© 2014. Published by The Company of Biologists Ltd | Development (2014) 141, 281-295 doi:10.1242/dev.093690
RESEARCH ARTICLE
STEM CELLS AND REGENERATION
Numb family proteins are essential for cardiac morphogenesis
and progenitor differentiation
ABSTRACT
Numb family proteins (NFPs), including Numb and numb-like
(Numbl), are cell fate determinants for multiple progenitor cell types.
Their functions in cardiac progenitor differentiation and cardiac
morphogenesis are unknown. To avoid early embryonic lethality and
study NFP function in later cardiac development, Numb and Numbl
were deleted specifically in heart to generate myocardial doubleknockout (MDKO) mice. MDKOs were embryonic lethal and
displayed a variety of defects in cardiac progenitor differentiation,
cardiomyocyte proliferation, outflow tract (OFT) and atrioventricular
septation, and OFT alignment. By ablating NFPs in different cardiac
populations followed by lineage tracing, we determined that NFPs in
the second heart field (SHF) are required for OFT and atrioventricular
septation and OFT alignment. MDKOs displayed an SHF progenitor
cell differentiation defect, as revealed by a variety of methods
including mRNA deep sequencing. Numb regulated cardiac
progenitor cell differentiation in an endocytosis-dependent manner.
Studies including the use of a transgenic Notch reporter line showed
that Notch signaling was upregulated in the MDKO. Suppression of
Notch1 signaling in MDKOs rescued defects in p57 expression,
proliferation and trabecular thickness. Further studies showed that
Numb inhibits Notch1 signaling by promoting the degradation of the
Notch1 intracellular domain in cardiomyocytes. This study reveals
that NFPs regulate trabecular thickness by inhibiting Notch1
signaling, control cardiac morphogenesis in a Notch1-independent
manner, and regulate cardiac progenitor cell differentiation in an
endocytosis-dependent manner. The function of NFPs in cardiac
progenitor differentiation and cardiac morphogenesis suggests that
NFPs might be potential therapeutic candidates for cardiac
regeneration and congenital heart diseases.
KEY WORDS: Numb family proteins, Cardiac progenitor cell,
Cardiac morphogenesis, Mouse
INTRODUCTION
Congenital heart defects (CHDs) occur in ~1% of live births
(Hoffman and Kaplan, 2002), yet knowledge of the underlying
genetic causes of the specific structural defects involved is still
limited (Olson, 2006; Bruneau, 2008). Moreover, the lack of
understanding of how cardiac progenitor cells renew and
differentiate in vivo has impeded progress toward treating
1
Cardiovascular Science Center, Albany Medical College, Albany, NY 12208, USA.
Molecular, Cellular and Developmental Biology, Yale University, New Haven, CT
06520, USA. 3Biology and Biochemistry, University of Houston, Houston, TX
77204-5001, USA. 4JABSOM, Center for Cardiovascular Research, University of
Hawaii, Honolulu, HI 96813, USA.
*These authors contributed equally to this work
2
‡
Author for correspondence ([email protected])
Received 1 January 2013; Accepted 21 October 2013
cardiovascular disease by cardiac regeneration using endogenous
cardiac progenitors.
Drosophila Numb, an intracellular adaptor protein, was the first
molecule discovered to influence cell fate by its asymmetric
segregation during cell division (Rhyu et al., 1994) and by inhibiting
Notch signaling (Uemura et al., 1989; Frise et al., 1996; Spana and
Doe, 1996; Petersen et al., 2002). In mice, Numb has two homologs,
Numb and numb-like (Numbl), collectively known as Numb family
proteins (NFPs). NFPs are nearly ubiquitously expressed during
embryogenesis (Zhong et al., 1997) and are known to function as
cell fate determinants by maintaining neural stem cell fate and
regulating its differentiation (Verdi et al., 1996; Petersen et al., 2002;
Li et al., 2003; Petersen et al., 2004). NFPs are also involved in the
specification and differentiation of hematopoietic stem cells (Wu et
al., 2007), muscle satellite cells (Conboy and Rando, 2002), cancer
stem cells (Ito et al., 2010) and hemangioblasts (Cheng et al., 2008).
Recently, additional mechanisms of Numb signaling at the
molecular level have been revealed. Numb functions as a component
of the adherens junction to regulate cell adhesion and migration
(Rasin et al., 2007; Wang et al., 2009; Wu et al., 2010), and is
involved in the ubiquitylation of p53 (Trp53) (Colaluca et al., 2008)
and Gli1 (Di Marcotullio et al., 2006) to regulate cancer initiation.
Numb has also been reported to complex with β-catenin (Rasin et
al., 2007; Wu et al., 2010; Kwon et al., 2011) to regulate Wnt
signaling. Additionally, Numb interacts with integrin β subunits
(Calderwood et al., 2003) and promotes their endocytosis for
directional cell migration (Nishimura and Kaibuchi, 2007).
Cardiac development is a spatiotemporally regulated multistep
morphogenetic process that depends on the addition of progenitor
cells from four different sources, including cells from the first
heart field and second heart field (FHF and SHF), cells derived
from cardiac neural crest cells (CNCCs) and cells derived from the
pro-epicardial organ (Kelly et al., 2001; Mjaatvedt et al., 2001;
Waldo et al., 2001; Verzi et al., 2005; Vincent and Buckingham,
2010). The SHF progenitor cells migrate to the pre-existing
scaffold of the linear heart tube and contribute to the right
ventricle, outflow tract (OFT) myocardium and to some
endocardium at embryonic day (E) 8.5-10.25 (Kelly and
Buckingham, 2002; Buckingham et al., 2005; Verzi et al., 2005;
Ward et al., 2005). Perturbation of SHF deployment and progenitor
differentiation leads to a spectrum of CHDs (Kelly, 2012) and is
responsible for the majority of CHDs (Buckingham et al., 2005;
Bruneau, 2008). The posterior SHF contributes to the dorsal
mesenchymal protrusion (DMP), an essential structure for
chamber septation (Snarr et al., 2007a). Abnormal differentiation
and development of the posterior SHF has been associated with
cardiac morphogenesis defects, such as atrial septal defect (ASD)
and atrioventricular septal defect (AVSD) (Briggs et al., 2012).
However, the molecules and the mechanisms that regulate
posterior SHF development are not entirely clear.
281
Development
Chen Zhao1,*, Hua Guo1,*, Jingjing Li1, Thomas Myint1, William Pittman1, Le Yang1, Weimin Zhong2,
Robert J. Schwartz3, John J. Schwarz1, Harold A. Singer1, Michelle D. Tallquist4 and Mingfu Wu1,‡
RESEARCH ARTICLE
Development (2014) doi:10.1242/dev.093690
Fig. 1. MDKO hearts display a
variety of morphogenetic
defects. (A) Numb (Nb) and
Numbl (Nl) deletions in the MDKO
and control mouse hearts at
different embryonic stages were
examined by Q-PCR. The control
is set at 1.0. (B) Numb deletion in
the MDKO was confirmed by
western blot using E12.5
ventricles. (C,D) Numb was
deleted in cardiomyocytes, but not
in epicardial and endothelial cells
(arrows). (E) MDKO hearts
displayed an outflow tract (OFT)
delayed septation defect at E12.5.
(F) MDKO hearts displayed
pulmonary artery and aortic
alignment defects, with both aortic
and pulmonary valves in the same
plane and both arteries extending
from the right ventricle (RV). The
blue arrows indicate aorta (Ao),
pulmonary artery (PA) and their
valves. (G,H) MDKO displayed
double outlet right ventricle
(DORV) and atrioventricular septal
defect (AVSD), as indicated by the
blue arrows. Scale bars: 50 μm in
C,D; 100 μm in E-H.
282
MDKOs. In summary, NFPs inhibit Notch1 to regulate
cardiomyocyte proliferation and trabecular thickness, and mediate
cardiac progenitor cell differentiation in an endocytosis-dependent,
Notch1-independent manner.
RESULTS
NFPs are essential for cardiac development and
morphogenesis
Numb and Numbl were deleted in mouse heart by Nkx2.5Cre/+, which
is active in myocardium (Moses et al., 2001) and some endocardial
cells based on the Rosa26-mTmG (mTmG) reporter line
(supplementary material Fig. S1A-C, Movie 1) (Muzumdar et al.,
2007). We refer to these mice as Numb and Numbl myocardial
double knockout (MDKO). Loss of expression of Numb and Numbl
in E9.5-13.5 MDKO ventricles was 70-90% as determined by QPCR (Fig. 1A) and western blot (Fig. 1B). Immunofluorescence (IF)
staining confirmed the deletion of Numb in the myocardium of the
MDKO (Fig. 1C,D) and indicated that the 10-30% residual
expression was due to Numb expression in epicardial and
endocardial cells (Fig. 1C,D).
No MDKO animals from 20 litters survived to birth, whereas
deletion of up to three alleles of Numb and Numbl in any
combination resulted in animals that survived to adulthood and
displayed no gross morphological or cardiac morphogenetic defects
(Table 1; supplementary material Fig. S1D), indicating that Numb
Development
Knowledge of NFP function in the mammalian heart is limited
and the specific role of NFPs in cardiac development is still unclear.
In Drosophila, Numb is implicated in controlling myogenic cell fate
by interfering with Notch signaling (Han and Bodmer, 2003). In
zebrafish, Numb is required for heart left-right asymmetric
morphogenesis via regulation of Notch signaling (Niikura et al.,
2006). In mice, Numb is reportedly expressed in adult cardiac
progenitor cells and is asymmetrically distributed during progenitor
asymmetric division (Cottage et al., 2010; Mishra et al., 2011).
Additionally, we have shown that NFPs are essential for epicardial
cells entering into myocardium (Wu et al., 2010). Very recent work
has shown that NFPs regulate myocardial compaction by inhibiting
Notch2 (Yang et al., 2012).
We previously reported that conditional deletion of NFPs in
epicardial cells caused epicardial cell epithelial-mesenchymal
transition defects (Wu et al., 2010). In this study, we deleted NFPs
via Nkx2.5Cre/+ to generate Numb and Numbl myocardial doubleknockout (MDKO) mice, and found that NFPs are required for
myocardial trabeculation, cardiac progenitor cell differentiation,
cardiomyocyte proliferation, OFT and atrioventricular septation and
OFT alignment. Deletion of NFPs in the SHF recapitulated the
morphogenetic defects of the MDKO. Further biochemical and
genetic studies revealed that Notch1 signaling is upregulated in the
myocardium of MDKOs and suppression of Notch1 signaling
partially rescued the defects of trabeculation and proliferation in
RESEARCH ARTICLE
Development (2014) doi:10.1242/dev.093690
Table 1. Survival rate of MDKO mice and embryos
Age
n
Heterozygous
MDKO
Harvested/expected percentage of MDKO
P1 or older
E15.5-18.5
E14.5
E13.5
E12.5
E11.5
E10.5
E9.5
124
260
182
320
355
320
426
226
30
68
46
82
88
79
106
56
0
15
18
53
69
82
108
54
0/25
6/25
10/25
17/25
19/25
25/25
25/25
25/25
Data were generated from a minimum of 20 litters at each time point. Nkx2.5-Cre+/−; Numbfl/+; Numblfl/fl or Nkx2.5-Cre+/−; Numbfl/fl; Numblfl/+ males were crossed
to Numbfl/fl; Numblfl/fl females to generate the MDKO. Nkx2.5-Cre+/−; Numbfl/+; Numblfl/fl and Nkx2.5-Cre+/−; Numbfl/fl; Numblfl/+ are designated as heterozygous
and Nkx2.5-Cre+/−; Numbfl/fl; Numblfl/fl is designated as MDKO.
n, total number of offspring or embryos.
