© 2014. Published by The Company of Biologists Ltd | Development (2014) 141, 4087-4097 doi:10.1242/dev.107326
RESEARCH ARTICLE
STEM CELLS AND REGENERATION
Hmga2 regulates self-renewal of retinal progenitors
ABSTRACT
In vertebrate retina, histogenesis occurs over an extended period. To
sustain the temporal generation of diverse cell types, retinal progenitor
cells (RPCs) must self-renew. However, self-renewal and regulation of
RPCs remain poorly understood. Here, we demonstrate that cellextrinsic factors coordinate with the epigenetic regulator high-mobility
group AT-hook 2 (Hmga2) to regulate self-renewal of late retinal
progenitor cells (RPCs). We observed that a small subset of RPCs was
capable of clonal propagation and retained multipotentiality of parents
in the presence of endothelial cells (ECs), known self-renewal
regulators in various stem cell niches. The self-renewing effects, also
observed in vivo, involve multiple intercellular signaling pathways,
engaging Hmga2. As progenitors exhaust during retinal development,
expression of Hmga2 progressively decreases. Analyses of Hmga2expression perturbation, in vitro and in vivo, revealed that Hmga2
functionally helps to mediate cell-extrinsic influences on late-retinal
progenitor self-renewal. Our results provide a framework for integrating
the diverse intercellular influences elicited by epigenetic regulators for
self-renewal in a dynamic stem cell niche: the developing vertebrate
retina.
KEY WORDS: Hmga2, Self-renewal, Retina, Progenitors, Epigenetic,
Stem cells, Rat
INTRODUCTION
The vertebrate retina is a simple and accessible central nervous
system (CNS) model, facilitating our understanding of how the
brain develops and functions. It consists of seven different cell types
generated by an evolutionarily conserved, temporal sequence from
single multipotential progenitors (Robinson, 1991; Livesey and
Cepko, 2001). For example, barring certain overlaps, in most
species the retinal ganglion cells (RGCs), cone photoreceptor (CPs),
horizontal cells (HCs) and the majority of amacrine cells (ACs) are
born during the early stage of histogenesis, whereas the rod
photoreceptors (RPs), bipolar cells (BCs) and Müller glia (MG) are
generated during the late stage of histogenesis (Rapaport et al.,
2004). A variety of approaches in different species have revealed the
identity of cell-intrinsic (Cepko, 1999; Hatakeyama et al., 2001;
Agathocleous and Harris, 2009) and cell-extrinsic (Cepko, 1999;
Yang, 2004; Agathocleous and Harris, 2009) factors in the
generation of specific retinal cell types. A general theme has
emerged that contextual interactions between these factors regulate
when, and along which sublineage RPCs would differentiate.
In humans, retinal cells are born over 28 weeks of gestation; in
rats, the animal studied here, retinal histogenesis takes half of the
gestation period plus two postnatal weeks to complete (Robinson,
Department of Ophthalmology and Visual Sciences, University of Nebraska
Medical Center, Omaha, NE 68198, USA.
*Author for correspondence ([email protected])
Received 18 December 2013; Accepted 28 August 2014
1991). Such a prolonged period of histogenesis likely requires the
progenitors to self-renew in order to sustain stage-specific
generation of different cell types. Although the multipotential
nature of the RPCs has been extensively examined (Livesey and
Cepko, 2001), little is known about their self-renewal property.
In vitro studies examining the differentiation potential of RPCs
from late-stage rat retinal histogenesis using time-lapse microscopy,
and retrospective morphological and immunocytochemical
identification demonstrated asymmetrical divisions that generated
differentiated and undifferentiated cells (Cayouette and Raff, 2003;
Gomes et al., 2011). Since asymmetrical division is how stem cells
maintain their population, this could be evidence of the self-renewal
ability of RPCs. However, stem cells that have advanced along the
differentiation path and transitioned into progenitors/precursors
may also divide asymmetrically, thereby blurring the boundary
between them and stem cells if features such as stem cell-specific
markers and propagation of clones over generations are not
considered. When late RPCs are examined on these criteria in a
neurosphere assay, which is used to test neural stem cell (NSC) selfrenewal elsewhere in the CNS (Weiss et al., 1996; Temple, 2001),
they fail to generate colonies at lower density, precluding tests to
determine their ability to generate successive colonies and if they
retain the multipotentiality of their parents (Ahmad et al., 2004). A
conservative interpretation is that the self-renewal property of RPCs
is not entirely intrinsic, and standard mitogens such as epidermal
growth factors (EGF) and fibroblast growth factors 2 (FGF2) used in
the assay are inadequate in exposing this property in vitro. This
interpretation confers an important role on the environment in
regulating the RPC self-renewal property.
Here, we test the hypothesis that the self-renewal property of
RPCs is non-cell autonomous, requiring contributions from other
cells in the histogenic environment. Without the identity of
contributing cells in the developing retina, this premise was
examined in the presence of the endothelial cells (ECs), which are
known to support stem cells in neural (Palmer et al., 2000; Shen
et al., 2004, 2008; Imura et al., 2008) and extra-neural (Yin and Li,
2006; Butler et al., 2010) niches. As evidence suggests different
stem cells use conserved mechanisms for their maintenance
(Morrison and Spradling, 2008; Shenghui et al., 2009), we argued
that ECs may sustain RPC self-renewal in vitro, thus revealing
the regulatory mechanism(s) underlying their maintenance. We
observed that, in the presence of ECs, RPCs generated successive
neurospheres at low density and retained parental multipotentiality,
thus fulfilling the self-renewal criterion. ECs similarly influenced
RPCs in vivo, demonstrated by higher indices of cell proliferation,
neurosphere generation and a side population (SP)-cell phenotype
upon intravitreal injection of EC-conditioned medium (ECCM).
Furthermore, we demonstrate that Hmga2 (Noro et al., 2003), which
is expressed in the developing retina, intrinsically mediated the
environmental influence on RPC self-renewal. Thus, our results
offer a framework to integrate diverse intercellular influences by
epigenetic regulators in the dynamic stem cell niche of the
developing retina. Additionally, these results may help formulate
4087
DEVELOPMENT
Sowmya Parameswaran, Xiaohuan Xia, Ganapati Hegde and Iqbal Ahmad*
approaches to overcome inefficient expansion of RPCs in vitro, a
significant barrier to cell therapy.
RESULTS
EC-mediated regulation of RPCs in vitro
Although embryonic RPCs reside in an avascular developing retina,
we asked whether their self-renewing property could be revealed
through their interactions with ECs (Shen et al., 2004). We cultured
embryonic day 18 (E18) retinal cells, representing the beginning
of late-stage histogenesis, at different densities in the presence of
ECCM or EGF (control) for 5 days and examined the generation
of neurospheres. In low-density culture (≤3×104 cells/cm2)
neurospheres were detected only in the presence of ECCM
(Fig. 1A-C). Subsequent cell culture at higher densities caused
neurosphere generation in both conditions; however, neurospheres
generated with ECCM were significantly higher in number and size
compared with those without ECCM (Fig. 1A-C). The terminal
deoxynucleotidyl transferase dUTP nick-end labeling (TUNEL)
Development (2014) 141, 4087-4097 doi:10.1242/dev.107326
assay revealed no significant difference in cell survival between the
two cultures conditions, thus eliminating selective ECCM-mediated
survival as the cause (Fig. 1D-F). We then asked if the difference in
the numbers and size of neurospheres were reflected in cell
proliferation and progenitor properties. First, RPCs were cultured
with the nucleotide analogue 5-bromo-2-deoxy uridine (BrdU) at a
plating density (1.0×105 cells/cm2) that allowed the generation
neurospheres in the control groups for comparison. Results showed a
significant increase in the BrdU+ cell number when cultured in
ECCM (40.4±0.1) versus controls (25.2+0.2; P<0.05) (Fig. 1G).
