© 2014. Published by The Company of Biologists Ltd | Development (2014) 141, 2473-2482 doi:10.1242/dev.103499
RESEARCH ARTICLE
Sema6a and Plxna2 mediate spatially regulated repulsion within
the developing eye to promote eye vesicle cohesion
ABSTRACT
Organs are generated from collections of cells that coalesce and
remain together as they undergo a series of choreographed
movements to give the organ its final shape. We know little about
the cellular and molecular mechanisms that regulate tissue cohesion
during morphogenesis. Extensive cell movements underlie eye
development, starting with the eye field separating to form bilateral
vesicles that go on to evaginate from the forebrain. What keeps eye
cells together as they undergo morphogenesis and extensive
proliferation is unknown. Here, we show that plexina2 (Plxna2), a
member of a receptor family best known for its roles in axon and cell
guidance, is required alongside the repellent semaphorin 6a
(Sema6a) to keep cells integrated within the zebrafish eye vesicle
epithelium. sema6a is expressed throughout the eye vesicle,
whereas plxna2 is restricted to the ventral vesicle. Knockdown of
Plxna2 or Sema6a results in a loss of vesicle integrity, with time-lapse
microscopy showing that eye progenitors either fail to enter the
evaginating vesicles or delaminate from the eye epithelium. Explant
experiments, and rescue of eye vesicle integrity with simultaneous
knockdown of sema6a and plxna2, point to an eye-autonomous
requirement for Sema6a/Plxna2. We propose a novel, tissueautonomous mechanism of organ cohesion, with neutralization of
repulsion suggested as a means to promote interactions between
cells within a tissue domain.
KEY WORDS: Plexin, Semaphorin, Morphogenesis, Repulsion,
Zebrafish
INTRODUCTION
During development, cells are specified to become part of a given
tissue, and then sorted so that like cells coalesce and are kept
segregated from non-like cells in adjacent tissues. Over time,
physical barriers, such as extracellular matrix or epithelium,
develop to prevent heterotypic interactions between cells of
neighboring domains. A period of extensive change in both cell
and tissue shape, however, usually precedes the establishment of a
physical barrier. For example, eye formation involves several
distinct phases of integrated cell movements (Graw, 2010). Eye
precursors are separated away from non-retinal cells through a
motile sorting mechanism, ultimately to collect together as a single
contiguous eye field (Moore et al., 2004; Cavodeassi et al., 2005).
The eye field separates to produce the bilateral optic vesicles, which
evaginate from the forebrain. A key question then is how do cells of
a specified tissue retain close associations through the complex
1
Department of Cell Biology and Anatomy, Hotchkiss Brain Institute, Calgary,
2
Alberta T2N 4N1, Canada. Department of Biochemistry and Molecular Biology,
University of Calgary, Calgary, Alberta T2N 4N1, Canada.
*Author for correspondence ([email protected])
Received 3 October 2013; Accepted 24 April 2014
morphogenetic events of embryogenesis in the absence of a
physical barrier?
Two simple molecular mechanisms that result in the formation of
borders between like and non-like tissues help explain how tissue
integrity is promoted (Krens and Heisenberg, 2011). The first
involves selective adhesion, whereby two distinct cell populations
express different levels or types of adhesion molecules. Homotypic
interactions between like cells then separate and sort the two cell
types (Nandadasa et al., 2009). The second mechanism relies on one
population of cells expressing a repellent membrane-associated
ligand and the other expressing the receptor (Krens and Heisenberg,
2011). For example, transmembrane ephrins and their Eph receptors
mediate repellent interactions that prevent mixing between the cells
of adjacent hindbrain rhombomeres (Cooke et al., 2005; Kemp
et al., 2009). Ephrin/Eph signaling also segregates somitic cells
(Watanabe and Takahashi, 2010), ectodermal and mesodermal
tissue (Rohani et al., 2011), and anterior neural plate domains
(Cavodeassi et al., 2013). Other than these few examples, however,
we know little of the molecular mechanisms that mediate tissue
cohesion during development.
In this regard, members of the semaphorin (Sema) family and their
plexin (Plxn) receptors are interesting (Zhou et al., 2008). They serve
as repellents for migrating neurons, axonal growth cones and
endothelial cells (Yazdani and Terman, 2006). Furthermore, certain
Sema proteins are membrane associated and thus would be ideal
candidates to mediate signaling between cells in contact (Zhou et al.,
2008). Indeed, Sema6a helps organize chick cardiac development
(Toyofuku et al., 2004) and Plx2 controls C. elegans epidermal
morphogenesis (Nakao et al., 2007).
In this paper, we provide evidence that Sema6a and Plxna2
promote cohesion of the zebrafish eye primordia, though not
primarily through a boundary mechanism between adjacent tissues.
