© 2014. Published by The Company of Biologists Ltd | Development (2014) 141, 436-447 doi:10.1242/dev.097758
RESEARCH ARTICLE
Postsynaptic glutamate receptors regulate local BMP signaling at
the Drosophila neuromuscular junction
ABSTRACT
Effective communication between pre- and postsynaptic
compartments is required for proper synapse development and
function. At the Drosophila neuromuscular junction (NMJ), a
retrograde BMP signal functions to promote synapse growth, stability
and homeostasis and coordinates the growth of synaptic structures.
Retrograde BMP signaling triggers accumulation of the pathway
effector pMad in motoneuron nuclei and at synaptic termini. Nuclear
pMad, in conjunction with transcription factors, modulates the
expression of target genes and instructs synaptic growth; a role for
synaptic pMad remains to be determined. Here, we report that pMad
signals are selectively lost at NMJ synapses with reduced
postsynaptic sensitivities. Despite this loss of synaptic pMad, nuclear
pMad persisted in motoneuron nuclei, and expression of BMP target
genes was unaffected, indicating a specific impairment in pMad
production/maintenance at synaptic termini. During development,
synaptic pMad accumulation followed the arrival and clustering of
ionotropic glutamate receptors (iGluRs) at NMJ synapses. Synaptic
pMad was lost at NMJ synapses developing at suboptimal levels of
iGluRs and Neto, an auxiliary subunit required for functional iGluRs.
Genetic manipulations of non-essential iGluR subunits revealed that
synaptic pMad signals specifically correlated with the postsynaptic
type-A glutamate receptors. Altering type-A receptor activities via
protein kinase A (PKA) revealed that synaptic pMad depends on the
activity and not the net levels of postsynaptic type-A receptors. Thus,
synaptic pMad functions as a local sensor for NMJ synapse activity
and has the potential to coordinate synaptic activity with a BMP
retrograde signal required for synapse growth and homeostasis.
KEY WORDS: BMP signaling, Glutamatergic synapses, Glutamate
receptor, Drosophila, Neuromuscular junction
INTRODUCTION
Synapse development is initiated by genetic programs, but is
coordinated by intercellular communications between the pre- and
postsynaptic compartments, and by neuronal activity itself. Neurons
exert both instantaneous and long-lasting effects on the postsynaptic
cell through synaptic transmission (reviewed by Malenka and
Nicoll, 1999), and postsynaptic cells influence the growth,
maturation and function of the presynaptic neurons through
retrograde signals (Tao and Poo, 2001; Marqués and Zhang, 2006).
Retrograde signals have been identified at both neuromuscular
junctions (NMJs) and central synapses (Sanes and Lichtman, 1999;
Tao and Poo, 2001; Davis, 2006; Turrigiano, 2007; Turrigiano,
2012), but little is known about how such signals detect the status
Program in Cellular Regulation and Metabolism, NICHD, NIH, Bethesda, MD
20892, USA.
*Author for correspondence ([email protected])
Received 22 April 2013; Accepted 29 October 2013
436
of synaptic activity and relay this information to presynaptic
neurons.
The Drosophila NMJ is an extremely useful model to study
synapse development and plasticity. Drosophila NMJ synapses are
glutamatergic, similar in composition and function to the
mammalian central AMPA/kainate synapses (Littleton and
Ganetzky, 2000). The fly NMJ ionotropic glutamate receptors
(iGluRs) are heterotetrameric complexes composed of three
essential subunits – GluRIIC, GluRIID and GluRIIE – and either
GluRIIA or GluRIIB (DiAntonio, 2006). Mutations that delete any
of the shared subunits, or GluRIIA and GluRIIB together, abolish
the NMJ synaptic transmission and limit the localization of iGluRs
at synaptic locations (DiAntonio et al., 1999; Marrus et al., 2004;
Featherstone et al., 2005; Qin et al., 2005). Type-A and type-B
receptors differ in their single-channel properties, synaptic currents
and regulation by second messengers (DiAntonio, 2006).
Mechanisms that differentially regulate the synaptic levels and
activity of these two channels have profound effects on synapse
strength and plasticity. Manipulations that decrease the activity of
type-A receptors produce large decreases in quantal size (Petersen
et al., 1997; Davis et al., 1998), yet the evoked transmission remains
normal due to a compensatory increase in presynaptic release.
Several factors have been shown to trigger the retrograde signal and
control synaptic homeostasis (Haghighi et al., 2003; Frank et al.,
2006; Goold and Davis, 2007; Dickman and Davis, 2009; Frank et
al., 2009; Marie et al., 2010; Müller et al., 2011; Müller and Davis,
2012). However, the molecular nature of the retrograde signal
remains a mystery.
At the Drosophila NMJ, Glass bottom boat (Gbb), a bone
morphogenetic protein (BMP)-type ligand secreted by the muscle,
provides a retrograde signal that promotes synaptic growth and
confers synaptic homeostasis (Aberle et al., 2002; Marqués et al.,
2002; Sweeney and Davis, 2002; McCabe et al., 2003; Goold and
Davis, 2007). Gbb signals by binding to presynaptic
heterotetrameric complex of type-I [Thickveins (Tkv) and
Saxophone (Sax)] and type-II [Wishful thinking (Wit)] receptors.
Activated receptors recruit and phosphorylate the BMP pathway
effector Mad. Phosphorylated Mad (pMad) accumulates at two
locations: in the motoneuron nuclei (nuclear pMad) and at the NMJ
synapses (synaptic pMad) (McCabe et al., 2003; Dudu et al., 2006).
Nuclear pMad in conjunction with other factors modulates
expression of BMP target genes, including trio, which encodes for
a Rac-activating protein important for cytoskeletal remodeling, and
target of wit (twit), which encodes for a Ly-6 related molecule
important for NMJ synapse activity (Ball et al., 2010; Kim and
Marqués, 2012). The function of synaptic pMad remains less well
understood. Recent evidence suggests that synaptic pMad does not
translocate to the motoneuron nuclei and instead may engage in a
local, unknown activity (Smith et al., 2012). Selective loss of
presynaptic pMad in importin-β11 mutants causes developmental
and functional defects at NMJ synapses (Higashi-Kovtun et al.,
Development
Mikolaj Sulkowski, Young-Jun Kim and Mihaela Serpe*
RESEARCH ARTICLE
Development (2014) doi:10.1242/dev.097758
2010). Previous studies have placed synaptic pMad at the active
zones, but also within the boundaries of endogenous iGluRs clusters
at postsynaptic densities (PSDs) (Dudu et al., 2006). In the muscle,
BMP signaling is triggered by glia-secreted TGFβ ligand Maverick
(Mav), which activates Gbb transcription and modulates Gbbdependent retrograde signaling and synaptic growth (Fuentes-Medel
et al., 2012).
We have previously characterized Neto as an essential auxiliary
subunit of glutamate receptor complexes required for iGluR synaptic
clustering and formation of functional NMJs (Kim et al., 2012).
Similar to disruptions in glutamate receptors, neto mutant embryos
are completely paralyzed and have no detectable iGluR clusters at
their NMJs. Synapses developing at suboptimal Neto levels have
physiological and structural defects, but are also smaller in size, with
reduced number of boutons, suggesting that Neto may influence one
of the several signaling pathway known to modulate NMJ
development. In particular, synapses with impairments in BMP
signaling have fewer boutons and reduced excitatory junction
potential amplitudes (reviewed by Marqués and Zhang, 2006)
similar to neto mutants. As Neto contains two extracellular, putative
BMP-binding complement CUB domains (Lee et al., 2009), we
hypothesized that Neto modulates the BMP signaling at Drosophila
NMJ.
Here, we report that Neto-deprived synapses exhibit selective loss
of synaptic pMad. We found that neto interacts genetically with
BMP pathway components and modulates synaptic pMad
throughout development. Synaptic pMad follows the accumulation
of postsynaptic Neto/iGluRs clusters and correlates exclusively with
the type-A glutamate receptors. Furthermore, we found that synaptic
pMad correlates with the activity of type-A receptors and constitutes
an effective sensor of synaptic activity.
RESULTS
Synaptic but not nuclear pMad is diminished at suboptimal
Neto levels
As Neto-deprived NMJs have phenotypes reminiscent of BMP
signaling pathway mutants, we hypothesized that Neto influences
the retrograde BMP signaling. We tested this possibility by
examining the levels and distribution of pMad, the effector of the
BMP signaling pathway. Whereas control animals had clear pMad
puncta decorating synaptic boutons, the pMad signals were
drastically reduced at synaptic locations in neto109 third instar larvae
(Fig. 1A,B). This difference was not caused by genetic background,
as control and neto109 animals are excisions of the same transposable
element (Kim et al., 2012). The loss of synaptic pMad at suboptimal
Neto levels was confirmed using several anti-pMad antibodies
(supplementary material Fig. S1) and resembled the loss of pMad
in mutants of the BMP pathway, such as wit (Fig. 1C).
Downregulation of neto via RNAi uncovered a similar decrease of
synaptic pMad following the levels of postsynaptic Neto
(Fig. 1D,E). A duplication covering the neto locus effectively
rescued the loss of pMad in neto109 boutons (Fig. 1F), indicating
that synaptic pMad specifically depends on Neto. To test if Neto
affects the levels or synaptic localization of BMP pathway
components we compared the distribution of Mad and BMP
receptors, Tkv and Wit, and the transcriptional response to the
retrograde BMP signaling in neto109 larvae and controls
(supplementary material Fig. S2; and see below). The loss of pMad
signals at neto109 NMJs did not appear to be a consequence of
reduced synaptic BMP pathway components. Also, the loss of
synaptic pMad at Neto-deprived NMJs could not be attributed to
defective PSD structures, as detailed below.