Second, examining the expression of select cell-cycle regulators
revealed increased Ki67 (Mki67), Pcna and cyclin D1 (Ccnd1)
transcript levels in ECCM neurospheres versus controls (Fig. 1H-J).
Last, a concomitant increase occurred in the number of BrdU+ cells
expressing three different retinal progenitor markers (Pax6, Rx and
Chx10) in ECCM neurospheres versus controls (Fig. 1K-Q).
Together, these observations suggested that ECCM contained
activities that supported the amplification of RPCs. Whether or not
Fig. 1. ECCM facilitates low cell density neurosphere generation. (A,B) ECCM facilitated neurosphere generation from E18 cells at a cell density (3.0×104
cells/cm2) at which control (EGF) could not. (C) At higher cell densities (>3.0×104 cells/well) neurospheres were generated in controls in significantly lower
numbers versus ECCM (n=5). (D-F) TUNEL staining revealed no significant difference in cell survival between the two conditions (n=3). (G) A higher percentage
of BrdU+ cells was observed in the ECCM groups versus controls (n=5). (H-J) An increase in Ki67, Pcna and Ccnd1 transcript levels was observed in the ECCM
groups versus controls (n=3). (K-Q) Higher proportions of BrdU+ cells were observed in neurospheres expressing retinal (Pax6, Rx, Chx10) progenitor markers in
the ECCM (N-Q) groups versus controls (n=5) (K-M,Q). Scale bars: 100 μm in A,B; 40 μm in D,E,K-P. Data are mean±s.e.m.
4088
DEVELOPMENT
RESEARCH ARTICLE
the proliferating RPCs could self-renew was examined using three
different approaches. First, we subjected RPCs to ex vivo assessment
of the self-renewal of neural stem cells (Ferron et al., 2007). Cell
dissociated from E18 retina were cultured in the presence and absence
of ECCM at densities of 5, 10 and 20 cells/μl. Primary neurospheres
were obtained at 20 cells/μl, and only with ECCM. Generation of
secondary and tertiary neurospheres was obtained at 5 cells/μl with
ECCM, and demonstrated a progressive increase in their numbers
(Fig. 2A). Second, cells in both primary and secondary neurospheres
were subjected to identical differentiation conditions, where they
differentiated into generic neurons and glia in a similar proportion.
This suggested the retention of parental multipotentiality over
successive generations (Fig. 2B). To determine whether EC
exposure altered the ability of RPCs to generate late-born retinal
neurons, control and ECCM-generated neurospheres were cultured
with postnatal day1 (PN1) retinal cell conditioned medium to
promote differentiation along late retinal sublineages (Parameswaran
et al., 2010). No significant difference in rod photoreceptor (e.g.
rhodopsin)- and bipolar cell (e.g. mGluR6)-specific transcripts levels
was observed, suggesting the intrinsic differentiation property of
progenitors remained unchanged (Fig. 2C,D). Third, to determine the
frequency of self-renewing RPCs and cellular interactions needed for
their maintenance during late histogenesis, limiting dilution analysis
(LDA) was performed, which revealed a 0.078% frequency of such
cells (Fig. 2E). Amplification in cell numbers is necessary to generate
clonal neurospheres; the increase in successive neurospheres points to
Development (2014) 141, 4087-4097 doi:10.1242/dev.107326
the adoption of symmetrical cell division by self-renewing RPCs. To
test this premise, we examined temporal generation of SP cells, a
functional characteristic of stem cells and also of RPCs (Bhattacharya
et al., 2003), in neurosphere assays. We observed that SP cell numbers
increased ∼7-fold at day 5 and ∼3-fold at day 8, compared with day 2
and day 5, respectively (Fig. 2F-H), a temporal increase in number
likely sustained by symmetrical cell division. Together, these
observations suggested that ECCM activities allowed for the
successive generation of RPCs at low density through symmetrical
cell division, while retaining parental properties of multi-lineage
differentiation, i.e. self-renewal.
EC-mediated RPC regulation in vivo
Next, to determine whether the influence of ECs on self-renewal
was not simply a function of the neurosphere assay, the effects
of ECCM were examined on RPCs in vivo. Concentrated ECCM
was injected intravitreally into the eyes of PN1 pups. RPCs were
examined for proliferation and progenitor properties two days later,
at PN3 (Fig. 3A). The following two controls were used: (1) vehicle
controls in which pups were injected retinal culture medium (RCM);
and (2) activities controls in which ECCM pre-incubated with
antibodies against FGF2, stem cell factor (SCF) and pigment
epithelium-derived factor (PEDF) to neutralize the specific
signaling pathways (i.e. nECCM). The rationale for neutralizing
these pathways was based on microarray analysis (see below) and
availability of neutralizing antibodies. Prospective enrichment of
Fig. 2. ECCM-generated neurospheres possess
the ability to self-renew. (A) E18 cells generated
primary, secondary and tertiary neurospheres, with
a successive increase in their number with ECCM;
neurospheres were not generated with EGF (n=5).
(B) BrdU+ RPCs in both primary and secondary
neurospheres generated β-tubulin+ neurons and
GFAP+ glia in a similar proportion with FBS (n=3).
(C,D) Q-PCR showed ECCM-exposed
neurospheres generated rods (opsin mRNA) and
bipolar cells (mGluR6 mRNA) in similar frequency
to controls with PN1CM (n=3). (E) LDA analysis of
the primary neurospheres in ECCM revealed a
single limiting cell type, 1 in 1290 cells, generating
secondary neurospheres (n=8). Data are
mean±s.e.m. (F-H) Hoechst dye efflux assay on
ECCM-exposed neurospheres showed a steady
increase in SP cell numbers.
DEVELOPMENT
RESEARCH ARTICLE
4089
RESEARCH ARTICLE
Development (2014) 141, 4087-4097 doi:10.1242/dev.107326
RPCs as SP cells from the injected retina demonstrated an ∼9-fold
increase in the proportion of retinal SP cells in ECCM-injected eyes,
compared with RCM controls (0.006% versus 0.052%) (Fig. 3B,C).
The positive effect of ECCM on retinal SP cells was abrogated in
eyes injected with nECCM (0.052% versus 0.008%) (Fig. 3C,D).
Similarly, the number of proliferating cells (BrdU+ cells), which
showed a significant increase in ECCM-injected eyes compared
with RCM controls (25.7±0.05 versus 20.7±0.15, P<0.05),
decreased significantly in the nECCM-injected eyes (21.2±0.05
versus 25.7±0.05, P<0.05) (Fig. 3E). Next, we determined whether
the influence of ECCM on RPCs in vivo was sufficient to allow
them to generate neurospheres with EGF, a non-conducive
condition for generating neurospheres at low density. To account
for the expected exhaustion of RPCs at this late stage of
histogenesis, the plating density of PN3 cell dissociates was
increased. We observed an ∼3-fold increase in the number of
neurospheres in ECCM-exposed cell dissociates versus RCM
controls (96.0±10.6 versus 34.2±15.6, P<0.05). The effect of
ECCM on neurosphere generation was abrogated when ECCM was
neutralized prior to injection (44.7±7.9 versus 96.0±10.6, P<0.05)
(Fig. 3F). Together, these results suggested that ECCM activities
had regulatory effects on RPCs in vitro and in vivo.
Identification of Hmga2 in EC-mediated RPCs regulation
To understand the mechanism underlying EC-mediated regulation of
RPCs, we performed hypothesis-driven transcriptional profiling of
ECCM and control neurospheres. Our hypothesis was, given the cellextrinsic influence, that the mechanism for self-renewal involves the
expression of genes encoding intercellular signaling components and
universal regulators of genes for nuclear integration of cell-cell
signaling. Under this premise, a general increase and decrease in
facilitators of the cell cycle and differentiation, respectively, would
4090
determine outcomes of regulation under the influence of ECs.
