© 2015. Published by The Company of Biologists Ltd | Development (2015) 142, 3954-3963 doi:10.1242/dev.124172
RESEARCH ARTICLE
Suppression of epithelial differentiation by Foxi3 is essential for
molar crown patterning
ABSTRACT
Epithelial morphogenesis generates the shape of the tooth crown.
This is driven by patterned differentiation of cells into enamel knots,
root-forming cervical loops and enamel-forming ameloblasts. Enamel
knots are signaling centers that define the positions of cusp tips in a
tooth by instructing the adjacent epithelium to fold and proliferate.
Here, we show that the forkhead-box transcription factor Foxi3
inhibits formation of enamel knots and cervical loops and thus the
differentiation of dental epithelium in mice. Conditional deletion of
Foxi3 (Foxi3 cKO) led to fusion of molars with abnormally patterned
shallow cusps. Foxi3 was expressed in the epithelium, and its
expression was reduced in the enamel knots and cervical loops and in
ameloblasts. Bmp4, a known inducer of enamel knots and dental
epithelial differentiation, downregulated Foxi3 in wild-type teeth. Using
genome-wide gene expression profiling, we showed that in Foxi3 cKO
there was an early upregulation of differentiation markers, such as
p21, Fgf15 and Sfrp5. Different signaling pathway components that
are normally restricted to the enamel knots were expanded in the
epithelium, and Sostdc1, a marker of the intercuspal epithelium, was
missing. These findings indicated that the activator-inhibitor balance
regulating cusp patterning was disrupted in Foxi3 cKO. In addition,
early molar bud morphogenesis and, in particular, formation of the
suprabasal epithelial cell layer were impaired. We identified keratin 10
as a marker of suprabasal epithelial cells in teeth. Our results suggest
that Foxi3 maintains dental epithelial cells in an undifferentiated state
and thereby regulates multiple stages of tooth morphogenesis.
KEY WORDS: Foxi3, Multituberculata, Epithelium, Morphogenesis,
Signaling center, Tooth development
INTRODUCTION
Teeth develop from oral epithelium and underlying mesenchyme
through reciprocal interactions mediated by conserved signaling
molecules (Jussila and Thesleff, 2012). The shape of the tooth
crown emerges during the morphogenesis of the epithelium via bud,
cap and bell stages. Cell differentiation takes place towards the end
of morphogenesis, and tooth shape becomes fixed when the hard
tissues are deposited.
1
Research Program in Developmental Biology, Institute of Biotechnology,
2
University of Helsinki, Biocenter 1, PO Box 56, Helsinki 00014, Finland. Division of
Materials Physics, Department of Physics, University of Helsinki, PO Box 64,
3
Helsinki 00014, Finland. Department of Otolaryngology, Head & Neck Surgery and
Zilkha Neurogenetic Institute, Keck School of Medicine, University of Southern
4
California, 1501 San Pablo Street, Los Angeles, CA 90033-4503, USA. Program in
Developmental Biology, Department of Molecular and Human Genetics and
Department of Neuroscience, Baylor College of Medicine, BCM295, 1 Baylor Plaza,
Houston, TX 77030, USA.
*These authors contributed equally to this work
‡
Author for correspondence ([email protected])
Received 10 March 2015; Accepted 27 September 2015
3954
Tooth development begins with the formation of an epithelial
thickening or placode. Tooth placodes consist of a basal cell layer
facing the mesenchyme and several layers of suprabasal cells
covered by periderm. The basal and suprabasal cells differ in their
gene expression patterns (Palacios et al., 1995; Mitsiadis et al.,
1995, 2010; Fausser et al., 1998; Nieminen et al., 1998; Ohazama
and Sharpe, 2007). The mechanism of suprabasal cell formation has
not been studied extensively in tooth development. After induction,
placodal cells proliferate and form a bud that grows to the
underlying mesenchyme. The connection of the bud to the oral
epithelium constricts and forms the dental cord, where only a thin
layer of suprabasal cells remains between the basal cells (Jussila and
Thesleff, 2012). At this time, the suprabasal cells become loosely
organized in the center of the bud. These cells, called stellate
reticulum cells, resemble mesenchymal cells morphologically,
while still maintaining an epithelial gene expression profile.
From the cap stage onwards, the basal epithelium is divided into
inner enamel epithelium (IEE), which faces the dental papilla
mesenchyme, and the outer enamel epithelium (OEE), which faces
the dental follicle mesenchyme. A signaling center called the
primary enamel knot (PEK) forms within the IEE and can be
identified histologically as a condensed group of epithelial cells. It
expresses several signaling molecules and is non-proliferative, as
demonstrated by the expression of genes such as the cyclindependent kinase inhibitor p21 (Cdkn1a) and absence of 5′-bromo2′-deoxyuridine (BrdU) incorporation (Jernvall et al., 1998;
Keränen et al., 1998). The signals secreted by the PEK stimulate,
either directly or via mesenchyme, the flanking basal epithelium to
grow and form the cervical loops, which eventually form the roots.
During subsequent morphogenesis of multicuspid molars,
secondary enamel knots (SEKs) are induced at the sites of the
future cusp tips. Like the PEK, the SEKs secrete signaling
molecules that instruct the surrounding intercuspal IEE to
proliferate. These IEE cells will eventually differentiate into
ameloblasts. Mathematical modeling has shown that the pattern of
the SEKs results from a balance of activating and inhibiting signals
coupled with tissue growth (Salazar-Ciudad and Jernvall, 2002,
2010). Consequently, the local patterns of proliferation, instructed
by the signaling centers, generate the shape of the tooth crown. The
initiation of the second and third molars differs from the first molar
in that they do not arise from a placode, but from a posterior
extension of the epithelium associated with the previously formed
tooth (Juuri et al., 2013). However, after initiation, their
morphogenesis proceeds in a similar manner to the first molar.
A heterozygous mutation in the Foxi3 transcription factor was
identified in hairless dogs, which have missing and abnormally
shaped teeth (Drögemüller et al., 2008). Foxi3 belongs to the
superfamily of Forkhead box transcription factors that act as
transcriptional activators, repressors, pioneer factors or chromatin
modifiers (Benayoun et al., 2011; Lam et al., 2013). Foxi3
DEVELOPMENT
Maria Jussila1, Anne J. Aalto1, *, Maria Sanz Navarro1,*, Vera Shirokova1, Anamaria Balic1, Aki Kallonen2,
Takahiro Ohyama3, Andrew K. Groves4, Marja L. Mikkola1 and Irma Thesleff1,‡
expression is restricted to the epithelium during the development of
several ectodermal appendages, including teeth (Shirokova et al.,
2013). Foxi3 is expressed in the dental epithelium at all stages of
development, but is downregulated in the differentiated ameloblasts
(Shirokova et al., 2013). Foxi3 knockout (KO) mice die at birth as a
result of craniofacial malformations, which arise from the lack of
branchial arch-derived structures (Edlund et al., 2014).
Here, we show that conditional epithelial deletion of Foxi3 led to
fusion of molars with abnormally patterned shallow cusps.
Genome-wide expression profiling revealed upregulation of genes
related to the differentiation of PEK and SEK and the cervical loop
in Foxi3 mutants. During normal development, Foxi3 is expressed
at high levels in IEE except for PEK and SEK signaling centers, tips
of cervical loops and ameloblasts. Bmp4, a known inducer of PEK
and SEK formation and ameloblast differentiation, inhibited Foxi3
expression. In situ analysis showed that markers normally restricted
to SEKs were extended, which probably reflected the disrupted
balance of activators and inhibitors regulating patterning and cusp
formation. In addition, an earlier defect in the suprabasal epithelial
cell compartment and budding morphogenesis was evident. Our
results suggest that Foxi3 maintains epithelial cells in an
undifferentiated state and thereby regulates multiple stages of
tooth morphogenesis.
RESULTS
Deletion of Foxi3 led to fusion of molars with an altered cusp
pattern
The Foxi3 −/− phenotype is embryonic lethal, with severely affected
development of branchial arch derivatives (Edlund et al., 2014),
precluding analysis of all mandibular teeth and maxillary molars.