In contrast to synaptic terminals, nuclear pMad signals appeared
normal in neto109 third instar ventral ganglia (Fig. 2A,B).
Quantification revealed only mild reduction of nuclear pMad signals
in neto109 compared with controls, whereas nuclear pMad was not
detectable in wit mutants (Fig. 2C). A similar specific reduction in
synaptic but not nuclear pMad was reported for importin-β11
mutants (Higashi-Kovtun et al., 2010). Furthermore, suboptimal
Neto levels did not appear to impact transcription of BMP target
genes in the motoneurons. Quantitative reverse transcription
polymerase chain reaction (qRT-PCR) from third instar ventral
ganglia indicated that twit expression was reduced by 16% in neto109
and by 83% in wit mutants compared with controls (Fig. 2D).
Importantly, suboptimal Neto levels did not affect gbb expression in
either ventral ganglia or muscle tissue (qPCR from larval muscle
cDNA shown in Fig. 2E). At the Drosophila NMJ, multiple
pathways control Gbb transcription and secretion and therefore
437
Development
Fig. 1. Suboptimal Neto prevents pMad accumulation at the NMJ. (A-F) Synaptic localization of Bruchpilot (green) and pMad (red) at third instar larvae
NMJ (muscle 4, abdominal segment 3). The anti-horseradish peroxidase (HRP) antibody (blue) labels motoneuron arbors. pMad localizes at NMJ synapses in
control animals (A), but is diminished in neto hypomorphs, neto109 (B), similar to wit null mutants (C). Synaptic pMad signals correlate with Neto levels (D,E). A
duplication containing the neto gene restores synaptic pMad at neto109 NMJs (F). Scale bars: 10 μm. Genotypes: (A) control (precise excision); (B) neto109; (C)
witB11/witA12; (D) UAS-Dicer/UAS-netoRNAi-6D; 24B-Gal4/+; (E) UAS-netoRNAi-6D/+; 24B-Gal4/+; (F) neto109;; Dp(1:3)DC270.
Fig. 2. Nuclear pMad does not change in neto hypomorphs.
(A-C) Confocal images of ventral ganglia of third instar larvae immunostained
against pMad. Nuclear pMad was detected in both control (A) and neto109
mutant ventral ganglia (B), including motoneuron nuclei. Nuclear pMad is lost
in wit mutants (C). (D,E) Quantitative analysis of gene expression. qRT-PCR
analysis reveals a small decrease of twit expression in neto109 ventral ganglia
compared with controls (D). wit mutants show significantly decreased in twit
expression. The levels of gbb expression in larval striated muscles are similar
in neto109 and control animals, but are reduced in gbb mutants, or increased
when gbb is overexpressed in the muscle (E). Bars represent the mean
relative expression of target gene from three independent experiments (n=3).
Error bars represent s.e.m. (***P<0.001). Genotypes: (A-D) control (precise
excision), neto109, and witB11/witA12; (E) control (precise excision), neto109,
gbb1/gbb2, and M>gbb (UAS-gbb9.9/G14-Gal4). Scale bar: 20 μm.
influence the BMP retrograde signaling (Ellis et al., 2010; Nahm et
al., 2010; Fuentes-Medel et al., 2012). Perturbations in any of these
pathways impact Gbb extracellular distribution and lead to concerted
variations of both synaptic and nuclear pMad. By contrast, selective
loss of pMad at Neto-deprived synapses does not seem to originate
from a general decrease in Gbb availability and appears to represent
a more specific impairment.
Genetic interaction of neto with the BMP pathway
The similarities between NMJs deficient for neto and BMP pathway
components, and the observed reduction of pMad at Neto-deprived
synapses suggest that neto and BMP signaling pathway may interact
to regulate synapse development. To test this hypothesis, we
examined genetic interactions between neto and the BMP pathway
components. Larvae with mutations in neto or BMP signaling
components have smaller NMJs, but this phenotype is recessive;
heterozygous larvae have normal numbers of synaptic boutons and
are indistinguishable from controls (McCabe et al., 2003) (Fig. 3).
However, animals with single copies of both neto and gbb (neto36/+;
gbb1/+) had smaller NMJs with 30% fewer synaptic boutons. This
significant decrease indicates a synergistic effect of mutations in
neto and gbb. We did not observe a similar decrease in the synaptic
arbors for neto and wit, put or mad trans-heterozygous
combinations, but larvae heterozygous for neto, wit and put together
had significantly smaller NMJs, with 25% fewer synaptic boutons
438
Development (2014) doi:10.1242/dev.097758
(Fig. 3B). Taking advantage of the 50% lethality of neto109
hemizygotes we tested whether further reduction of BMP signaling
pathway components affected the lethality. We found that neto109
lethality was increased from 50% to >80% when one copy of gbb
or mad was removed (supplementary material Fig. S3). This
synthetic lethality assay also revealed a modest interaction between
neto and wit, but not put. Together, these genetic interactions
indicated that neto and gbb formed trans-heterozygous combinations
for which phenotypic threshold effects could be consistently
observed.
If neto is upstream of gbb in the BMP signaling pathway, then
lowering Neto levels should not aggravate gbb null mutant
phenotypes. Indeed, third instar gbb null larvae (gbb1/gbb2)
showed a ~50% reduction in synaptic boutons with either one or
two copies of neto (Fig. 3B). However, overexpression of gbb did
not rescue the synaptic arbors or local pMad in neto109 (Fig. 3C;
supplementary material Fig. S4). In control experiments,
overexpression of gbb in the muscle significantly rescued the NMJ
growth phenotype of gbb null mutants (supplementary material
Fig. S5). If neto is upstream gbb but cannot be rescued by genetic
manipulations of Gbb levels, then how does Neto impact BMP
signaling? One possibility could be that Neto controls localization
of Gbb activities: in this scenario, overexpression of Gbb cannot
suppress neto loss-of-function phenotypes, even though neto is
upstream of gbb.
Synaptic pMad does not accumulate at Neto-deprived
synapses throughout development
As reduced Neto levels efficiently disrupted synaptic pMad without
affecting nuclear pMad levels, we wondered if our observations
captured a cumulative effect on synaptic pMad. To rule out such a
combined effect we performed developmental timecourse analyses
and compared pMad in control and neto109 animals starting from late
embryo stages.
In embryos 21 hours after egg laying (AEL), Neto forms distinct
puncta that mark iGluR clusters at neuronal arbors (Kim et al., 2012)
(Fig. 4A). Some of these puncta colocalized with a few pMad
immunoreactivities present at this stage. The synaptic pMad puncta
were very rare in control embryos and were never found in neto109
hemizygotes, which also lacked Neto-positive signals (Fig. 4A′).
First and second instar larvae had well defined synapses with
boutons decorated by Neto puncta (Fig. 4B,C). By second instar all
Neto-positive puncta were accompanied by pMad signals in control
larvae, but pMad immunoreactivities remained very small and
scattered along the axonal arbor in neto109, mirroring the dim Neto
signals (Fig. 4B′,C′, arrows). By contrast, nuclear pMad levels were
similar in neto109 and control animals at all stages of development
(Fig. 4D-F). Furthermore, although they die paralyzed, neto36 null
embryos had normal nuclear pMad (not shown). The selective loss
of pMad observed throughout development suggests that the loss of
synaptic pMad is not a consequence of impaired development at
Neto-deprived synapses; instead, neto is directly required for the
accumulation of local pMad.
As synaptic pMad followed the temporal and spatial accumulation
of Neto at developing synapses, we examined whether increased
Neto levels affect pMad accumulation. Synaptic Neto showed
punctate as well as diffuse distribution when neto transgenes were
overexpressed in the striated muscles (Fig. 4G). Neto puncta
colocalized with the iGluR subunits, whereas diffuse Neto exceeded
the receptor field. However, excess Neto did not affect the intensity
and appearance of synaptic pMad signals, which remained organized
in distinct puncta. The similarities between iGluRs and synaptic
Development
RESEARCH ARTICLE
RESEARCH ARTICLE
Development (2014) doi:10.1242/dev.097758
Fig. 3. neto interacts genetically with gbb.
(A) Representative confocal images of muscle 4 NMJ,
abdominal segment 3, in third instar larvae immunostained
against Dlg (green) and HRP (blue). Scale bar: 10 μm.
(B,C) Quantification of mean number of type-IB boutons on
muscle 4 per μm2 of muscle surface area. Numbers of
segments analyzed are indicated. Error bars represent s.e.m.
***P<0.005 compared with control. N.S. (not significant)
denotes P>0.1. Genotypes: control (precise excision), gbb1/2
(gbb1/gbb2), neto109 N>gbb (neto109; UAS-gbb9.9/+; elavGal4/+), neto109 M>gbb (neto109; UAS-gbb9.9/G14-Gal4).