Microarray analysis revealed that the exposure of the neurospheres to
ECCM suppressed genes that encode regulators (e.g. Crx, Nrl and
Neurod1) and markers [rhodopsin, recoverin, mGluR6 (Grm6) and
Rlbp1] of different retinal cell types. By contrast, ECCM exposure
resulted in upregulation of genes that regulate the cell cycle (e.g.
Ccnd1 and ccna1), cell commitment (e.g. Id1, Id2, Id4, Hes1 and
Lef1) and epigenetic changes for the self-renewal (e.g. Hmga2 and
Smarca4). From the perspective of the cell-cell signaling, a
noteworthy increase occurred in the expression of receptors for
Notch (Notch1), FGF (Fgfr1), VEGF (Vegfr2), Wnt (Fzd5), SCF
(Kit), BMP (Bmpr2) and activin (Acvr1) pathways with ECCM
(Fig. 4A). The differential expression patterns of genes, confirmed by
Q-PCR analysis for select genes (supplementary material Fig. S1),
suggested that ECCM activities regulated RPCs by recruiting
disparate signaling pathways whose targets could be Hmga2 and
Smarca4. Here, given its role in regulating tissue-specific stem cells,
we examined the involvement of Hmga2 (Nishino et al., 2008; Copley
et al., 2013). Hypothesis testing involved: (1) the examination of
intercellular pathways, which necessitates that ECs express the
corresponding ligands for the identified receptors in RPCs (Wang
et al., 2007); and (2) determining whether the recruitment of the
signaling pathway(s) engaged Hmga2 expression. Examination of
transcripts by reverse transcriptase polymerase chain reaction (RTPCR) revealed expression of genes Kit, Fgfr1, Lrp6, Vegfr1, Vegfr2,
Bmpr1, Bmpr2, Actr2a, Actr2b and Notch1, and Frizzled genes in
E18 RPCs, and transcripts corresponding to their ligands (Scf, Fgf2,
Wnt2b, Vegfa, Bmp4, activin and follistatin) in ECs (Fig. 4B,
supplementary material Fig. S2). PEDF was included in the analysis
given its own expression and that of its receptor (PEDFR), in the ECs
and RPCs, respectively (Fig. 4B), and the known influence of PEDF
on proliferation of cortical progenitors (Ramirez-Castillejo et al.,
DEVELOPMENT
Fig. 3. ECCM promotes RPC self-renewal
in vivo. (A) Schematic of experiment.
(B-D) Hoechst dye efflux assay on freshly
dissociated PN3 retinal cells revealed (compared
with RCM controls) an increase SP cell numbers in
the ECCM-injected group, which was abrogated in
nECCM-injected retinal cells. (E) The increase in
the proportion of SP cells was reflected in
increased BrdU+ cell numbers in the ECCMinjected retina versus RCM and nECCM groups
(n=3). (F) Cells from ECCM-injected retina
generated significantly more neurospheres
compared with those from RCM- or nECCMinjected groups (n=3). Data are mean±s.e.m.
RESEARCH ARTICLE
Development (2014) 141, 4087-4097 doi:10.1242/dev.107326
Fig. 4. ECCM-exposed RPCs reveal a relative change in
the transcriptional profile of select genes. (A) Graph
obtained from the microarray data showed the differential
expression of a select group of genes in ECCM-generated
neurospheres versus controls (n=2). (B) RT-PCR analyses
of E18 RPCs and ECs revealed complement receptor-ligand
gene expression profiles of genes identified in the
microarray analysis. Lane M, 100 bp ladder; lane 1, E18
RPCs. EC, endothelial cells. (C) Attenuation of signaling
pathways using specific inhibitors or their cocktail
significantly reduced the number of ECCM-generated
secondary neurospheres (n=3). (D) ECCM-generated
neurospheres revealed robust Hmga2 expression,
abrogated with cocktail inhibitors (n=3). (E) Cell dissociates
from ECCM/RCM/nECCM injected retina revealed a
significant increase in the number of Hmga2+ cells in ECCM
group versus RCM controls (n=3). Data are mean±s.e.m.
the ECCM-mediated activation of signaling pathways regulated stem
cell properties of RPCs in concert with Hmga2 in vitro and in vivo.
Developmental expression patterns and Hmga2 in RPCs
regulation
Hmga2 involvement in the regulation of stem cell properties of RPCs
necessitates the association of Hmga2 expression with the temporal
aspects of retinal histogenesis. Therefore, we first determined
temporal and spatial expression patterns during retinal development.
Hmga2 transcripts were observed at early histogenesis at E14, and
transcript levels declined significantly at the beginning of late
histogenesis (E18) (Fig. 5A). At PN3, Hmga2 transcript levels were
lowest compared with earlier stages and not detectable in adult retina.
Spatial localization of Hmga2 immunoreactivities in E14 and E18
retina revealed their distribution in the outer neuroblastic layers,
predominantly in BrdU+ cells, with a peripheral-to-central gradient
(Fig. 5B,C). The temporal and spatial expression patterns suggested
that Hmga2 was physiologically associated with RPCs and that the
decline in Hmga2 expression corresponded to progressive exhaustion
of RPCs, as differentiation completed. To further establish an
association of Hmga2 with RPC self-renewal, we examined
expression of Hmga2 and its negative regulator Let7 (Lee and
Dutta, 2007) in ECCM-mediated neurosphere assay. First, we
observed a significant increase in Hmga2 transcript and protein
levels (Fig. 5D-G) and decrease in Let7 miRNA levels (Fig. 5H).
Second, levels of Let7 miRNA increased and that of Hmga2
transcripts decreased precipitously when cocktail inhibitors
4091
DEVELOPMENT
2006; Andreu-Agullo et al., 2009) and RPCs (De Marzo et al., 2010).
To test the involvement of the signaling pathways, we studied the
generation of secondary neurospheres in the presence of their
inhibitors. Results showed that attenuating each of the signaling
pathways significantly reduced neurosphere numbers but did not
eliminate their generation, suggesting each pathway was important
and might act in concert to regulate self-renewal (Fig. 4C). To test this
premise, cells were cultured in the combined presence of inhibitors
(cocktail of inhibitors) of these pathways. Neurospheres were
generated, albeit at reduced numbers, confirming the interactions
between these pathways, but also revealing the possible involvement
of other unknown pathway(s). TUNEL staining revealed that the
difference in neurosphere generation was not due to selective survival
under control conditions (supplementary material Fig. S3). That these
pathways engaged Hmga2 was demonstrated as follows. First, we
examined the expression of Hmga2 during neurosphere formation in
the presence of ECCM and ECCM+cocktail inhibitors. Robust
expression levels of Hmga2 transcripts were observed in ECCMgenerated neurospheres, which were abrogated with cocktail
inhibitors (Fig. 4D). Second, we determined levels of Hmga2
expression in vivo following intravitreal injection of ECCM/nECCM
and RCM as described above. We observed ∼3-fold increase in the
proportion of cells expressing Hmga2 immunoreactivities in ECCMtreated retina versus RCM controls (45.8±4.36 versus 17.42±4.40,
P<0.05). No significant change occurred in the proportion of Hmga2+
cells between nECCM- and ECCM-treated retina (32.3±6.20 versus
45.8±4.36, P>0.05) (Fig. 4E). Together, these results suggested that
RESEARCH ARTICLE
Development (2014) 141, 4087-4097 doi:10.1242/dev.107326
compromised neurosphere generation (Fig. 5I,J), suggesting Hmga2
mediated the influence of ECCM on the RPCs. Last, we examined the
expression of Junb and P19 arf, components of the emerging Hmga2
axis for regulating self-renewal of NSCs (Nishino et al., 2008). Junb
and P19arf transcript levels increased significantly with a cocktail of
inhibitors versus controls. This was in accordance with the previous
observations that Hmga2 inhibits Junb expression to negatively
regulate P19arf (Nishino et al., 2008) (Fig. 5K,L). Together, these
observations suggested that the Hmga2 regulatory axis was active in
RPCs in development and associated with ECCM-mediated selfrenewal.