Sema6a is expressed by progenitors throughout the eye vesicle,
whereas cells in the ventral eye vesicle express its known receptor
Plxna2. With Sema6a or Plxna2 knockdown, many morphant eye
progenitors fail to associate with the eye epithelium and exit the eye
vesicle into either the vesicle lumen or the surrounding mesenchyme.
We propose a novel and third mechanism of tissue cohesion, which
involves dampening of tissue-autonomous repellent signaling. Our
data argue that Sema6a/Plxna2 act eye autonomously to establish and
maintain the position and integration of cells within the eye vesicle
epithelium, processes we postulate involve both repulsive signaling
and selective neutralization of Sema6a activity within the ventral
eye vesicle.
RESULTS
plxna2 is required for eye vesicle development
Several class 6 semaphorin genes (Ebert et al., 2012) and plxna2, a
known receptor for Sema6a in mammals (Suto et al., 2007; Renaud
et al., 2008; Tawarayama et al., 2010), are expressed in the 72 hours
post fertilization (hpf ) zebrafish retina (supplementary material
2473
DEVELOPMENT
Alicia M. Ebert1, Sarah J. Childs2, Carrie L. Hehr1, Paula B. Cechmanek1 and Sarah McFarlane1,*
Fig. S1). To investigate plxna2 expression earlier in zebrafish eye
development, we used RNA in situ hybridization. Interestingly,
plxna2 is expressed transiently as the eye vesicles first form. At
4-12 somites, plxna2 is present in the ventral (future temporal) eye
vesicle and the surrounding mesenchyme (Fig. 1A-D). Expression
continues through 18 somites and is absent from the optic cup at
24 hpf (data not shown).
To investigate whether Plxna2 plays a role in early eye
development, we designed an antisense morpholino oligonucleotide
(MO) against plxna2 ( plxna2e3i3) that alters mRNA splicing and, as
seen by RT-PCR, excludes exon3 to create a frameshift mutation
(Fig. 1F). Zebrafish eye fields are specified during gastrulation, and
eye-field separation into the bilateral eye vesicles initiates during
neurulation (Rembold et al., 2006; Fuhrmann, 2010) (Fig. 1G). To
determine whether these events occur normally in plxna2 morphants,
we examined the expression of key eye-field transcription factors: Rx3
is required for vesicle evagination (Loosli et al., 2003) and precursor
proliferation (Stigloher et al., 2006); Six3 for specification (Liu et al.,
2010); and Meis1 for patterning (Erickson et al., 2010). Induction of
the eye field, as marked by rx3 and six3 at 4-6 somites, appears normal
in plxna2 morphants (Fig. 1H-K). By 12 somites, in both control and
plxna2 morphant embryos, the eye field separates into bilateral
vesicles that evaginate, as seen by meis1 expression (Fig. 1L,M). The
size of the meis1 domain, however, is smaller in the plxna2
morphants, and lagging meis1+ cells that fail to segregate into the
eye vesicles form a bridge of cells in the midline (Fig. 1L,M,P,Q).
One possibility is that cells destined to become eye tissue are
reallocated to a hypothalamic fate, as these two tissues derive from
the same forebrain region (Wilson and Houart, 2004). Yet, the size
of the expression domain of the hypothalamic marker nkx2.1 (Marin
et al., 2002) is unaltered in the plxna2 morphants (Fig. 1N,O) (control
194.4±8 µm, n=16; plxna2 MO 183.2±7.6 µm, n=17; P=0.45
unpaired Student’s t-test). Not surprisingly, given the brain
expression of plxna2, the meis1 domain in the plxna2 morphant
midbrain is reduced slightly when compared with control (91% of
control length along the anterior-posterior axis, n=20). These data
point to possible subtle defects in development of brain structures;
Development (2014) 141, 2473-2482 doi:10.1242/dev.103499
however, we focused our study on understanding the unexpected early
role for Plxna2 in eye development.
Plxna2 is required for eye vesicle integrity
To visualize eye vesicle development, we used the Tg(rx3:GFP)
transgenic line, in which GFP is expressed by developing eye and
hypothalamic progenitors (Rembold et al., 2006). In a 20-somite
control, GFP+ cells are closely packed in the eye epithelium,
whereas in plxna2 morphants the packing of GFP+ cells is less tight
(Fig. 2A-D). In fact, significant numbers of GFP+ cells are ectopic
to plxna2 morphant eyes as the eye vesicles evaginate and elongate
from the neural keel (8-12 somites) (Fig. 2E,F,H). By 12 somites,
the GFP+ eye vesicles of plxna2 morphants are smaller than control
(Fig. 2E-G), consistent with the decrease in the meis1+ eye domain
(Fig. 1Q). Importantly, a similar loss of GFP+ cells from the eye
vesicles is seen with a second plxna2 MO directed against the ATG
start site, showing specificity (Fig. 2I,J). Subsequent analyses are
performed with the e3i3 MO. Moreover, the small eye vesicle
observed with the plxna2 e3i3 MO is partially rescued by coinjection of human PLXNA2 mRNA, which is not targeted by the
splice MO (Fig. 2M-O). To verify that the loss of eye cells and small
eye size did not occur as a result morpholino off-target effects due to
p53 activation (Robu et al., 2007), we compared eye size in plxna2
morphants injected with or without a p53 MO. In both groups, eye
size is reduced when compared with control eyes (data not shown).