Synaptic pMad correlates with glutamate receptor levels
To test whether synaptic pMad follows the Neto/iGluRs clusters we
examined pMad at various iGluRs levels. We first targeted the
essential subunits of iGluR complexes, GluRIIC, GluRIID and
GluRIIE, via muscle specific RNAi. Staining and imaging conditions
were kept identical to facilitate comparison of various genotypes.
Mild reduction of iGluR levels, such as in GluRIIERNAi, induced
attenuation of Neto and GluRIIC signals and a corresponding
decrease in synaptic pMad (Fig. 5B; supplementary material
Fig. S6). Strong reduction of iGluR levels (i.e. GluRIIDRNAi,
GluRIICRNAi) disrupted larval development and reduced Neto and
GluRIIC synaptic levels in a concentration-dependent manner
(supplementary material Fig. S6). The levels of pMad closely
followed the synaptic levels of Neto/iGluR clusters (Fig. 5C-E). A
similar phenotype was found in GluRIIC ‘weakly’ rescued flies,
carrying a leaky UAS-GluRIIC cDNA transgene (Marrus et al.,
2004) (Fig. 5F). Similar to neto109, iGluR-deprived larvae had
normal levels of nuclear pMad in ventral ganglia (Fig. 5G-I). Thus,
synaptic pMad mirrors the levels of postsynaptic Neto/iGluRs,
whereas nuclear pMad appears insensitive to the glutamate receptors
status.
The Drosophila NMJ utilizes two types of iGluRs, type-A and
type-B, which differ in their composition, channel properties and
subcellular localization (DiAntonio, 2006). To test whether synaptic
pMad differentiated between these channels, we examined the
synapses at various GluRIIA and GluRIIB levels. Consistent with
the previous demonstration that GluRIIA and GluRIIB compete for
the essential subunits for synaptic targeting (Sigrist et al., 2002;
Marrus et al., 2004), we found that GluRIIA overexpression
produced strong reduction of GluRIIB synaptic levels (Fig. 6A,B).
Also, lowering GluRIIA (or GluRIIB) levels produced a significant
increase in synaptic accumulation of GluRIIB (or respectively,
GluRIIA) (Fig. 6C-E). None of these genetic manipulations induced
changes in the GluRIIC and Neto synaptic signals (not shown; Fig.
6). We found that synaptic pMad specifically followed synaptic
GluRIIA levels over a wide range of concentrations, in RNAi
experiments or heteroallelic combinations (Fig. 6F-J). These
striking variations in synaptic pMad levels cannot be due to
structural disruptions at postsynaptic specializations. Unlike neto109,
GluRIIA mutant NMJs have normal distribution of postsynaptic
scaffolds such as Discs-large (Dlg) (supplementary material Fig. S7)
(Kim et al., 2012). Furthermore, nuclear pMad remained relatively
constant over a wide range of GluRIIA levels (Fig. 6K-N). Thus,
postsynaptic type-A receptors selectively modulate the accumulation
of synaptic pMad.
Activity-dependent accumulation of synaptic pMad
The relative ratio of synaptic type-A versus type-B glutamate
receptors is also a key determinant of quantal size. Overexpression
of GluRIIA induces a dose-dependent increase in quantal size,
whereas overexpression of GluRIIB induces a dose-dependent
decrease (Petersen et al., 1997; DiAntonio et al., 1999). Therefore,
synaptic pMad may correlate with the net levels of type-A
receptors or may reflect a change in synapse activity/quantal size.
To distinguish between these two possibilities, we next
manipulated the activity of postsynaptic glutamate receptors.
Postsynaptic protein kinase A (PKA; PKA-C1 – FlyBase) controls
quantal size through a mechanism that requires the presence of
GluRIIA subunit; the current model is that PKA may
phosphorylate and inhibit the activity of type-A receptors without
changing the levels of synaptic receptors (Davis et al., 1998). If
synaptic pMad depends on the activity of type-A receptors, then
PKA activity should have profound effects on synaptic pMad
accumulation. We tested this possibility by genetic manipulation
of PKA activity in postsynaptic muscles using transgenes that
express either a constitutively active catalytic subunit (PKA-act)
or a mutant regulatory subunit of PKA with reduced affinity for
cAMP that inhibits the release of catalytic subunits (PKA-inh)
(Davis et al., 1998). Expression of these transgenic lines in
selected muscles using BG487-Gal4 promoter produced mosaic
animals suitable for comparative analyses within the same
439
Development
pMad labeling at various Neto levels raised the possibility that
synaptic pMad correlates with clustered Neto/iGluRs.
RESEARCH ARTICLE
Development (2014) doi:10.1242/dev.097758
Fig. 4. Synaptic pMad accumulation follows
Neto clustering at the developing NMJ.
(A-C′) Synaptic pMad is diminished throughout
development at suboptimal Neto levels. Confocal
images of body wall muscles 6/7 (abdominal
segment 3) using anti-Neto antibodies (green),
anti-pMad (red) and anti-HRP (blue) are shown.
Synaptic pMad forms puncta that colocalize with
Neto puncta in late control embryos (A) but are
absent in neto109 (A′). First (B) and second instar
(C) larvae also show Neto and pMad synaptic
signals that are largely absent from neto
hypomorphs (B′,C′). (D-F′) Nuclear pMad levels
remain normal at suboptimal Neto levels
throughout development, including late embryos,
21 hours AEL (D,D′), first instar (E,E′) and
second instar larvae (F,F′). (G,G′) High levels of
Neto in muscle do not affect synaptic pMad
signals. Neto labels distinct puncta that
colocalize with GluRIIA signals in control animals
(muscle 4, abdominal segment 3) (G). When
overexpressed, Neto positive fields expand
beyond the GluRIIA signals to encompass the
entire bouton (G′). pMad staining does not follow
the pattern of elevated Neto signals and remains
colocalized with GluRIIA and Neto-positive
puncta. Scale bars: 10 μm (A-C′); 20 μm (D-F′);
5 μm (G,G′). Genotypes: (G) UAS-neto-A9/+;
(G′) UAS-neto-A9/G14-Gal4.
DISCUSSION
We have previously described Neto as the first nonchannel subunit
required for the clustering of iGluRs and formation of functional
440
synapses at the Drosophila NMJ. Neto and iGluR complexes
associate in the striated muscle and depend on each other for
targeting and clustering at postsynaptic specializations. Here, we
show that Neto/iGluR synaptic complexes induce accumulation of
pMad at synaptic termini in an activity-dependent manner. The
effect of Neto/iGluR clusters on BMP signaling is selective, and
limited to synaptic pMad; nuclear accumulation of pMad appears
largely independent of postsynaptic glutamate receptors. We
demonstrate that synaptic pMad mirrors the activity of postsynaptic
type-A receptors. As such, synaptic pMad may function as an acute
sensor for postsynaptic sensitivity. Local fluctuations in synaptic
pMad may provide a versatile means to relay changes in synapse
activity to presynaptic neurons and coordinate synapse activity
status with synapse growth and homeostasis.
Synaptic pMad as a sensor for synapse activity
Drosophila NMJs maintain their evoked potentials remarkably
constant during development, from late embryo to the third instar
larval stages (Keshisian and Kim, 2004). This coordination between
motoneuron and muscle properties requires active trans-synaptic
signaling, including a retrograde BMP signal, which promotes
synaptic growth and confers synaptic homeostasis (Marqués, 2005;
Goold and Davis, 2007). Nuclear pMad accumulates in
motoneurons during late embryogenesis. However, embryos mutant
for BMP pathway components hatch into the larval stages,
indicating that BMP signaling is not required for the initial assembly
of NMJ synapses and instead modulates NMJ growth and
development (Aberle et al., 2002; Marqués et al., 2002). Here we
demonstrate that synaptic accumulation of pMad follows GluRIIA
arrival at nascent NMJs (Fig. 4) and depends on optimal levels of
synaptic Neto and iGluRs (Figs 1, 5). As type-A receptors have
been associated with nascent synapses, and type-B receptors mark
mature NMJs, accumulation of synaptic pMad appears to correlate
with a growing phase at NMJ synapses. Furthermore, synaptic pMad
Development
specimen (Budnik et al., 1996) (Fig. 7; supplementary material
Fig. S8).
We found that increased PKA activity in postsynaptic muscles
produced a significant decrease in the levels of synaptic pMad, but
not GluRIIA levels, compared with the control (Fig. 7A-E). We
quantified this difference relative to HRP and found that pMad
levels were reduced at synapses with normal or even slightly
increased GluRIIA levels (Fig. 7E,F). The synaptic pMad levels
were inversely proportional to the BG487-Gal4 expression pattern,
including its anteroposterior gradient. For example, muscle 6/7
synapses in anterior segments had greatly increased PKA-act
expression and showed decreased synaptic pMad, whereas posterior
segments had mild expression of PKA-act and reduced change in
synaptic pMad (supplementary material Fig. S8). By contrast,
decreased PKA activity induced no significant change in synaptic
pMad levels (Fig. 7C,D). Furthermore, high levels of PKA activity
throughout development, such as driven by G14-Gal4, resulted in
complete loss of synaptic pMad signals and larval lethality
(Fig. 7E,F). In this case, escaper third instar larvae also showed a
severe reduction of GluRIIA levels and diminished Neto signals. In
addition, overexpression of a dominant-negative GluRIIA receptor
with a mutation in the putative ion conduction pore (DiAntonio et
al., 1999) induced a significant reduction in synaptic pMad
indicating that synaptic pMad does not correlate with the net levels
of GluRIIA (supplementary material Fig. S9). In spite of these
drastic reductions in synaptic pMad, we found no changes in nuclear
pMad levels in motoneurons (Fig. 7G-J). Together, these findings
indicate that accumulation of synaptic pMad depends on the activity
of type-A receptors and not the net receptor levels. Thus, synaptic
pMad reflects the activity status of postsynaptic glutamate receptors.