Involvement of Hmga2 in EC-mediated RPC regulation
Next, we perturbed Hmga2 expression in vitro and in vivo to
determine Hmga2 involvement in EC-mediated RPC regulation
(Fig. 6A). First, the gain-of-function experiments (validated in
supplementary material Fig. S6A-D) were carried out in vitro, where
E18 retinal cells were transduced with a dual-promoter lentivirus that
expressed Hmga2+GFP or only GFP (minus Hmga2) as a control
(Nishino et al., 2008) (see Materials and Methods; supplementary
material Table S3), and subjected to neurosphere assay. GFP+ cells,
which co-express Ki67/Pax6, in cell dissociates represented
transduced RPCs (Fig. 6B; supplementary material Fig. S7). In
addition, we observed a significant increase in the numbers of
neurospheres in gain-of-function groups versus controls (Fig. 6C);
the gain-of-function neurospheres also contained significantly more
GFP+ Ki67+ (Fig. 6D)/GFP+ Pax6+ (Fig. 6E) cells than controls,
4092
demonstrating a positive influence of Hmga2 overexpression on
RPC regulation, which was independently corroborated by a
significant increase in BrdU+ (Fig. 6F) and SP (Fig. 6G) cell
numbers in gain-of-function neurospheres versus controls.
Additionally, changes in response to Hmga2 overexpression were
accompanied by a significant decrease in levels of Junb/p19arf
transcripts (supplementary material Fig. S4A-D), suggesting
involvement of the Hmga2-Junb/p19arf axis in RPC regulation.
Next, to corroborate Hmga2-mediated regulation of RPCs in vivo,
Hmga2 (3′UTR del)+GFP/control-GFP lentivirus was injected
intravitreally into PN1 pups. Because the expression of Let7b, the
negative regulator of Hmga2 transcripts, inversely correlates with the
decline of Hmga2 expression postnatally, 3′UTR deleted Hmga2
lentivirus constructs were used to stabilize Hmga2 against Let7b
(Nishino et al., 2008). Retinae were recovered at PN4 and dissociated
to examine RPCs properties. We observed a significant increase in
the numbers of GFP+ Ki67+ (Fig. 6H)/GFP+ Pax6+ (Fig. 6I)/BrdU+
(Fig. 6J) cells in gain-of-function groups versus controls, suggesting
that RPCs were similarly influenced by Hmga2 overexpression in
vivo. In addition, RPCs from gain-of-function retina generated ∼1.5
fold more neurospheres (Fig. 6K), which contained significantly
more SP cells (Fig. 6L) than did controls.
When retina were examined at PN10 for differentiation by
immunofluorescence analysis, no difference was observed in rod
photoreceptor generation (Fig. 6M,N) or other late-born cells, i.e.
the bipolar cells and Müller glia (supplementary material Fig. S4).
To determine whether the lack of effect on differentiation was due to
DEVELOPMENT
Fig. 5. Expression of Hmga2 regulatory axis components
correspond with RPC self-renewing properties.
(A) Hmga2 expression during retinal development revealed a
temporal decline and their absence in the adults (n=3).
(B,C) Hmga2 immunoreactivities were predominantly
colocalized in BrdU+ cells in the outer neuroblastic layer in E14
and E18 retina. (D-F) BrdU+ Hmga2+ cell numbers were
significantly higher in ECCM-exposed neurospheres versus
controls (n=3). (G,H) Correspondingly, there was a significant
increase and decrease in the expression of Hmga2 (G) and its
negative regulator Let7 (H) in ECCM-exposed neurospheres,
with an inverse pattern of their expression in control
neurospheres (n=3). (I-L) With cocktail inhibitors, there was a
significant decrease in the Hmga2 transcript levels (I), with a
concomitant increase in the expression of Let7 miRNA (J), and
Junb (K) and p19arf (L) transcripts (n=3). Scale bars: 100 μm in
B,C; 50 μm in D,E. Data are mean±s.e.m.
RESEARCH ARTICLE
Development (2014) 141, 4087-4097 doi:10.1242/dev.107326
perturbing Hmga2 expression at a stage (PN1), where most RPCs
were committed, or to low efficiency of transduction, or to both, we
performed gain-of-function experiments in E18 retinal explants; the
effects on RPC regulation were examined after 4 and 10 days in
culture. As observed in vitro and in vivo, numbers of GFP+Ki67+
(Fig. 6O)/GFP+Pax6+ (Fig. 6P)/BrdU+ (Fig. 6Q)/SP(R) cells
increased at day 4 in gain-of-function groups versus controls.
When explants were examined at day 10 for differentiation, in
contrast to in vivo experiments, we observed a significant decrease
in the numbers of rod photoreceptors in gain-of-function groups
versus controls, suggesting that sustained Hmga2 expression
negatively influences differentiation along the rod photoreceptor
lineage (Fig. 6S-U). No such differences were observed between the
groups in bipolar cells (PKC+ cells) and Müller glia (GLAST+ cells)
generation (supplementary material Fig. S4). Next, we carried out
the loss-of-function experiments, which were similar to gain-offunction experiments (Fig. 6A,B; supplementary material Fig. S7),
except for viral transduction that included a dual-promoter Hmga2
4093
DEVELOPMENT
Fig. 6. Hmga2 gain of function promotes RPC self-renewal in the absence of ECCM in vitro and in vivo. (A) E18 retinal cell dissociates (in vitro)/PN1 retina
(in vivo)/E18 retinal explants (ex vivo) were transduced with Hmga2/Hmga2 (3′UTR DEL)+GFP/control GFP lentivirus and subjected to self-renewal and
differentiation assays. (B-G) In cell dissociates of transduced neurospheres/retina/explants, infected RPCs were identified as GFP+ cells co-expressing
Ki67/Pax6 immunoreactivities (B, arrowhead). Hmga2-lentivirus transduced RPCs generated more neurospheres than controls (C), and contained significantly
higher numbers of GFP+Ki67+ (D)/GFP+Pax6+ (E)/BrdU+ (F) and SP (G) cells. (H-L) Hmga2-lentivirus transduced retina contained significantly more GFP+Ki67+
(H)/GFP+Pax6+ (I)/BrdU+ (J) cells, and RPCs therein generated significantly more neurospheres (K), containing higher numbers of SP cells (L) than controls.
(M,N) Immunofluoresence analysis of gain-of-function retina at PN10 revealed no significant difference in the generation of rod photoreceptors (rhodopsin+ cells)
compared with controls. (O-U) Hmga2-lentivirus transduced E18 retinal explants had increased numbers of GFP+Ki67+ (O)/GFP+Pax6+ (P)/BrdU+ (Q) and SP (R)
cells at day 4, and decreased numbers of rod photoreceptors (S), as estimated by rhodopsin+ cells (T) and GFP+ rhodopsin+ cell quantifications (U) versus
controls at day 10. Scale bars: 50 μm. Data are mean±s.e.m. All the experiments were carried out three times in triplicates with four animals/group (in vivo
perturbation); nine retinae per group (ex vivo perturbation); 10-12 E18 embryos per group (in vitro perturbation).
siRNA+GFP/control GFP lentivirus (see Materials and Methods
and supplementary material Table S3) to attenuate Hmga2
expression (validated in supplementary material Fig. S6E-G).