These data argue strongly for the specificity of the loss of eye
integrity to a reduction in Plxna2.
The border of the developing eye vesicle is normally continuous
and smooth (Fig. 2A,E). In contrast, the border of the plxna2
morphant eye vesicle is often disrupted, with either cell processes or
somata extruding from the vesicle (Fig. 2B,F). To visualize the
movements of eye progenitors, we performed time-lapse microscopy
of control (Fig. 3A, supplementary material Movie 1) and plxna2
morphant (Fig. 3B, supplementary material Movie 2) rx3:GFP
embryos from 6-14 somites. Over this period, control eye vesicles
evaginate and elongate, driven by the migration of eye progenitors
(England et al., 2006; Kwan et al., 2012), and cells remain integral to
Fig. 1. plxna2 morphants exhibit small eye
vesicles. (A-D) RNA in situ hybridization for plxna2
viewed in lateral wholemounts (A,B), and in sagittal
(C) and transverse (D) sections. At 4-12 somites,
plxna2 mRNA is in the ventral, but not dorsal, eye
(e) vesicle (outlined in white), as well as in the
mesenchyme (m), somites (s) and brain (br). op,
olfactory placode. Red dotted line separates the eye
vesicle into approximate dorsal and ventral
domains. (E) Transverse (t) and coronal (c) planes
of section. (F) RT-PCR indicates the expected
mis-splicing of plxna2 mRNA in the morphants.
(G) A dorsal view of the events of eye vesicle
formation. (H-O) Dorsal views of whole-mount RNA
in situ hybridization of control (H,J,L,N) and plxna2
morphant (I,K,M,O) embryos. rx3 (H,I), six3 (J,K)
and meis1 (L,M) labeling. Arrows indicate the
hypothalamus; the arrowhead marks meis1+ cells
that bridge the eye vesicles in the plxna2 morphant.
(N,O) nkx2.1 labeling of hypothalamus. (P,Q)
Quantitation of the length (P) and area (Q) of the
meis1+ domain. n=2. Error bars indicate s.e.m.
***P<0.001 unpaired Student’s t-test.
2474
DEVELOPMENT
RESEARCH ARTICLE
RESEARCH ARTICLE
Development (2014) 141, 2473-2482 doi:10.1242/dev.103499
Fig. 2. Plxna2 is required for eye tissue cohesion. (A-F) Dorsal
confocal images of (A,B) 20- and (E,F) 12-somite rx3:GFP
transgenic eye vesicles (e) in control (A,E) and plxna2 morphant
(B,F). Scale bar: 50 µm in A,B; 100 µm in E,F. GFP+ cells are
seen ectopic to (arrowheads), emerging from (arrows) and bridging
(red arrow, F) the eye vesicles. hy, hypothalamus. Schematics
highlight ectopic GFP+ cells in morphants (D), but not in control
(C). (G,H) Mean rx3:GFP eye vesicle area (dorsal) (G) and the
numbers of ectopic eye cells (H). n=3. Error bars indicate s.e.m.
***P<0.001 unpaired Student’s t-test. (I,J) Dorsal views of
14-somite rx3:GFP control (I) and ATG plxna2 morphant (J).
(K-N) Dorsosagittal views of 14-somite rx3:GFP control (K) and
e3i3 plxna2 morphant (L), and two embryos co-injected with
human PLXNA2 mRNA and e3i3 plxna2 MO (M,N).
(O) Quantitation of the dorsosagittal GFP+ eye vesicle area in
control, e3i3 plxna2 morphants and e3i3 morphants injected with
human PLXNA2 mRNA. The latter have significantly larger eye
vesicles than plxna2 morphants, although their eyes are still
smaller than control (P<0.001) and some ectopic cells are
evident. n=3. Error bars indicate s.e.m., ***P<0.001, one-way
ANOVA, Newman-Keuls test.