We detected structures resembling upper incisors in Foxi3 −/−
embryos in an outbred ICR background, but when the mice were
maintained in an inbred C57Bl/6 background, no signs of tooth
development were observed (data not shown).
Conditional Foxi3 mutant mice (K14-cre43;Foxi3 −/floxed;
hereafter Foxi3 cKO) in a mixed ICR and NMRI background
were viable and fertile, but often smaller than their littermates
(Table S2). The adults had erupted molars, but their morphology
and cusp pattern were dramatically altered. Furthermore, the first
(M1) and second (M2) molars of Foxi3 cKO mice were fused,
and the third molar (M3) was sometimes missing or fused with
anterior molars (Fig. 1A-C). Micro-computed tomography (microCT) scans on 5-week-old control and Foxi3 cKO lower jaws
(Fig. 1D-L; Fig. S1) revealed small cusps in two parallel rows. The
transverse ridges connecting cusps in the wild-type teeth were
missing from mutants. Shallow cusps were easily visible in a lingual
view (Fig. 1G-I). From an anterior view, it was obvious that the
buccal side of the Foxi3 cKO molars was more affected (Fig. 1J-L).
An additional row of cusps appeared to be forming on the buccal
side of the mutant teeth. The morphologies of the roots of were also
affected (Fig. S1J,K)
Molars were fused in 95% of the lower jaw halves (38/40) and in
100% of the upper jaw halves (40/40). M3 was missing in 53% of
lower jaw halves (21/40) and in 17.5% of upper jaw halves (7/40).
Incisors were absent or small (the incisor phenotype will be
described elsewhere). We did not observe any phenotype in
heterozygous animals. Given that the hairless dogs having a
severe tooth phenotype are heterozygotes for Foxi3, it is plausible
that mice have a compensatory mechanism for reduction in Foxi3
levels that is not present in dogs. Taken together, the adult
phenotype of the Foxi3 cKO mice indicates that Foxi3 is an
important regulator of tooth morphogenesis.
Development (2015) 142, 3954-3963 doi:10.1242/dev.124172
Fig. 1. Phenotype of K14cre43;Foxi3 −/floxed (Foxi3 cKO) mice. (A-C) Molars
of 5-week-old WT and two Foxi3 cKO mice showing fused molars in Foxi3 cKO.
(D-L) Micro-CT scans showing occlusal (D-F), lingual (G-I) and anterior (J-L)
views of right molars of one Foxi3 −/floxed and two Foxi3 cKO mice. Arrows point
to an additional cusp-like row in Foxi3 cKO teeth. The remaining micro-CTscanned samples are shown in Fig. S1. Scale bar: 1 mm (for A-C). bu, buccal;
cKO, conditional knockout; CT, computed tomography; li, lingual; M1, first
molar; M2, second molar; M3, third molar; WT, wild type.
Epithelial morphogenesis was impaired in Foxi3 cKO mice
To determine the stage of molar morphogenesis when the Foxi3
cKO tooth phenotype arises, we analyzed the histology of control
and mutant molars from the M1 initiation onwards, as Foxi3 is
already expressed in the epithelium in the molar placode and bud
(Shirokova et al., 2013). At embryonic day (E) 12.5, the Foxi3 cKO
placode was smaller compared with controls, and the suprabasal
epithelium appeared especially poorly developed (Fig. 2A,B). At
E13.0 and E13.5, budding morphogenesis was impaired in Foxi3
cKO (Fig. 2C-F). Both the dental cord and the stellate reticulum
were missing from Foxi3 cKO molars (Fig. 2E-J). Cervical loops
formed in Foxi3 cKO, but they were smaller in size than controls
(Fig. 2G,H). At E16, the IEE did not show normal folding,
indicating that the shape of the crown was not forming correctly
(Fig. 2I-L). At E18, some embryos showed normal M3 bud
formation despite the fusion of M1 and M2 (Fig. 2M,N).
Mesenchymal condensation and ameloblast differentiation
appeared normal in Foxi3 cKO embryos (Fig. 2). In postnatal day
(P) 8 molar crown, there was secreted enamel and dentin, and
root formation had been initiated normally (Fig. 2O,P). We
analyzed the efficiency of the Cre-driver used and noticed mosaic
Foxi3 expression in the Foxi3 cKO molars at E12.5 (Fig. S2A-C).
At later stages (E13.5 and E14.5), qRT-PCR and in situ
hybridization confirmed the downregulation of Foxi3 expression
(Fig. 5A; Fig. S2D,E). In conclusion, loss of Foxi3 affects several
epithelial cell populations in the developing molar and impairs tooth
morphogenesis.
Foxi3 expression was downregulated upon differentiation of
dental epithelium and is regulated by several signaling
pathways
Next we examined the localization of Foxi3 protein (Fig. 3A-C). In
a similar manner to Foxi3 mRNA expression (Shirokova et al.,
2013), at E13.5 Foxi3 was strongly expressed on the lingual side of
the forming tooth, which grows faster when the epithelium proceeds
3955
DEVELOPMENT
RESEARCH ARTICLE
RESEARCH ARTICLE
Development (2015) 142, 3954-3963 doi:10.1242/dev.124172
Fig. 2. Embryonic phenotype of Foxi3 cKO mice. (A-J) Frontal
sections of control and Foxi3 cKO molars from E12.5 to E16. Arrows
in A,B point to the suprabasal cells; asterisks in E,G,I mark the
stellate reticulum; white open arrowheads in G,H point to the cervical
loops; and arrows in G,I point to the dental cord. (K-N) Sagittal
sections of control and Foxi3 cKO molars at E16 and E18. Asterisk in
K marks the stellate reticulum; arrows in M,N point to M3.
(O,P) Frontal sections of developing roots of control and Foxi3 cKO
molars at P8. Arrowheads point to the tips of roots. D, dentin; E,
enamel; IEE, inner enamel epithelium; M1, first molar; M2, second
molar; M3, third molar. Lingual is on the right in A-J. Scale bars:
100 μm.
from bud to cap. At E14.5, double staining with Lef1 revealed that
although Foxi3 was present in most epithelial cells, it appeared
largely absent from the Lef1-positive PEK (Fig. 3B). At E16, Foxi3
was present in the IEE and in the stellate reticulum, but only weakly
expressed in the Lef1-positive SEKs (Fig. 3C). In addition, the tips
of the growing cervical loops were negative for Foxi3 staining
(Fig. 3C). These observations indicate that Foxi3 is excluded from
the epithelial cells that have started to differentiate and acquire new
identities, such as enamel knots and the cervical loops.
Downregulation of Foxi3 in IEE before their differentiation to
ameloblasts was reported previously (Shirokova et al., 2013).
The morphogenesis of the tooth germ from bud to cap stage and
the induction of PEK are known to be regulated by epithelial-
mesenchymal interactions. Therefore, we decided to explore which
signaling molecules might regulate Foxi3 expression at this time by
using a hanging drop culture system, in which E13.5 molars are
exposed to a growth factor for 4 h before RNA collection for
qRT-PCR. Activin A was previously shown to upregulate Foxi3
in embryonic skin, and it stimulated Foxi3 in tooth epithelium by
2.7-fold (Fig. 3D). Shh induced a 1.7-fold upregulation of Foxi3
(Fig. 3E). Bmp4, a known inducer of PEK (Jernvall et al., 1998),
downregulated Foxi3 expression levels to half that of the control
samples (Fig. 3F). Fgf8 had no effect on Foxi3 expression, yet it
induced its own target Dusp6 by over fivefold (data not shown).
These results suggest that Foxi3 is a target of Activin A, Shh and
Bmp4. We have previously shown that ectodysplasin (Eda) also
enhances Foxi3 expression at this stage in the tooth (Shirokova
et al., 2013). However, after the bud stage Foxi3 expression is
significantly broader than Eda receptor expression (Laurikkala
et al., 2001), indicating that Foxi3 expression is regulated largely by
other signals. All these pathways are known to target the dental
epithelium (Jussila and Thesleff, 2012) and might therefore regulate
Foxi3 directly.