NFPs regulate ventricular trabeculation in a cardiomyocyteautonomous manner
We then examined the formation of trabeculae, which are sheet-like
structures extending from the compact zone, in control and MDKO
hearts. E10.5 MDKO; mTmG and Nkx2.5Cre/+; mTmG embryos, in
which Nkx2.5-expressing cells were GFP positive, were stained for
PECAM (Pecam1) to identify endocardial/endothelial cells. When
whole hearts were three-dimensionally (3D) imaged by confocal
microscopy we found that control trabecula had a diameter of one
or two cells, whereas the MDKO trabecula had a diameter of two or
three cells at E10.5 (Fig. 2A,B; supplementary material Movie 2,
Fig. S3). The number of trabeculae and the thickness of the
trabeculae and the compact zone were quantified. Beginning at
E10.5, MDKO hearts displayed fewer trabeculae per unit length but
thicker trabeculae compared with controls (Fig. 2C-E). The
thickness of the compact zone was not significantly different
between control and MDKO from E10.5 to E13.5, whereas at E14.5
the compact zone of MDKO was thinner than that of the control
(Fig. 2C-E), indicating a non-compaction defect, consistent with a
previous report (Yang et al., 2012). Dual-fluorescence staining of
heart sections with MF20 (which recognizes myosin II heavy chain)
and PECAM antibodies (Chen et al., 2009) showed that endocardial
cells could invade the cardiac jelly and surround the myocardium in
both MDKO and control (Fig. 2A-D), indicating that the
trabeculation defect was not due to a defect in endocardial cell
invasion.
The variety of defects in the MDKO might be caused by the loss
of NFP function in different cardiac cell types. To determine the
population that is responsible for these morphogenetic defects,
SM22-Cre, Tie2-Cre, Wnt1-Cre, WT1CreERT2 and Mef2c-Cre were
applied to delete NFPs in cardiomyocytes, endothelial cells, CNCCs,
epicardial cells and cells derived from the SHF, respectively. The
deletion of NFPs in cardiomyocytes via SM22-Cre, which is
expressed in cardiomyocytes at the early stage of heart development
in addition to its expression in smooth muscle cells (Li et al., 1996;
Umans et al., 2007; Stankunas et al., 2008), resulted in trabeculation
defects with thicker trabeculae and a decreased number of trabeculae
per unit length at E14.5 (supplementary material Fig. S2A,B),
whereas NFP deletion mediated by Tie2-Cre, Wnt1-Cre or
WT1CreERT2 did not display any trabeculation defects (supplementary
material Fig. S2A-D; data not shown), indicating that NFPs regulate
trabeculation in a cardiomyocyte-autonomous manner.
NFPs in the SHF are required for OFT and atrioventricular
septation
We further determined that NFP deletion mediated by SM22-Cre,
Tie2-Cre and WT1CreERT2 in cardiomyocytes, endocardial/endothelial
cells and epicardial cells, respectively, did not display any defects in
morphogenesis (supplementary material Fig. S2A; data not shown),
indicating that the function of NFPs in differentiated
cardiomyocytes, endocardial cells or epicardial cells does not
contribute to cardiac morphogenesis. Wnt1-Cre-mediated NFP
deletion in CNCCs caused cranial facial defects (supplementary
material Fig. S2C), but no obvious cardiac morphogenesis defect
(supplementary material Fig. S2D), indicating that NFP function in
Table 2. MDKO morphogenetic defects at E13.5 and 14.5
Age
Trabeculation defect
Valvular defect
AVSD
PTA
DORV
E13.5
E14.5
17/17
8/8
17/17
8/8
17/17
8/8
2/12
0/8
17/17
8/8
Nkx2.5-Cre+/−; Numbfl/+; Numblfl/fl or Nkx2.5-Cre+/−; Numbfl/fl; Numblfl/+ males were crossed to Numbfl/fl; Numblfl/fl females to generate the MDKO. Shown in each
case is: total number of mutants that displayed the defect/total number of mutants that were examined.
AVSD, atrioventricular septal defect; PTA, persistent truncus arteriosus; DORV, double outlet right ventricle.
283
Development
and Numbl function redundantly during cardiac morphogenesis.
MDKO embryos were indistinguishable from their littermates until
E12.5, at which point they began to show edema that became more
severe at E13.5 (supplementary material Fig. S1E,F).
MDKO hearts displayed a variety of morphogenetic defects. By
E11.5, MDKO heart size was larger than that of the control and the
OFT of MDKO hearts exhibited abnormal alignment with the right
ventricle (supplementary material Fig. S1G). At E12.5, the aortic
and pulmonary artery in the distal OFT (Webb et al., 2003) were
separated in control but not in MDKO hearts, indicating an OFT
septation defect (Fig. 1E, Table 2). At E13.5, the aorta and
pulmonary artery in MDKO hearts were finally separated, but
displayed an alignment defect with the aortic and pulmonary valves
being in the same plane (Fig. 1F). The alignment defect at E14.5 in
MDKOs was visible by gross morphology as both aortic and
pulmonary arteries extended from the right ventricle in a parallel
pattern (supplementary material Fig. S1H), which resulted in a
double outlet right ventricle (DORV) (Fig. 1G, Table 2). MDKO
hearts also displayed an AVSD, permitting both atrial and
ventricular shunting (Fig. 1H, Table 2).
RESEARCH ARTICLE
Development (2014) doi:10.1242/dev.093690
CNCCs does not contribute to cardiac morphogenesis. Instead,
Mef2c-Cre-mediated deletion in the SHF recapitulated the OFT
septation defect and alignment defect in six out of ten E13.5 mutant
hearts (supplementary material Fig. S2E), AVSD in eight out of ten
mutant hearts (Fig. 3A) and trabeculation defect in the right ventricle
in four out of four mutant hearts (data not shown). Mef2c-Cre is not
active in the endocardial cells of the atrioventricular cushion (AVC)
(Fig. 3B), indicating that the AVSD is not caused by the lack of
NFPs in endocardial cells of the AVC, which is consistent with the
observation that Tie2-Cre-mediated NFP deletion did not cause any
defects.
Both Nkx2.5Cre/+-mediated and Mef2c-Cre-mediated mutants lacked
the DMP (Fig. 1H, Fig. 3A), which is required for atrioventricular
septation (Snarr et al., 2007b; Hoffmann et al., 2009). Using lineage
tracing and 3D imaging, we observed that cells derived from the SHF
migrated to the AVC and formed the DMP in the control, but fewer
(data not shown) or no cells (Fig. 3C,D; supplementary material
Movies 4, 5) were observed in the DMP in the knockout, indicating
that NFPs are required for the migration of cells in the posterior SHF
to form the DMP and the atrioventricular septum. In control hearts,
Mef2c-Cre-labeled cardiomyocytes displayed myocardial spikes
protruding towards the cushion in the OFT region (Fig. 3E), indicating
a polarized migration toward the cushion. In the mutants, most of the
NFP-null cells lacked myocardial spikes and fewer cells invaded the
OFT cushion (Fig. 3E).
MDKOs display differentiation defects
Whole-mount in situ hybridization of E9.5-12.5 embryos with probes
of the heart chamber markers ANP (Nppa – Mouse Genome
Informatics) and Hand1 demonstrated that their expression patterns
in the ventricles did not differ between control and MDKO hearts
(supplementary material Fig. S3A), indicating that there are no
chamber specification defects. We then screened for genome-wide
284
transcriptional differences between control and MDKO E10.5
ventricles via mRNA deep sequencing (supplementary material Table
S1). There were 340 genes with an expression ratio of MDKO to
control that was higher than 1.7 (P<0.05) and 474 genes with a ratio
of MDKO to control that was lower than 0.6 (P<0.05) (supplementary
material Table S2). Of the 814 dysregulated genes, 42 have been
reported to be involved in heart morphogenesis and heart diseases
(Fig. 4A). Notably, genes that are involved in the differentiation of
progenitors in the SHF, such as Isl1, Shox2, Fgf8, Hoxa3 and Tbx1,
were expressed at significantly higher levels in MDKO than in control
(Fig. 4A). The transcriptional differences were consistent with the QPCR results (Fig. 4B). The expression of Isl1 (Cai et al., 2003) was
consistently upregulated 2- to 4-fold in E9.5-11.5 MDKO hearts
(Fig. 4C). The transcription of Isl1 in OFT, where the Isl1-expressing
cells accumulate, was ~30-fold higher than in the ventricles (Fig. 4D).
Isl1 expression in the OFT of the MDKO is about double that in the
OFT of the control, similar to its upregulation in the ventricles
(Fig. 4D). Isl1 transcription, as assessed by in situ hybridization, did
not show any obvious expansion from right to left ventricle in the
MDKO (data not shown). Instead, we observed more Isl1-expressing
cells in the OFT of the MDKO based on IF staining (Fig. 4E).
Cardiomyocyte differentiation is a sequential process and to
further define the differentiation defect we examined the expression
of genes that encode cardiac differentiation regulators and structural
proteins in E12.5 and E13.5 hearts by Q-PCR. Irx3, Irx4, Irx5 and
Myh6 were significantly downregulated in the MDKO, whereas
Myh11 and Bmp10 were upregulated and Myh7, Myl2 and Tnnt2
were not significantly different from the control (Fig. 4F). The ratio
of Mhc7:Mhc6 after being normalized to cyclophilin A
(peptidylprolyl isomerase A) was ~2-fold greater in the MDKO than
in the control at both E12.5 and E13.5, indicating a cardiomyocyte
differentiation defect. Transcriptional patterns of Irx3 and Irx4 were
investigated by in situ hybridization. Irx3 was uniformly expressed
Development
Fig. 2. NFPs are required for myocardial
trabeculation. (A,B) E10.5 Nkx2.5Cre/+; mTmG and
MDKO; mTmG whole hearts were stained for
PECAM and then 3D imaged. The control trabecula
has a diameter of one or two cells, whereas the
MDKO trabecula has a diameter of two or three
cells (trabeculae indicated by arrows). Images are
one section from z-stacks (the whole 130 μm stacks
are shown in supplementary material Movies 2, 3).
(C,D) Control and MDKO hearts were stained with
MF20 and PECAM antibodies. Endocardial cells in
MDKOs can invade the cardiac jelly and contact
cardiomyocytes. The control heart displayed more
trabeculae per unit length than the MDKO. Arrows
indicate the trabeculae. (E) Quantification of
trabeculae density, trabeculae thickness and
compact zone thickness. The MDKO hearts had
fewer trabeculae per unit length, but the trabeculae
were thicker than those of the control hearts. Error
bars indicate s.d.; n values are shown within each
bar. Scale bars: 100 μm.
RESEARCH ARTICLE
Development (2014) doi:10.1242/dev.093690
in the trabeculae of the control heart, whereas the MDKO pattern
was less uniform and there was no Irx3 expression in some
trabeculae (Fig. 4G). Irx4, which specifies cardiomyocytes in
ventricles (Bao et al., 1999; Bruneau et al., 2001), was expressed in
the compact and trabecular zones in controls, whereas in MDKOs
the compact zone exhibited weaker or no expression of Irx4
(Fig. 4G). We found that 88% of the trabeculae in the control
displayed organized sarcomere arrays at E12.5 (n=4 hearts), whereas
in the MDKO only 15% of the trabeculae displayed sarcomeric
arrays (n=3 hearts) (Fig. 4H). In summary, MDKO hearts displayed
defects in the differentiation of cardiac progenitors and in the
maturation of sarcomeres.
Numb regulates cardiac progenitor differentiation through
its function in endocytosis
Cardiomyocyte differentiation in cultured mouse embryoid bodies
(EBs) recapitulates the genetic network that regulates this process
in vivo (Smith, 2001; Mummery et al., 2002). To study NFP
regulation of cardiac progenitor differentiation, we took advantage
of a pluripotent P19 embryonal carcinoma cell line (P19Cl6-GFP)
(McBurney and Rogers, 1982; Habara-Ohkubo, 1996), in which
GFP is under the transcriptional control of the rat Mlc-2v promoter
and therefore functions as a marker for differentiated
cardiomyocytes (Moore et al., 2004). Adenovirus-mediated
expression of Numb (p65 isoform) in the EB increased the number
of GFP+ cells (Fig. 5A-C) and the number of beating cultures (data
not shown), suggesting that Numb overexpression promotes
cardiomyocyte differentiation. We examined the expression of genes
that are involved in cardiac progenitor differentiation and those that
encode structural proteins. Nkx2.5, Gata6, ANP, Irx3, Myh7 and
Myh6 were all upregulated 2- to 4-fold (Fig. 5D), whereas
progenitor cell markers Isl1 and Gata4 were significantly
downregulated (Fig. 5D).