RESEARCH ARTICLE
Development (2014) doi:10.1242/dev.097758
secreted Mav, which regulates gbb expression and indirectly
modulates the Gbb-mediated retrograde signaling (Fuentes-Medel
et al., 2012). RNAi experiments revealed that knockdown of mad in
muscle induces a decrease in synaptic pMad, albeit much reduced
in amplitude compared with knockdown of mad in motoneurons
(supplementary material Fig. S10) (Fuentes-Medel et al., 2012).
Also, knockdown of wit in motoneurons, but not in muscle, and
knockdown of put in muscle, but not in motoneurons, triggers
reduction of synaptic pMad (data not shown) (Fuentes-Medel et al.,
2012). Intriguingly, the synaptic pMad is practically abolished in
GluRIIA and neto109 mutants and cannot be further reduced by
additional decrease in Mad levels (supplementary material
Fig. S10). Whereas loss of postsynaptic pMad could be due to a
Mav-dependent feedback mechanism that controls Gbb secretion
from the muscle, the absence of presynaptic pMad demonstrates a
role for GluRIIA and Neto in modulation of BMP retrograde
signaling.
As BMP signals are generally short lived (O’Connor et al., 2006;
Tucker et al., 2008; Ramel and Hill, 2012), synaptic pMad probably
reflects accumulation of active BMP/receptor complexes at synaptic
termini. Recent evidence suggests that BMP receptors traffic along
the motoneuron axons, with Gbb/receptors complexes moving
preferentially in a retrograde direction. By contrast, Mad does not
appear to traffic (Smith et al., 2012). Thus, Mad is likely to be
phosphorylated and maintained locally by a pool of active
Gbb/BMP receptor complexes that remain at synaptic termini for the
time postsynaptic type-A receptors are active.
Fig. 5. Neto/iGluR clusters control synaptic pMad accumulation.
(A-F) Synaptic localization of Neto (green) and pMad (red) at third instar
larvae NMJ (muscle 4, abdominal segment 3). Synaptic pMad signals are
diminished when obligatory iGluR subunits are reduced via RNAi (B-E) or in
hypomorphic combinations (F). Moderate reduction of synaptic Neto/iGluR
complexes such as with GluRIIERNAi produce limited decrease in synaptic
pMad (B). Strong loss of Neto/iGluR clusters in GluRIIDRNAi larvae induces
severe reduction in the synaptic pMad signals (C); rearing GluRIIDRNAi
animals at 18°C preserves some of the Neto/iGluR clusters as well as
synaptic pMad (D). Reducing GluRIIC levels either by RNAi (E) or in strong
hypomorphs (F) produces loss of Neto/iGluR clusters and synaptic pMad.
(G-I) pMad accumulation in motoneuron nuclei remains unchanged when
synaptic Neto/iGluR clusters are diminished. Nuclear pMad signals resemble
controls (G) in GluRIIChypo (H) and GluRIIDRNAi (I). Scale bars: 10 μm (A-F);
20 μm (G-I). Genotypes: (A,G) control (precise excision); (B) GluRIIERNAi
(G14-Gal4/+; UAS-GluRIIERNAi/+); (C,D,I) GluRIIDRNAi (G14-Gal4/+; UASGluRIIDRNAi/+); (E) GluRIICRNAi (G14-Gal4/+; UAS-GluRIICRNAi/+); (F,H)
GluRIIEhypo (DGluRIII2/df(2L)ast1; P[UAS-cGluRIII]/+).
correlates with the activity and not the net levels of postsynaptic
type-A receptors (Fig. 6). In fact, expression of a GluRIIA variant
with a mutation in the putative ion conduction pore triggered
reduction of synaptic pMad levels (supplementary material Fig. S9).
Thus, synaptic pMad functions as a molecular sensor for synapse
activity and may constitute an important element in synapse
plasticity.
The synaptic pMad pool has been localized primarily to the
presynaptic compartment (Marqués and Zhang, 2006; O’ConnorGiles et al., 2008; Higashi-Kovtun et al., 2010). However, a
contribution for postsynaptic pMad to the pool of synaptic pMad is
also possible. Postsynaptic pMad accumulates in response to glia-
The activity of type-A glutamate receptors may control synaptic
pMad accumulation (1) indirectly via activity-dependent changes
that are relayed to both pre- and postsynaptic cells, or (2) directly
by influencing the production and signaling of varied Gbb ligand
forms or by localizing Gbb activities. For example, inhibition of
postsynaptic receptor activity induces trans-synaptic modulation of
presynaptic Ca2+ influx (Müller and Davis, 2012). Such Ca2+ influx
changes may trigger events that induce a local change in synaptic
pMad accumulation. One possibility is that changes in Ca2+ influx
may recruit Importin-β11 at presynaptic termini, which in turn
mediate synaptic pMad accumulation.
At the Drosophila NMJ, Gbb is secreted in the synaptic cleft from
both pre- and postsynaptic compartments. The secretion of Gbb is
regulated at multiple levels, transcriptionally and post-translationally
(Ellis et al., 2010; Nahm et al., 2010; James and Broihier, 2011;
Fuentes-Medel et al., 2012; Nahm et al., 2013). Furthermore, the
Gbb prodomain could be processed at several cleavage sites to
generate Gbb ligands with varying activities (Akiyama et al., 2012).
The longer, more active Gbb ligand retains a portion of the
prodomain that could influence the formation of Gbb/BMP receptor
complexes (Sengle et al., 2011). Synaptic pMad may result from
signaling by selective forms of Gbb. Or type-A receptors could
modulate secretion and processing of Gbb in an activity-dependent
manner. Understanding the function of different pools and active
forms of Gbb within the synaptic cleft will help explain the multiple
roles for Gbb at Drosophila NMJs.
Alternatively, active postsynaptic type-A receptor complexes may
directly engage and stabilize presynaptic Gbb/BMP receptor
signaling complexes via trans-synaptic interactions. CUB domains
can directly bind BMPs (Lee et al., 2009); thus Neto may utilize its
extracellular CUB domains to engage Gbb and/or presynaptic BMP
receptors. As synaptic pMad mirrors active type-A receptors, such
441
Development
How does postsynaptic glutamate receptor activity
modulate local pMad?
RESEARCH ARTICLE
Development (2014) doi:10.1242/dev.097758
trans-synaptic complexes will depend on Neto in complexes with
active type-A receptors. We have been unable to capture a direct
interaction between Gbb and Neto CUB domains in coimmunoprecipitation experiments (data not shown). Nonetheless, a
trans-synaptic complex that depends on the activity of type-A
receptors could offer a versatile means for relaying synapse activity
status to the presynaptic neuron via fast assembly and disassembly.
Irrespective of the strategy that correlates synaptic pMad pool
with the active type-A receptor/Neto complexes, further mechanisms
must act to maintain the Gbb/BMP receptor complexes at synapses
and protect them from endocytosis and retrograde transport. Such
mechanisms must be specific, as general modulators of BMP
receptors endocytosis impact both synaptic and nuclear pMad
(Sweeney and Davis, 2002; Wang et al., 2007; O’Connor-Giles and
Ganetzky, 2008; O’Connor-Giles et al., 2008; Nahm et al., 2013). A
442
candidate for differential control of BMP/receptor complexes is
Importin-β11. Loss of synaptic pMad in importin-β11 is rescued by
neuronal expression of activated BMP receptors, by blocking
retrograde transport, but not by neuronal expression of Mad
(Higashi-Kovtun et al., 2010). As Mad does not appear to traffic
(Smith et al., 2012), presynaptic Importin-β11 must act upstream of
the BMP receptors, perhaps to stabilize active Gbb/BMP receptor
complexes at the neuron membrane. By contrast, local pMad cannot
be restored at Neto-deprived NMJs by overactivation of presynaptic
BMP receptors or by blocking retrograde transport (supplementary
material Fig. S4). As neto and gbb interact genetically, it is tempting
to speculate that postsynaptic Neto/type-A complexes localize Gbb
activities and stabilize Gbb/BMP receptor complexes from the
extracellular side. Additional extracellular factors, for example
heparan proteoglycans (Dani et al., 2012), or intracellular
Development
Fig. 6. Type-A receptors are required
for synaptic pMad accumulation.
(A-J) Confocal microscopy was
performed on muscle 4 (abdominal
segment 3) with anti-GluRIIA
antibodies (green), anti-Neto (blue) and
either anti-GluRIIB (red) (A-E) or antipMad (red) (F-J). Overexpression of
GluRIIA in striated muscles reduces
GluRIIB levels compared with controls
(A-B). Reduction of GluRIIA levels via
RNAi (C) or in strong hypomorphs (D)
increases the GluRIIB levels, whereas
reduction of GluRIIB via RNAi (E)
increases the GluRIIA signals. Neto
synaptic signals are largely unaffected
by changes in GluRIIA/GluRIIB ratio.
Overexpression of GluRIIA produces
an increase in pMad signal intensities
compared with controls (F,G).