Fig. 3. Foxi3 protein expression and upstream regulation.
(A-C) Localization of Foxi3 protein together with Lef1 (B,C) in molar epithelium
at E13.5, E14.5 and E16. Arrows point to enamel knots; white open
arrowheads point to cervical loops. White line indicates the border between
epithelium and mesenchyme. Scale bars: 100 μm. (D-F) Relative expression
of Foxi3 analyzed by qRT-PCR (mean±s.d.) in E13.5 wild-type molars in the
presence or absence of a growth factor. Known target genes of each pathway
were used as the positive controls. (D) Activin A induced Foxi3 2.7-fold and
follistatin 5.4-fold (P=0.012, Wilcoxon signed-rank test), n=8. (E) Shh induced
Foxi3 1.8-fold, Gli 2.9-fold and Ptch1 4.8-fold (P=0.028, Wilcoxon signed-rank
test), n=6. (F) Bmp4 induced Foxi3 0.5-fold and Msx2 4.4-fold (P=0.018,
Wilcoxon signed-rank test), n=7. *P<0.05.
3956
In order to study more closely the defect in the early morphogenesis
of Foxi3 mutant molars, we used E- and P-cadherin (cadherins 1 and
3, respectively) as markers of the suprabasal and basal epithelial cell
populations (Palacios et al., 1995; Fausser et al., 1998). We
measured the relative areas of the strongly E-cadherin-positive and
weakly P-cadherin-positive suprabasal epithelia and the strongly
P-cadherin-positive basal epithelia at E13.0, and found that the
suprabasal cell population was smaller in the Foxi3 cKO molar
(Fig. 4A-C). In control molars, the suprabasal epithelium
represented 35% of the total epithelial area, and in the Foxi3 cKO
only 28% (Fig. 4C; P=0.006). Overall, the area of the Foxi3 cKO
epithelium was smaller than in control embryos (Fig. S3). These
observations raise the possibility that the defect in suprabasal cell
layer and budding morphogenesis might be connected.
A putative defect in suprabasal cells was supported by our
microarray analysis of E13.5 Foxi3 cKO and wild-type molar
epithelia (array results reported in detail below), which showed that
Notch2, Krt10 and Krt1 were downregulated in the Foxi3 cKO
molar. Notch2, together with Notch1 and 3, is expressed in the
DEVELOPMENT
Suprabasal cell population was reduced in the Foxi3 cKO
molar
RESEARCH ARTICLE
Development (2015) 142, 3954-3963 doi:10.1242/dev.124172
We analyzed expression of K10, and observed few weakly K10positive cells in control and Foxi3 cKO molars at E13.0 (data not
shown). Twelve hours later, there were K10-positive cells in the
suprabasal epithelium of control molars, and in addition, some basal
cells expressed weaker K10 signal (Fig. 4I, Fig. S4A,B). In Foxi3
cKO molars, only few weakly K10-positive cells were scattered
among the suprabasal cells (Fig. 4J, Fig. S4C). At E14.5, both K10positive and K10-negative cells were present in the control molars,
whereas in the Foxi3 cKO the K10-positive cells were largely absent
(Fig. 4K,L). At E16, the lack of K10-positive cells in the suprabasal
cell compartment (i.e. stellate reticulum) of the Foxi3 cKO tooth
was striking compared with the control tooth (Fig. 4M,N). These
results indicate that the K10-positive suprabasal cell population in
the molars is decreased in the Foxi3 cKOs, consistent with the
reduction of the stellate reticulum cell compartment. K10-positive
cells associated with the stratification of oral epithelium were
present in both control and Foxi3 cKO (Fig. 4N; data not shown).
Fig. 4. Analysis of the suprabasal epithelium in Foxi3 cKO molars.
(A,B) E- and P-cadherin double staining of control and Foxi3 cKO molars at
E13.0. Arrows point to the suprabasal epithelium. White line indicates areas of
suprabasal and basal epithelium measured in C. (C) Relative ratios of
suprabasal and basal epithelial areas of the total epithelium in wild-type and
Foxi3 cKO molars at E13.0 (n=3). Total areas are shown in Fig. S4. (D) Relative
expression of downregulated Notch2 (0.51-fold), Krt1 (0.32-fold) and Krt10
(0.16-fold) analyzed by qRT-PCR (mean±s.d.) in control and Foxi3 cKO molars
at E13.5 (P=0.029, Mann–Whitney U-test, n=4). (E,F) Expression of Notch2 in
E13.5 control and Foxi3 cKO molars. (G,H) Expression of Notch1 in E13.5
control and Foxi3 cKO molars. (I-N) Keratin 10 and P-cadherin (in I-L) staining
of control and Foxi3 cKO molars at E13.5, E14.5 and E16. Arrows point to K10positive cells, open white arrowheads to K10-positive cells in the oral
epithelium. White line in E-H indicates the border between epithelium and
mesenchyme. Lingual is on the right. Scale bars: 100 μm.
suprabasal epithelium throughout tooth development (Mitsiadis
et al., 1995). Keratin 10 (K10) is a type I keratin, which forms
intermediate filaments with the type II keratin 1 (K1). In skin,
suprabasal cells express K1 and K10 both during embryogenesis
and in adulthood (Wallace et al., 2012). qRT-PCR validation
showed a downregulation of Notch2 (0.51-fold), K1 (0.32-fold) and
K10 (0.16-fold) in the Foxi3 cKO bud stage epithelium (Fig. 4D).
Radioactive in situ hybridization (RISH) revealed that Notch2
expression was downregulated in the mutant epithelium (Fig. 4E,F),
but Notch1, which was not significantly changed in our microarray
analysis, was expressed in a comparable manner in controls and
Foxi3 cKO molars (Fig. 4G,H).
In order to identify putative Foxi3 downstream targets, we
performed genome-wide profiling of differentially expressed
genes in Foxi3 cKO and control molar epithelia at E13.5, the
earliest stage displaying efficient Foxi3 deletion. Of the
differentially expressed genes, 292 were downregulated and 431
upregulated (Table S3), but only 30 of the downregulated genes
showed more than a 0.6-fold reduction of expression and only 54
upregulated genes showed more than a 1.2-fold difference. To
validate the microarray results, we confirmed Foxi3 downregulation
and assessed 16 other genes by qRT-PCR. With the exception of
one gene, all showed a statistically significant change with qRTPCR (Fig. 4D; Fig. 5).
The Bmp4 target gene Msx2, as well as three Iroquois-family
transcription factors (Irx2, Irx3 and Irx5) that are expressed in the
molar epithelium (Houweling et al., 2001), were among the
downregulated genes (Fig. 5A). Interestingly, a striking number of
the genes upregulated in the Foxi3 cKO in the microarray belonged
to different signaling pathways, including Fgf, Shh, Wnt and Bmp.
Fgf15 and the Wnt inhibitor Sfrp5 were among the highest
upregulated genes in the microarray, and qRT-PCR showed about
15- and 13-fold upregulation of Fgf15 and Sfrp5 transcripts,
respectively (Fig. 5B). In addition, we validated upregulation of the
Fgf pathway target genes Dusp6 and Etv5 and the Shh pathway
genes Shh and Ptch1, whereas the difference in Gli1 expression was
not significant (Fig. 5C). Semaphorin 3E (Sema3e) was also
upregulated in Foxi3 cKO (Fig. 5C).
Subsequently, we localized some of the differentially expressed
genes by RISH in sections of E13.5 control and Foxi3 cKO molars.
In the control samples, Fgf and Bmp pathway genes were confined
to the tip of the bud epithelium, but in Foxi3 cKO the expression of
the Fgf pathway target Dusp6 and Fgf antagonist sprouty 2 (Spry2)
spanned the whole depth of the dental epithelium (Fig. 6A-D).