Numb interacts with endocytic adapters such as α-adaptin and
Eps15 via the NPF and DPF motifs in the C-terminus (Salcini et al.,
1997; Santolini et al., 2000) to selectively promote clathrindependent endocytosis of transmembrane proteins including Notch1
and the EGF receptor (Traub, 2003; Sorkin, 2004). To determine if
Numb regulates cardiomyocyte differentiation via endocytosis, EB
cultures were treated with Bafilomycin A1 (BafA1), an inhibitor of
endocytosis. BafA1 abolished the Numb-induced increase in cardiac
progenitor differentiation (Fig. 5E). When the α-adaptin or Eps15
binding sites (NPF and DPF, respectively) of Numb were mutated
to generate NbNPFm and NbDPFm they failed to promote
differentiation, as evidenced by fewer GFP+ cells and no
upregulation of Nkx2.5, Gata6 and Myh7 (Fig. 5F,G). We then
examined whether Numb can normalize Isl1 expression in E9.5
MDKO hearts using an ex vivo culture system. Ad-Numb, but not
Ad-NbDPFm, reduced Isl1, Fgf8 and Shox2 expression significantly
in the MDKO (Fig. 5H). These results demonstrate that NFPs
285
Development
Fig. 3. NFPs in the SHF are required for dorsal mesenchymal protrusion development and atrioventricular septation. (A) Mef2c-Cre-mediated NFP
knockout displayed absence of the dorsal mesenchymal protrusion (DMP) (arrows). (B) Mef2c-Cre is active in endocardial cells of the OFT but not AVC of the
inflow tract (IFT) and left ventricle (LV) region. Arrows indicate IFT. (C,D) Lineage tracing indicated that cells from the SHF contribute to the DMP in the control,
whereas in the knockout Mef2c-Cre-labeled cells do not migrate to the AVC to form the DMP. Arrows indicate endocardial cells of the AVC. One section from a
3D imaged z-stack is shown in C and D (for whole stacks see supplementary material Movies 4, 5). The lower magnifications (10×) are shown to indicate their
orientation (which can also be determined from A). PAS, primary atria septum. (E) Mef2c-Cre-labeled control cells form myocardial spikes that are oriented
perpendicular to the wall (red arrows indicate the spikes), whereas NFP-null cells do not show spike formation. Scale bars: 100 μm.
RESEARCH ARTICLE
Development (2014) doi:10.1242/dev.093690
regulate cardiac progenitor differentiation in an endocytosisdependent manner.
Both CBF1-dependent and -independent Notch signaling are
upregulated in MDKO hearts
Numb negatively regulates Notch1 signaling, and the MDKO
phenotype is comparable to that of transgenic mice expressing
activated Notch1 in cardiogenic mesoderm (Watanabe et al., 2006),
286
which led us to investigate Notch1 signaling in MDKO hearts. We
examined the level of Notch1 intracellular domain (NICD1), the
activated form of the Notch1 receptor, in control and MDKO hearts.
MDKO hearts displayed higher levels of NICD1 protein (Fig. 6A).
IF staining showed that endocardial cells were positive for NICD1
(Fig. 6B; supplementary material Fig. S4A), consistent with a
previous report (Grego-Bessa et al., 2007), whereas in MDKOs
NICD1 staining was also observed in some cardiomyocyte nuclei at
Development
Fig. 4. MDKOs display cardiomyocyte differentiation and maturation defects. (A) mRNA deep sequencing showed that multiple genes involved in cardiac
morphogenesis and disease are dysregulated in the MDKO. (B) Q-PCR showing the upregulation of Tbx1, Fgf8 and Shox2. (C) Transcription of Isl1 was
upregulated in the MDKO ventricles from E9.5 to E11.5 as compared with controls based on Q-PCR. (D) Compared with control, Isl1 expression in the OFT of
the MDKO increased to a similar extent as in the ventricles. (E) There are two or three layers of Isl1 protein-positive cells in the control OFT, whereas there are
three or four layers in MDKO OFT (red arrows and white bars). White arrows indicate endocardial cells. The inset shows quantification of Isl1+ cells in control
and MDKO hearts, with four sections for each heart and a total of three hearts. (F) Cardiomyocytes in E12.5 and E13.5 MDKO hearts displayed differentiation
defects, with significantly lower expression of Irx3, Irx4, Irx5 and Myh6 but higher expression of Bmp10 and Myh11. (G) The trabecular cardiomyocyte
specification gene Irx3 was not expressed in some trabeculae, and the ventricular cardiomyocyte specification gene Irx4 was not transcribed in some regions
based on in situ hybridization. The arrows indicate zones that did not transcribe Irx3 or Irx4. (H) MF20 staining demonstrated that the MDKO displayed a
sarcomere array formation defect. Error bars indicate s.d. Asterisks indicate statistical significance at P≤0.05. Scale bars: 100 μm in E,G; 10 μm in H.
RESEARCH ARTICLE
Development (2014) doi:10.1242/dev.093690
E9.5 (Fig. 6B) and in all nuclei at E12.5 (supplementary material
Fig. S4A).
To determine whether upregulation of Notch signaling in MDKO
hearts is dependent on CBF1/canonical Notch signaling, the
transgenic Notch reporter (TNR) line (Duncan et al., 2005), in which
GFP expression is under the control of CBF1 (Rbpj – Mouse
Genome Informatics), a downstream target of Notch signaling, was
used to generate the MDKO; TNR strain. GFP intensity was stronger
in MDKO; TNR hearts than in the control (supplementary material
Fig. S4B). Western blot indicated that GFP levels were higher in
eight out of nine MDKO; TNR hearts than in littermate controls
(Fig. 6C), indicating upregulated canonical Notch signaling in
MDKO hearts. We observed GFP in some cardiomyocytes as well
as endocardial cells in MDKO; TNR hearts at E9.5 (Fig. 6D).
However, at E12.5, although all cardiomyocytes expressed NICD1
(supplementary material Fig. S4A), not all of them were TNR/GFP+
(supplementary material Fig. S4C). The discrepancy is due to TNR
incompletely representing all NICD1+ cells, indicating that NFPs
regulate both canonical and non-canonical – or CBF1-dependent and
-independent – Notch signaling (Hellström et al., 2007; Mizutani et
al., 2007; Sanalkumar et al., 2010).
Expression levels of Notch target genes, including Hey1, Hey2,
Heyl and Hes1, were used to assess the activation of Notch
signaling in MDKO hearts. Q-PCR showed that Hey1 and Hes1
expression levels were slightly higher in MDKO hearts than
controls at certain ages (supplementary material Fig. S4D). To
confirm that Notch signaling was upregulated in NFP-null
cardiomyocytes, we used a lentivirus RBP-Jk luciferase reporter
287
Development
Fig. 5. Numb regulates cardiac
progenitor differentiation via
endocytosis. (A-C) Numb
overexpression in EB culture
promotes the differentiation of P19Cl6GFP cells, in which GFP is under the
control of rat Mlc-2v, as evidenced by
increased numbers of GFP+ cells
compared with β-gal-overexpression
EB cultures. The percentage of GFP+
cells was quantified by flow cytometry.
FSC, forward scatter channel.
(D) Numb overexpression EB cultures
showed higher expression of Nkx2.5,
Gata6, ANP (Nppa), Irx3, Myh7 and
Myh6, but lower expression of Isl1
and Gata4. (E) The endocytosis
inhibitor BafA1 abolished Numb
overexpression-induced EB culture
differentiation. (F,G) Endocytosisdefective Numb variants: both
NbDPFm and NbNPFm failed to
enhance cardiomyocyte differentiation
and induce Nkx2.5, Gata6 and Myh7
expression using the EB culture
system. (H) Using an ex vivo culture
system, Numb, but not NbDPFm and
control virus GFP, could rescue the
expression of Isl1, Fgf8 and Shox2 in
E9.5 MDKO hearts. Isl1 and Numb
expression in the control and virusinfected MDKO hearts was examined
by Q-PCR. Isl1 expression in GFPinfected wild-type hearts was set as 1.
Error bars indicate s.d.
RESEARCH ARTICLE
Development (2014) doi:10.1242/dev.093690
to measure Notch signaling activation in cardiomyocytes that were
isolated from control or αMHC-Cre-mediated cardiomyocytespecific NFP knockout hearts. The NFP knockout showed higher
Notch signaling activation, indicating upregulated Notch signaling
in cardiomyocytes (Fig. 6E).
To determine whether upregulated Notch1 signaling was
responsible for the defects in morphogenesis in MDKO hearts,
Notch1 signaling was suppressed by deleting one of the Notch1
alleles (Garg et al., 2005) in the MDKO to generate MDKO; Ntfl/+.
This resulted in reduced NICD1 staining intensity (supplementary
material Fig. S4A). However, this reduction did not rescue the OFT
septation defect or AVSD (data not shown). Instead, Notch1
suppression did reduce the thickness of the trabeculae, although it
did not increase the number of trabeculae per unit length (Fig. 6F;
supplementary material Fig. S5A,B). This suggests that NFPs
regulate trabecular thickness through Notch1 signaling.
NFPs regulate cardiomyocyte proliferation through
inhibition of Notch1 signaling
To examine if the thicker trabeculae and the larger size of MDKO
hearts are due to an increase in cell proliferation, the cardiomyocyte
proliferation rate was assessed by BrdU pulse labeling (Fig. 7A,B).
In the compact zone, the percentage of BrdU-positive
cardiomyocytes in the MDKO was significantly higher than in the
control from E9.5 to E12.5 (Fig. 7C), consistent with the increased
288
heart size in MDKOs. This result was also apparent specifically in
the trabecular zone, where there was a 3-fold increase in the
percentage of BrdU-positive cells in the MDKO compared with the
control at E12.5 (Fig. 7D), consistent with the thicker trabeculae in
MDKOs.
We examined the mRNA deep sequencing data and found, among
the known cell cycle regulators, that only p57 (Cdkn1c or p57kip2),
a cyclin-dependent kinase inhibitor, was significantly different.
Expression levels of cyclin D1 (Ccnd1), Cdkn1a (p21) and p57 were
further examined by Q-PCR and only p57 was significantly different
from the control in E9.5-13.5 MDKO hearts (Fig. 7E). We then
examined whether reduced p57 expression in MDKOs was caused
by increased Notch1 signaling. MDKO; Nt+/fl mice showed
increased p57 expression compared with the MDKO (Fig. 7F).
Consistent with the higher expression of p57 and the thinner
trabeculae, cardiomyocyte proliferation in the trabeculae of MDKO;
Nt+/fl mice was significantly reduced compared with the MDKO
(Fig. 7G). To further study how NFPs regulate p57, embryonic
cardiomyocytes from control, Numbflox/flox; Numblflox/flox or
Notch1flox/flox; Numbflox/flox; Numblflox/flox were cultured and treated
with Ade-Cre to induce recombination. We found that p57 was
downregulated in Cre+; Numbflox/flox; Numblflox/flox cardiomyocytes,
but was upregulated in Cre+; Notch1flox/flox; Numbflox/flox; Numblflox/flox
cardiomyocytes (Fig. 7H,I), indicating that downregulation of p57
in NFP-null cardiomyocytes is Notch1 dependent.
Development
Fig. 6. MDKO hearts display
elevated Notch signaling.
(A) E12.5 ventricles were lysed
for NICD1 western blot. MDKO
and heterozygous hearts showed
higher levels of NICD1 protein
than controls. (B) IF showed that
some cardiomyocytes in E9.5
MDKO but not control hearts were
NICD1 positive (white arrows).
(C) E12.5 ventricles were lysed
for GFP quantification and eight
out of nine MDKO; TNR hearts
displayed higher levels of GFP
protein than the control. (D) GFP
staining in sections from E9.5
TNR control and MDKO; TNR
hearts showed that Notch
signaling is active in endocardial
cells in the control, whereas in the
MDKO some cardiomyocytes are
also positive (blue arrows).