enter the eye vesicles. In contrast, most of the GFP+ cells that exit from
the eye vesicle itself (based on time-lapse data) do not express meis1
(arrowheads, Fig. 4B). In section (Fig. 4C,D), the uneven boundary to
the meis1+ morphant eye vesicle is particularly evident. We find that a
laminin-immunoreactive basal lamina forms in both control and
plxna2 morphants embryos (Fig. 4E-L), suggesting that failure to
develop the basal lamina that borders the eye vesicle does not explain
the ragged edges of the morphant vesicles. In plxna2 morphants,
ectopic GFP+ cells are present in the laminin-rich mesenchyme, both
close to and at a distance from the GFP+ eye vesicle (arrowheads,
Fig. 4H,J,K). Also evident are GFP+ cells filling an expanded
ventricle (Fig. 4K,L), a phenomenon explained by the arrival of
progenitors from the epithelium, as seen by time-lapse imaging
(Fig. 3D,D00 ). Finally, although the dorsal and ventral vesicle epithelia
Fig. 3. Retinal progenitors leave the eye
vesicle with Plxna2 knockdown. Frames
from time-lapse confocal imaging of
control (A,C) and plxna2 morphant (B,D)
rx3:GFP eyes viewed dorsally between 10
and 12 somites (A,B) and laterally between
8 and 14 somites (C,D). In the plxna2
morphant the eye field separates, but
some cells leave the eye vesicle
(arrowhead), whereas others fail to enter
the eye vesicle (*). (D0 ,D00 ) Higher
magnification view of the areas boxed
in D, showing eye cells moving out of the
eye (D0 , arrows and arrowheads) or into the
eye vesicle ventricle (ve) (D00 , arrowheads).
hy, hypothalamus.
2475
DEVELOPMENT
the eye domain. By contrast, in plxna2 morphants, several aberrant
cellular behaviors are observed. First, some GFP+ eye progenitors fail
to enter the eye vesicles and remain in the region separating the two
eye vesicles (Figs 2F and 3B, supplementary material Movie 2). These
cells are also evident as ectopic meis1 label at the anterior midline of
plxna2 morphants (Fig. 1M). Second, GFP+ cells within the eye
vesicle move from the epithelium either into the vesicle lumen
(Fig. 3D,D00 ) or the surrounding mesenchyme (Fig. 3B,D,D0 ). In
summary, Plxna2 knockdown leads to some retinal progenitors failing
to integrate into the eye vesicle epithelium.
To determine whether GFP+ cells continue to express an eye
identity upon leaving the eye vesicle, we assessed meis1 expression.
Ectopic meis1 is seen at the midline between the eye vesicles of plxna2
morphants (Fig. 1M), presumably labeling eye progenitors that fail to
RESEARCH ARTICLE
Development (2014) 141, 2473-2482 doi:10.1242/dev.103499
are tightly apposed in controls, in many plxna2 morphants this
juxtaposition of epithelial layers is lost (Fig. 4H,K,L). Ectopic cells
often show hallmark features of apoptosis, including GFP exclusion
from subcellular compartments, crenated nuclei and activated caspase
3 immunoreactivity (Fig. 4M-Q). Caspase 3+ cells are virtually absent
from control eyes, but in plxna2 morphants, immunopositive cells are
present in the ventricle and epithelium of the eye, and the mesenchyme
(Fig. 4N-Q). Time-lapse microscopy indicates that cells can acquire
an apoptotic appearance prior to leaving the neuroepithelium or
shortly thereafter (Fig. 3D0 ,D00 ). Cell death may occur as a result of the
loss of contact of some progenitors in the plxna2 morphants with the
eye epithelium, a phenomenon known as anoikis.
Loss of Sema6a causes defects in eye vesicle cohesion
Sema6a was a candidate ligand for Plxna2 in regulating eye vesicle
integrity, as it serves as a Plxna2 ligand in other systems (Zhou et al.,
2008) and is expressed in the optic cup (Ebert et al., 2012). We find
that sema6a mRNA is expressed throughout the eye vesicle between
4-14 somites (Fig. 5A-D). Although sema6a is co-expressed with
plxna2 in the ventral vesicle (Fig. 1C), there is no co-expression in the
dorsal vesicle (Fig. 5D,E). If Sema6a and Plxna2 function as a ligandreceptor pair, knockdown of either protein should produce a similar
eye phenotype. To inhibit Sema6a, we designed a sema6a antisense
2476
MO to splice out exon 1 and introduce a frameshift mutation and
premature truncation of the protein (sema6ae1i1) (Fig. 5F). Similar to
the plxna2 morphant (Fig. 2B,F), knockdown of Sema6a results in
smaller GFP+ eye vesicles at 12 somites when compared with controls
(Fig. 5G,I,N), and the presence of GFP+ cells ectopic to the vesicles
(Fig. 5I,O). Furthermore, activated caspase 3+ cells are observed
within and around the eye vesicle (supplementary material Fig. S2).
The specificity of the eye phenotype for Sema6a knockdown is
confirmed by us being able to rescue the sema6a morphants by
injection at the one-cell stage of a full-length zebrafish sema6a mRNA
not targeted by the sema6a splice MO: loss of progenitors from the
eye vesicle and eye size are both partially rescued (Fig. 5J,N). The
similarity of the eye phenotypes in plxna2 and sema6a morphants
argues that Sema6a is the Plxna2 ligand.