Bmp7, as well as the Bmp target Id1, showed a similar broad
expression in Foxi3 cKO (Fig. 6E-H). By contrast, Shh was expressed
in a patchy pattern compared with the focal signaling center present in
control teeth (Fig. 6I,J), and Wnt10a was more restricted to the basal
portion of the mutant molar epithelium (Fig. 6K,L). Msx2 showed a
similar but weaker expression in the buccal epithelium in the Foxi3
mutants compared with controls (Fig. 6M,N). Sema3e expression has
not been reported for developing molars, and unlike the control
teeth, Sema3e was expressed ectopically in the Foxi3 cKO
epithelium (Fig. 6O,P). In conclusion, our microarray, qRT-PCR
3957
DEVELOPMENT
Microarray analysis revealed alterations in multiple
signaling pathway components in the Foxi3 cKO molar
RESEARCH ARTICLE
Development (2015) 142, 3954-3963 doi:10.1242/dev.124172
Fig. 5. Validation of differentially expressed genes from
the microarray by qRT-PCR. (A) Relative expression of
Foxi3 (0.05-fold), Msx2 (0.5-fold), Irx2 (0.6-fold), Irx3 (0.5fold) and Irx5 (0.5-fold) analyzed by qRT-PCR (mean±s.d.) in
wild-type and Foxi3 cKO molars at E13.5 (mean±s.d.,
P=0.029, Mann–Whitney U-test, n=4). (B) Relative
expression of Fgf15 (14.9-fold) and Sfrp5 (13.6-fold) in wildtype and Foxi3 cKO molars at E13.5 (mean±s.d., P=0.029,
Mann–Whitney U-test, n=4). (C) Relative expression of Fgf9
(1.9-fold), Dusp6 (2.9-fold), Etv5 (2.7-fold), Shh (4.2-fold),
Gli1 (1.5-fold), Ptch1 (2.4-fold) and Sema3e (3.0-fold) in wildtype and Foxi3 cKO molars at E13.5 (mean±s.d., Gli1 P=0.34,
others P=0.029, Mann–Whitney U-test, n=4). ns, not
statistically significant; *P<0.05.
and RISH data suggest that the defect in epithelial morphogenesis of
the Foxi3 cKO tooth was associated with incorrect localization and
activity of signaling pathways, and in particular, the Fgf, Shh and
Bmp pathways were stimulated.
Foxi3 cKO dental epithelium displayed molecular signs of
precocious differentiation
The PEK and the SEKs are marked by expression of the cyclindependent kinase inhibitor p21 (Jernvall et al., 1998). p21 was
upregulated in our microarrays, and RISH confirmed a strong
expression at E13.5 in the tip of Foxi3 cKO epithelium (Fig. 7A,B).
At E14.5, there was p21 expression in the PEK and in the dental
cord in control molars, but in the Foxi3 cKO p21 expression
spanned the whole epithelium (Fig. 7C,D). This prompted us to
investigate other characteristics of the Foxi3 cKO PEK. Analysis of
BrdU-negative cells at E14.0 revealed that, in contrast to weightmatched littermates, there was already a clear BrdU-negative area in
the tip of the epithelial bud of the Foxi3 cKO molar, indicating
precocious PEK formation (Fig. S5A,B). At E14.5, Lef1 and Pcadherin immunostaining revealed that the structure of the PEK was
abnormal in Foxi3 cKO (Fig. S5C-F). However, PEK marker genes
Shh and Dkk4 were expressed in a similar manner in control and
Foxi3 cKO PEK, whereas Wnt10a seemed to be expressed more
widely in Foxi3 cKO (Fig. S5G-L).
At E16, p21 was expressed in the SEKs of the control teeth,
whereas in the Foxi3 cKO p21 spanned the whole IEE (Fig. 7E,F).
The Wnt and Bmp inhibitor Sostdc1 has been linked to PEK
formation and it is expressed in a mirror image with p21 (Laurikkala
et al., 2003; Kassai et al., 2005). Sostdc1 was downregulated in our
microarray, and RISH revealed a reduction of Sostdc1-expressing
epithelium in the Foxi3 cKO at E13.5 and E14.5, whereas its
mesenchymal expression seemed unaffected (Fig. 7G-J). At E16,
Sostdc1 was expressed in the stellate reticulum and in the IEE
between the SEKs in the control tooth, but in Foxi3 cKO there was
no expression in the IEE (Fig. 7K,L). p21 and Sostdc1 showed
mirror-image expression patterns in both the control and Foxi3 cKO
DEVELOPMENT
Fig. 6. Validation of differentially expressed genes from the
microarray by in situ hybridization. (A-P) Expression of
microarray hit genes in E13.5 control and Foxi3 cKO molars.
White line indicates the border between epithelium and
mesenchyme. Lingual is on the right. Scale bar: 100 μm.
3958
RESEARCH ARTICLE
Development (2015) 142, 3954-3963 doi:10.1242/dev.124172
Fig. 7. Expression of p21, Sostdc1, Fgf15 and Sfrp5 in Foxi3
cKO. (A-F) Expression of p21 in E13.5, E14.5 and E16 control
and Foxi3 cKO molars. Arrows in E,F point to p21 expression in
IEE. (G-L) Expression of Sostdc1 in E13.5, E14.5 and E16
control and Foxi3 cKO molars. Arrows in K,L point to IEE where
Sostdc1 is expressed in control molars. (M-P) Expression of
Fgf15 in E14.0 and E15 control and Foxi3 cKO molars.
(Q-T) Expression of Sfrp5 in E14.5 and E15 control and Foxi3
cKO molars. IEE, inner enamel epithelium. White line indicates
the border between epithelium and mesenchyme. Lingual is on
the right. Scale bars: 100 μm.
Crown patterning signals were misexpressed in the Foxi3
cKO molar
The cusp phenotype of the adult Foxi3 cKO molars and the
expression pattern of the SEK marker p21 at E16 (see above)
indicated a dramatic defect in SEK patterning. Also, the expression
of other SEK markers, such as Lef1, Dkk4 and Wnt10a, spanned the
entire IEE in Foxi3 cKO molars as evidenced by analysis in both
sagittal (Fig. 8A-D) and frontal (Fig. 8E-H) sections. However, Fgf4
was expressed focally in the SEKs in both the control and in Foxi3
cKO molars (Fig. 8I,J). Thus, most but not all SEK markers
analyzed were ectopically expressed in the Foxi3 cKO IEE.
DISCUSSION
We have shown that Foxi3 affects all major stages of tooth
morphogenesis and has several different functions during tooth
development (Fig. 9). Early on, it controls the formation of K10positive suprabasal cells. Later on, Foxi3 acts as an inhibitor of
differentiation that prevents the epithelium from precociously
acquiring the fates of cervical loops and enamel knots and
probably also of ameloblasts. This kind of function has not been
suggested previously for any transcription factor expressed in the
dental epithelium (Bei, 2009).
Foxi3 regulates formation of suprabasal cells
The earliest manifestation of the Foxi3 cKO molar phenotype was
an abnormally shaped placode with a reduced suprabasal
compartment. We saw a specific downregulation of Notch2 but
not Notch1, which suggests that in addition to being fewer in
number, the suprabasal cells are abnormally specified. Little is
known about the cellular mechanism driving tooth placode
3959
DEVELOPMENT
epithelium at all stages studied. This suggests that in the Foxi3 cKO
the intercuspal Sostdc1-positive IEE had undergone a change in cell
fate into SEK.
In the microarray, Fgf15 and Sfrp5 were significantly upregulated
in Foxi3 cKO at E13.5, but we could not detect their expression with
RISH at this stage. At E14, however, Fgf15 was weakly expressed in
control molars and upregulated in the Foxi3 cKO epithelium
(Fig. 7M,N). At E15, Fgf15 expression was present in the SEKs of
the control tooth, whereas in the Foxi3 cKO there was ectopic Fgf15
expression in the cervical loops (Fig. 7O,P). Sfrp5 was expressed in
both the control and Foxi3 cKO molars at E14.5 around the PEK and
in the cervical loops (Fig. 7Q,R). At E15 in the control molar, there
was expression only in the cervical loops, but in the Foxi3 cKO there
was strong expression spanning from the cervical loops towards the
enamel knots (Fig. 7S,T). During normal development, Foxi3 is
downregulated in the cervical loops at E16 (Fig. 3C). Taken
together, upregulation of differentiation markers, such as p21,
Fgf15 and Srfp5, points to a precocious differentiation of the Foxi3
cKO epithelium.