(E) Lenti RBP-Jk luciferase
reporter assay showed that
cardiomyocytes from αMHC-Cremediated NFP knockout hearts
displayed higher Notch signaling
activation than the control.
(F) The thickness of trabeculae of
MDKO; Ntfl/+ hearts was
significantly decreased compared
with that of MDKO. The
incomplete Numb deletion in
MDKO in A and C was due to its
expression in epicardial and
endocardial cells. V, ventricle.
Scale bars: 50 μm.
Development (2014) doi:10.1242/dev.093690
Fig. 7. NFPs regulate cardiomyocytes proliferation via Notch1. (A,B) BrdU pulse labeling indicated that cardiomyocytes in the MDKO proliferated at a
higher rate than those in the control. Cardiomyocytes were identified by collagen IV, a marker for the basement membrane. (C,D) MDKO displayed higher
proliferation rates of cardiomyocytes in the compact zone (C) and in the trabecular zone (D) at various ages. (E) Transcription of the cell cycle inhibitor p57
(p57kip2) was significantly reduced in the MDKO. (F) p57 expression was partially rescued in MDKO; Ntfl/+. The expression of Numb (Nb), Numbl (Nl) and
Notch1 (Nt1) in MDKO; Ntfl/+ was comparable to their expression in MDKO. (G) Trabecular cardiomyocyte proliferation was reduced in E12.5 MDKO; Nt1+/fl
compared with the control. (H,I) p57 expression was downregulated in Nbfl/fl; Nlfl/fl cardiomyocytes but upregulated in Nbfl/fl; Nlfl/fl; Notch1fl/fl after Cre-mediated
recombination for 72 hours. (J) Numb and Notch1 antibody can immunoprecipitate Numb using P4 heart lysates. IP, immunoprecipitate; WB, western blot.
(K) DAPT inhibited Notch1 cleavage to produce NICD1, and overexpressing Numb:GFP but not NbDPFm:GFP reduced NICD1 in cultured embryonic
cardiomyocytes. E12.5 mouse brain and Nbfl/fl; Nlfl/fl; Notch1fl/fl cardiomyocytes treated with pAd-Cre were used as positive and negative control, respectively.
*A weak band in the positive control, DAPT and GFP lanes that is non-specific. **The Numb antibody can detect all four Numb isoforms. (L) Quantification of
NICD1 in different treatments from three independent experiments. Error bars indicate s.d. Scale bar: 50 μm.
To study how NFPs regulate Notch1 signaling, we first
determined whether Notch1 and Numb interact in the heart. Both
Numb and Notch1 antibodies could pull down Numb based on coimmunoprecipitation using whole heart lysates (Fig. 7J) or
endocardial cell-specific NFP-null heart lysate (Wu et al., 2012)
(supplementary material Fig. S6A), indicating that Numb interacts
with Notch1 in the mouse heart. To determine how Numb inhibits
Notch1 signaling, Numb was overexpressed in cultured embryonic
289
Development
RESEARCH ARTICLE
cardiomyocytes. Western blot indicated that Numb:GFP
overexpression reduced the level of NICD1. However,
overexpressing GFP or the endocytosis-defective NbDPFm:GFP did
not reduce the level of NICD1 (Fig. 7K,L), indicating that Numb
promotes NICD1 degradation via endocytosis.
DISCUSSION
NFPs play multiple roles during cardiac development and
their disruption results in multiple CHDs
The defects in trabeculation, proliferation, progenitor
differentiation, OFT and atrioventricular septation and OFT
alignment in MDKO hearts, together with the recent report that
NFPs inhibit Notch2 to regulate compaction (Yang et al., 2012),
demonstrate that NFPs are essential for cardiac development and
morphogenesis. These findings extend our previous analysis which
found that NFPs are essential for epicardial development (Wu et al.,
2010). Our present analysis using NFP knockout models mediated
by Tie2-Cre, Wnt1-Cre, SM22-Cre, WT1CreERT2, Mef2c-Cre and
Nkx2.5Cre/+ suggests that the key functions of NFPs in cardiac
development are stage- and cell type-specific. NFP knockouts
mediated by Tie2-Cre, WT1CreERT2 and Wnt1-Cre did not display
any obvious cardiac morphogenetic defects (supplementary
material Fig. S2), indicating that NFP functions in endocardial cells,
epicardial cells and CNCCs are not essential for heart
morphogenesis. SM22-Cre-mediated NFP knockout in
cardiomyocytes partially phenocopied the MDKO, with disrupted
trabeculation, but did not display differentiation and morphogenetic
defects (supplementary material Fig. S2). Mef2c-Cre-mediated NFP
knockouts recapitulated the morphogenesis defects of the MDKO,
indicating that NFPs in the SHF are essential for cardiac
morphogenesis (Fig. 3; supplementary material Fig. S2). The
difference in phenotypes between SM22-Cre-mediated and
Nkx2.5Cre/+-mediated mutants might be due to the different timing
and cell types in which NFPs were deleted. Nkx2.5Cre/+ was active
in cardiomyocytes derived from the FHF and SHF, some
endocardial cells of the OFT and AVC (supplementary material
Fig. S1A,B), and very few endocardial cells of the ventricles
(supplementary material Fig. S1C, Movie 1) and was active
beginning at E7.5 based on Nkx2.5Cre/+; mTmG. By contrast, SM22Cre is active in some cardiomyocytes in the E8.5 heart tube, but not
in all cardiomyocytes until ~E9.0, a stage at which cardiac
progenitor cells have already initiated the differentiation process.
However, the expression of Nkx2.5Cre/+ in the endocardial cells
appears not to be the cause of the AVSD and OFT septation in the
MDKO, as Tie2-Cre-mediated NFP deletion did not cause any
defect. Furthermore, NFP deletion via Mef2c-Cre, which is not
active in the endocardial cells of the AVC (Fig. 3B), caused the
AVSD, indicating that NFP absence in endocardial cells of the AVC
is not responsible for the AVSD in the mutants. Instead, the
morphogenesis defects in MDKOs might be caused by the SHF
progenitor cell differentiation defect, as evidenced by the
upregulation of Isl1, Fgf8, Hoxa3 and Tbx1 in MDKOs. This is
consistent with previous reports that down- or upregulation of
Fgf8/Fgf10 (Kelly et al., 2001; Ilagan et al., 2006; Park et al., 2006),
Isl1 (Ai et al., 2007; Kwon et al., 2007; Lin et al., 2007; Ueno et al.,
2007) and Tbx1 (Vitelli et al., 2002) interferes with SHF progenitor
cell differentiation and subsequently causes cardiac morphogenetic
defects or CHDs (Buckingham et al., 2005; Black, 2007; Rochais et
al., 2009). Further studies showed that NFP-null cells fail to form
myocardial spikes that orient perpendicularly to the heart wall
(Fig. 3E) and fail to migrate into the OFT cushion, which might
result in the OFT septation defect.
290
Development (2014) doi:10.1242/dev.093690
NFPs regulate ventricular trabeculation and compaction
Ventricular trabeculation and compaction are two related but
different biological processes during cardiac morphogenesis.
Trabeculation initiates at E9.0-9.5 and myocardial compaction
occurs at ~E14.5 (Samsa et al., 2013; Zhang et al., 2013). Lack of
trabeculation causes embryonic lethality in mice and excess
trabeculation causes cardiomyopathy and heart failure in humans
(Jenni et al., 1999; Weiford et al., 2004; Breckenridge et al., 2007).
Despite the fundamental nature of these morphogenic processes, the
molecular and cellular mechanisms controlling trabeculation and
compaction are not fully understood. Pathways that regulate
trabeculation include the Notch1 and Notch2 signaling pathways.
Global or endothelial-specific Notch1 deletion causes ventricular
hypoplasia and trabeculation defects (Grego-Bessa et al., 2007).
Notch1 activation in early cardiac cell lineages by Mesp1-Cremediated overexpression of NICD1 leads to several cardiac
morphogenetic defects, including abnormal ventricular morphology
similar to ventricular non-compaction (Watanabe et al., 2006).
However, NICD1 overexpression in cardiomyocytes at a later stage
via Mlc-2v-Cre does not cause obvious trabecular morphogenesis
(Croquelois et al., 2008). The discrepancy could be caused by
Notch1 activation at different developmental stages or in different
cell populations.
Notch2 intracellular domain (N2ICD) is detected throughout the
myocardium before E11.5, but at a later stage Notch2 activity is
specifically downregulated in the compact zone and is restricted in
trabecular myocardium during ventricular compaction (Yang et al.,
2012). Notch2 global knockout displays ventricular hypoplasia
(McCright et al., 2001). Notch2 deletion in heart via SM22-Cre
displays cyanosis at birth due to narrow arteries, but whether or not
the knockout displays a trabeculation defect was not reported
(Varadkar et al., 2008). However, loss-of-function analysis for
Notch1 or Notch2 in cardiomyocytes cannot determine whether they
are involved in trabecular morphogenesis, as all four Notch
receptors are expressed at relatively high levels in the heart
(supplementary material Fig. S6B) and the deletion of one Notch
receptor in cardiomyocytes may be compensated by the function of
another, although they might not be expressed in cardiomyocytes
under normal conditions. Yang et al. (Yang et al., 2012) reported that
N2ICD continues to be present in the compact zone at E12.5 and
E13.5, which was not observed in the control, and we observed that
NICD1 is present in cardiomyocytes in both the compact and
trabecular zones of the MDKO, indicating that NFPs regulate
trabecular morphogenesis via inhibition of both Notch1 and Notch2.
Trabecular morphogenesis is a multistep process that includes, but
is not limited to, trabecular initiation, proliferation/growth,
differentiation and compaction. Notch1 and Notch2 might regulate
different steps of trabecular morphogenesis. Genetic epistasis studies
can determine whether Notch receptors function downstream of
NFPs in the regulation of a particular trabecular morphogenesis step.
MDKOs displayed lower p57 expression, higher proliferation rates
and thicker trabeculae. When one of the Notch1 alleles was deleted
in the MDKO, p57 expression and proliferation were partially
rescued (Fig. 7F,G) and the thickness of the trabeculae was reduced
compared with that of the MDKO (Fig. 6F). However, Notch1
deletion did not rescue the defects in trabecular initiation and noncompaction (supplementary material Fig. S5A,B; data not shown).
This indicates that NFPs inhibit Notch1 to regulate cardiomyocyte
proliferation and trabecular growth/thickness, but not trabecular
initiation and compaction. NICD2 overexpression in cardiomyocytes
mediated by αMHC-Cre results in hypertrabeculation and noncompaction, indicating that Notch2 is involved in compaction and
Development
RESEARCH ARTICLE
RESEARCH ARTICLE
Development (2014) doi:10.1242/dev.093690
that NFPs might inhibit Notch2 to regulate compaction (Yang et al.,
2012). However, many questions regarding the regulation of
trabecular morphogenesis by Notch1 and Notch2 remain. Notch2
activity is restricted to trabeculae, where cells are more
differentiated, more mature and less proliferative compared with
cardiomyocytes in the compact zone, raising a number of questions
for future research, such as whether Notch2 inhibits the proliferation
of cardiomyocytes and promotes their differentiation to regulate
compaction, and what the unique Notch2 downstream targets
regulating compaction are. The observation that both Notch1
deletion (Grego-Bessa et al., 2007) and overexpression (Venkatesh
et al., 2008) in endocardial cells reduced trabeculation indicates that
further work is needed to reveal how Notch1 regulates trabeculation.