Reducing the GluRIIA levels leads to
reduction of pMad signals (H,I), but
reducing the GluRIIB levels has the
opposite effect (J). (K-N) Confocal
microscopy of third instar ventral
ganglia using anti-pMad antibodies
indicates that nuclear pMad signals
were not affected by manipulations of
GluRIIA levels. Scale bars: 10 μm (AJ); 20 μm (K-N). Genotypes: (A,F,K)
control (precise excision); (B,G,L)
M>GluRIIA (UAS-GluRIIA/+; G14Gal4/+); (C,H,M) GluRIIARNAi (G14Gal4/+; UAS-GluRIIARNAi/+); (D,I,N)
GluRIIASP16/Df (GluRIIASP16/Df(2L)clh4);
(E,J) GluRIIBRNAi (G14-Gal4/+; UASGluRIIBRNAi/+).
RESEARCH ARTICLE
Development (2014) doi:10.1242/dev.097758
modulators, such as Nemo kinase (Merino et al., 2009), may control
the distribution of sticky Gbb molecules within the synaptic cleft
and their binding to BMP receptors, or may stabilize Gbb/BMP
receptor complexes at synaptic termini.
Possible functions for synaptic pMad
Synaptic pMad may act locally and/or in coordination with the
transcriptional control of BMP target genes to ensure proper growth
and development of the synaptic structures. A presynaptic pool of
pMad maintained by Importin-β11 neuronal activities ensures
normal NMJ structure and function (Higashi-Kovtun et al., 2010).
Like importin-β11, GluRIIA and Neto-deprived synapses show a
significantly reduced number of boutons (Table 1) (Petersen et al.,
1997; Higashi-Kovtun et al., 2010; Kim et al., 2012). Intriguingly,
the absence of GluRIIA induces up to 20% reduction in bouton
numbers, whereas knockdown of GluRIIB does not appear to affect
NMJ growth (Table 1) (Petersen et al., 1997; Reiff et al., 2002).
Although the amplitude of the growth phenotypes we observed in
normal culturing conditions (25°C) was modest, this phenomenon
may explain the requirement for GluRIIA reported for activitydependent NMJ development (at 29°C) (Sigrist et al., 2002; Sigrist
et al., 2003). Furthermore, knockdown of Neto or any iGluR
essential subunit affect synaptic pMad and NMJ growth in a dosedependent manner (Figs 1, 5; Table 1) (Kim et al., 2012). We could
not find significant changes in nuclear pMad or expression of BMP
target genes in GluRIIA or Neto-deprived animals, but the
restoration of synaptic pMad by presynaptic constitutively active
BMP receptors rescues the morphology and physiology of importinβ11 mutant NMJs (Higashi-Kovtun et al., 2010). The smaller NMJs
observed in the absence of local pMad may reflect a direct
contribution of synaptic pMad to retrograde BMP signaling, a
pathway that provides an instructive signal for NMJ growth
(O’Connor-Giles et al., 2008). Thus, BMP signaling may integrate
synapse activity status with the control of synapse growth.
Synaptic pMad may also contribute to synapse stability. Mutants in
BMP signaling pathway have an increased number of ‘synaptic
footprints’: regions of the NMJ where the terminal nerve once resided
and has retracted (Eaton and Davis, 2005). It has been proposed that
Gbb binding to its receptors activates the Williams Syndromeassociated Kinase LIMK1 to stabilize the NMJ (Eaton and Davis,
2005). Synaptic pMad may further contribute to the stabilization of
synapse contacts by engaging in interactions that anchor the
Gbb/BMP receptor complexes at synaptic termini. During neural tube
closure, local pSmad1/5/8 mediates stabilization of BMP signaling
complexes at tight junction via binding to apical polarity complexes
(Eom et al., 2011). Flies may utilize a similar anchor mechanism that
relies on pMad-mediated interactions for stabilizing BMP signaling
complexes and other components at synaptic junctions. Local active
443
Development
Fig. 7. GluRIIA activity controls the accumulation of
synaptic pMad. (A-D) Confocal microscopy was performed
on muscle 6/7 (abdominal segment 3) with anti-GluRIIA
antibodies (green), anti-pMad (red) and anti-HRP (blue).
Compared with control (A), muscle expression of a
constitutively active catalytic subunit (PKA-act) produces a
significant reduction in synaptic pMad signals (B). Expression
of one (C) or two (D) copies of a mutant regulatory subunit of
PKA (PKA-inh) induces a small increase in synaptic pMad
accumulation. (E,F) Quantification of synaptic pMad and
GluRIIA signals at various levels of muscle PKA activity.
(G,H) Confocal images of third instar larvae muscle 4
(abdominal segment 3) immunostained with anti-GluRIIA
antibodies (green), anti-pMad (red) and anti-Neto (blue).
Strong postsynaptic PKA activity throughout development
leads to complete loss of synaptic pMad and significant
reduction in GluRIIA synaptic levels compared with control.
(I-L) pMad accumulation in motoneuron nuclei does not
change at various levels of PKA activity in the muscle. Scale
bars: 10 μm (A-D); 5 μm (G,H). Genotypes: (A) control
(BG487-Gal4/UAS-PKAm-inh); (B) PKAact (BG487-Gal4/UASPKA.mC); (C) 1xPKAinh (BG487-Gal4/+; UASPKAinh(GDK33)/+;); (D) 2xPKAinh (BG487-Gal4/UASPKAinh(GDK22); UAS-PKAinh(BDK35)/+;); (G) G14 control
(G14-Gal4/UAS-PKAm-inh); (H) G14>PKAact (G14-Gal4/UASPKA.mC).
RESEARCH ARTICLE
Development (2014) doi:10.1242/dev.097758
Table 1. Genotypes and quantification of bouton numbers
Muscles 6/7 NMJ
Genotype
Bouton number
Boutons/m2104
Segments
counted
P value versus
control
Precise excision
G14/+
G14>GluRIIARNAi
G14>GluRIIERNAi
G14>GluRIICRNAi
G14>GluRIIDRNAi
GluRIIASP16/Df
109.9±6.8
120.3±8.7
87.2±2.8
87.5±3.2
59.4±2.5
45.6±5.3
86±5.2
19.5±1.2
19.3±1.4
15.4±0.5
13.6±1
12±0.5
9.5±1
16.8±1.1
10
11
8
8
10
12
10
1
1
0.044
0.011
0.004
<0.001
0.19
neto109
GluRIIChypo
G14>GluRIIBRNAi
MHC>PKAACT
mad12/Df
64.2±12.9
59.3±2.5
101.8±9.5
121.5±9.3
32.7±4.4
9±0.6
11.7±0.5
15.8±1.4
20.8±1.6
11.4±1.7
10
9
8
7
10
<0.001
<0.001
0.078
0.51
<0.001
witA12/Df
37.2±5.9
9.3±1.4
6
<0.001
References
(Petersen et al., 1997;
Reiff et al., 2002)
(Kim et al., 2012)
(McCabe et al., 2004;
Ball et al., 2010)
(Marqués et al., 2002)
Muscle 4 NMJ
Genotype
Bouton number
Boutons/m2104
Segments counted
P value versus control
Precise excision
G14/+
G14>GluRIIARNAi
G14>GluRIIERNAi
G14>GluRIICRNAi
G14>GluRIIDRNAi
GluRIIASP16/Df
neto109
GluRIIChypo
G14>GluRIIBRNAi
MHC>PKAACT
mad12/Df
witA12/Df
35.3±1.1
36.1±3.2
30.3±1
30.3±1.6
18.7±1.1
15.5±0.7
24.4±1.3
18.9±1.5
19.9±0.8
27.6±4.6
27.6±3
10±1.2
13±1.6
11±0.3
11.2±1
11.5±0.5
9.8±0.5
7.7±0.5
6.4±0.4
9.7±0.5
6.5±0.5
7.3±0.3
10.9±1.8
9.3±1
6.2±1.1
6.7±1
14
8
8
8
10
12
10
8
10
8
10
8
6
1
1
0.203
0.043
<0.001
<0.001
0.031
<0.001
<0.001
0.805
0.046
<0.001
<0.001
Bouton numbers (±s.e.m.) at muscle 4 and muscle 6/7 NMJs, and in abdominal segment A3 are shown.
444
MATERIALS AND METHODS
Fly stocks
The netoRNAi lines were generated by insertion of a neto cDNA PCR
fragment in pUAST-R57 followed by germline transformation using
standard protocols. The PCR primers utilized were: RNAi-F (5′AAGGCCTACATGGCCGGACCGTTGTTTGTGTGACAGTGACAGTGC3′) and RNAi-Rev (5′-AATCTAGAGGTACCTTTTGTGTGAGGTTTGCCAGC-3′). Precise excisions of transposomal elements
Mi(ET1)Neto[MB05569] and Mi(ET1)Neto[MB04917] were utilized to
generate the neto109 and neto36 alleles were used as controls (Bellen et al.,
2011; Kim et al., 2012). The duplication covering neto locus is
Dp(1:3)DC270 (Venken et al., 2010).