When transduced E18 retinal cells were subjected to a
neurosphere assay in the presence of ECCM, unlike gain-offunction results, significantly fewer neurospheres were generated in
the loss-of-function group versus controls (Fig. 7A). In addition, the
loss-of-function neurospheres contained significantly fewer
Ki67+GFP+ (Fig. 7B)/Pax6+GFP+ (Fig. 7C)/BrdU+ (Fig. 7D)/SP
(Fig. 7E) cells compared with controls. However, levels of
Junb/p19arf transcripts were higher in the former versus the latter,
suggesting the involvement of the Hmga2-Junb/p19 axis in RPC
regulation (supplementary material Fig. S5). When cell dissociates
from in vivo-transduced retina were examined, a significant decrease
Development (2014) 141, 4087-4097 doi:10.1242/dev.107326
in GFP+ Ki67+ (Fig. 7F)/GFP+ Pax6+ (Fig. 7G)/BrdU+ (Fig. 7H)
cell numbers was observed in loss-of-function groups versus
controls, suggesting that RPC were similarly influenced by the
attenuation of Hmga2 expression in vivo. As observed in vitro, RPCs
from loss-of-function groups generated significantly fewer
neurospheres (Fig. 7I) that also contained fewer SP cells (Fig. 7J)
than controls. However, as in the gain-of-function approach, no
significant differences were observed in the generation of late-born
cells in vivo (Fig. 7K,L; supplementary material Fig. S5). Based on
the rationale above, when the loss-of-function experiments were
performed on E18 retinal explants, there was a significant decrease in
the numbers of GFP+Ki67+ (Fig. 7M)/GFP+Pax6+ (Fig. 7N)/BrdU+
(Fig. 7O)/SP (Fig. 7P) cells at day 4 in culture in loss-of-function
explants versus controls, as observed both in vitro and in vivo.
Fig. 7. Hmga2 loss-of-function compromises ECCM-mediated RPC self-renewal in vitro and in vivo. E18 retinal cell dissociates (in vitro)/PN1 retina
(in vivo)/E18 retinal explants (ex-vivo) were transduced with Hmga2siRNA+GFP/control GFP lentivirus, and subjected to self-renewal and differentiation assays
as described in Fig. 6A,B. (A-E) Hmga2 siRNA-lentivirus transduced RPCs generated fewer neurospheres than controls (A) and contained significantly lower
numbers of GFP+Ki67+ (B)/GFP+Pax6+ (C)/BrdU+ (D) and SP (E) cells. (F-J) Hmga2 siRNA-lentivirus transduced retina contained significantly fewer GFP+Ki67+
(F)/GFP+Pax6+ (G)/BrdU+ (H) cells, and RPCs therein generated significantly fewer neurospheres (I), containing fewer SP (J) cells than controls.
(K,L) Immunofluoresence analysis of loss-of-function retina at PN10 revealed no significant difference in the generation of rod photoreceptors (rhodopsin+ cells)
compared with controls. (M-S) Hmga2 siRNA-lentivirus transduced E18 retinal explants had decreased numbers of GFP+Ki67+ (M)/GFP+Pax6+ (N)/BrdU+ (O)
and SP (P) cells at day 4 and increased numbers of rod photoreceptors (Q), as estimated by rhodopsin+ cells (R) and GFP+ rhodopsin+ cell quantifications (S)
compared with controls at day 10. Scale bars: 50 μm. Data are mean±s.e.m. All the experiments were carried out three times in triplicates with four animals/group
(in vivo perturbation); nine retinae per group (ex vivo perturbation); 10-12 E18 embryos per group (in vitro perturbation).
4094
DEVELOPMENT
RESEARCH ARTICLE
However, in contrast to in vivo experiments, when explants were
examined at day 10 in culture, there was a significant increase in the
numbers of rod photoreceptors in loss-of-function groups versus
controls (Fig. 7Q-S). No significant differences in the number of
bipolar cells (PKC+ cells) and Müller glia (GLAST+ cells) were
observed between the two groups (supplementary material Fig. S5).
Together, these results suggest that Hmga2 regulates RPCs and is
functionally involved in mediating cell-extrinsic influences on their
self-renewal.
DISCUSSION
RPCs, whether from early or late stages of retinal histogenesis, tend
not to generate typical neurospheres or clones in low-density cultures,
but instead produce floating cell aggregates (Ahmad et al., 2004) or
fewer than a dozen adherent clones (Jensen and Raff, 1997). Neither
aggregates or clones generate secondary clones, failing the selfrenewal test. The apparent lack of self-renewal in RPCs in vitro,
compared with their counterparts from other CNS regions (Weiss
et al., 1996; Temple, 2001), is counterintuitive to their maintenance
being required to sustain prolonged histogenesis, a significant
proportion of which is completed postnatally. Here, we demonstrate
that RPCs self-renew, but this property probably depends on the
microenvironment. For example, under the influence of ECs, which
are known to support stem cells in a variety of niches (Palmer et al.,
2000; Shen et al., 2004, 2008; Yin and Li, 2006; Imura et al., 2008;
Butler et al., 2010), RPCs generate clonal neurospheres. These
neurospheres can be passaged; cells therein possess the multipotentiality of the parents, thus fulfilling self-renewal criterion
in vitro. The technical limitations of serial transplantation of neural
progenitors preclude the unambiguous determination of RPCs selfrenewal in vivo. However, the increased number of proliferating
progenitors and their ability to form neurospheres under nonconducive conditions in response to ECCM, and the abrogation of
these effects upon enforced attenuation of Hmga2 expression, attest to
their non-cell autonomous self-renewal in vivo and identifies some of
the mechanisms involved. The frequency of such progenitors in E18
retinal cell dissociates is 0.078%. The low frequency of self-renewing
RPCs might reflect their exhaustion by E18, when the majority of cells
are committing along the predominant rod photoreceptor lineage.
An interesting question is how the diffusible factors recruit cellintrinsic machinery to promote cell proliferation and maintain
multipotentiality. In addition, what is the source(s) of these factors
in the developing retina? There are several candidate sources for
these factors. For example, within the retina, factors expressed by
cells in different stages of differentiation may influence RPC
maintenance; Shh expressed by nascent RPCs promotes RPC
proliferation. This is presumably to maintain the RPCs for
subsequent rounds of differentiation (Wang et al., 2005). Without
the retina, retinal pigment epithelium (RPE) may play a significant
role in regulating self-renewal, as it is a source of Wnt2b (Cho and
Cepko, 2006), Vegf (Sonoda et al., 2009) and Pedf (Serpinf1)
(Tombran-Tink et al., 1991; Sonoda et al., 2009). The lens, the
development of which precedes formation of the optic cup and is
regulated by FGF signaling, may be a source of Fgf2 for retinal
development. Last, although the developing retina is avascular, the
choroidal circulation, which is established during formation of the
optic cup (Saint-Geniez and D’Amore, 2004), may serve as a source
of regulatory factors. However, regardless of sources, these factors
may not individually regulate RPC self-renewal. It is likely that their
combined effects with unknown factor(s) alter the expression of
intrinsic factors, such as Hmga2, to specific levels required for selfrenewal. Recently, Hmga2 was shown to repress Junb and indirectly
Development (2014) 141, 4087-4097 doi:10.1242/dev.107326
reduce expressions of p16ink4a and p19arf, thereby increasing selfrenewal of multi-lineage NSCs (Nishino et al., 2008). The role of
Hmga2, however, was limited to young mice because Let7
expression increases with age, leading to a reciprocal decline in
Hmga2 expression and consequently self-renewal (Nishino et al.,
2008). Several observations support that the Hmga2 regulatory axis
is involved in a similar capacity in RPCs. First, the developmental
decline in Hmga2 expression (localized predominantly in
proliferating RPCs) corresponds to progressive exhaustion of
RPCs, implicating Hmga2 in RPC maintenance. Second, changes
in Hmga2 expression in early postnatal retina following exposure to
ECCM/nECCM are associated with changes in the proliferation
index and retinal SP cell number. Third, examining RPCs at
late-stage histogenesis revealed that the unmasking of their selfrenewal property by ECs accompanied reciprocal expression
patterns of Let7, Hmga2, Junb and p19arf, as expected for the
Hmga2-regulatory axis in self-renewal. Finally, attenuation of
Hmga2 expression compromised EC-dependent RPC self-renewal,
whereas ectopic expression of Hmga2 increased the indices of selfrenewal, in vitro and in vivo. This functionally implicates Hmga2
as an intrinsic factor regulating non-cell autonomous RPC
self-renewal.