One of the well-known pathways that NFPs regulate is Notch1
signaling. It has been shown that Numb inhibits Notch1 signaling in
Drosophila and mammalian cells (Guo et al., 1996; Spana and Doe,
1996; Zhong et al., 1996; McGill and McGlade, 2003; Cheng et al.,
2008; McGill et al., 2009; Beres et al., 2011). However, the NumbNotch1 relationship during vertebrate embryogenesis remains an
enigma (Zhong et al., 1996; Petersen et al., 2006). Although the
phenotype of the NFP global knockout is similar to that of Notch1
pathway disrupted mutants, leading to the hypothesis that Numb and
Notch1 signaling are associated, Notch1 targets were not upregulated
in the NFP global knockout during mammalian development, as
would be predicted if Numb inhibits Notch1 signaling (Petersen et al.,
2006). The exact relationship between Numb and Notch1 during
embryogenesis is therefore unclear. Genetic tools to test the interaction
between Numb and Notch1 should be applied to reveal the
relationship. We used a transgenic Notch reporter line and other assays
to clearly show that canonical Notch signaling is upregulated in
MDKO hearts. Significantly, deletion of one Notch1 allele partially
rescued the MDKO phenotype, including the expression of p57,
cardiomyocyte proliferation and trabecular thickness (Fig. 6). This
indicates that NFPs regulate trabecular proliferation/growth and
thickness via Notch1 signaling.
Notch1 signaling is local and only cells that are adjacent to the
ligand will be activated. Notch1 transcription was highest in
endocardial cells and weak in cardiomyocytes. It has been proposed
that jagged 1 in cardiomyocytes can activate Notch1 in endocardial
cells, so NICD1 is usually detected in endocardial cells (GregoBessa et al., 2007). The activated Notch1 signaling in endocardial
cells then can enhance cardiomyocyte proliferation by inhibiting p57
through Bmp10 in the myocardium (Chen et al., 2004; Grego-Bessa
et al., 2007; Chen et al., 2013; Luxán et al., 2013). In MDKO hearts,
the Notch1 transcriptional level did not differ from that of the
control based on mRNA sequencing and Q-PCR (data not shown),
and NICD1 was detected in both endocardial cells and
cardiomyocytes, indicating that Notch1 is expressed in
cardiomyocytes and that NFPs are required to inhibit NICD1 in a
post-transcriptional manner, consistent with their functions as
endocytic proteins. Furthermore, Nkx2.5Cre/+-mediated Notch1fl/fl
deletion reduced NICD1 to ~46% of control levels based on western
blot using lysates of E12.5 ventricles (supplementary material
Fig. S6C,D), and presumably the remaining Notch1 protein was
contributed by endocardial and epicardial cells. This suggests that
Notch1 is expressed in cardiomyocytes at E12.5, considering that
Nkx2.5Cre/+ is active in all cardiomyocytes and in very few
endocardial cells in the ventricles. This is consistent with a previous
report that NICD1 is detected in cardiomyocytes in E13.5 and older
hearts (Kratsios et al., 2010). We propose that Notch1 in
Fig. 8. The deletion of NFPs abolishes NICD1 degradation, resulting in
activation of Notch1 signaling. (A) In the control heart, jagged 1 (Jag1) in
cardiomyocytes activates Notch1 in endocardial cells to produce NICD1,
which in turn can inhibit p57 expression via Bmp10 in cardiomyocytes.
Notch1 expression in cardiomyocytes is weak, and can be activated by
Delta4 (Dl4) in endocardial cells and/or Jag1 in cardiomyocytes; however,
NICD1 will be degraded via NFPs. In NFP-null cardiomyocytes, NICD1
degradation by NFPs is disrupted, resulting in activation of Notch1 and
inhibition of p57 expression.
cardiomyocytes is activated by Delta4 (delta-like 4) in the
endocardial cells and/or jagged 1 in cardiomyocytes to produce
NICD1, which is degraded by NFP-mediated endocytosis and is not
detectable in cardiomyocytes in the control hearts. In the
cardiomyocytes of MDKO hearts, NFP-mediated NICD1
degradation is abolished, which results in NICD1 accumulation to a
detectable level. This NICD1 accumulation in cardiomyocytes
activates Notch1-related signaling, including the inhibition of p57
expression to promote cell proliferation in a myocardiumautonomous manner in the MDKO (Fig. 8A).
NFPs regulate Notch1-independent signaling pathways
NFPs play a variety of roles during normal and disease conditions
in a cell context-dependent manner (Gulino et al., 2010). Numb is
an endocytic protein (Santolini et al., 2000), and NFPs execute their
functions mainly through their involvement in endocytosis and
interaction with other proteins. Numb functions as a component of
the adherens junction to regulate cell adhesion and migration in
neural epithelium and epicardium (Rasin et al., 2007; Wang et al.,
2009; Wu et al., 2010), regulates cancer initiation by controlling the
stability of p53 (Colaluca et al., 2008) and Gli1 (Di Marcotullio et
al., 2006), regulates neuroblast specification in Drosophila SOP cells
by inhibiting Notch signaling (Guo et al., 1996), and regulates axon
growth in neural cells (Nishimura and Kaibuchi, 2007). Numb also
interacts with Notch and Wnt signaling to specify the hemangioblast
to the primitive erythroid lineage (Cheng et al., 2008). Of all the
pathways with which NFPs interact, the best-studied is the Notch1
pathway. However, suppression of Notch1 did not rescue all the
defects of MDKOs, indicating that NFPs function upstream of
Notch1-independent signaling pathways to regulate cardiac
morphogenesis and cardiac progenitor differentiation.
To reveal the mechanisms that cause the defects in morphogenesis
and progenitor differentiation, we examined mRNA deep sequence
data. Of the 814 dysregulated genes in the MDKO, 36.9% encode
membrane-associated proteins, 30.4% encode glycoproteins and
26.8% encode signal peptides (supplementary material Fig. S7A),
indicating that NFPs are involved in multiple signaling pathways,
which is consistent with previous findings that Numb is an adaptor
protein involved in the endocytosis of multiple proteins (Santolini
291
Development
NFPs regulate Notch1 signaling during cardiac development
RESEARCH ARTICLE
Development (2014) doi:10.1242/dev.093690
MATERIALS AND METHODS
Mice
fl/fl
fl/fl
Mouse strains Numb , Numbl (Zilian et al., 2001; Wilson et al., 2007),
transgenic Notch reporter (TNR) (Duncan et al., 2005), Tie2-Cre (Kisanuki
et al., 2001), Rosa26-mTmG (mTmG) (Muzumdar et al., 2007), SM22-Cre
(Holtwick et al., 2002; Boucher et al., 2003), CMV-Cre (Schwenk et al.,
1995), Wnt1-Cre (Danielian et al., 1998), WT1CreERT2 (Zhou et al., 2008),
αMHC-Cre (Oka et al., 2006) and Notch1fl/fl (Yang et al., 2004) were
purchased from Jackson Lab. Dr Robert Schwartz provided Nkx2.5Cre/+
(Moses et al., 2001) mice. Dr Brian Black provided Mef2c-Cre (Verzi et al.,
2005). Nkx2.5Cre/+; Numbfl/+; Numblfl/fl or Nkx2.5Cre/+; Numbfl/fl; Numblfl/+
males were mated to Numbfl/fl; Numblfl/fl females to generate Nkx2.5Cre/+;
Numbfl/fl; Numblfl/fl designated as MDKO; their sibling embryos without the
Cre allele are designated as controls. All animal experiments were approved
by the Institutional Animal Care and Use Committee (IACUC) at Albany
Medical College and performed according to the NIH Guide for the Care
and Use of Laboratory Animals.
Paraffin and frozen section immunohistochemistry
Immunohistochemistry, immunofluorescence (IF) and Hematoxylin and
Eosin (H&E) staining were performed as described (Lechler and Fuchs,
2005; Mellgren et al., 2008). Primary antibodies were: BrdU (1:50; Becton
Dickinson, 347583), collagen IV (1:1000; Chemicon, AB756P), b-tubulin
(1:1000; BD Pharmingen, 556321), active caspase 3 (1:100; Cell Signaling,
9661S), WT1 (1:100, DAKO, M3561; or 1:50, Santa Cruz Biotechnology,
sc192), PECAM (1:50; BD Pharmingen, 550274), MF20 [1:100;
Developmental Studies Hybridoma Bank (DSHB), MF20], b-catenin (1:400;
BD Pharmingen, 610153), NICD1 (1:50; Cell Signaling, 4147S), GFP
(1:10,000; Abcam, ab290), Isl1 (1:50; DSHB, 39.4D5) and Numb (1:600,
Abcam, ab14140; or 1:600, Cell Signaling, 2756s); the third Numb primary
antibody was provided by Dr Weimin Zhong at Yale University (1:1000).
mRNA deep sequencing
Total RNA was isolated with Trizol (Invitrogen) from ten E10.5 ventricles
from both control and MDKO for each experiment. As an indication of
quality, the RNA had an integrity number of 8 or greater by Bioanalyzer
(Agilent Technology). Samples for mRNA deep sequencing were prepared
according to the manufacturer’s protocol (mRNASeq 8-Sample Prep Kit,
Illumina). The samples were sequenced by the Microarray Core Facility at
the University of Texas, Southwestern Medical Center at Dallas. A HiSeq
2000 system (Illumina) was used for SE-50 sequencing (single-ended 50 bp
reads), with over 30×106 ‘reads’ per sample. Basic data analysis was
performed with CLC-Biosystems Genomic Workbench analysis programs
to generate quantitative data for all genes. The quality filtered and trimmed
reads were aligned to an annotated mouse reference genome downloaded
from the Ensembl Genome Browser. cDNA fragments were mapped back
to individual transcripts. After normalization, the RNA-Seq fragment count
was used as a measure of relative abundance of transcripts, and CLC BIO
measured transcript abundances in reads per kilobase of transcript per
million mapped reads (RPKM). The experiment was repeated three times.
Relative expression levels of genes (ratio of MDKO to control) with P<0.05
were considered significantly different.
Cardiomyocyte isolation
Ventricles (E15.5-17.5) were washed with cold Hank’s balanced salt
solution, snipped and then digested with warmed 0.2% collagenase B
solution. The digestion was repeated four times of four minutes each. The
digested mixtures were combined and centrifuged to collect the cardiac cells,
which were then plated in a culture dish for 1 hour to allow noncardiomyocytes to adhere, followed by the transfer of unattached cells to
292
another dish; these last two steps were repeated three times to enrich
cardiomyocytes. The cardiomyocyte-enriched cells were cultured and cells
that were beating were counted as cardiomyocytes on day four. The
enrichment procedure resulted in more than 95% of the cells being
cardiomyocytes. The cardiomyocytes were transduced with various viruses
or treated with different chemicals for 1, 2 or 3 days. mRNA or proteins
were isolated and used for analysis.
Imaging
The following systems were used: for confocal imaging, Zeiss LSM510
META and Zeiss 510 META NLO; for color imaging, Zeiss Observer Z1
with a Hamamatsu ORCA-ER camera; for fluorescence imaging, Zeiss
Observer Z1 with an AxioCam MRm camera. 3D images were produced by
Zeiss 510 META NLO with 0.9 μm per section and reconstructed with
Imaris software (Bitplane).
Cardiomyocyte proliferation assay by BrdU pulse labeling
Pregnant females were intraperitoneally injected with BrdU for 1 hour
before embryo harvesting. The proliferation rate was assessed by the
percentage of BrdU-positive cells among total cells as described (Wu et al.,
2010). Collagen IV was used to stain the basement membrane to distinguish
cardiomyocytes from non-cardiomyocytes.
Western blot and co-immunoprecipitation (Co-IP)
Lysates from E12.5 or E13.5 ventricles of each genotype were processed for
western blot as described (Mellgren et al., 2008). Lysates from postnatal day
(P) 4 hearts were used for Co-IP according to the protocol of uMACS
Protein A/G Microbeads (Miltenyi Biotec). Antibodies used for western
blots and Co-IP included Numb (1:1000; Cell Signaling, 2756s), NICD1
(1:500; Cell Signaling, 4147s), Notch1 (1:1000; Cell Signaling, 4380s),
Notch1 (1:500; Santa Cruz Biotechnology, sc-6014), GFP (1:10,000;
Abcam, ab290) and Gapdh (1:1000; Santa Cruz Biotechnology, sc-25778).