In order to investigate whether the precocious epithelial
differentiation had an effect on ameloblasts, we localized expression
of the enamel protein ameloblastin. At E18 in control lower molars,
ameloblastin expression had started at the cusp tips and spread
cervically in some sections, whereas in Foxi3 cKO lower molars
the expression covered a wider area and appeared more intense
(Fig. S6A-D). In upper molars, there was no ameloblastin expression
in controls, but in Foxi3 cKO the expression was evident (Fig. S6E,F).
These observations suggested an earlier onset of ameloblast
differentiation in the Foxi3 mutants. However, owing to the restricted
number of samples the results should be considered preliminary.
Fig. 8. Expression of SEK markers in Foxi3 cKO. (A-D) Expression of Lef1
and Dkk4 in sagittal sections of E16 control and Foxi3 cKO molars.
(E-J) Expression of Dkk4, Wnt10a and Fgf4 in frontal sections of E16 control
and Foxi3 cKO molars. Arrows point to focal expression in SEK signaling
centers. Lingual is on the right. Scale bars: 100 μm.
formation and the origin of the suprabasal cells. In the embryonic
skin, asymmetric cell divisions of basal cells give rise to suprabasal
cells, which express differentiation markers, such as K1, while
remaining proliferative (Lechler and Fuchs, 2005), as do dental
suprabasal cells. We observed K10 expression in some basal cells,
suggesting that also in teeth, the K10-positive cells might originate
from the basal layer. The lack of stellate reticulum and the
downregulation of K1 and K10 in Foxi3 cKO would indicate
a failure in this process. However, K10 expression was detectable
in developing teeth only after E13.0, whereas the reduction in
suprabasal cell population was already noticeable at the placode
stage, suggesting an alternative or additional explanation. Hair
placodes arise from cell migration and intercalation (Ahtiainen et al.,
2014), and it is possible that a similar mechanism exists in teeth and is
impaired in the Foxi3 cKO. This could lead to a failure in the
specification of the initial suprabasal cells. Further studies will be
required to uncover the causative mechanism, but unfortunately, the
inefficient deletion of Foxi3 prior to E13.5 hampers these efforts.
Foxi3 regulates dental cord formation and prevents molar
fusion
The cellular mechanisms that drive the narrowing of the neck of the
tooth bud, the dental cord, are not known. The defect in Foxi3 cKO
Development (2015) 142, 3954-3963 doi:10.1242/dev.124172
bud formation could be a result of altered adhesive properties of the
epithelium. In support of this hypothesis, several adhesion
molecules, such as cadherins and claudins, were differentially
expressed in the microarray. The branchial arch phenotype of the
Foxi3 KO has been speculated to result from a defect in cell
adhesion (Edlund et al., 2014). In addition to Foxi3 cKO, the dental
cord does not form in the molars of the conditional epithelial Shh
KO (Dassule et al., 2000). In the Shh cKO, also the M1 and M2 fuse
and the molars have shallow cusps with an abnormal pattern
(Dassule et al., 2000). Deletion of other Shh pathway components,
Smo or Evc, leads to milder molar fusion phenotypes (Gritli-Linde
et al., 2002; Nakatomi et al., 2013). Our hanging drop induction
experiment suggests that Foxi3 might be a downstream target of
Shh, and therefore Foxi3 deletion could lead to a similar phenotype
to the mutations in the Shh pathway components. Sostdc1 was
downregulated in the Foxi3 cKO, and M1 and M2 are fused in the
Sostdc1 knockouts (Kassai et al., 2005). However, their cusp
phenotype is different from Foxi3 cKO and their early molar
morphogenesis appears normal. The molar fusion in Sostdc1 KO
was suggested to be caused by ectopic p21 expression, which we
observed also in Foxi3 cKO. In general, the mechanism of molar
fusion is poorly understood. The buds of M2 and M3 form
sequentially from the posterior end of the previous molar, and the
separation of molars requires epithelial downgrowth in a similar
manner to the growth of cusps in the tooth crown. We suggest that
the molar fusion in Foxi3 cKO is related to the failure in the M1 bud
formation and to the impaired epithelial downgrowth, which is
necessary for proper separation of M2 from M1. Interestingly, Li
et al. (2015) showed recently that the downgrowth of cervical loop
epithelium in the molar depends on Shh signaling to regulate the
maintenance of Sox2-expressing transient stem cells in the loops. It
is possible that Foxi3 regulates cervical loop downgrowth as part of
this signaling network.
Foxi3 might function as an epigenetic regulator
Our microarray revealed a large number of up- and downregulated
genes. They are likely to represent both direct and indirect targets
of Foxi3, the latter reflecting a deficiency in the suprabasal
cell population and precocious enamel knot differentiation. We
validated by qRT-PCR downregulation of Irx2, Irx3 and Irx5 in
Foxi3 cKO, and in addition, Irx1 was downregulated in the
microarray. All four transcription factors have an overlapping
expression pattern with Foxi3 (Houweling et al., 2001), making
them good candidates for Foxi3 targets, but their function in tooth
formation is not known. The highest upregulated gene in the
microarray was the enamel knot marker Fgf15 (Kettunen et al.,
Fig. 9. Foxi3 inhibits epithelial differentiation
and promotes suprabasal cell formation.
Schematic illustration of the key findings in this
article. At the bud stage at E13.5, loss of Foxi3
leads to a lack of suprabasal cells and upregulation
of signaling pathway components in the
epithelium. At E16, markers of SEKs and cervical
loops become expanded. The key genes identified
were Krt10 (K10), Krt1 (K1) and Notch2 in
suprabasal cells and p21, Fgf15 and Sfrp5, in
addition to several PEK and SEK markers, as
indicators of differentiation. WT, wild type.
3960
DEVELOPMENT
RESEARCH ARTICLE
RESEARCH ARTICLE
Foxi3 is an inhibitor of epithelial differentiation
The microarray revealed a general upregulation of components of
different signaling pathways, and in particular, PEK markers p21
and Fgf15 in the Foxi3 cKO tooth bud epithelium (Fig. 9). In
addition, Sfrp5, which marks the cervical loops initiating root
formation at late bell stage (E. Juuri and I.T., unpublished results),
was induced precociously at the bud stage in Foxi3 cKO (Fig. 9).
Foxi3 was expressed throughout the bud epithelium but became
downregulated during bud to cap stage transition from the PEK
signaling center. During subsequent tooth morphogenesis, Foxi3
was downregulated in the cervical loop epithelium. Together, these
observations suggest that Foxi3 inhibits the dental epithelium from
precocious differentiation towards PEK and cervical loop fates.
Additionally, downregulation of Foxi3 in PEK and SEK might be a
prerequisite for their induction. The BrdU incorporation assay
indicated that PEK induction was accelerated in Foxi3 mutants. Our
preliminary data suggested that ameloblasts differentiated slightly
earlier in Foxi3 cKO compared with their littermates, supporting a
role for Foxi3 as an inhibitor of precocious differentiation. We
showed that exposure of bud stage teeth to Bmp4 downregulated
Foxi3 expression. Interestingly, Bmp4 has been shown to induce
PEK formation (Jernvall et al., 1998) and ameloblast differentiation
(Wang et al., 2004) and this, together with the downregulation of
Foxi3 in the PEK and ameloblasts, suggests that Foxi3 might
function as an inhibitor of dental epithelial differentiation.