Other stocks used in this study are as follows: witA12 and witB11
(Marqués et al., 2002); gbb1 (Khalsa et al., 1998); gbb2 (Wharton et al.,
1999); UAS-gbb9.9 (McCabe et al., 2003) UAS-tkvQ253D (Nellen et al.,
1996) and UAS-saxQ263D (Haerry et al., 1998) (from M. O’Connor,
University of Minnesota); mad1 mutant (Takaesu et al., 2005); mad
deficiency Df(2L)C28 (Adachi-Yamada et al., 1999); GluRIIChypo
(DGluRIII2/df(2L)ast1; P[UAS-cDGluRIII]/+) (Marrus et al., 2004), UASGluRIIAM/R (DiAntonio et al., 1999), GluRIIASP16, Df(2L)clh4, and UASGluRIIA (Petersen et al., 1997) (all from A. DiAntonio, Washington
University); impß1124 and impß1170 (Higashi-Kovtun et al., 2010); UASdynamitin (Duncan and Warrior, 2002); UAS-PKAinh, UAS-PKA.mC (Li et
al., 1995), and control UAS-PKAm-inh (Kiger and O’Shea, 2001) (from B.
White, NIH); BG380-Gal4 and BG487-Gal4 (Budnik et al., 1996); elavGal4 (BL-8760); 24B-Gal4 (BL-1716); G14-Gal4 and MHC-Gal4
(from C. Goodman, University of California at Berkeley). For RNAimediated knockout we used the following TRiP lines generated by the
Transgenic RNAi Project, Harvard Medical School: GluRIIA
Development
BMP signaling complexes are thought to function in this manner in
the maintenance of stemness (Michel et al., 2011) and in epithelial-tomesenchymal transition (Zeisberg et al., 2003).
Separate from its role in synapse growth and stability, BMP
signaling is required presynaptically to maintain the competence of
motoneurons to express homeostatic plasticity (Goold and Davis,
2007). The requirements for BMP signaling components for the rapid
induction of presynaptic response may include a role for synaptic
pMad in relaying acute perturbations of postsynaptic receptor function
to the presynaptic compartment. At the very least, attenuation of local
pMad signals, when postsynaptic type-A receptors are lost or inactive,
may release local Gbb/BMP receptor complexes and allow them to
traffic to neuron soma and increase the BMP transcriptional response,
promoting expression of presynaptic components and neurotransmitter
release. In addition, synaptic pMad-dependent complexes may
influence the composition and/or activity of postsynaptic glutamate
receptors. Although future experiments will be needed to address the
nature and function of local pMad-containing complexes, our findings
clearly demonstrate that synaptic pMad constitutes an exquisite
monitor of synapse activity status, which has the potential to relay
information about synapse activity to both pre- and postsynaptic
compartments and contribute to synaptic plasticity. As BMP signaling
plays a crucial role in synaptic growth and homeostasis at the
Drosophila NMJ, the use of synaptic pMad as a sensor for synapse
activity may enable the BMP signaling pathway to monitor synapse
activity then function to adjust synaptic growth and stability during
development and homeostasis.
RESEARCH ARTICLE
(P[TRiP.JF02647]attP2), GluRIIB (P[TRiP.JF03145]attP2), GluRIIC
(P[TRiP.JF01854]attP2), GluRIID (P[TRiP.JF02035]attP2) and GluRIIE
(P[TRiP.JF01962]attP2).
Protein purification and antibody generation
A rabbit polyclonal anti-GluRIIC antibody was generated against the Nterminal domain of GluRIIC subunit. Drosophila S2 cells were used for
producing recombinant proteins as described previously (Serpe and
O’Connor, 2006). An AcPA-based construct containing the N-terminal
domain of GluRIIC subunit (residues Q48-M446) C-tagged with RGS-Hx6
was transiently transfected into S2 cells, and the secreted fragment was
purified from conditioned supernatant using a His-Trap column (Pharmacia).
The antigen was further purified by SDS-PAGE and the gel pieces were used
for immunization (Open Biosystems). Positive sera were cleaned by protein
A/G affinity, eluted using 0.1 M Gly-HCl (pH 2.8) and quenched with 0.1
vol of 1 M Tris-HCl (pH 9.0).
Development (2014) doi:10.1242/dev.097758
relative expression of target gene using 2–∆∆CT method (Livak and
Schmittgen, 2001). Amplification efficiency, determined by serial dilutions,
was >98% for all primers. RP-49 was used as endogenous control. Primer
pairs utilized were: RP-49-F: TGCACCAGGAACTTCTTGAATCCG; RP49-R: ATGCTAAGCTGTCGCACAAATGGC; twit-F: GCCTGGCACATCACAGCCATAAAT; twit-R: TTAATGGTGCCGTTGCAGCTCCTT;
gbb-F: TAATGTCGGGACTGCGAAACACCT; gbb-R: TCAGCACTCTGTGCATGATCGTCT.
Acknowledgements
We thank Bing Zhang, Ed Giniger, Mark Mayer, Chi-Hon Lee and Alan Hinnebusch
for helpful discussions and suggestions. We are grateful to Aaron DiAntonio, Carl
Heldin, Mike O’Connor and Ben White for antibodies and Drosophila stocks. We
thank Peter Nguyen for technical assistance. We also thank the Bloomington
Stock Center at the University of Indiana for fly stocks and the Developmental
Studies Hybridoma Bank at the University of Iowa for antibodies.
Competing interests
Embryos 18 hours AEL were dechorionated, genotyped and, after an
additional incubation (2 hours at room temperature), dissected as described
previously (Budnik et al., 2006). Larvae were dissected as described
previously in ice-cooled Ca2+-free HL-3 solution (Stewart et al., 1994;
Budnik et al., 2006). The samples were fixed in either 4% formaldehyde
(Polysciences) for 30 minutes or in Bouin’s fixative (Bio-Rad) for 3 minutes
and washed in phosphate-buffered saline (PBS) containing 0.5% Triton X100. Primary antibodies from Developmental Studies Hybridoma Bank were
used at the following dilutions: mouse anti-GluRIIA (MH2B), 1:200; mouse
anti-Disc-large (Dlg) (4F3), 1:1000; mouse anti-Bruchpilot (Brp) (Nc82),
1:200; mouse anti-Wishful thinking (Wit) (23C7), 1:10. Other primary
antibodies were as follows: rabbit anti-phosphorylated Mothers against
decapentaplegic (pMad), 1:500 (a gift from Carl Heldin) (Persson et al.,
1998); rabbit anti-pMad, 1:100 (Peluso et al., 2011); rabbit anti-pSmad3,
1:500 (Epitomics) (Smith et al., 2012); rabbit anti-GluRIIB, 1:2000 (a gift
from Aaron DiAntonio) (Marrus et al., 2004); goat anti-Mad, 1:100 (Santa
Cruz Biotechnology); FITC-, rhodamine- and Cy5- conjugated goat antiHRP, 1:1000 (Jackson ImmunoResearch Laboratories); rabbit anti-GFP,
1:250 (Abcam); rat anti-Neto, 1:1000 (Kim et al., 2012). Alexa Fluor 488-,
Alexa Fluor 568- and Alexa Fluor 647-conjugated secondary antibodies
(Molecular Probes) were used at 1:400. All samples were mounted in
ProLong Gold (Invitrogen). Samples of different genotypes were processed
simultaneously and imaged under identical confocal settings using laser
scanning confocal microscopes (Carl Zeiss 510 and LSM710). Boutons were
counted using anti-HRP and anti-Dlg immunoreactivities. All quantifications
were performed while blinded to genotype. The numbers of samples
analyzed are indicated inside the bars.
Fluorescence intensity measurements
For nuclear pMad, confocal regions of interest (ROIs) were determined with
Imaris software (Bitplane) by using the ‘spots’ feature to automatically
identify pMad-positive motor nuclei. Spots were verified manually and
mean center intensity for all nuclei in a given sample was recorded. This
procedure was repeated for all samples of a given genotype and the mean
was used for comparison between genotypes. For NMJ signal
quantifications, mean signal intensity within the ROI encompassing the
synaptic area was normalized to HRP signal. Student’s t-test was performed
using Sigma Plot (Systat) to evaluate statistical significance. All graphs
represent mean value of all samples of the given genotype ± s.e.m.
cDNA synthesis and quantitative real-time PCR
Ventral ganglia or carcasses were dissected in ice-cold HL-3, transferred in
DEPC-treated PBS, and frozen on dry ice. Three independent samples (ten
carcasses or 30 ventral ganglia per sample) were prepared for each genotype.
Total RNA was isolated using Trizol (Invitrogen), purified with an RNeasy
kit (Qiagen), and verified with Agilent Bioanalyzer. The RNA was reverse
transcribed using AccuScript (Agilent), and qPCR reactions were prepared
using Power Sybr Green (Invitrogen) and run on Applied Biosystems
StepOnePlus system. Mean Ct of triplicate reactions was used to determine
The authors declare no competing financial interests.
Author contributions
M. Sulkowski, Y.-J.K. and M. Serpe designed and performed the experiments; M.
Sulkowski and M. Serpe wrote the paper.
Funding
This research was supported by the Intramural Research Program of the National
Institutes of Health, National Institute of Child Health and Human Development
[grants Z01 HD008869 and Z01 HD008914]. Deposited in PMC for release after
12 months.
Supplementary material
Supplementary material available online at
http://dev.biologists.org/lookup/suppl/doi:10.1242/dev.097758/-/DC1
References
Aberle, H., Haghighi, A. P., Fetter, R. D., McCabe, B. D., Magalhães, T. R. and
Goodman, C. S. (2002). wishful thinking encodes a BMP type II receptor that
regulates synaptic growth in Drosophila. Neuron 33, 545-558.