RNA isolation and quantitative PCR (Q-PCR)
For Q-PCR analysis, total RNA was isolated from three ventricles for each
experiment using Trizol and the RNeasy Micro Kit (Qiagen). The
experiments were repeated at least three times for each age. At least 300 ng
total RNA was used for reverse transcription (iScript cDNA Synthesis Kit,
Bio-Rad). Gene expression was analyzed using standard Q-PCR methods
with iTAQ SYBR Green Master Mix on a CFX96 instrument (Bio-Rad).
Each sample was run in triplicate and normalized to cyclophilin A. Primer
sequences are listed in supplementary material Table S3. Transcription of
Isl1 and Hey1 was confirmed using two sets of primers.
In situ hybridization
Digoxigenin-labeled RNA probes were made as described (Xu et al., 2009).
In situ hybridization of whole-mount mouse embryos and paraffin sections
was as described (Xu et al., 2011). Briefly, after fixation, embryos were
treated with 10 μg/ml proteinase K, refixed in a 0.2% glutaraldehyde/4%
paraformaldehyde (PFA) solution, and prehybridized at 65°C for 1 hour. The
samples were then transferred into hybridization mix containing 0.5 μg/ml
digoxigenin-labeled probes. Post-hybridization washes and antibody
incubation were as described (Xu et al., 2009). Color development employed
BM Purple solution (Roche).
Trabecular density and thickness quantification and wholemount IF staining
One in every four sections from E10.5-13.5 hearts was stained with PECAM
and MF20 antibodies. At least six sections from the medial part of the heart
were quantified for the number of trabeculae per unit length and for the
thickness of trabeculae or compact zone in both left and right ventricles.
Trabecular thickness was defined as the average thickness of the base,
middle and top of an individual trabecula. Compact zone thickness was
defined as the average thickness of six different spots in left and right
ventricle in each section. The data presented in figures include both left and
right ventricles.
Development
et al., 2000; Krieger et al., 2013). Indeed, it is possible that NFPs
regulate cardiac morphogenesis and progenitor differentiation
through the endocytosis of multiple proteins. Analysis of transgenic
lines expressing endocytosis-defective Numb might help to
determine how NFPs regulate cardiac morphogenesis and progenitor
differentiation.
RESEARCH ARTICLE
Embryoid body (EB) culture and analysis
EB culture was as described (Moore et al., 2004). Briefly, 800 P19Cl6-GFP
cells in 20 μl medium (passage number less than 20) were used for each
hanging drop culture. Forty-eight hours after hanging drop formation,
adenovirus at a multiplicity of infection (MOI) of 100, DAPT at a final
concentration of 10 μM, or BafA1 at a final concentration of 0.1 μM, or an
equal amount of vehicle (DMSO) mixed in medium was added to the
hanging drop without disturbing the cell aggregates. The hanging drops were
allowed to grow for another 4 days. Then, the EB or cell aggregates were
transferred to culture plates to grow for another 5 days. On day 6, the EB
cultures were harvested and dissociated into single cells for flow cytometry
analysis or RNA isolation. The percentage of GFP+ cells was analyzed by
FACScan (Becton Dickinson).
Site-directed mutagenesis
Numb mutant variants including NumbDPF/AAA (NbDPFm or NbDPFm:GFP)
and NumbNPF/AAF (NbNPFm), in which DPF and NPF were mutated to AAA
and AAF, respectively, were generated by site-directed mutagenesis
following protocols provided with the Phusion Site-Directed Mutagenesis
Kit (Thermo Scientific). Primers used for NbDPFm and NbNPFm generation
are (5′-3′, forward and reserve): NumbDPF, CCAGGCACCTGCCCAGTGGCTGCTGCCGAAGCTCAGTGGGCCGCA and AGGGACTTCTGCATGCCTGTTTCCTGAGGCTAGCCCACCATT; NumbNPF, CGTACAAATCCTTCTCCTACCGCCGCTTTCTCCAGTGACTTACAGA and
CTGCTTGGACTTGCTTTCTAGTGCGGCC.
Ex vivo culture system
The ex vivo culture protocol was developed in Dr Brian Black’s laboratory.
Briefly, embryos lacking the head and tail with the heart exposed to medium
were cultured in medium containing Ad-Nb, Ad-GFP or Ad-NbDPFm for 48
hours. Then, the heart was used for Q-PCR analysis.
Statistics
Data are shown as mean ± s.d. An unpaired two-tailed Student’s t-test was
used for statistical comparison. P≤0.05 was considered statistically
significant.
Lenti RBP-Jk luciferase reporter assay
The Lenti RBP-Jk reporter is a preparation of ready-to-transduce lentiviral
particles for monitoring the activity of Notch signaling pathways in virtually
any mammalian cell type (Qiagen, CLS-014L). Cardiomyocytes from
E16.5-18.5 control or αMHC-Cre-mediated NFP knockout hearts were
cultured in 48-well plates for 4 days. Then, the cells were infected with Lenti
RBP-Jk luciferase and Lenti renilla luciferase, which functions as a control.
Seventy-two hours after infection, the lysate was used to measure luciferase
activity according to the supplied protocol.
Acknowledgements
We thank Dr Brian Black for helpful comments and critical reading; Drs Eric Olson,
Ondine Cleaver, Brian Black and Benoit Bruneau for reagents; the Jay Schneider
laboratory for sorting PECAM cells; Dr Christine L. Mummery for the P19Cl6-GFP
cell line; Dr Andy Wessels for advice on DMP; Dr Brian Black for establishing the
embryo culture system for us; and the M.W. laboratory members for scientific
discussion.
Competing interests
The authors declare no competing financial interests.
Author contributions
M.W. designed experiments, analyzed the data and wrote the manuscript. C.Z.,
H.G., J.L., L.Y., T.M., W.P. and M.W. performed the experiments and analyzed the
data. The project was initiated while M.W. was a postdoc in the M.D.T. lab. W.Z.,
R.J.S., J.S., H.S. and M.D.T. assisted the study.
Funding
This work is supported by Albany Medical College start-up and the American Heart
Association [13SDG16920099] to M.W., and by National Heart, Lung, and Blood
Institute grants [HL074257] to M.D.T. and [HL049426, HL092510] to H.A.S.
Deposited in PMC for release after 12 months.
Supplementary material
Supplementary material available online at
http://dev.biologists.org/lookup/suppl/doi:10.1242/dev.093690/-/DC1
References
Ai, D., Fu, X., Wang, J., Lu, M. F., Chen, L., Baldini, A., Klein, W. H. and Martin, J.
F. (2007). Canonical Wnt signaling functions in second heart field to promote right
ventricular growth. Proc. Natl. Acad. Sci. USA 104, 9319-9324.
Bao, Z. Z., Bruneau, B. G., Seidman, J. G., Seidman, C. E. and Cepko, C. L. (1999).
Regulation of chamber-specific gene expression in the developing heart by Irx4.
Science 283, 1161-1164.
Beres, B. J., George, R., Lougher, E. J., Barton, M., Verrelli, B. C., McGlade, C. J.,
Rawls, J. A. and Wilson-Rawls, J. (2011). Numb regulates Notch1, but not Notch3,
during myogenesis. Mech. Dev. 128, 247-257.
Black, B. L. (2007). Transcriptional pathways in second heart field development.
Semin. Cell Dev. Biol. 18, 67-76.
Boucher, P., Gotthardt, M., Li, W. P., Anderson, R. G. and Herz, J. (2003). LRP: role
in vascular wall integrity and protection from atherosclerosis. Science 300, 329-332.
Breckenridge, R. A., Anderson, R. H. and Elliott, P. M. (2007). Isolated left
ventricular non-compaction: the case for abnormal myocardial development. Cardiol.
Young 17, 124-129.
Briggs, L. E., Kakarla, J. and Wessels, A. (2012). The pathogenesis of atrial and
atrioventricular septal defects with special emphasis on the role of the dorsal
mesenchymal protrusion. Differentiation 84, 117-130.
Bruneau, B. G. (2008). The developmental genetics of congenital heart disease.
Nature 451, 943-948.
Bruneau, B. G., Bao, Z. Z., Fatkin, D., Xavier-Neto, J., Georgakopoulos, D.,
Maguire, C. T., Berul, C. I., Kass, D. A., Kuroski-de Bold, M. L., de Bold, A. J. et
al. (2001). Cardiomyopathy in Irx4-deficient mice is preceded by abnormal
ventricular gene expression. Mol. Cell. Biol. 21, 1730-1736.
Buckingham, M., Meilhac, S. and Zaffran, S. (2005). Building the mammalian heart
from two sources of myocardial cells. Nat. Rev. Genet. 6, 826-835.
Cai, C. L., Liang, X., Shi, Y., Chu, P. H., Pfaff, S. L., Chen, J. and Evans, S. (2003).
Isl1 identifies a cardiac progenitor population that proliferates prior to differentiation
and contributes a majority of cells to the heart. Dev. Cell 5, 877-889.
Calderwood, D. A., Fujioka, Y., de Pereda, J. M., García-Alvarez, B., Nakamoto, T.,
Margolis, B., McGlade, C. J., Liddington, R. C. and Ginsberg, M. H. (2003).
Integrin beta cytoplasmic domain interactions with phosphotyrosine-binding
domains: a structural prototype for diversity in integrin signaling. Proc. Natl. Acad.
Sci. USA 100, 2272-2277.
Chen, H., Shi, S., Acosta, L., Li, W., Lu, J., Bao, S., Chen, Z., Yang, Z., Schneider,
M. D., Chien, K. R. et al. (2004). BMP10 is essential for maintaining cardiac growth
during murine cardiogenesis. Development 131, 2219-2231.
Chen, H., Zhang, W., Li, D., Cordes, T. M., Mark Payne, R. and Shou, W. (2009).
Analysis of ventricular hypertrabeculation and noncompaction using genetically
engineered mouse models. Pediatr. Cardiol. 30, 626-634.
Chen, H., Zhang, W., Sun, X., Yoshimoto, M., Chen, Z., Zhu, W., Liu, J., Shen, Y.,
Yong, W., Li, D. et al. (2013). Fkbp1a controls ventricular myocardium trabeculation
and compaction by regulating endocardial Notch1 activity. Development 140, 19461957.
Cheng, X., Huber, T. L., Chen, V. C., Gadue, P. and Keller, G. M. (2008). Numb
mediates the interaction between Wnt and Notch to modulate primitive erythropoietic
specification from the hemangioblast. Development 135, 3447-3458.
Colaluca, I. N., Tosoni, D., Nuciforo, P., Senic-Matuglia, F., Galimberti, V., Viale, G.,
Pece, S. and Di Fiore, P. P. (2008). NUMB controls p53 tumour suppressor activity.
Nature 451, 76-80.
Conboy, I. M. and Rando, T. A. (2002). The regulation of Notch signaling controls
satellite cell activation and cell fate determination in postnatal myogenesis. Dev. Cell
3, 397-409.
Cottage, C. T., Bailey, B., Fischer, K. M., Avitable, D., Collins, B., Tuck, S., Quijada,
P., Gude, N., Alvarez, R., Muraski, J. et al. (2010). Cardiac progenitor cell cycling
stimulated by pim-1 kinase. Circ. Res. 106, 891-901.
Croquelois, A., Domenighetti, A. A., Nemir, M., Lepore, M., Rosenblatt-Velin, N.,
Radtke, F. and Pedrazzini, T. (2008). Control of the adaptive response of the heart
to stress via the Notch1 receptor pathway. J. Exp. Med. 205, 3173-3185.
Danielian, P. S., Muccino, D., Rowitch, D. H., Michael, S. K. and McMahon, A. P.
(1998). Modification of gene activity in mouse embryos in utero by a tamoxifeninducible form of Cre recombinase. Curr. Biol. 8, 1323-1326.
Di Marcotullio, L., Ferretti, E., Greco, A., De Smaele, E., Po, A., Sico, M. A.,
Alimandi, M., Giannini, G., Maroder, M., Screpanti, I. et al. (2006). Numb is a
suppressor of Hedgehog signalling and targets Gli1 for Itch-dependent
ubiquitination. Nat. Cell Biol. 8, 1415-1423.