Balance of activating and inhibiting signals that regulate
crown patterning is perturbed in Foxi3 cKO
At a later stage, during SEK formation, most IEE took the SEK fate
in Foxi3 cKO mutants. This was manifested by the ectopic
expression of a number of SEK markers and the absence of
Sostdc1 from the intercuspal epithelium, supporting the idea of
Foxi3 as an inhibitor of SEKs in addition to PEK. During crown
patterning, the cells respond to two types of signals, to activators
inducing SEK formation and to inhibitors. The inhibitors repress
differentiation and induce proliferation and they prevent new
signaling centers from forming in close proximity to the existing
centers (Salazar-Ciudad and Jernvall, 2010). The spreading of SEK
markers in Foxi3 cKO suggests that there is a decreased level of
inhibition in the mutant tooth. Thus, Foxi3 might either suppress the
responsiveness of the intercuspal epithelium to activators (such as
Bmp4) or promote their sensitivity to inhibitors (such as Shh). As
Bmp4 was able to inhibit Foxi3 expression in bud stage teeth, it
could likewise also inhibit Foxi3 in the SEKs, allowing
differentiation of the signaling centers. At the same time, in
intercuspal regions Foxi3 could prevent Bmp4 responses, such as
induction of p21 expression (Jernvall et al., 1998) and ameloblast
differentiation (Wang et al., 2004). In addition to Bmp4, we
identified several other signals that affected Foxi3 expression,
namely Shh, Activin and Eda. They have all been linked to
modulation of crown shape complexity (Harjunmaa et al., 2012);
therefore, changes in Foxi3 levels during evolution could be one
way to modify the cusp pattern in different species. Interestingly, the
cusp pattern of Foxi3 cKO resembles the multituberculates, an
extinct clade of mammals, which had molars with longitudinal cusp
rows (Wilson et al., 2012).
In conclusion, based on the expression pattern of Foxi3 and the
phenotype of the Foxi3 cKO, we propose that during tooth
morphogenesis Foxi3 has a unique role as a transcription factor
that keeps the dental epithelium in an undifferentiated state. Foxi3
might execute its function partly through epigenetic regulation, and
it regulates formation of the suprabasal cells and inhibits the
differentiation of cervical loops and enamel knots.
MATERIALS AND METHODS
Animals
Wild-type NMRI mice (The Jackson Laboratory) were used in hanging drop
cultures. K14-cre43;Foxi3 +/− males (Andl et al., 2004; Edlund et al., 2014)
were crossed with Foxi3 floxed/floxed females (Edlund et al., 2014;
Foxi3tm1.1Akg/J; The Jackson Laboratory stock 024843) to obtain K14cre43;Foxi3 −/floxed mice (Foxi3 cKO). For analyzing the adult tooth
phenotype, cleaned skulls were used in micro-CT scan. For collecting
embryonic samples, the day of the vaginal plug was counted as E0.5, and the
embryos were staged further according to limb and molar morphology.
Foxi3 +/floxed and Foxi3 −/floxed animals were used as controls except in
microarray experiments where all controls were Foxi3+/floxed. All mouse
work has been carried out in accordance with the guidelines and approval
from Finnish National Board of Animal Experimentation.
Histology, in situ hybridization, immunohistochemistry and
immunofluorescence
For histology, radioactive in situ hybridization (RISH) and
immunohistochemistry, tissues were fixed overnight in 4%
paraformaldehyde, dehydrated and embedded in paraffin. Sections 5-7 μm
thick were cut in frontal and sagittal planes. Antigen retrieval for
immunohistochemistry and immunofluorescence was performed by
heating the slides in 10 mM sodium citrate buffer ( pH 6.0). Each gene or
protein was analyzed in two or three individuals.
RISH was carried out according to a standard protocol. The following
[35S]-UTP (Perkin Elmer)-labeled RNA probes were used to detect gene
expression: Bmp7 (Åberg et al., 1997), Dkk4 (Fliniaux et al., 2008), Dusp6
(James et al., 2006), Fgf4 (Jernvall et al., 1994), Fgf15 (Kettunen et al.,
2011), Foxi3 (Ohyama and Groves, 2004), Id1 (Rice et al., 2000), Lef1
(Travis et al., 1991), Msx2 (Jowett et al., 1993), p21 (Jernvall et al.,
1998), Sfrp5 (Witte et al., 2009), Shh (Vaahtokari et al., 1996a),
Sostdc1 (Laurikkala et al., 2003), Sprouty2 (Zhang et al., 2001) and
Wnt10a (Dassule and McMahon, 1998). Rat ameloblastin probe was a kind
gift from Jan C. Hu (University of Texas School of Dentistry, TX, USA).
A 645 bp fragment of the mouse Sema3e gene was amplified using the
following primers: forward, ACATTGGATCAGCCTCTGCT; and reverse,
AGCCAATCAGCTGCAAGAAT. The PCR fragment was cloned into
pCRII-pTOPO vector (Invitrogen by LifeTechnologies) and sequenced to
confirm fragment identity.
To detect proliferating cells, BrdU (Amersham) was injected to pregnant
females at 10 µl/g, and embryos were collected after 2 h. BrdU was detected
with anti-BrdU antibody at 1:1000 (mouse; Thermo Fisher Scientific), the
M.O.M. immunodetection kit (Vector Laboratories) and DAB staining
(DAB Peroxidase Substrate Kit; Vector Laboratories).
For immunofluorescence, primary antibodies were used at the following
dilutions: Foxi3 1:150 (goat; Santa Cruz Biotechnology), E-cadherin
1:1000 (mouse; BD Biosciences), P-cadherin 1:100 (goat; R&D Systems),
3961
DEVELOPMENT
2011; Porntaveetus et al., 2011). Fgf15−/− mice have no phenotype
(Porntaveetus et al., 2011), but it might act redundantly with other
Fgfs. Interestingly, it has been shown that Foxi3 binds to a specific
oxidized form of methylated cytosines on the Fgf15 promoter, and
this binding is linked to repression of transcription (Iurlaro et al.,
2013). This suggests that Foxi3 could normally repress genes such
as Fgf15, and perhaps also other microarray hits, such as Sema3e
and the Wnt inhibitor Sfrp5, which were also among the most highly
upregulated genes. The winged helix domains of Fox factors have
structural similarity to linker histones, and some of them have been
shown to bind and modulate chromatin in order to induce changes in
gene expression (Benayoun et al., 2011). If epigenetic regulation is
the main function of Foxi3 in dental epithelium, it is possible that a
large amount of microarray targets exhibit this type of regulation.
This might also explain why we did not see many genes being
strongly up- or downregulated.
Development (2015) 142, 3954-3963 doi:10.1242/dev.124172
RESEARCH ARTICLE
Hanging drop experiments
Foxi3 induction was studied by treating E13.5 wild-type NMRI molars for 4 h
in hanging drop culture with control media (Dulbecco’s minimal essential
medium supplemented with 10% fetal calf serum, glutamine and penicillinstreptomycin) or media containing the signaling molecule of interest at the
following concentrations: Activin A 0.5 µg/ml (Harrington et al., 2006), Shh
5 µg/ml (R&D Systems), Bmp4 0.1 µg/ml (R&D Systems) and Fgf8 1 µg/ml
(R&D Systems). A known signaling pathway target gene was used as a
positive control. Left molars or right molars of two to three embryos were
pooled together for control and growth factor-treated samples, respectively.
RNA extraction and quantitative reverse transcriptasepolymerase chain reaction (qRT-PCR)
RNA from the hanging drop experiment samples or from the molar epithelia
collected for the microarray validation was extracted using the RNeasy mini
kit (Qiagen) and reverse transcribed using 500 ng of random hexamers
(Promega) and Superscript II (Invitrogen by Life Technologies) following
the manufacturers’ instructions.
qRT-PCR was performed using Lightcycler DNA Master SYBR Green I
(Roche Applied Science) with the Lightcycler 480 (Roche Applied
Science). Gene expression was quantified by comparing the sample data
against a dilution series of PCR products of each gene of interest. Data were
analyzed with the manufacturer’s software and normalized against Ranbp.
Data are shown as the mean±s.d. Wilcoxon signed-rank test was used for
the paired hanging drop experiment samples and the Mann–Whitney U-test
for the non-paired microarray validation samples for testing statistical
significance, and a P-value of 0.05 was used as the significance threshold.
Primers are listed in Table S1.