Adachi-Yamada, T., Nakamura, M., Irie, K., Tomoyasu, Y., Sano, Y., Mori, E., Goto,
S., Ueno, N., Nishida, Y. and Matsumoto, K. (1999). p38 mitogen-activated
protein kinase can be involved in transforming growth factor beta superfamily
signal transduction in Drosophila wing morphogenesis. Mol. Cell. Biol. 19, 23222329.
Akiyama, T., Marqués, G. and Wharton, K. A. (2012). A large bioactive BMP ligand
with distinct signaling properties is produced by alternative proconvertase
processing. Sci. Signal. 5, ra28.
Ball, R. W., Warren-Paquin, M., Tsurudome, K., Liao, E. H., Elazzouzi, F.,
Cavanagh, C., An, B. S., Wang, T. T., White, J. H. and Haghighi, A. P. (2010).
Retrograde BMP signaling controls synaptic growth at the NMJ by regulating trio
expression in motor neurons. Neuron 66, 536-549.
Bellen, H. J., Levis, R. W., He, Y., Carlson, J. W., Evans-Holm, M., Bae, E., Kim, J.,
Metaxakis, A., Savakis, C., Schulze, K. L. et al. (2011). The Drosophila gene
disruption project: progress using transposons with distinctive site specificities.
Genetics 188, 731-743.
Budnik, V., Koh, Y. H., Guan, B., Hartmann, B., Hough, C., Woods, D. and
Gorczyca, M. (1996). Regulation of synapse structure and function by the
Drosophila tumor suppressor gene dlg. Neuron 17, 627-640.
Budnik, V., Gorczyca, M. and Prokop, A. (2006). Selected methods for the
anatomical study of Drosophila embryonic and larval neuromuscular junctions. Int.
Rev. Neurobiol. 75, 323-365.
Dani, N., Nahm, M., Lee, S. and Broadie, K. (2012). A targeted glycan-related gene
screen reveals heparan sulfate proteoglycan sulfation regulates WNT and BMP
trans-synaptic signaling. PLoS Genet. 8, e1003031.
Davis, G. W. (2006). Homeostatic control of neural activity: from phenomenology to
molecular design. Annu. Rev. Neurosci. 29, 307-323.
Davis, G. W., DiAntonio, A., Petersen, S. A. and Goodman, C. S. (1998).
Postsynaptic PKA controls quantal size and reveals a retrograde signal that
regulates presynaptic transmitter release in Drosophila. Neuron 20, 305-315.
DiAntonio, A. (2006). Glutamate receptors at the Drosophila neuromuscular junction.
Int. Rev. Neurobiol. 75, 165-179.
DiAntonio, A., Petersen, S. A., Heckmann, M. and Goodman, C. S. (1999).
Glutamate receptor expression regulates quantal size and quantal content at the
Drosophila neuromuscular junction. J. Neurosci. 19, 3023-3032.
Dickman, D. K. and Davis, G. W. (2009). The schizophrenia susceptibility gene
dysbindin controls synaptic homeostasis. Science 326, 1127-1130.
Dudu, V., Bittig, T., Entchev, E., Kicheva, A., Jülicher, F. and González-Gaitán, M.
(2006). Postsynaptic mad signaling at the Drosophila neuromuscular junction. Curr.
Biol. 16, 625-635.
445
Development
Immunohistology
Duncan, J. E. and Warrior, R. (2002). The cytoplasmic dynein and kinesin motors have
interdependent roles in patterning the Drosophila oocyte. Curr. Biol. 12, 1982-1991.
Eaton, B. A. and Davis, G. W. (2005). LIM Kinase1 controls synaptic stability
downstream of the type II BMP receptor. Neuron 47, 695-708.
Ellis, J. E., Parker, L., Cho, J. and Arora, K. (2010). Activin signaling functions
upstream of Gbb to regulate synaptic growth at the Drosophila neuromuscular
junction. Dev. Biol. 342, 121-133.
Eom, D. S., Amarnath, S., Fogel, J. L. and Agarwala, S. (2011). Bone
morphogenetic proteins regulate neural tube closure by interacting with the
apicobasal polarity pathway. Development 138, 3179-3188.
Featherstone, D. E., Rushton, E., Rohrbough, J., Liebl, F., Karr, J., Sheng, Q.,
Rodesch, C. K. and Broadie, K. (2005). An essential Drosophila glutamate receptor
subunit that functions in both central neuropil and neuromuscular junction. J.
Neurosci. 25, 3199-3208.
Frank, C. A., Kennedy, M. J., Goold, C. P., Marek, K. W. and Davis, G. W. (2006).
Mechanisms underlying the rapid induction and sustained expression of synaptic
homeostasis. Neuron 52, 663-677.
Frank, C. A., Pielage, J. and Davis, G. W. (2009). A presynaptic homeostatic
signaling system composed of the Eph receptor, ephexin, Cdc42, and CaV2.1
calcium channels. Neuron 61, 556-569.
Fuentes-Medel, Y., Ashley, J., Barria, R., Maloney, R., Freeman, M. and Budnik, V.
(2012). Integration of a retrograde signal during synapse formation by glia-secreted
TGF-β ligand. Curr. Biol. 22, 1831-1838.
Goold, C. P. and Davis, G. W. (2007). The BMP ligand Gbb gates the expression of
synaptic homeostasis independent of synaptic growth control. Neuron 56, 109-123.
Haerry, T. E., Khalsa, O., O’Connor, M. B. and Wharton, K. A. (1998). Synergistic
signaling by two BMP ligands through the SAX and TKV receptors controls wing
growth and patterning in Drosophila. Development 125, 3977-3987.
Haghighi, A. P., McCabe, B. D., Fetter, R. D., Palmer, J. E., Hom, S. and Goodman,
C. S. (2003). Retrograde control of synaptic transmission by postsynaptic CaMKII at
the Drosophila neuromuscular junction. Neuron 39, 255-267.
Higashi-Kovtun, M. E., Mosca, T. J., Dickman, D. K., Meinertzhagen, I. A. and
Schwarz, T. L. (2010). Importin-beta11 regulates synaptic phosphorylated mothers
against decapentaplegic, and thereby influences synaptic development and function
at the Drosophila neuromuscular junction. J. Neurosci. 30, 5253-5268.
James, R. E. and Broihier, H. T. (2011). Crimpy inhibits the BMP homolog Gbb in
motoneurons to enable proper growth control at the Drosophila neuromuscular
junction. Development 138, 3273-3286.
Keshishian, H. and Kim, Y. S. (2004). Orchestrating development and function:
retrograde BMP signaling in the Drosophila nervous system. Trends Neurosci. 27,
143-147.
Khalsa, O., Yoon, J. W., Torres-Schumann, S. and Wharton, K. A. (1998). TGFbeta/BMP superfamily members, Gbb-60A and Dpp, cooperate to provide pattern
information and establish cell identity in the Drosophila wing. Development 125,
2723-2734.
Kiger, J. A., Jr and O’Shea, C. (2001). Genetic evidence for a protein kinase
A/cubitus interruptus complex that facilitates processing of cubitus interruptus in
Drosophila. Genetics 158, 1157-1166.
Kim, N. C. and Marqués, G. (2012). The Ly6 neurotoxin-like molecule target of wit
regulates spontaneous neurotransmitter release at the developing neuromuscular
junction in Drosophila. Dev. Neurobiol. 72, 1541-1558.
Kim, Y. J., Bao, H., Bonanno, L., Zhang, B. and Serpe, M. (2012). Drosophila Neto is
essential for clustering glutamate receptors at the neuromuscular junction. Genes
Dev. 26, 974-987.
Lee, H. X., Mendes, F. A., Plouhinec, J. L. and De Robertis, E. M. (2009). Enzymatic
regulation of pattern: BMP4 binds CUB domains of Tolloids and inhibits proteinase
activity. Genes Dev. 23, 2551-2562.
Li, W., Ohlmeyer, J. T., Lane, M. E. and Kalderon, D. (1995). Function of protein
kinase A in hedgehog signal transduction and Drosophila imaginal disc development.
Cell 80, 553-562.
Littleton, J. T. and Ganetzky, B. (2000). Ion channels and synaptic organization:
analysis of the Drosophila genome. Neuron 26, 35-43.
Livak, K. J. and Schmittgen, T. D. (2001). Analysis of relative gene expression data
using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 25,
402-408.
Malenka, R. C. and Nicoll, R. A. (1999). Long-term potentiation – a decade of
progress? Science 285, 1870-1874.
Marie, B., Pym, E., Bergquist, S. and Davis, G. W. (2010). Synaptic homeostasis is
consolidated by the cell fate gene gooseberry, a Drosophila pax3/7 homolog. J.
Neurosci. 30, 8071-8082.
Marqués, G. (2005). Morphogens and synaptogenesis in Drosophila. J. Neurobiol. 64,
417-434.
Marqués, G. and Zhang, B. (2006). Retrograde signaling that regulates synaptic
development and function at the Drosophila neuromuscular junction. Int. Rev.
Neurobiol. 75, 267-285.