We reasoned that because MOs may only partially knockdown
protein levels, tandem knockdown of both Plxna2 and Sema6a
should exacerbate the eye phenotype. Surprisingly, however,
injection of both MOs rescues the defects observed in single
morphants, including the small eye vesicle, the escape of GFP+ cells
and the presence of activated caspase 3+ cells (Fig. 5K-M,O,P,
supplementary material Fig. S2). These data argue strongly that the
location and levels of Sema6a and Plxna2 activity must be tightly
regulated: a decrease of one gene or the other leads to a reduction in
DEVELOPMENT
Fig. 4. plxna2 morphant cells leave the eye
epithelium and undergo apoptosis. (A-D) Lateral
whole-mount view (A,B) and coronal sections (C,D)
of meis1 label of the eye vesicle (e) of a control (C)
and a plxna2 morphant (A,B,D). Ectopic GFP
immunoreactive cells (arrowheads) are indicated, as
well as an ectopic meis1+ cell (arrow). (E-L)
Transverse sections of 12-somite rx3:GFP control
(E,G,I) or plxna2 morphant eye vesicles (F,H,J,K,L)
immunolabeled with an anti-laminin antibody (E,F,L).
The basal lamina (white arrows) is present in both sets
of embryos, but is not complete (red arrows). GFP+
cells are found ectopic to the eye vesicle (arrowheads),
and within (asterisk) the ventricle (outlined; ve), of the
plxna2 morphant (K,L). (M,M0 ) A GFP+ cell in a plxna2
morphant sits at the vesicle edge (M) with a crenated
nucleus (DAPI; M0 ). (N-Q) Anti-activated caspase 3
immunolabeling (N,P,Q) of transverse sections of
control (N) and plxna2 morphant (O-Q; vesicle outlined
by dots). Merge with GFP epifluorescence (N,Q).
Apoptotic GFP+ cells (arrowheads; Q) are present in
the eye vesicle, ventricle and mesenchyme (arrow; P)
of the morphant. Scale bar: 20 µm for A-L. br, brain;
m, mesenchyme.
RESEARCH ARTICLE
Development (2014) 141, 2473-2482 doi:10.1242/dev.103499
eye vesicle integrity and size, whereas loss of both genes in tandem
produces no overt defect.
Plxna2 and Sema6a act primarily within the eye vesicle
To shed light on where and how Sema6a/Plxna2 are required to
promote eye cohesion, we developed an eye explant assay (Fig. 6A).
We dissected eyes from 6-somite rx3:GFP transgenic embryos and
plated them in culture for 6 h. We found that a small number of
GFP+ cells lose integral association with the control explants within
6 h (Fig. 6B), a fact that provided us with a means to investigate
whether Sema6a/Plxna2 could signal in a repellent fashion to block
their escape (Toyofuku et al., 2004; Mauti et al., 2007). We
examined whether soluble Sema6a-Fc (Haklai-Topper et al., 2010)
would prevent cells from leaving the explant. This scenario would
only exist if the emerging eye cells expressed a functional Plxn
receptor. This appears to be the case, because almost no ectopic cells
are seen in Sema6a-Fc cultured explants (Fig. 6B,C,G). Thus,
Sema6a can act as a repellent for zebrafish eye progenitors.
With plxna2 mRNA in the mesenchyme and sema6a in eye
progenitors, we hypothesized that Sema6a and Plxna2 mediate
repellent signaling at the eye vesicle boundary to prevent eye cells
from leaving (Figs 1D and 5D). To test this possibility, we cultured
eye explants with and without the adherent plxna2-expressing
mesenchyme. Only a handful of GFP+ cells lose integral association
with the control eye vesicle explants within 6 h [5.8±1 (s.e.m.) cells,
n=10 explants], and although more do so when the mesenchyme is
removed (13.6±1.6 cells, n=10 explants; unpaired Student’s t-test
P<0.001), the numbers are still small. Thus, the surrounding
mesenchyme likely plays only a small role in maintaining a
boundary for the eye vesicle.
An alternative model is that Sema6a and Plxna2 function in a
tissue-autonomous manner to control eye vesicle integrity. In
support of this, simultaneous knockdown of Plxna2 and Sema6a
largely mitigates the ectopic cell phenotype (Fig. 5M,O), whereas
loss of both signaling partners would be expected to result in a
robust escape of cells from the eye vesicle if a mesenchyme-derived
Plxna2 repellent boundary mechanism is key. To provide further
support for a tissue-autonomous role, we cultured sema6a and
plxna2 morphant eye vesicles (Fig. 6D-F), postulating that
morphant explants should exhibit comparable numbers of ectopic
cells to a mesenchyme-removed wild-type explant if a Sema6a/
Plxna2 repellent boundary is important. This is clearly not the case,
because extensive disaggregation of morphant eye explants occurs
(Fig. 6D-F,H). Thus, our data argue for an additional mechanism(s),
apparently eye-autonomous, by which Sema6a and Plxna2 mediate
eye vesicle cohesion. In support of this, in hanging-drop cultures
(Foty, 2011) of dissected and disaggregated wild-type and plxna2
18-somite rx3:GFP eye vesicles (n=3; 16 drops/condition/
experiment), wild-type, but not plxna2 morphant, cells come
together to form cellular aggregates (data not shown).