However, the observation that RPC self-renewal depends upon
modulation of Hmga2 transcript levels, not their presence alone,
points to the significance of stoichiometry in Hmga2 expression
levels for cells acquiring the self-renewal capacity. This mechanism
appears similar to the interactive nexus genes, Oct4 and Nanog, in
the pluripotency network, the expression levels of which must reach
a specific threshold before pluripotency is realized (Pan et al.,
2006). Thus, a similar network can be proposed for RPC selfrenewal with interactive nexus genes, one of which is likely to be
Hmga2. Other genes occupying the nodes in this network may be
the chromatin remodeling ATPase Brg1 (also known as Smarca4)
and Bmi1, a polycomb gene. Both Smarca4 and Bmi1 regulate stemcell self-renewal (Kidder et al., 2009; Chatoo et al., 2010), are
expressed in the developing retina and are modulated in RPCs in
response to EC exposure (S.P., X.X. and I.A. unpublished). These
epigenetic factors likely integrate the influence of the niche,
rendered through disparate signaling pathways, and globally alter
transcription of downstream genes required for self-renewal. Thus,
our results provide a framework for the integration of diverse
intercellular influences by epigenetic regulators in a dynamic stem
cell niche in the developing retina. Furthermore, these findings
allow for the formulation of approaches to maintain RPCs in
sufficient numbers in vitro, which is essential for the practical use of
RPCs for therapeutic purposes.
MATERIALS AND METHODS
The Institutional Animal Care and Use Committee (IACUC) at University of
Nebraska Medical Center (UNMC) ( protocols #97-100-08FC and #95-00509FC) approved the study. Animals were housed in the Department of
Comparative Medicine at UNMC. All experiments were carried out on
timed pregnant Sprague Dawley rats obtained from SASCO.
Neurosphere assay
The neurosphere assay was as described previously (Ahmad et al., 1999;
Parameswaran et al., 2010). Briefly, cell dissociates from E18 retina were
cultured in RCM supplemented either with EGF (20 ng/ml)/EGF+ECCM
for 4-5 days to generate neurospheres. Retinal differentiation was induced
with PN1 CM. For the clonal density assay (Ferron et al., 2007), cells were
plated in control or ECCM conditions at 5,10 and 20 cells/µl. Primary and
secondary neurospheres were manually titrated and cultured at 5 cells/µl
under above-mentioned conditions to obtain secondary and tertiary
4095
DEVELOPMENT
RESEARCH ARTICLE
RESEARCH ARTICLE
Retinal explant culture
Retinal explant cultures were performed as previously described (Del Debbio
et al., 2010). Briefly, E18 retinae were placed with the ganglion cell layer
(GCL) side upwards on a 0.4 µm semi-permeable membrane (Millipore) and
cultured in RCM with 5% FBS. Explants were exposed to BrdU (10 μM) for
8 h on day 4 and collected for analyses at the end of day 4 and day 10. Sections
of explants and that of age-matched retina (PN5; taking into consideration
explants from E18 retina, birth at the gestation age 22 and the duration of the
culture) were examined for the laminar structure to determine the integrity of
the explant culture (supplementary material Fig. S8).
Viral vectors
The details of the lentiviral vectors used in the study are provided in
supplementary material Table S3. The backbone of Hmga2+GFP and Hmga2
(3′UTR DEL)+GFP and control GFP viral vectors was the dual promoter viral
plasmid, pLentilox RSV, in which Hmga2 and GFP expression was driven by
RSV and CMV promoters, respectively (Nishino et al., 2008). The backbone
of Hmga2 siRNA GFP and control (scrambled) siRNA GFP vectors was the
viral plasmid piLenti siRNA GFP (ABM), where the opposing polymerase III
promoters (H1 and U6) transcribed the sense and antisense strands of the
siRNA duplex and a CMV promoter driving GFP expression. The target
sequence for rat Hmga2 siRNA was 5′AGACCCAAAGGCAGCAAGAACAAGAGCCC3′. The sequence for the scrambled siRNA control was
5′GGGTGAACTCACGTCAGAA3′. In the mCherry control vector
(GeneCopoeia), GFP expression was driven by the CMV promoter.
Lentivirus preparation and transduction
Lentivirus preparation and transduction were as previously described
(Parameswaran et al., 2012). Given the RPC limitations, the efficacy of
Hmga2 overexpression and siRNA-mediated gene silencing was
determined in 293T and C6 glioma cells, respectively. Lentivirustransduced neurospheres/retina/retinal explants were dissociated and cells
plated on glass coverslip and subjected immunofluorescence analysis to
quantify transduced RPCs. The perturbation experiments were carried out
three times in triplicates as follows: four animals/group (in vivo
perturbations), nine retinae/group (ex vivo perturbations) and 10-12 E18
embryos/group (in vitro perturbations).
Intravitreal injection
Injections were performed on PN1 pups as described previously (Das et al.,
2006). RCM and ECCM media were concentrated using 10 kDa Amicon
filters. Concentrated ECCM, neutralized with anti-FGF (2.5 μg/ml), antiPEDF (2.5 μg/ml) and anti-SCF (1 μg/ml) antibodies for 4 h at 37°C was
injected in a 1 µl volume. For Hmga2 gain-of-function studies, 1 µl of Hmga2
(3′UTR DEL)+GFP/Control GFP lentivirus (1×1010 IFU/ml) were injected.
For Hmga2 loss-of-function studies, 1 µl of Hmga2 siRNA-GFP/control GFP
lentivirus (1×1010 IFU/ml) mixed 1:1 with concentrated ECCM were injected.
was plotted against the number of cells/well. The zero term of the Poisson
equation predicted that when 37% of test wells were negative, one stem cell/
well existed (on average).
Inhibition of signaling pathways
To analyze signaling pathway involvement, primary neurospheres were
dissociated and cultured (4.5×104 cells/cm2) in ECCM containing
individual inhibitors [DAPT (5 mM/ml), DKK1 (100 ng/ml), anti-FGF2
(2.5 mg/ml), anti-SCF (1 mg/ml), anti-PEDF (2.5 mg/ml), CBOP11
(1.3 mM/ml), BMP4(20 ng/ml), Activin (100 ng/ml)] or their cocktail.
Cell-cycle analysis
BrdU-treated cells were fixed in 70% ethanol overnight, denatured with 2 N
HCl and 0.5% triton in 1× PBS, and neutralized with 1 M boric acid
solutions. Cells were washed once with 1% BSA in PBS, incubated in BrdU
antibody in blocking solution (1% BSA with 0.5% triton in PBS) for 1 h.
Cells were washed and incubated in 10 μg/ml of RNase and 20 μg/ml of
propidium iodide (PI) for 30 min at room temperature. FACS analysis was
carried out using the BD FACSCalibur.