Microarray experiments and data analysis
For identification of Foxi3 target genes, E13.5 molar epithelium was
dissected from Foxi3 cKO and Foxi3+/floxed littermate embryos from six
litters. Briefly, molar tooth germs were dissected under a microscope in
Dulbecco’s PBS and transferred to 1:25 Dispase II in 10 mM NaAc pH 7.5
(stock 5 U/ml; Sigma-Aldrich) and incubated at 4°C for 3-4 h. The
separated epithelia of the two molars of each embryo were collected together
and frozen in dry ice before storage at −80°C.
Molar epithelia from five embryos were pooled together, and the
microarray consisted of four biological replicates of control and Foxi3 cKO
samples. RNA extraction is described above. RNA quality was monitored
using a 2100 Bioanalyzer (Agilent Technologies). RNA processing and
hybridization on Affymetrix Mouse Exon 1.0 ST arrays (Affymetrix) and
data analysis were carried out at the Biomedicum Functional Genomics Unit
(University of Helsinki, Finland). The data were processed using R/
Bioconductor and normalized with the RMA algorithm and CustomCDFdatabase probe annotations. Differentially expressed genes were searched
using the Cyber-T algorithm. P-values were corrected using the Q-value
method. Microarray data are available in Gene Expression Omnibus
(accession number GSE65725).
Acknowledgements
We thank Jukka Jernvall for discussions and comments on the manuscript and Raija
Savolainen, Merja Mä kinen and Riikka Santalahti for technical assistance.
3962
Competing interests
The authors declare no competing or financial interests.
Author contributions
M.J., M.L.M. and I.T. designed the study. M.J., M.S.N., A.A., V.S., A.B. and A.K.
performed the experiments. M.J. and I.T. analyzed the data. A.G. and T.O.
generated the Foxi3 mutant mice. M.J., M.L.M. and I.T. prepared the manuscript.
All authors commented on the manuscript.
Funding
This work was financially supported by the Academy of Finland; the Swiss National
Science Foundation Sinergia [CRSI33_125459]; the Sigrid Juselius Foundation; the
Jane and Aatos Erkko Foundation and the Finnish Cultural Foundation.
Supplementary information
Supplementary information available online at
http://dev.biologists.org/lookup/suppl/doi:10.1242/dev.124172/-/DC1
References
Åberg, T., Wozney, J. and Thesleff, I. (1997). Expression patterns of bone
morphogenetic proteins (Bmps) in the developing mouse tooth suggest roles in
morphogenesis and cell differentiation. Dev. Dyn. 210, 383-396.
Ahtiainen, L., Lefebvre, S., Lindfors, P. H., Renvoisé , E., Shirokova, V.,
Vartiainen, M. K., Thesleff, I. and Mikkola, M. L. (2014). Directional cell
migration, but not proliferation, drives hair placode morphogenesis. Dev. Cell. 28,
588-602.
Andl, T., Ahn, K., Kairo, A., Chu, E. Y., Wine-Lee, L., Reddy, S. T., Croft, N. J.,
Cebra-Thomas, J. A., Metzger, D., Chambon, P. et al. (2004). Epithelial Bmpr1a
regulates differentiation and proliferation in postnatal hair follicles and is essential
for tooth development. Development. 131, 2257-2268.
Bei, M. (2009). Molecular genetics of tooth development. Curr. Opin. Genet. Dev.
19, 504-510.
Benayoun, B. A., Caburet, S. and Veitia, R. A. (2011). Forkhead transcription
factors: key players in health and disease. Trends Genet. 27, 224-232.
Dassule, H. R. and McMahon, A. P. (1998). Analysis of epithelial–mesenchymal
interactions in the initial morphogenesis of the mammalian tooth. Dev. Biol. 202,
215-227.
Dassule, H. R., Lewis, P., Bei, M., Maas, R. and McMahon, A. P. (2000). Sonic
hedgehog regulates growth and morphogenesis of the tooth. Development 127,
4775-4785.
Drö gemü ller, C., Karlsson, E. K., Hytö nen, M. K., Perloski, M., Dolf, G., Sainio,
K., Lohi, H., Lindblad-Toh, K. and Leeb, T. (2008). A mutation in hairless dogs
implicates FOXI3 in ectodermal development. Science 321, 1462.
Edlund, R. K., Ohyama, T., Katarchi, H., Riley, B. B. and Groves, A. K. (2014).
Foxi transcription factors promote pharyngeal arch development by regulating
formation of FGF signaling centers. Dev. Biol. 390, 1-13.
Fausser, J.-L., Schlepp, O., Aberdam, D., Meneguzzi, G., Ruch, J. V. and Lesot,
H. (1998). Localization of antigens associated with adherens junctions,
desmosomes, and hemidesmosomes during murine molar morphogenesis.
Differentiation 63, 1-11.
Fliniaux, I., Mikkola, M. L., Lefebvre, S. and Thesleff, I. (2008). Identification of
dkk4 as a target of Eda-A1/Edar pathway reveals an unexpected role of
ectodysplasin as inhibitor of Wnt signalling in ectodermal placodes. Dev. Biol.
320, 60-71.
Gritli-Linde, A., Bei, M., Maas, R., Zhang, X. M., Linde, A. and McMahon, A. P.
(2002). Shh signaling within the dental epithelium is necessary for cell
proliferation, growth and polarization. Development 129, 5323-5337.
Harjunmaa, E., Kallonen, A., Voutilainen, M., Hä mä lä inen, K., Mikkola, M. L. and
Jernvall, J. (2012). On the difficulty of increasing dental complexity. Nature 483,
324-327.
Harrington, A. E., Morris-Triggs, S. A., Ruotolo, B. T., Robinson, C. V., Ohnuma,
S.-i. and Hyvö nen, M. (2006). Structural basis for the inhibition of activin
signalling by follistatin. EMBO J. 25, 1035-1045.
Houweling, A. C., Dildrop, R., Peters, T., Mummenhoff, J., Moorman, A. F. M.,
Rü ther, U. and Christoffels, V. M. (2001). Gene and cluster-specific expression
of the iroquois family members during mouse development. Mech. Dev. 107,
169-174.
Iurlaro, M., Ficz, G., Oxley, D., Raiber, E.-A., Bachman, M., Booth, M. J.,
Andrews, S., Balasubramanian, S. and Reik, W. (2013). A screen for
hydroxymethylcytosine and formylcytosine binding proteins suggests functions
in transcription and chromatin regulation. Genome Biol. 14, R119.
James, M. J., Jä rvinen, E., Wang, X.-P. and Thesleff, I. (2006). Different roles of
Runx2 during early neural crest-derived bone and tooth development. J. Bone
Miner. Res. 21, 1034-1044.
Jernvall, J., Kettunen, P., Karavanova, I., Martin, L. B. and Thesleff, I. (1994).
Evidence for the role of the enamel knot as a control centre in mammalian tooth
cusp formation: non-dividing cells express growth stimulating Fgf4 gene.
Int. J. Dev. Biol. 38, 463-469.
DEVELOPMENT
Lef1 1:1000 (rabbit; Cell Signaling Technology) and keratin 10 1:200
(rabbit; Abcam). Secondary antibodies, Alexa488 donkey anti-goat,
Alexa568 goat anti-mouse and Alexa568 donkey anti-rabbit (Invitrogen
by Life Technologies), were used at a dilution of 1:800.
All samples were imaged with a Zeiss Axio Imager M2 microscope
equipped with an Axio Cam HR camera (Zeiss) and processed in
Photoshop. Frontal images are oriented so that the lingual side is on the left.
Quantification of the epithelial areas was done on E-cadherin- and Pcadherin-stained sections, and ten sections at the widest part of the molar
were chosen from three control and three Foxi3 cKO individuals. The whole
area of the epithelium, in addition to the basal (strong P-cadherin) and
suprabasal areas (strong E-cadherin), was outlined manually using the
Zen2011 program (Zeiss). Student’s t-test was used for testing statistical
significance, and a P-value of 0.05 was used as the significance threshold.
Development (2015) 142, 3954-3963 doi:10.1242/dev.124172
Jernvall, J., Åberg, T., Kettunen, P., Kerä nen, S. and Thesleff, I. (1998). The life
history of an embryonic signalling center. BMP4 induces p21 and is associated
with apoptosis in the mouse tooth enamel knot. Development 125, 161-169.