Duncan, A. W., Rattis, F. M., DiMascio, L. N., Congdon, K. L., Pazianos, G., Zhao,
C., Yoon, K., Cook, J. M., Willert, K., Gaiano, N. et al. (2005). Integration of Notch
293
Development
Whole embryos were stained as described (Wu et al., 2010). Briefly,
whole embryos were fixed for 2 hours in 4% PFA, permeabilized for 8 hours
in PBS-Tween 20, blocked with 3% BSA, and then incubated with primary
antibody for ~24 hours. After three washes, the embryos were incubated
with secondary antibody for 24 hours, followed by washing with PBS. After
staining, embryos were cleared in glycerol and then 3D imaged.
Development (2014) doi:10.1242/dev.093690
and Wnt signaling in hematopoietic stem cell maintenance. Nat. Immunol. 6, 314322.
Frise, E., Knoblich, J. A., Younger-Shepherd, S., Jan, L. Y. and Jan, Y. N. (1996).
The Drosophila Numb protein inhibits signaling of the Notch receptor during cellcell interaction in sensory organ lineage. Proc. Natl. Acad. Sci. USA 93, 1192511932.
Garg, V., Muth, A. N., Ransom, J. F., Schluterman, M. K., Barnes, R., King, I. N.,
Grossfeld, P. D. and Srivastava, D. (2005). Mutations in NOTCH1 cause aortic
valve disease. Nature 437, 270-274.
Grego-Bessa, J., Luna-Zurita, L., del Monte, G., Bolós, V., Melgar, P., Arandilla, A.,
Garratt, A. N., Zang, H., Mukouyama, Y. S., Chen, H. et al. (2007). Notch signaling
is essential for ventricular chamber development. Dev. Cell 12, 415-429.
Gulino, A., Di Marcotullio, L. and Screpanti, I. (2010). The multiple functions of
Numb. Exp. Cell Res. 316, 900-906.
Guo, M., Jan, L. Y. and Jan, Y. N. (1996). Control of daughter cell fates during
asymmetric division: interaction of Numb and Notch. Neuron 17, 27-41.
Habara-Ohkubo, A. (1996). Differentiation of beating cardiac muscle cells from a
derivative of P19 embryonal carcinoma cells. Cell Struct. Funct. 21, 101-110.
Han, Z. and Bodmer, R. (2003). Myogenic cells fates are antagonized by Notch only in
asymmetric lineages of the Drosophila heart, with or without cell division.
Development 130, 3039-3051.
Hellström, M., Phng, L. K., Hofmann, J. J., Wallgard, E., Coultas, L., Lindblom, P.,
Alva, J., Nilsson, A. K., Karlsson, L., Gaiano, N. et al. (2007). Dll4 signalling
through Notch1 regulates formation of tip cells during angiogenesis. Nature 445,
776-780.
Hoffman, J. I. and Kaplan, S. (2002). The incidence of congenital heart disease. J.
Am. Coll. Cardiol. 39, 1890-1900.
Hoffmann, A. D., Peterson, M. A., Friedland-Little, J. M., Anderson, S. A. and
Moskowitz, I. P. (2009). sonic hedgehog is required in pulmonary endoderm for
atrial septation. Development 136, 1761-1770.
Holtwick, R., Gotthardt, M., Skryabin, B., Steinmetz, M., Potthast, R., Zetsche, B.,
Hammer, R. E., Herz, J. and Kuhn, M. (2002). Smooth muscle-selective deletion of
guanylyl cyclase-A prevents the acute but not chronic effects of ANP on blood
pressure. Proc. Natl. Acad. Sci. USA 99, 7142-7147.
Ilagan, R., Abu-Issa, R., Brown, D., Yang, Y. P., Jiao, K., Schwartz, R. J.,
Klingensmith, J. and Meyers, E. N. (2006). Fgf8 is required for anterior heart field
development. Development 133, 2435-2445.
Ito, T., Kwon, H. Y., Zimdahl, B., Congdon, K. L., Blum, J., Lento, W. E., Zhao, C.,
Lagoo, A., Gerrard, G., Foroni, L. et al. (2010). Regulation of myeloid leukaemia
by the cell-fate determinant Musashi. Nature 466, 765-768.
Jenni, R., Rojas, J. and Oechslin, E. (1999). Isolated noncompaction of the
myocardium. N. Engl. J. Med. 340, 966-967.
Kelly, R. G. (2012). The second heart field. Curr. Top. Dev. Biol. 100, 33-65.
Kelly, R. G. and Buckingham, M. E. (2002). The anterior heart-forming field: voyage
to the arterial pole of the heart. Trends Genet. 18, 210-216.
Kelly, R. G., Brown, N. A. and Buckingham, M. E. (2001). The arterial pole of the
mouse heart forms from Fgf10-expressing cells in pharyngeal mesoderm. Dev. Cell
1, 435-440.
Kisanuki, Y. Y., Hammer, R. E., Miyazaki, J., Williams, S. C., Richardson, J. A. and
Yanagisawa, M. (2001). Tie2-Cre transgenic mice: a new model for endothelial celllineage analysis in vivo. Dev. Biol. 230, 230-242.
Kratsios, P., Catela, C., Salimova, E., Huth, M., Berno, V., Rosenthal, N. and
Mourkioti, F. (2010). Distinct roles for cell-autonomous Notch signaling in
cardiomyocytes of the embryonic and adult heart. Circ. Res. 106, 559-572.
Krieger, J. R., Taylor, P., Gajadhar, A. S., Guha, A., Moran, M. F. and McGlade, C.
J. (2013). Identification and selected reaction monitoring (SRM) quantification of
endocytosis factors associated with Numb. Mol. Cell. Proteomics 12, 499-514.
Kwon, C., Arnold, J., Hsiao, E. C., Taketo, M. M., Conklin, B. R. and Srivastava, D.
(2007). Canonical Wnt signaling is a positive regulator of mammalian cardiac
progenitors. Proc. Natl. Acad. Sci. USA 104, 10894-10899.
Kwon, C., Cheng, P., King, I. N., Andersen, P., Shenje, L., Nigam, V. and
Srivastava, D. (2011). Notch post-translationally regulates β-catenin protein in stem
and progenitor cells. Nat. Cell Biol. 13, 1244-1251.
Lechler, T. and Fuchs, E. (2005). Asymmetric cell divisions promote stratification and
differentiation of mammalian skin. Nature 437, 275-280.
Li, L., Miano, J. M., Mercer, B. and Olson, E. N. (1996). Expression of the
SM22alpha promoter in transgenic mice provides evidence for distinct transcriptional
regulatory programs in vascular and visceral smooth muscle cells. J. Cell Biol. 132,
849-859.
Li, H. S., Wang, D., Shen, Q., Schonemann, M. D., Gorski, J. A., Jones, K. R.,
Temple, S., Jan, L. Y. and Jan, Y. N. (2003). Inactivation of Numb and Numblike in
embryonic dorsal forebrain impairs neurogenesis and disrupts cortical
morphogenesis. Neuron 40, 1105-1118.
Lin, L., Cui, L., Zhou, W., Dufort, D., Zhang, X., Cai, C. L., Bu, L., Yang, L., Martin,
J., Kemler, R. et al. (2007). Beta-catenin directly regulates Islet1 expression in
cardiovascular progenitors and is required for multiple aspects of cardiogenesis.
Proc. Natl. Acad. Sci. USA 104, 9313-9318.
Luxán, G., Casanova, J. C., Martínez-Poveda, B., Prados, B., D’Amato, G.,
MacGrogan, D., Gonzalez-Rajal, A., Dobarro, D., Torroja, C., Martinez, F. et al.
(2013). Mutations in the NOTCH pathway regulator MIB1 cause left ventricular
noncompaction cardiomyopathy. Nat. Med. 19, 193-201.
McBurney, M. W. and Rogers, B. J. (1982). Isolation of male embryonal carcinoma
cells and their chromosome replication patterns. Dev. Biol. 89, 503-508.
McCright, B., Gao, X., Shen, L., Lozier, J., Lan, Y., Maguire, M., Herzlinger, D.,
Weinmaster, G., Jiang, R. and Gridley, T. (2001). Defects in development of the
294
Development (2014) doi:10.1242/dev.093690
kidney, heart and eye vasculature in mice homozygous for a hypomorphic Notch2
mutation. Development 128, 491-502.
McGill, M. A. and McGlade, C. J. (2003). Mammalian numb proteins promote Notch1
receptor ubiquitination and degradation of the Notch1 intracellular domain. J. Biol.
Chem. 278, 23196-23203.
McGill, M. A., Dho, S. E., Weinmaster, G. and McGlade, C. J. (2009). Numb
regulates post-endocytic trafficking and degradation of Notch1. J. Biol. Chem. 284,
26427-26438.
Mellgren, A. M., Smith, C. L., Olsen, G. S., Eskiocak, B., Zhou, B., Kazi, M. N.,
Ruiz, F. R., Pu, W. T. and Tallquist, M. D. (2008). Platelet-derived growth factor
receptor beta signaling is required for efficient epicardial cell migration and
development of two distinct coronary vascular smooth muscle cell populations. Circ.
Res. 103, 1393-1401.
Mishra, R., Vijayan, K., Colletti, E. J., Harrington, D. A., Matthiesen, T. S.,
Simpson, D., Goh, S. K., Walker, B. L., Almeida-Porada, G., Wang, D. et al.
(2011). Characterization and functionality of cardiac progenitor cells in congenital
heart patients. Circulation 123, 364-373.
Mizutani, K., Yoon, K., Dang, L., Tokunaga, A. and Gaiano, N. (2007). Differential
Notch signalling distinguishes neural stem cells from intermediate progenitors.
Nature 449, 351-355.
Mjaatvedt, C. H., Nakaoka, T., Moreno-Rodriguez, R., Norris, R. A., Kern, M. J.,
Eisenberg, C. A., Turner, D. and Markwald, R. R. (2001). The outflow tract of the
heart is recruited from a novel heart-forming field. Dev. Biol. 238, 97-109.
Moore, J. C., Spijker, R., Martens, A. C., de Boer, T., Rook, M. B., van der Heyden,
M. A., Tertoolen, L. G. and Mummery, C. L. (2004). A P19Cl6 GFP reporter line to
quantify cardiomyocyte differentiation of stem cells. Int. J. Dev. Biol. 48, 47-55.
Moses, K. A., DeMayo, F., Braun, R. M., Reecy, J. L. and Schwartz, R. J. (2001).
Embryonic expression of an Nkx2-5/Cre gene using ROSA26 reporter mice. Genesis
31, 176-180.
Mummery, C., Ward, D., van den Brink, C. E., Bird, S. D., Doevendans, P. A.,
Opthof, T., Brutel de la Riviere, A., Tertoolen, L., van der Heyden, M. and Pera,
M. (2002). Cardiomyocyte differentiation of mouse and human embryonic stem cells.
J. Anat. 200, 233-242.
Muzumdar, M. D., Tasic, B., Miyamichi, K., Li, L. and Luo, L. (2007). A global
double-fluorescent Cre reporter mouse. Genesis 45, 593-605.
Niikura, Y., Tabata, Y., Tajima, A., Inoue, I., Arai, K. and Watanabe, S. (2006).
Zebrafish Numb homologue: phylogenetic evolution and involvement in regulation of
left-right asymmetry. Mech. Dev. 123, 407-414.
Nishimura, T. and Kaibuchi, K. (2007). Numb controls integrin endocytosis for
directional cell migration with aPKC and PAR-3. Dev. Cell 13, 15-28.
Oka, T., Maillet, M., Watt, A. J., Schwartz, R. J., Aronow, B. J., Duncan, S. A. and
Molkentin, J. D. (2006). Cardiac-specific deletion of Gata4 reveals its requirement
for hypertrophy, compensation, and myocyte viability. Circ. Res. 98, 837-845.
Olson, E. N. (2006). Gene regulatory networks in the evolution and development of the
heart. Science 313, 1922-1927.
Park, E. J., Ogden, L. A., Talbot, A., Evans, S., Cai, C. L., Black, B. L., Frank, D. U.
and Moon, A. M. (2006). Required, tissue-specific roles for Fgf8 in outflow tract
formation and remodeling. Development 133, 2419-2433.