Plxna2 required for regionalization of the developing eye
In other systems, the interaction of Sema6a and Plxna2 in cis
(same membrane) apparently inhibits the ability of Sema6a to
2477
DEVELOPMENT
Fig. 5. Plxna2 and Sema6a function together in eye
cohesion. (A-D) RNA in situ hybridization for sema6a viewed in
lateral wholemounts (A-C) and in a transverse section (D). At 4
(A), 6 (B) and 12 somites (C,D), sema6a is expressed in the brain
(br), and both the dorsal and ventral vesicle (e), but not the
mesenchyme (m; arrows). (E) Schematic of a transverse view of
eye vesicle depicting sema6a (blue) throughout and plxna2 (red)
restricted ventrally. (F) RT-PCR indicates a knockdown of
sema6a mRNA in the morphants because of mis-splicing of
exon 1. (G-J) Dorsal images of 12-somite rx3:GFP transgenic
eyes for control (G), sema6a morphant (I), full-length zebrafish
sema6 mRNA-injected embryo (H) and sema6a morphant
rescued with sema6a mRNA (J). (K-M) Dorsal views of
12-somite control (K), plxna2 morphant (L) and plxna2 and
sema6a double morphant (M) rx3:GFP eye vesicles. Ectopic
GFP+ cells are seen around, and at the midline between, the eye
vesicles (arrows). (N) Mean area of the 12-somite GFP+ eye
vesicles of control, and embryos co-injected with the sema6a
MO, with or without sema6a mRNA. n=3. Numbers of embryos in
brackets. ***P<0.001, one-way ANOVA, Newman-Keuls test.
(O,P) Percentage of ectopic GFP+ cells (O) and the GFP+ eye
vesicle area (P) in control and morphant embryos. Error bars
indicate s.e.m., numbers of embryos are in brackets. n=3.
(O) Chi-square ***P<0.001; (P) ***P<0.001, **P<0.01 unpaired
one-way ANOVA, Bonferroni’s test.
RESEARCH ARTICLE
Development (2014) 141, 2473-2482 doi:10.1242/dev.103499
Fig. 6. Sema6a/Plxna2 mediate eye tissue
aggregation. (A) Explant assay. (B,C) Explants with
mesenchyme removed treated with (C) or without (B)
Sema6a-Fc. (D-F) Control (D), plxna2 (E) and sema6a
(F) morphant explants without mesenchyme.
(G,H) Numbers of GFP+ cells outside explants. (G) n=3,
***P<0.001, unpaired Student’s t-test; (H) n=2,
***P<0.001, one-way ANOVA, Dunnett’s test.
Defects in proliferation are present in plxna2 and sema6a
morphants
We focus here primarily on a role for Sema6a/Plxna2 in eye
tissue integrity, but evaluated whether defects in proliferation,
arising either directly from a loss of Sema6a/Plxna2 or
secondary to a loss of eye vesicle integrity (Gao et al., 1991;
Temple and Davis, 1994), might also contribute to the small
morphant eyes. The proliferation regulator rx3 (Stigloher et al.,
2006) is expressed normally in the separating eye vesicles at
eight somites (supplementary material Fig. S3A,B), but by 16
somites rx3 levels are reduced, specifically in the eye vesicle and
2478
not the hypothalamus (supplementary material Fig. S3C,D).
Additionally, at 20 somites, fewer mitotically active phosphohistone ( pHH3) immunopositive cells are present in both plxna2
and sema6a morphant eyes relative to controls (supplementary
material Fig. S3E-K). Thus, the reduction in morphant eye
vesicle size probably arises from both a loss of cells from the
eye vesicle and defects in proliferation.
Sema6a/Plxna2 are not required for optic cup integrity
Although the loss of Plxna2 signaling transiently compromises eye
vesicle cohesion, optic cups form as development proceeds, which
is not unexpected given that plxna2 mRNA is absent from the optic
cup after 24 hpf (data not shown). The cells that remain in the
plxna2 morphant eye organize into an apparently cohesive,
apicobasal polarized neuroepithelium by 21 hpf (Fig. 8A-D), as
shown by the appropriate apical localization of immunoreactivity
for ZO1, a tight junction-associated protein. The pigment
epithelium is present in both control and morphant eyes at 30 hpf
(supplementary material Fig. S4A,B), and few TUNEL+ apoptotic
cells are evident at 24 hpf (data not shown).
Not surprisingly, plxna2 (control, 6.5% small eyes, n=155; plxna2
morphants, 93%, n=233; Fisher’s exact test P<0.001) and sema6a
morphants have smaller eyes than wild type at 72 hpf (Fig. 8E-H,O).
