer Cells. PLoS ONE. 4(3): e4797.
Galli, R., Binda, E., Orfanelli, U., Cipelletti, B., Gritti, A., De Vitis, S., Fiocco, R.,
Foroni, C., DiMeco, F. & Vescovi, A. 2004. Isolation and characterization of
tumorigenic, stem-like neural precursors from human glioblastoma. Cancer Res.
64(19):7011-21.
62
Goellner, E.M., Grimme, B., Brown, A.R., Lin Y., Wang, X.,Sugrue K.F., Mtichell, L.,
Trivedi, R.N., Tang, J. & Sobol, R.W. 2011. Overcoming temozolomide
resistance in glioblastoma via dual inhibition of nad+ biosynthesis and base
excision repair. Cancer Res. 71(6):2308-17.
Goldman, C.K., Kim, J., Wong, W.L., King, V., Brock, T. & Gillespie, G.Y., 1993.
Epidermal growth factor stimulates vascular endothelial growth factor production
by human malignant glioma cells: a model of glioblastoma multiforme
pathophysiology. Mol Biol Cell. 4(1):121-33.
Gregorian, C., Nakashima, J., Le Belle, J., Ohab, J., Kim, R., Liu, A., Smith, K.B.,
Groszer, M., Garcia, A.D., Sofroniew, M.V., Carmichael, T.S, Kornblum, H.I.,
Liu, X. & Wu, H. 2009. Pten deletion in adult neural stem/progenitor cells
enhances constitutive neurogenesis. J Neurosci 29(6):1874-1886.
Groszer, M., Erickson, R., Scripture-Adams, D.D., Dougherty, J.D., Le Belle., J., Zack,
J.A., Geschwind, D.H., Liu, X., Kornblum, H.I. & Wu, H. 2005. PTEN negatively
regulates neural stem cell self-renewal by modulating G0-G1 cell cycle entry Proc
Natl Acad Sci U S A. 103(1):111-6.
Hartwell, L.H. & Weinert, T.A. 1989. Checkpoints: controls that ensure the order of cell
cycle events. Science. 246: 4930.
Hegi, M.E., Diserens, A.C., Gorlia, T., Hamou, M., de Tribolet, N., Weller, M., Kros,
J.M., Hainfellner, J.A., Mason, W., Mariani, L. et al., 2005. MGMT gene
silencing and benefit from temozolomide in glioblastoma. N Engl J Med. 352:
997–1003
Hermeking, H., Lengauer, C., Polyak, K., He, T.C., Zhang, L., Thiagalingam, S., Kinzler,
K.W. & Vogelstein, B. 1997. 14-3-3 sigma is a p53- regulated inhibitor of G2/M
progression. Mol. Cell 1, 3-11.
Hollstein, M., Sidransky, D., Vogelstein, B. & Harris, C.C. p53 mutations in human
cancers. Science. 1991,253(5015):49–53.
Huang, L. C., Clarkin, K. C. & Wahl, G. M. 1996. Sensitivity and selectivity of the DNA
damage sensor responsible for activating p53-dependent G1 arrest. Proc. Natl
Acad. Sci USA 93, 4827-4832.
Jackson, E.L., Willis, N., Mercer, K., Bronson, R.T., Crowley, D., Montoya, R., Jacks, T.
& Tuveson, T.A. 2001. Analysis of lung tumor initiation and progression using
conditional expression of oncogenic K-ras. Genes Dev 15(24):3243-3248.
Kao, G.D., Jiang, Z., Fernandes, A.M., Gupta, A.K. & Maity, A. 2007. Inhibition of
phosphatidylinositol-3-OH kinase/Akt signaling impairs DNA repair in
glioblastoma cells following ionizing radiation. J Biol Chem. 282(29):21206-12.
63
Karnoub, A.E. & Weinberg, R.A., 2008. Ras oncogenes: split personalities. Nat Rev Mol
Cell Biol. 9(7):517-31.