Petersen, P. H., Zou, K., Hwang, J. K., Jan, Y. N. and Zhong, W. (2002). Progenitor
cell maintenance requires numb and numblike during mouse neurogenesis. Nature
419, 929-934.
Petersen, P. H., Zou, K., Krauss, S. and Zhong, W. (2004). Continuing role for mouse
Numb and Numbl in maintaining progenitor cells during cortical neurogenesis. Nat.
Neurosci. 7, 803-811.
Petersen, P. H., Tang, H., Zou, K. and Zhong, W. (2006). The enigma of the numbNotch relationship during mammalian embryogenesis. Dev. Neurosci. 28, 156-168.
Rasin, M. R., Gazula, V. R., Breunig, J. J., Kwan, K. Y., Johnson, M. B., Liu-Chen,
S., Li, H. S., Jan, L. Y., Jan, Y. N., Rakic, P. et al. (2007). Numb and Numbl are
required for maintenance of cadherin-based adhesion and polarity of neural
progenitors. Nat. Neurosci. 10, 819-827.
Rhyu, M. S., Jan, L. Y. and Jan, Y. N. (1994). Asymmetric distribution of numb protein
during division of the sensory organ precursor cell confers distinct fates to daughter
cells. Cell 76, 477-491.
Rochais, F., Mesbah, K. and Kelly, R. G. (2009). Signaling pathways controlling
second heart field development. Circ. Res. 104, 933-942.
Salcini, A. E., Confalonieri, S., Doria, M., Santolini, E., Tassi, E., Minenkova, O.,
Cesareni, G., Pelicci, P. G. and Di Fiore, P. P. (1997). Binding specificity and in vivo
targets of the EH domain, a novel protein-protein interaction module. Genes Dev. 11,
2239-2249.
Samsa, L. A., Yang, B. and Liu, J. (2013). Embryonic cardiac chamber maturation:
trabeculation, conduction, and cardiomyocyte proliferation. Am. J. Med. Genet. C
Semin. Med. Genet. 163C, 157-168.
Sanalkumar, R., Dhanesh, S. B. and James, J. (2010). Non-canonical activation of
Notch signaling/target genes in vertebrates. Cell. Mol. Life Sci. 67, 2957-2968.
Santolini, E., Puri, C., Salcini, A. E., Gagliani, M. C., Pelicci, P. G., Tacchetti, C.
and Di Fiore, P. P. (2000). Numb is an endocytic protein. J. Cell Biol. 151, 13451352.
Schwenk, F., Baron, U. and Rajewsky, K. (1995). A cre-transgenic mouse strain for
the ubiquitous deletion of loxP-flanked gene segments including deletion in germ
cells. Nucleic Acids Res. 23, 5080-5081.
Smith, A. G. (2001). Embryo-derived stem cells: of mice and men. Annu. Rev. Cell
Dev. Biol. 17, 435-462.
Snarr, B. S., O’Neal, J. L., Chintalapudi, M. R., Wirrig, E. E., Phelps, A. L., Kubalak,
S. W. and Wessels, A. (2007a). Isl1 expression at the venous pole identifies a novel
role for the second heart field in cardiac development. Circ. Res. 101, 971-974.
Development
RESEARCH ARTICLE
Snarr, B. S., Wirrig, E. E., Phelps, A. L., Trusk, T. C. and Wessels, A. (2007b). A
spatiotemporal evaluation of the contribution of the dorsal mesenchymal protrusion
to cardiac development. Dev. Dyn. 236, 1287-1294.
Sorkin, A. (2004). Cargo recognition during clathrin-mediated endocytosis: a team
effort. Curr. Opin. Cell Biol. 16, 392-399.
Spana, E. P. and Doe, C. Q. (1996). Numb antagonizes Notch signaling to specify
sibling neuron cell fates. Neuron 17, 21-26.
Stankunas, K., Hang, C. T., Tsun, Z. Y., Chen, H., Lee, N. V., Wu, J. I., Shang, C.,
Bayle, J. H., Shou, W., Iruela-Arispe, M. L. et al. (2008). Endocardial Brg1
represses ADAMTS1 to maintain the microenvironment for myocardial
morphogenesis. Dev. Cell 14, 298-311.
Traub, L. M. (2003). Sorting it out: AP-2 and alternate clathrin adaptors in endocytic
cargo selection. J. Cell Biol. 163, 203-208.
Uemura, T., Shepherd, S., Ackerman, L., Jan, L. Y. and Jan, Y. N. (1989). numb, a
gene required in determination of cell fate during sensory organ formation in
Drosophila embryos. Cell 58, 349-360.
Ueno, S., Weidinger, G., Osugi, T., Kohn, A. D., Golob, J. L., Pabon, L., Reinecke,
H., Moon, R. T. and Murry, C. E. (2007). Biphasic role for Wnt/beta-catenin
signaling in cardiac specification in zebrafish and embryonic stem cells. Proc. Natl.
Acad. Sci. USA 104, 9685-9690.
Umans, L., Cox, L., Tjwa, M., Bito, V., Vermeire, L., Laperre, K., Sipido, K., Moons,
L., Huylebroeck, D. and Zwijsen, A. (2007). Inactivation of Smad5 in endothelial
cells and smooth muscle cells demonstrates that Smad5 is required for cardiac
homeostasis. Am. J. Pathol. 170, 1460-1472.
Varadkar, P., Kraman, M., Despres, D., Ma, G., Lozier, J. and McCright, B. (2008).
Notch2 is required for the proliferation of cardiac neural crest-derived smooth muscle
cells. Dev. Dyn. 237, 1144-1152.
Venkatesh, D. A., Park, K. S., Harrington, A., Miceli-Libby, L., Yoon, J. K. and
Liaw, L. (2008). Cardiovascular and hematopoietic defects associated with Notch1
activation in embryonic Tie2-expressing populations. Circ. Res. 103, 423-431.
Verdi, J. M., Schmandt, R., Bashirullah, A., Jacob, S., Salvino, R., Craig, C. G.,
Program, A. E., Lipshitz, H. D. and McGlade, C. J. (1996). Mammalian NUMB is
an evolutionarily conserved signaling adapter protein that specifies cell fate. Curr.
Biol. 6, 1134-1145.
Verzi, M. P., McCulley, D. J., De Val, S., Dodou, E. and Black, B. L. (2005). The right
ventricle, outflow tract, and ventricular septum comprise a restricted expression
domain within the secondary/anterior heart field. Dev. Biol. 287, 134-145.
Vincent, S. D. and Buckingham, M. E. (2010). How to make a heart: the origin and
regulation of cardiac progenitor cells. Curr. Top. Dev. Biol. 90, 1-41.
Vitelli, F., Morishima, M., Taddei, I., Lindsay, E. A. and Baldini, A. (2002). Tbx1
mutation causes multiple cardiovascular defects and disrupts neural crest and
cranial nerve migratory pathways. Hum. Mol. Genet. 11, 915-922.
Waldo, K. L., Kumiski, D. H., Wallis, K. T., Stadt, H. A., Hutson, M. R., Platt, D. H.
and Kirby, M. L. (2001). Conotruncal myocardium arises from a secondary heart
field. Development 128, 3179-3188.
Wang, Z., Sandiford, S., Wu, C. and Li, S. S. (2009). Numb regulates cell-cell adhesion
and polarity in response to tyrosine kinase signalling. EMBO J. 28, 2360-2373.
Ward, C., Stadt, H., Hutson, M. and Kirby, M. L. (2005). Ablation of the secondary
heart field leads to tetralogy of Fallot and pulmonary atresia. Dev. Biol. 284, 72-83.
Watanabe, Y., Kokubo, H., Miyagawa-Tomita, S., Endo, M., Igarashi, K., Aisaki, K.,
Kanno, J. and Saga, Y. (2006). Activation of Notch1 signaling in cardiogenic
Development (2014) doi:10.1242/dev.093690
mesoderm induces abnormal heart morphogenesis in mouse. Development 133,
1625-1634.
Webb, S., Qayyum, S. R., Anderson, R. H., Lamers, W. H. and Richardson, M. K.
(2003). Septation and separation within the outflow tract of the developing heart. J.
Anat. 202, 327-342.
Weiford, B. C., Subbarao, V. D. and Mulhern, K. M. (2004). Noncompaction of the
ventricular myocardium. Circulation 109, 2965-2971.
Wilson, A., Ardiet, D. L., Saner, C., Vilain, N., Beermann, F., Aguet, M., Macdonald,
H. R. and Zilian, O. (2007). Normal hemopoiesis and lymphopoiesis in the
combined absence of numb and numblike. J. Immunol. 178, 6746-6751.
Wu, B., Zhang, Z., Lui, W., Chen, X., Wang, Y., Chamberlain, A. A., MorenoRodriguez, R. A., Markwald, R. R., O'Rourke, B. P., Sharp, D. J. et al. (2012).
Endocardial cells form the coronary arteries by angiogenesis through myocardialendocardial VEGF signaling. Cell 151, 1083-1096.
Wu, M., Kwon, H. Y., Rattis, F., Blum, J., Zhao, C., Ashkenazi, R., Jackson, T. L.,
Gaiano, N., Oliver, T. and Reya, T. (2007). Imaging hematopoietic precursor
division in real time. Cell Stem Cell 1, 541-554.
Wu, M., Smith, C. L., Hall, J. A., Lee, I., Luby-Phelps, K. and Tallquist, M. D. (2010).
Epicardial spindle orientation controls cell entry into the myocardium. Dev. Cell 19,
114-125.
Xu, K., Chong, D. C., Rankin, S. A., Zorn, A. M. and Cleaver, O. (2009). Rasip1 is
required for endothelial cell motility, angiogenesis and vessel formation. Dev. Biol.
329, 269-279.
Xu, K., Sacharidou, A., Fu, S., Chong, D. C., Skaug, B., Chen, Z. J., Davis, G. E.
and Cleaver, O. (2011). Blood vessel tubulogenesis requires Rasip1 regulation of
GTPase signaling. Dev. Cell 20, 526-539.
Yang, X., Klein, R., Tian, X., Cheng, H. T., Kopan, R. and Shen, J. (2004). Notch
activation induces apoptosis in neural progenitor cells through a p53-dependent
pathway. Dev. Biol. 269, 81-94.
Yang, J., Bücker, S., Jungblut, B., Böttger, T., Cinnamon, Y., Tchorz, J., Müller, M.,
Bettler, B., Harvey, R., Sun, Q. Y. et al. (2012). Inhibition of Notch2 by
Numb/Numblike controls myocardial compaction in the heart. Cardiovasc. Res. 96,
276-285.
Zhang, W., Chen, H., Qu, X., Chang, C. P. and Shou, W. (2013). Molecular
mechanism of ventricular trabeculation/compaction and the pathogenesis of the left
ventricular noncompaction cardiomyopathy (LVNC). Am. J. Med. Genet. C Semin.
Med. Genet. 163C, 144-156.
Zhong, W., Feder, J. N., Jiang, M. M., Jan, L. Y. and Jan, Y. N. (1996). Asymmetric
localization of a mammalian numb homolog during mouse cortical neurogenesis.
Neuron 17, 43-53.
Zhong, W., Jiang, M. M., Weinmaster, G., Jan, L. Y. and Jan, Y. N. (1997).
Differential expression of mammalian Numb, Numblike and Notch1 suggests distinct
roles during mouse cortical neurogenesis. Development 124, 1887-1897.
Zhou, B., Ma, Q., Rajagopal, S., Wu, S. M., Domian, I., Rivera-Feliciano, J., Jiang,
D., von Gise, A., Ikeda, S., Chien, K. R. et al. (2008). Epicardial progenitors
contribute to the cardiomyocyte lineage in the developing heart. Nature 454, 109113.
Zilian, O., Saner, C., Hagedorn, L., Lee, H. Y., Säuberli, E., Suter, U., Sommer, L.
and Aguet, M. (2001). Multiple roles of mouse Numb in tuning developmental cell
fates. Curr. Biol. 11, 494-501.
Development
RESEARCH ARTICLE
295