Nonetheless, plxna2 morphant eyes show the appropriate proportion
of cells in the three cell layers (Fig. 8P), and contain several distinct
cell types: ZN8+ retinal ganglion cells (RGCs), Pax6+ amacrine cells
(Pax6 also weakly labels RGCs) and rhodopsin+ rod photoreceptors
(Link et al., 2000) (Fig. 8I-N). Reflecting eye size, fewer RGCs are
present in the central retina of a transgenic in which differentiating
RGCs express GFP [Tg(isl2b:GFPzc7) (Pittman et al., 2010)], in
morphants compared with control (control=83.4±4.1 cells (s.e.m.);
plxna2 morphant=47.5±3.1 cells; n=3 experiments, n=15; MannWhitney, P<0.001). A delay in eye development does not account for
the reduction in RGCs, in that GFP expression initiates normally in
both control and morphant isl2b:GFP transgenics at 28-30 hpf
(supplementary material Fig. S4A,B). Together, these data indicate
that subsequent events of retinogenesis occur normally, albeit in the
context of the defects that arise from the early role of Plxna2 in eye
development.
DEVELOPMENT
interact with Plxna in trans (membrane of different cell) (Suto
et al., 2007; Renaud et al., 2008; Haklai-Topper et al., 2010;
Yaron and Sprinzak, 2012). Because plxna2 and sema6a mRNAs
are both present in the ventral vesicle, we postulated that Plxna2
neutralizes Sema6a repulsion in this domain. Neutralization
would divide the eye vesicle into repellent and non-repellent
domains. If true, we expected to see disorganization of regionally
expressed eye markers in the morphants. We evaluated the
expression of several transcription factors at 12 somites. fogx1a, a
transcription factor expressed in the dorsal (future nasal) eye
vesicle (Picker et al., 2009), expands into ventral domains in
plxna2 and sema6a morphants (Fig. 7A-C). vax2 and tbx5 mark
tissue that gives rise to future ventral and dorsal retina,
respectively (Koshiba-Takeuchi et al., 2000; Take-uchi et al.,
2003). In wild type, vax2 is expressed in the anterior eye vesicle
(future ventral retina; Fig. 7E,E0 ), whereas tbx5 is in the posterior
eye vesicle (future dorsal retina; Fig. 7K,M). The tight domain of
vax2 expands in both plxna2 and sema6a morphants into the
posterior/future dorsal region (Fig. 7F-G), as seen by an increase
in the ratio of the height of the vax2 expression domain relative to
the eye vesicle height (Fig. 7I,J). The tbx5 domain appears less
distinct and intense in the plxna2 (compare Fig. 7I,J) and sema6a
(data not shown) morphants. Interestingly, although eye vesicle
cohesion is rescued in the plxna2 and sema6a double morphants
(Fig. 5), regionalization of the eye vesicles is still disrupted
(Fig. 7D,H,N). These data indicate a failure of regionalization of
the eye vesicle in the absence of Plxna2 and/or Sema6a.
RESEARCH ARTICLE
Development (2014) 141, 2473-2482 doi:10.1242/dev.103499
Fig. 7. Sema6a/Plxna2 are necessary for proper regionalization
of the eye vesicle. Twelve-somite control eyes (A,E,E0 ,K,M), and
plxna2 (B,F,F0,L), sema6a (C,G) and sema6a/plxna2 double
(D,H,N) morphant eyes processed with riboprobes for foxg1a (A-D),
vax2 (E-H; posterior extent of expression indicated by red dots) and
tbx5 (K-N). (A-D) Transverse sections. (E-H,K,L) Lateral views.
(M,N) Dorsal views. A/P orientation in E applies. (A-D) foxg1a label
is present ventrally in morphants (arrowheads) but not in control
(arrow). In E-H, arrows indicate in situ label showing through from
the opposite eye vesicle. Mesenchyme (*) is stuck to the eye vesicle
in L. (E0 ,F0 ) Coronal sections show vax2 mRNA expansion into the
posterior eye vesicle in a plxna2 morphant. (I,J) Analysis method (I)
and the ratio of vax2 domain height (Ev) normalized to eye vesicle
height (Eh) (J). ***P<0.001, unpaired Student’s t-test. Numbers of
embryos in brackets (n=2); error bars indicate s.e.m.
Here, we provide evidence that precise spatial control of Sema6a/
Plxna2 function is required for progenitors to remain within the eye
primordium. In the early embryo, the transmembrane Sema6a is
expressed throughout the eye vesicle, whereas cells in the ventral
eye vesicle express its partner receptor, Plxna2. In the absence of
normal Plxna2 signaling, progenitors escape from the eye vesicle
over time. We put forward a novel, tissue-autonomous mechanism
of organ cohesion involving local control of repellent signaling,
which ultimately allows the proper positioning of cells and
organization of the eye vesicle into regionalized subdomains.