Marqués, G., Bao, H., Haerry, T. E., Shimell, M. J., Duchek, P., Zhang, B. and
O’Connor, M. B. (2002). The Drosophila BMP type II receptor Wishful Thinking
regulates neuromuscular synapse morphology and function. Neuron 33, 529-543.
Marrus, S. B., Portman, S. L., Allen, M. J., Moffat, K. G. and DiAntonio, A. (2004).
Differential localization of glutamate receptor subunits at the Drosophila
neuromuscular junction. J. Neurosci. 24, 1406-1415.
McCabe, B. D., Marqués, G., Haghighi, A. P., Fetter, R. D., Crotty, M. L., Haerry, T.
E., Goodman, C. S. and O’Connor, M. B. (2003). The BMP homolog Gbb provides
a retrograde signal that regulates synaptic growth at the Drosophila neuromuscular
junction. Neuron 39, 241-254.
446
Development (2014) doi:10.1242/dev.097758
McCabe, B. D., Hom, S., Aberle, H., Fetter, R. D., Marques, G., Haerry, T. E., Wan,
H., O’Connor, M. B., Goodman, C. S. and Haghighi, A. P. (2004). Highwire
regulates presynaptic BMP signaling essential for synaptic growth. Neuron 41, 891905.
Merino, C., Penney, J., González, M., Tsurudome, K., Moujahidine, M., O’Connor,
M. B., Verheyen, E. M. and Haghighi, P. (2009). Nemo kinase interacts with Mad to
coordinate synaptic growth at the Drosophila neuromuscular junction. J. Cell Biol.
185, 713-725.
Michel, M., Raabe, I., Kupinski, A. P., Pérez-Palencia, R. and Bökel, C. (2011).
Local BMP receptor activation at adherens junctions in the Drosophila germline stem
cell niche. Nat. Commun. 2, 415.
Müller, M. and Davis, G. W. (2012). Transsynaptic control of presynaptic Ca² influx
achieves homeostatic potentiation of neurotransmitter release. Curr. Biol. 22, 11021108.
Müller, M., Pym, E. C., Tong, A. and Davis, G. W. (2011). Rab3-GAP controls the
progression of synaptic homeostasis at a late stage of vesicle release. Neuron 69,
749-762.
Nahm, M., Kim, S., Paik, S. K., Lee, M., Lee, S., Lee, Z. H., Kim, J., Lee, D., Bae, Y.
C. and Lee, S. (2010). dCIP4 (Drosophila Cdc42-interacting protein 4) restrains
synaptic growth by inhibiting the secretion of the retrograde Glass bottom boat
signal. J. Neurosci. 30, 8138-8150.
Nahm, M., Lee, M. J., Parkinson, W., Lee, M., Kim, H., Kim, Y. J., Kim, S., Cho, Y.
S., Min, B. M., Bae, Y. C. et al. (2013). Spartin regulates synaptic growth and
neuronal survival by inhibiting BMP-mediated microtubule stabilization. Neuron 77,
680-695.
Nellen, D., Burke, R., Struhl, G. and Basler, K. (1996). Direct and long-range action
of a DPP morphogen gradient. Cell 85, 357-368.
O’Connor, M. B., Umulis, D., Othmer, H. G. and Blair, S. S. (2006). Shaping BMP
morphogen gradients in the Drosophila embryo and pupal wing. Development 133,
183-193.
O’Connor-Giles, K. M. and Ganetzky, B. (2008). Satellite signaling at synapses. Fly
(Austin) 2, 259-261.
O’Connor-Giles, K. M., Ho, L. L. and Ganetzky, B. (2008). Nervous wreck interacts
with thickveins and the endocytic machinery to attenuate retrograde BMP signaling
during synaptic growth. Neuron 58, 507-518.
Peluso, C. E., Umulis, D., Kim, Y. J., O’Connor, M. B. and Serpe, M. (2011).
Shaping BMP morphogen gradients through enzyme-substrate interactions. Dev.
Cell 21, 375-383.
Persson, U., Izumi, H., Souchelnytskyi, S., Itoh, S., Grimsby, S., Engström, U.,
Heldin, C. H., Funa, K. and ten Dijke, P. (1998). The L45 loop in type I receptors for
TGF-beta family members is a critical determinant in specifying Smad isoform
activation. FEBS Lett. 434, 83-87.
Petersen, S. A., Fetter, R. D., Noordermeer, J. N., Goodman, C. S. and DiAntonio,
A. (1997). Genetic analysis of glutamate receptors in Drosophila reveals a
retrograde signal regulating presynaptic transmitter release. Neuron 19, 1237-1248.
Qin, G., Schwarz, T., Kittel, R. J., Schmid, A., Rasse, T. M., Kappei, D.,
Ponimaskin, E., Heckmann, M. and Sigrist, S. J. (2005). Four different subunits
are essential for expressing the synaptic glutamate receptor at neuromuscular
junctions of Drosophila. J. Neurosci. 25, 3209-3218.
Ramel, M. C. and Hill, C. S. (2012). Spatial regulation of BMP activity. FEBS Lett. 586,
1929-1941.
Reiff, D. F., Thiel, P. R. and Schuster, C. M. (2002). Differential regulation of active
zone density during long-term strengthening of Drosophila neuromuscular junctions.
J. Neurosci. 22, 9399-9409.
Sanes, J. R. and Lichtman, J. W. (1999). Development of the vertebrate
neuromuscular junction. Annu. Rev. Neurosci. 22, 389-442.
Sengle, G., Ono, R. N., Sasaki, T. and Sakai, L. Y. (2011). Prodomains of
transforming growth factor beta (TGFbeta) superfamily members specify different
functions: extracellular matrix interactions and growth factor bioavailability. J. Biol.
Chem. 286, 5087-5099.
Serpe, M. and O’Connor, M. B. (2006). The metalloprotease tolloid-related and its
TGF-beta-like substrate Dawdle regulate Drosophila motoneuron axon guidance.
Development 133, 4969-4979.
Sigrist, S. J., Thiel, P. R., Reiff, D. F. and Schuster, C. M. (2002). The postsynaptic
glutamate receptor subunit DGluR-IIA mediates long-term plasticity in Drosophila. J.
Neurosci. 22, 7362-7372.
Sigrist, S. J., Reiff, D. F., Thiel, P. R., Steinert, J. R. and Schuster, C. M. (2003).
Experience-dependent strengthening of Drosophila neuromuscular junctions. J.
Neurosci. 23, 6546-6556.
Smith, R. B., Machamer, J. B., Kim, N. C., Hays, T. S. and Marqués, G. (2012).
Relay of retrograde synaptogenic signals through axonal transport of BMP receptors.
J. Cell Sci. 125, 3752-3764.
Stewart, B. A., Atwood, H. L., Renger, J. J., Wang, J. and Wu, C. F. (1994).
Improved stability of Drosophila larval neuromuscular preparations in haemolymphlike physiological solutions. J. Comp. Physiol. A 175, 179-191.
Sweeney, S. T. and Davis, G. W. (2002). Unrestricted synaptic growth in spinster-a
late endosomal protein implicated in TGF-beta-mediated synaptic growth regulation.
Neuron 36, 403-416.
Takaesu, N. T., Herbig, E., Zhitomersky, D., O’Connor, M. B. and Newfeld, S. J.
(2005). DNA-binding domain mutations in SMAD genes yield dominant-negative
proteins or a neomorphic protein that can activate WG target genes in Drosophila.
Development 132, 4883-4894.
Tao, H. W. and Poo, M. (2001). Retrograde signaling at central synapses. Proc. Natl.
Acad. Sci. USA 98, 11009-11015.
Development
RESEARCH ARTICLE
Tucker, J. A., Mintzer, K. A. and Mullins, M. C. (2008). The BMP signaling gradient
patterns dorsoventral tissues in a temporally progressive manner along the
anteroposterior axis. Dev. Cell 14, 108-119.
Turrigiano, G. (2007). Homeostatic signaling: the positive side of negative feedback.
Curr. Opin. Neurobiol. 17, 318-324.
Turrigiano, G. (2012). Homeostatic synaptic plasticity: local and global mechanisms
for stabilizing neuronal function. Cold Spring Harb. Perspect. Biol. 4, a005736.
Venken, K. J., Popodi, E., Holtzman, S. L., Schulze, K. L., Park, S., Carlson, J. W.,
Hoskins, R. A., Bellen, H. J. and Kaufman, T. C. (2010). A molecularly defined
duplication set for the X chromosome of Drosophila melanogaster. Genetics 186,
1111-1125.
Development (2014) doi:10.1242/dev.097758
Wang, X., Shaw, W. R., Tsang, H. T., Reid, E. and O’Kane, C. J. (2007). Drosophila
spichthyin inhibits BMP signaling and regulates synaptic growth and axonal
microtubules. Nat. Neurosci. 10, 177-185.
Wharton, K. A., Cook, J. M., Torres-Schumann, S., de Castro, K., Borod, E. and
Phillips, D. A. (1999). Genetic analysis of the bone morphogenetic protein-related
gene, gbb, identifies multiple requirements during Drosophila development. Genetics
152, 629-640.
Zeisberg, M., Hanai, J., Sugimoto, H., Mammoto, T., Charytan, D., Strutz, F.
and Kalluri, R. (2003). BMP-7 counteracts TGF-beta1-induced epithelial-tomesenchymal transition and reverses chronic renal injury. Nat. Med. 9, 964968.
Development
RESEARCH ARTICLE
447