Kaur, H., Phillips-Mason, P.J., Burden-Gulley, S.M., Kerstetter-Fogle, A.E., Basilion,
J.P., Sloan, A.E. & Brady-Kalnay, S.M. 2012. Cadherin-11, a marker of the
Mesenchymal Phenotype, Regulates Glioblastoma Cell Migration and Survival In
Vivo. Mol. Cancer Res. 10:293-304.
Kim, Y., Kim, E., Wu, Q., Guryanova, O., Hitomi, M., Lathia, J.D., Serwanski, D.,
Sloan, A.E. Weil, R.J. & Lee, J. 2012. Platelet-derived growth factor receptors
differentially inform intertumoral and intratumoral heterogeneity. Genes Dev.
26(11):1247-62.
Kleihues, P. & Ohgaki, H., 1999. Primary and secondary glioblastomas: from concept to
clinical diagnosis. Neuro Oncol. 1(1):44-51.
Koumenis, C., Alarcon, R., Hammond, E., Sutphin, P., Hoffman, W., Murphy, M., Derr,
J., Taya, Y., Lowe, S.W. & Kastan, W. 2001. Regulation of p53 by hypoxia:
dissociation of transcriptional repression and apoptosis from p53-dependent
transactivation. Mol. Cell
Biol. 21:1297-1310.
Kreth, S., Thon, N., Eigenbrod, S., Lutz, J., Ledderose, C., Egensperger, R., Tonn, J.C.,
Kretzschmar, H.A., Hinske, L.C. & Kreth, F.W. 2011. O-methylguanine-dna
methyltransferase (mgmt) mrna expression predicts outcome in malignant glioma
independent of 0 mgmt promoter methylation. PLoS One. 6(2):e17156.
Khodarev ,N.N., Beckett, M., Labay E., Darga, L., Roizman, B. & Weichselbaum, R.R.
2010. STAT1 is overexpressed in tumors selected for radioresistance and confers
protection from radiation in transduced sensitive cells. Proc Natl Acad Sci U S A.
101(6):1714-9.
Laks, D.R., Masterman-Smith, M., Visnyei, K., Angenieux, B., Orozco, N.M., Foran, I.,
Yong, W.H., Vinters, H.V., Liau, L.M., Lazareff, J.A., et al. 2009. Neurosphere
formation is an independent predictor of clinical outcome in malignant glioma.
Stem Cells. 27(4):980-7.
Laks, D.R., Visnyei, K. & Kornblum, H.I. 2010. Brain tumor stem cells as therapeutic
targets in models of glioma Yonsei Med J. 51(5):633-40.
Lane, D.P. 1992. Cancer. P53, guardian of the genome. Nature. 358(6381):15-6.
Lee, J., Kotliarova, S., Kotliarov, Y., Li, A., Su, Q., Donin, N.M., Pastorino, S., Purow,
B.W., Chrisopher, N., Zhang, W., Park, J.K. & Fine, H.A. 2006. Tumor stem cells
derived from glioblastomas cultured in bFGF and EGF more closely mirror the
phenotype and genotype of primary tumors than do serum-cultured cell lines.
Cancer Cell. 9(5):391-403
64
Lee, S.M., Koh, H.J., Park, D.C., Song, B.J., Huh, T. & Park, J. 2002. Cytosolic
NADP(+)-dependent isocitrate dehydrogenase status modulates oxidative damage
to cells. Free Radic Biol Med 32:1185–96.
Li, L., Ying, J., Li H., Zhang, Y., Shu, X., Fan, Y., Tan, J., Cao, Y., Tsao, S., Srivastava,
G., Chan, A & Tao, Q. 2011. The human cadherin 11 is a pro-apoptotic tumor
suppressor modulating cell stemness through wnt/β-catenin signaling and silenced
in common carcinomas. Oncogene
Lindberg, N., Kastemar, M., Olofsson, T., Smits, A. & Uhrbom, L. 2009.
Oligodendrocyte progenitor cells can act as cell of origin for experimental glioma.
Oncogene 28(23):2266-2275.
Lokker, N.A., Sullivan, C.M., Hollenback, S.J., Israel, M.A. & Giese, N.A. 2002.