Hoechst dye efflux assay
E18 neurospheres were dissociated into single cells and subjected to
Hoechst dye efflux assay, as previously described (Bhattacharya et al.,
2003). Briefly, cells (1×106 cells/ml) were incubated in 1 ml of Iscove’s
modified Dulbecco’s medium (IMDM) and 2% FBS overnight. Cells were
stained with 3-4 μg/ml of Hoechst 33342 dye for 30 min at 37°C in a
shaking water bath. Verapamil (100 μM) and PI controls were included for
each experiment. The SP regions were defined based on fluorescence
emission in both blue and red wavelengths.
Microarray analysis
Total RNA was isolated from control and ECCM neurospheres, and used to
synthesize biotin-labeled cRNA probe using Gene Chip 30 IVT Express kit
(Affymetrix). Fragmented cRNA probes were hybridized to rat genome 430
2.0 gene chip arrays (Affymetrix) at 45°C for 16 h. Arrays were scanned
with Affymetrix GCS3000 7G device; images were analyzed with GCOS
software. Raw data for each sample were processed separately by robust
multiarray analysis using Genepattern analysis software (Reich et al., 2006);
log2-transformed values were used to calculate fold changes of specific
genes. The accession number for microarray data deposited to NCBI Gene
Expression Omnibus Database is GSE5330.
Statistical analysis
Statistical analysis was performed using an unpaired, two-tailed t-test or
one-way analysis of variance (ANOVA) for pairwise and multiple group
comparisons, respectively (GraphPad Prism Software). P values less than
0.05 were considered significant. Tukey’s method for multiple comparison
was used wherever ANOVA showed a significant P value.
Acknowledgements
The authors thank Dr Mahendra Rao for guidance and consultation, Dr Graham
Sharp for constructive criticisms, Dr Yoshiki Sasai for Rx antibody, Lynette Smith in
the College of Public Health, UNMC for microarray analysis, Melody Montgomery for
editorial help and UNMC microarray core facility.
Preparation of ECCM
Competing interests
Bovine pulmonary artery EC lines (BPAE) (ATCC) were maintained in
Eagle’s minimum essential medium (EMEM) with 20% FBS. Cells were
plated at the density of 5×104 cells/cm2 in RCM. After 3 days, CM was
collected, centrifuged to remove floating cells and filtered and stored at
−80°C until use.
The authors declare no competing financial interests.
LDA assay
LDA analysis was performed as described previously (Das et al., 2006).
Briefly, retinal cells in serial dilutions in 200 μl aliquots were plated
individually in a 96-well plate and cultured for 7 days. Fraction of wells,
lacking neurospheres were scored. The negative logarithm of these wells
4096
Author contributions
S.P. designed the experiments, performed experiments, analyzed data and wrote
the manuscript. X.X. performed experiments and analyzed data. G.H. performed
experiments and analyzed data. I.A. conceived and designed experiments,
analyzed data, and wrote the manuscript.
Funding
This research is supported by the Lincy Foundation, the Pearson Foundation, the
National Institutes of Health (NIH) [NEI; R01-EY022051] and the Glebe Foundation.
Deposited in PMC for release after 12 months.
DEVELOPMENT
neurospheres, respectively. PCR and immunofluorescence analyses were
performed using gene-specific primers (supplementary material Table S1)
and primary antibodies (supplementary material Table S2), respectively.
Measurements were performed in triplicates. Western analysis performed as
previously described (Das et al., 2007).
Development (2014) 141, 4087-4097 doi:10.1242/dev.107326
Supplementary material
Supplementary material available online at
http://dev.biologists.org/lookup/suppl/doi:10.1242/dev.107326/-/DC1
References
Agathocleous, M. and Harris, W. A. (2009). From progenitors to differentiated cells
in the vertebrate retina. Annu. Rev. Cell Dev. Biol. 25, 45-69.
Ahmad, I., Dooley, C. M., Thoreson, W. B., Rogers, J. A. and Afiat, S. (1999). In
vitro analysis of a mammalian retinal progenitor that gives rise to neurons and glia.
Brain Res. 831, 1-10.
Ahmad, I., Das, A. V., James, J., Bhattacharya, S. and Zhao, X. (2004). Neural
stem cells in the mammalian eye: types and regulation. Semin. Cell Dev. Biol. 15,
53-62.
Andreu-Agulló , C., Morante-Redolat, J. M., Delgado, A. C. and Farinas,
I. (2009).
̃
Vascular niche factor PEDF modulates Notch-dependent stemness in the adult
subependymal zone. Nat. Neurosci. 12, 1514-1523.
Bhattacharya, S., Jackson, J. D., Das, A. V., Thoreson, W. B., Kuszynski, C.,
James, J., Joshi, S. and Ahmad, I. (2003). Direct identification and enrichment of
retinal stem cells/progenitors by Hoechst dye efflux assay. Invest. Ophthalmol.
Vis. Sci. 44, 2764-2773.
Butler, J. M., Nolan, D. J., Vertes, E. L., Varnum-Finney, B., Kobayashi, H.,
Hooper, A. T., Seandel, M., Shido, K., White, I. A., Kobayashi, M. et al. (2010).
Endothelial cells are essential for the self-renewal and repopulation of Notchdependent hematopoietic stem cells. Cell Stem Cell 6, 251-264.
Cayouette, M. and Raff, M. (2003). The orientation of cell division influences cellfate choice in the developing mammalian retina. Development 130, 2329-2339.
Cepko, C. L. (1999). The roles of intrinsic and extrinsic cues and bHLH genes in the
determination of retinal cell fates. Curr. Opin. Neurobiol. 9, 37-46.
Chatoo, W., Abdouh, M., Duparc, R.-H. and Bernier, G. (2010). Bmi1
distinguishes immature retinal progenitor/stem cells from the main progenitor
cell population and is required for normal retinal development. Stem Cells 28,
1412-1423.
Cho, S.-H. and Cepko, C. L. (2006). Wnt2b/beta-catenin-mediated canonical Wnt
signaling determines the peripheral fates of the chick eye. Development 133,
3167-3177.
Copley, M. R., Babovic, S., Benz, C., Knapp, D. J. H. F., Beer, P. A., Kent, D. G.,
Wohrer, S., Treloar, D. Q., Day, C., Rowe, K. et al. (2013). The Lin28b-let-7Hmga2 axis determines the higher self-renewal potential of fetal haematopoietic
stem cells. Nat. Cell Biol. 15, 916-925.
Das, A. V., Mallya, K. B., Zhao, X., Ahmad, F., Bhattacharya, S., Thoreson, W. B.,
Hegde, G. V. and Ahmad, I. (2006). Neural stem cell properties of Muller glia in
the mammalian retina: regulation by Notch and Wnt signaling. Dev. Biol. 299,
283-302.
Das, A. V., James, J., Bhattacharya, S., Imbalzano, A. N., Bhattacharya, S.,
Antony, M. L., Hegde, G., Zhao, X., Mallya, K., Ahmad, F., Knudsen, E. and
Ahmad, I. (2007). SWI/SNF chromatin remodeling ATPase Brm regulates the
differentiation of early retinal stem cells/progenitors by influencing Brn3b
expression and Notch signaling. J. Biol. Chem. 282, 35187-35201.
Del Debbio, C. B., Balasubramanian, S., Parameswaran, S., Chaudhuri, A., Qiu,
F. and Ahmad, I. (2010). Notch and Wnt signaling mediated rod photoreceptor
regeneration by Mü ller cells in adult mammalian retina. PLoS One 5, e12425.
De Marzo, A., Aruta, C. and Marigo, V. (2010). PEDF promotes retinal neurosphere
formation and expansion in vitro. Adv. Exp. Med. Biol. 664, 621-630.