Jowett, A. K., Vainio, S., Ferguson, M. W., Sharpe, P. T. and Thesleff, I. (1993).
Epithelial-mesenchymal interactions are required for msx 1 and msx 2 gene
expression in the developing murine molar tooth. Development 117, 461-470.
Jussila, M. and Thesleff, I. (2012). Signaling networks regulating tooth
organogenesis and regeneration, and the specification of dental mesenchymal
and epithelial cell lineages. Cold Spring Harb. Perspect. Biol. 4, a008425.
Juuri, E., Jussila, M., Seidel, K., Holmes, S., Wu, P., Richman, J., Heikinheimo,
K., Chuong, C.-M., Arnold, K., Hochedlinger, K. et al. (2013). Sox2 marks
epithelial competence to generate teeth in mammals and reptiles. Development
140, 1424-1432.
Kassai, Y., Munne, P., Hotta, Y., Penttilä , E., Kavanagh, K., Ohbayashi, N.,
Takada, S., Thesleff, I., Jernvall, J. and Itoh, N. (2005). Regulation of
mammalian tooth cusp patterning by ectodin. Science 309, 2067-2070.
Kerä nen, S. V. E., Åberg, T., Kettunen, P., Jernvall, J. and Thesleff, I. (1998).
Association of developmental regulatory genes with the development of different
molar tooth shapes in two species of rodents. Dev. Genes Evol. 208, 477-486.
Kettunen, P., Furmanek, T., Chaulagain, R., Hals Kvinnsland, I. and Luukko, K.
(2011). Developmentally regulated expression of intracellular Fgf11-13, hormonelike Fgf15 and canonical Fgf16, -17 and -20 mRNAs in the developing mouse
molar tooth. Acta Odontol. Scand. 69, 360-366.
Lam, E. W.-F., Brosens, J. J., Gomes, A. R. and Koo, C.-Y. (2013). Forkhead box
proteins: tuning forks for transcriptional harmony. Nat. Rev. Cancer 13, 482-495.
Laurikkala, J., Mikkola, M., Mustonen, T., Åberg, T., Koppinen, P., Pispa, J.,
Nieminen, P., Galceran, J., Grosschedl, R. and Thesleff, I. (2001). TNF
signaling via the ligand–receptor pair ectodysplasin and edar controls the function
of epithelial signaling centers and is regulated by Wnt and activin during tooth
organogenesis. Dev. Biol. 229, 443-455.
Laurikkala, J., Kassai, Y., Pakkasjä rvi, L., Thesleff, I. and Itoh, N. (2003).
Identification of a secreted BMP antagonist, ectodin, integrating BMP, FGF, and
SHH signals from the tooth enamel knot. Dev. Biol. 264, 91-105.
Lechler, T. and Fuchs, E. (2005). Asymmetric cell divisions promote stratification
and differentiation of mammalian skin. Nature 437, 275-280.
Li, J., Feng, J., Liu, Y., Ho, T.-V., Grimes, W., Ho, H. A., Park, S., Wang, S. and
Chai, Y. (2015). BMP-SHH signaling network controls epithelial stem cell fate via
regulation of its niche in the developing tooth. Dev. Cell. 33, 125-135.
Mitsiadis, T. A., Lardelli, M., Lendahl, U. and Thesleff, I. (1995). Expression of
Notch 1, 2 and 3 is regulated by epithelial-mesenchymal interactions and retinoic
acid in the developing mouse tooth and associated with determination of
ameloblast cell fate. J. Cell Biol. 130, 407-418.
Mitsiadis, T. A., Graf, D., Luder, H., Gridley, T. and Bluteau, G. (2010). BMPs and
FGFs target Notch signalling via Jagged 2 to regulate tooth morphogenesis and
cytodifferentiation. Development 137, 3025-3035.
Nakatomi, M., Hovorakova, M., Gritli-Linde, A., Blair, H. J., MacArthur, K.,
Peterka, M., Lesot, H., Peterkova, R., Ruiz-Perez, V. L., Goodship, J. A. et al.
Development (2015) 142, 3954-3963 doi:10.1242/dev.124172
(2013). Evc regulates a symmetrical response to Shh signaling in molar
development. J. Dent. Res. 92, 222-228.
Nieminen, P., Pekkanen, M., Åberg, T. and Thesleff, I. (1998). A graphical WWWdatabase on gene expression in tooth. Eur. J. Oral Sci. 106, 7-11.
Ohazama, A. and Sharpe, P. T. (2007). Expression of claudins in murine tooth
development. Dev. Dyn. 236, 290-294.
Ohyama, T. and Groves, A. K. (2004). Expression of mouse Foxi class genes in
early craniofacial development. Dev. Dyn. 231, 640-646.
Palacios, J., Benito, N., Berraquero, R., Pizarro, A., Cano, A. and Gamallo, C.
(1995). Differential spatiotemporal expression of E- and P-cadherin during mouse
tooth development. Int. J. Dev. Biol. 39, 663-666.
Porntaveetus, T., Otsuka-Tanaka, Y., Basson, M. A., Moon, A. M., Sharpe, P. T.
and Ohazama, A. (2011). Expression of fibroblast growth factors (Fgfs) in murine
tooth development. J. Anat. 218, 534-543.
Rice, D. P., Åberg, T., Chan, Y., Tang, Z., Kettunen, P. J., Pakarinen, L., Maxson,
R. E. and Thesleff, I. (2000). Integration of FGF and TWIST in calvarial bone and
suture development. Development 127, 1845-1855.
Salazar-Ciudad, I. and Jernvall, J. (2002). A gene network model accounting for
development and evolution of mammalian teeth. Proc. Natl. Acad. Sci. USA 99,
8116-8120.
Salazar-Ciudad, I. and Jernvall, J. (2010). A computational model of teeth and the
developmental origins of morphological variation. Nature 464, 583-586.
Shirokova, V., Jussila, M., Hytö nen, M. K., Perä lä , N., Drö gemü ller, C., Leeb, T.,
Lohi, H., Sainio, K., Thesleff, I. and Mikkola, M. L. (2013). Expression of Foxi3 is
regulated by ectodysplasin in skin appendage placodes. Dev. Dyn. 242, 593-603.
Travis, A., Amsterdam, A., Belanger, C. and Grosschedl, R. (1991). LEF-1, a
gene encoding a lymphoid-specific protein with an HMG domain, regulates T-cell
receptor α enhancer function [corrected]. Genes Dev. 5, 880-894.
Vaahtokari, A., Åberg, T., Jernvall, J., Kerä nen, S. and Thesleff, I. (1996). The
enamel knot as a signaling center in the developing mouse tooth. Mech. Dev. 54,
39-43.
Wallace, L., Roberts-Thompson, L. and Reichelt, J. (2012). Deletion of K1/K10
does not impair epidermal stratification but affects desmosomal structure and
nuclear integrity. J. Cell Sci. 125, 1750-1758.
Wang, X.-P., Suomalainen, M., Jorgez, C. J., Matzuk, M. M., Werner, S. and
Thesleff, I. (2004). Follistatin regulates enamel patterning in mouse incisors by
asymmetrically inhibiting BMP signaling and ameloblast differentiation. Dev. Cell
7, 719-730.
Wilson, G. P., Evans, A. R., Corfe, I. J., Smits, P. D., Fortelius, M. and Jernvall, J.
(2012). Adaptive radiation of multituberculate mammals before the extinction of
dinosaurs. Nature 483, 457-460.
Witte, F., Dokas, J., Neuendorf, F., Mundlos, S. and Stricker, S. (2009).
Comprehensive expression analysis of all Wnt genes and their major secreted
antagonists during mouse limb development and cartilage differentiation. Gene
Expr. Patterns 9, 215-223.
Zhang, S., Lin, Y., Itä ranta, P., Yagi, A. and Vainio, S. (2001). Expression of
Sprouty genes 1, 2 and 4 during mouse organogenesis. Mech. Dev. 109, 367-370.
DEVELOPMENT
RESEARCH ARTICLE
3963