Platelet-derived growth factor (PDGF) autocrine signaling regulates survival and
mitogenic pathways in glioblastoma cells: evidence that the novel PDGF-C and
PDGF-D ligands may play a role in the development of brain tumors. Cancer Res.
62(13):3729-35.
Louis, D.N., Ohgaki, H., Wiestler, O.D., Cavenee, W.K., Burger, P.C., Jouvet, A.,
Scheithauer, B.W. & Kleihues, P. 2007. The 2007 WHO classification of tumours
of the central nervous system. Acta Neuropathol. 114(2):97-109.
Maehama, T. & Dixon J.E., 1998. The tumor suppressor, PTEN/MMAC1,
dephosphorylates the lipid second messenger, phosphatidylinositol 3,4,5trisphosphate. J Biol Chem. 273(22):13375-8.
Marchesi, F., Turriziani, M., Tortorelli, G., Avvisati, G., Torino, F. & De Vecchis, L.
2007. Triazene compounds: mechanism of action and related DNA repair
systems. Pharmacol Res 56:275–287.
Maria-del-Mar, I., Rudy, B., Akitake, M., Narita, Y., Shah, D., Vandenberg, S., Brennan,
C., Johns, T.G., Bachoo, R., Hadwiger, P., et al. 2010. EGFR-induced cytokine
circuit in Glioblastoma. Genes Dev. 2010 24: 1731-45.
Miller, M.S. & Miller, L.D. 2012. RAS Mutations and Oncogenesis: Not all RAS
Mutations are Created Equally. Front Genet. 2011, 2: 100.
Miyaki, M., Konishi, M., Tanaka K., Kikuchi-Yanoshita, R., Muraoka, M., Yasuno, M.,
Igari, T., Koike, M., Chiba, M. & Mori, T. 1997. Germline mutation of MSH6 as
the cause of hereditary nonpolyposis colorectal cancer. Nat. Genet. 17:271-272.
Nakano, I. and Kornblum, H.I. 2006. Brain Tumor Stem Cells. Pediatr Res. 2006
9(4Pt2):54R-8R.
65
Nunes, M.C., Roy, N.S., Keyoung, H.M., Goodman, R.R., McKhann, G., Jiang, L., Kang,
J., Nedergaard, M. & Goldman, S.A. 2003. Identification and isolation of
multipotential neural progenitor cells from the subcortical white matter of the
adult human brain. Nat Med 9(4):439-447.
Ohgaki, H. & Kleihues, P. 2004. Epidemiology and etiology of gliomas. Acta
Neuropathol. 109(1):93-108.
Panet-Raymond, V., Souhami, L., Roberge, D., Kavan, P., Shakibnia, L., Muanza, T.,
Lambert, C., Leblanc, R., Del Maestro, R., Guiot, M., et al. 2009. Accelerated
hypofractionated intensity-modulated radiotherapy with concurrent and adjuvant
temozolomide for patients with glioblastoma multiforme: a safety and efficacy
analysis. Int J Radiat Oncol Biol Phys. 73(2):473-8.
Negrini, S., Gorgoulis, V.G. & Halazonetis, T.D. 2010. Genomic instability—an evolving
hallmark of cancer. Nat Rev Mol Cell Biol. 11(3):220-8.
Phillips, H.S., Kharbanda, S., Chen, R., Forrest, W.F., Soriano, R.H., Wu, T.D., Misra,
A., Nigro, J.M., Colman, H. & Soroceanu, H. 2006. Molecular subclasses of highgrade glioma predict prognosis, delineate a pattern of disease progression, and
resemble stages in neurogenesis. Cancer Cell. 9: 157-173.
Quinn, J., Jiang, S., Reardon, D., Desjardins, A., Vredenburgh, J., Gururangan, S.,
Sampson, J.H., McLendon, R.E., Herndon, J.E. & Friedman, H.S. 2005. Phase I
trial of temozolomide plus O6-benzylguanine for patients with recurrent or
progressive malignant glioma. J Clin Oncol 23:7178–7187.