Ferró n, S. R., Andreu-Agulló , C., Mira, H., Sanchez, P., Marques-Torrejon, M. A.
and Farinas,
I. (2007). A combined ex/in vivo assay to detect effects of
̃
exogenously added factors in neural stem cells. Nat. Protoc. 2, 849-859.
Gomes, F. L. A. F., Zhang, G., Carbonell, F., Correa, J. A., Harris, W. A., Simons,
B. D. and Cayouette, M. (2011). Reconstruction of rat retinal progenitor cell
lineages in vitro reveals a surprising degree of stochasticity in cell fate decisions.
Development 138, 227-235.
Hatakeyama, J., Tomita, K., Inoue, T. and Kageyama, R. (2001). Roles of
homeobox and bHLH genes in specification of a retinal cell type. Development
128, 1313-1322.
Imura, T., Tane, K., Toyoda, N. and Fushiki, S. (2008). Endothelial cell-derived
bone morphogenetic proteins regulate glial differentiation of cortical progenitors.
Eur. J. Neurosci. 27, 1596-1606.
Jensen, A. M. and Raff, M. C. (1997). Continuous observation of multipotential
retinal progenitor cells in clonal density culture. Dev. Biol. 188, 267-279.
Kidder, B. L., Palmer, S. and Knott, J. G. (2009). SWI/SNF-Brg1 regulates selfrenewal and occupies core pluripotency-related genes in embryonic stem cells.
Stem Cells 27, 317-328.
Development (2014) 141, 4087-4097 doi:10.1242/dev.107326
Lee, Y. S. and Dutta, A. (2007). The tumor suppressor microRNA let-7 represses
the HMGA2 oncogene. Genes Dev. 21, 1025-1030.
Livesey, F. J. and Cepko, C. L. (2001). Vertebrate neural cell-fate determination:
lessons from the retina. Nat. Rev. Neurosci. 2, 109-118.
Morrison, S. J. and Spradling, A. C. (2008). Stem cells and niches: mechanisms
that promote stem cell maintenance throughout life. Cell 132, 598-611.
Nishino, J., Kim, I., Chada, K. and Morrison, S. J. (2008). Hmga2 promotes neural
stem cell self-renewal in young but not old mice by reducing p16Ink4a and p19Arf
Expression. Cell 135, 227-239.
Noro, B., Licheri, B., Sgarra, R., Rustighi, A., Tessari, M. A., Chau, K.-Y., Ono,
S. J., Giancotti, V. and Manfioletti, G. (2003). Molecular dissection of the
architectural transcription factor HMGA2. Biochemistry 42, 4569-4577.
Palmer, T. D., Willhoite, A. R. and Gage, F. H. (2000). Vascular niche for adult
hippocampal neurogenesis. J. Comp. Neurol. 425, 479-494.
Pan, G., Li, J., Zhou, Y., Zheng, H. and Pei, D. (2006). A negative feedback loop of
transcription factors that controls stem cell pluripotency and self-renewal. FASEB
J. 20, 1730-1732.
Parameswaran, S., Balasubramanian, S., Babai, N., Qiu, F., Eudy, J. D.,
Thoreson, W. B. and Ahmad, I. (2010). Induced pluripotent stem cells generate
both retinal ganglion cells and photoreceptors: therapeutic implications in
degenerative changes in glaucoma and age-related macular degeneration.
Stem Cells 28, 695-703.
Parameswaran, S., Balasubramanian, S., Babai, N., DelDebbio, C. B., Harms, D.
W., Gurumurthy, C. B., Rao, M. S., Sharp, J. G. and Ahmad, I. (2012). Nucleic
acid and non-nucleic acid-based reprogramming of adult limbal progenitors to
pluripotency. PLoS One 7, e46734.
Ramı́rez-Castillejo, C., Sá nchez-Sá nchez, F., Andreu-Agulló , C., Ferró n, S. R.,
Aroca-Aguilar, J. D., Sá nchez, P., Mira, H., Escribano, J. and Farinas,
I.
̃
(2006). Pigment epithelium-derived factor is a niche signal for neural stem cell
renewal. Nat. Neurosci. 9, 331-339.
Rapaport, D. H., Wong, L. L., Wood, E. D., Yasumura, D. and LaVail, M. M.
(2004). Timing and topography of cell genesis in the rat retina. J. Comp. Neurol.
474, 304-324.
Reich, M., Liefeld, T., Gould, J., Lerner, J., Tamayo, P. and Mesirov, J. P. (2006).
GenePattern 2.0. Nat. Genet. 38, 500-501.
Robinson, S. (1991). Neuroanatomy of the visual pathways and their development.
In Vision and Visual Dysfunction, Vol. 3 (ed. B. Dreber and S. R. Robinson),
pp. 59-128. London: MacMillan.
Saint-Geniez, M. and D’Amore, P. A. (2004). Development and pathology of the
hyaloid, choroidal and retinal vasculature. Int. J. Dev. Biol. 48, 1045-1058.
Shen, Q., Goderie, S. K., Jin, L., Karanth, N., Sun, Y., Abramova, N., Vincent, P.,
Pumiglia, K. and Temple, S. (2004). Endothelial cells stimulate self-renewal and
expand neurogenesis of neural stem cells. Science 304, 1338-1340.
Shen, Q., Wang, Y., Kokovay, E., Lin, G., Chuang, S.-M., Goderie, S. K., Roysam, B.
and Temple, S. (2008). Adult SVZ stem cells lie in a vascular niche: a quantitative
analysis of niche cell-cell interactions. Cell Stem Cell 3, 289-300.
Shenghui, H., Nakada, D. and Morrison, S. J. (2009). Mechanisms of stem cell
self-renewal. Annu. Rev. Cell Dev. Biol. 25, 377-406.
Sonoda, S., Sreekumar, P. G., Kase, S., Spee, C., Ryan, S. J., Kannan, R. and
Hinton, D. R. (2009). Attainment of polarity promotes growth factor secretion by
retinal pigment epithelial cells: relevance to age-related macular degeneration.
Aging 2, 28-42.
Temple, S. (2001). The development of neural stem cells. Nature 414, 112-117.
Tombran-Tink, J., Chader, G. G. and Johnson, L. V. (1991). PEDF: a pigment
epithelium-derived factor with potent neuronal differentiative activity. Exp. Eye
Res. 53, 411-414.
Wang, Y., Dakubo, G. D., Thurig, S., Mazerolle, C. J. and Wallace, V. A. (2005).
Retinal ganglion cell-derived sonic hedgehog locally controls proliferation and the
timing of RGC development in the embryonic mouse retina. Development 132,
5103-5113.
Wang, L., Schulz, T. C., Sherrer, E. S., Dauphin, D. S., Shin, S., Nelson, A. M.,
Ware, C. B., Zhan, M., Song, C.-Z., Chen, X. et al. (2007). Self-renewal of human
embryonic stem cells requires insulin-like growth factor-1 receptor and ERBB2
receptor signaling. Blood 110, 4111-4119.
Weiss, S., Dunne, C., Hewson, J., Wohl, C., Wheatley, M., Peterson, A. C. and
Reynolds, B. A. (1996). Multipotent CNS stem cells are present in the adult
mammalian spinal cord and ventricular neuroaxis. J. Neurosci. 16, 7599-7609.
Yang, X.-J. (2004). Roles of cell-extrinsic growth factors in vertebrate eye pattern
formation and retinogenesis. Semin. Cell Dev. Biol. 15, 91-103.
Yin, T. and Li, L. (2006). The stem cell niches in bone. J. Clin. Invest. 116,
1195-1201.
4097
DEVELOPMENT
RESEARCH ARTICLE