Reya, T., Morrison, S.J., Clarke, M.F. & Weissman, I.L. 2001 Stem cells, cancer, and
cancer stem cells. Nature. 414(6859):105-11.
Reynolds, B.A. & Weiss, S., 1992. Generation of neurons and astrocytes form isolated
cells of the adult mammalian central nervous system. Science. 255(5052):170710.
Rivers, L.E., Young, K.M., Rizzo, M., Jamen, F., Psachoulia, K., Wade, A., Kessaris, N.
& Richardson, W.D. 2008. PDGFRA/NG2 glia generate myelinating
oligodendrocytes and piriform projection neurons in adult mice. Nat Neurosci
11(12):1392-1401.
Shah, N., Lin, B., Sibenaller, Z., Ryken, T., Lee, H., Yoon, J., Rostad, S. & Foltz, G.
2011. Comprehensive analysis of MGMT promoter methylation: correlation with
MGMT expression and clinical response in GBM. PLoS One. 6(1):e16146.
Singh, S.K., Hawkens, C. & Clarke, I.D., 2004. Identification of human brain tumour
initiating Cells. Nature. 432(7015):396-401.
66
The Cancer Genome Atlas (TCGA) Research Network, 2008. Comprehensive genomic
characterization defines human glioblastoma genes and core pathways. Nature.
455(7216): 1061-68.
Terasaki, M., Eto, T., Nakashima, S., Okada, Y., Ogo, E., Sugita, Y., Tokutomi, T. &
Shigemori, M. 2011. A pilot study of hypofractionated radiation therapy with
temozolomide for adults with glioblastoma multiforme. J
Neurooncol. 102(2):247-53.
Tubbs, J.L., Pegg, A.E. & Tainera, J.A. 2007. DNA binding, nucleotide flipping, and the
helix turn-helix motif in base repair by O6- alkylguanine-DNA alkyltransferase
and its implications for cancer chemotherapy. DNA Repair. 6. 1100-1115.
Uhrbom, L., Dai, C., Celestino, J.C., Rosenblum, M.K., Fuller, G.N. & Holland, E.C.
2002. Ink4a-Arf loss cooperates with KRas activation in astrocytes and neural
progenitors to generate glioblastomas of various morphologies depending on
activated Akt. Cancer Res 62(19):5551-5558.
van den Bent, M.J., Gravendeel, L.A., Gorlia, T., Kros, J.M., Lapre, L., Wesseling, P.,
Teepen, J.L., Idbaih, A., Sanson, M., Smitt, P. & French, P.J. 2011. A
hypermethylated phenotype is a better predictor of survival than MGMT
methylation in anaplastic oligodendroglial brain tumors: a report from EORTC
study 26951. Clin Cancer Res. 17(22):7148-55.
Vaziri, C. , Saxena, S. , Jeon, Y. , Lee, C. , Murata, K. , Machinda, Y., Wagle, N.,
Hwang, D. & Dutta, A. 2003. A p53-dependent checkpoint pathway prevents
rereplication. Molecular Cell. 11(4): 997-1008.
Verhaak, R.G.W, Hoadley, K.A., Purdom, E., Wang, V., Qi, Y., Wilkerson, M.D., Miller,
C.R., Ding, L., Golub, T., Mesirove, J.P., et al 2010. Integrated Genomic
Analysis Identifies Clinically Relevant Subtypes of Glioblastoma Characterized
by Abnormalities in PDGFRA, IDH1, EGFR, and NF1. Cancer Cell. 17: 98–110.
Wang, J., Wakeman, T.P., Lathia, J.D., Hjelmeland, A.J., Wang, X., White, R.R., Rich,
J.N. & Sullenger, B.A. 2010. Notch promotes radioresistance of glioma stem
cells. Stem Cells. 2:17-28.
Yan, H., Parsons, D.W., Jin, G., McLendon, R., Rasheed, B.A., Yuan, W., BatinicHaberle, I., Jones, S., Riggins, G.J., et al. 2009. IDH1 and IDH2 mutations in
gliomas. N Engl J Med. 360:765–773.
67