Our data argue that carefully regulated Sema6a and Plxna2
interactions are required to maintain eye cohesion. Similar defects
with regards to eye vesicle size, ectopic eye cells, marker expression and
proliferation are present with loss of either Plxna2 or Sema6a. Yet, loss
of both Sema6a and Plxna2 results in no obvious epithelial integrity
phenotype, arguing that Plxna2 and Sema6a need to be appropriately
expressed relative to one another, with no interaction actually less
Fig. 8. plxna2 morphants form retinas with the appropriate
cell types. (A-D) Transverse sections of 21 hpf control (A,B) and
plxna2 (C,D) morphant rx3:GFP optic cups immunolabeled with
anti-ZO-1. (B,D) Merge. a, apical; b, basal. (E-P) Analysis of
72 hpf retinas. Transverse sections (F,H-N). (E-H) Control (E)
and plxna2 morphant (G) indicating smaller eye (bracket) and
pericardial edema (*) in the morphant that likely reflects cardiac
Plxna2 expression (Toyofuku et al., 2004). (F,H) Hematoxylin
and Eosin staining. Optic nerve head is indicated by arrows.
(I-N) Immunolabeling of ZN8+ retinal ganglion cells (RGCs) (I,J),
Pax6+ RGCs and amacrine cells (K,L), and rhodopsin+ rods
(M,N). Scale bar: 50 µm for I-L; 20 µm for M,N. (O,P) Eye height
(O) (***P<0.001; one-way ANOVA, Dunnett’s test, n=2) and % of
total nuclei in each layer of the central one-third of a central
retinal section (P) (control, n=6; plxna2 morphant, n=8). Error
bars indicate s.e.m. inl, inner nuclear layer; l, lens; ipl, inner
plexiform layer; nr, neural retina; opl, outer plexiform layer;
pe, pigment epithelium; pr, photoreceptors.
DEVELOPMENT
DISCUSSION
2479
harmful than too little of one or the other protein. The double-morphant
data also support the idea that the two proteins function in concert.
Initially, we postulated that Sema6a/Plxna2 provide a molecular
boundary to the eye vesicle, by mediating repulsive interactions
between cells in neighboring tissues: mesenchymal Plxna2 would
keep Sema6a-expressing cells in the eye vesicle, presumably via
reverse Sema6a signaling [cells are known to use Sema6 to respond to
repellent Plxn signals from neighboring non-like cells (Toyofuku
et al., 2004; Mauti et al., 2007)]. Yet two observations suggest that a
boundary mechanism plays only a minimal role in maintaining eye
vesicle integrity. First, there is a rescue of eye vesicle size and
suppression of delamination when Plxna2 and Sema6a are knocked
down simultaneously, whereas with a boundary mechanism we would
expect a worsened phenotype. Second, wild-type eye explants missing
mesenchyme show a relatively minor loss of cells.
Instead, we suggest that Sema6a/Plxna2 function within the eye
vesicle itself. We propose a working model (Fig. 9A), based on our
Fig. 9. Working model for Sema6a/Plxna2 involvement in eye vesicle
development. (A) Sagittal eye vesicle schematic. sema6a (blue) is expressed
throughout the eye vesicle and plxna2 (orange) ventrally. (A0 ) We suggest a
tissue-autonomous role for Sema6a/Plxna2, where Plxna2 neutralizes
Sema6a repulsion in the ventral (V) domain, leaving the dorsal (D) vesicle as
repulsive (red bars). Sema6a-sensitive progenitors (green) migrating into the
eye vesicle are directed to the ventral domain, and mixing of cells between the
dorsal and ventral domains is discouraged. Dorsal Sema6a is sensed either
by Plxna2 or by an unknown Plxn receptor. When either Plxna2 (B) or Sema6a
(C) is knocked down in the eye vesicle, a preferred ‘choice’ of ventral over
dorsal is lost, with either low (sema6a morphant; C0 ) or high ( plxna2 morphant;
B0 ) Sema6a repellent activity present throughout the entire eye vesicle. As a
result, progenitors that are normally directed ventrally move into both the dorsal
or ventral vesicle (black arrows), but Sema6a repellent activity prevents them
from integrating into the epithelium: cells exit out of the eye (red arrows). In
plxna2 morphants, other progenitors fail to migrate into the eye vesicle entirely
and collect at the brain midline (*). (D,D0 ) Knockdown of all repulsive signaling
in the sema6a/plxna2 double morphant removes the ventral over dorsal
preference; yet, in the absence of any repulsive signaling, mis-positioned
progenitors remain within the vesicle. In support of this, regionalization of the
vesicle is disrupted in all morphants, but vesicle integrity is defective in single
but not double morphants.
2480
Development (2014) 141, 2473-2482 doi:10.1242/dev.103499
data and work showing that Plxna2 in cis with Sema6a inhibits the
function of Sema6a in trans (Suto et al., 2007; Haklai-Topper et al.,
2010). In the hippocampus, such a mechanism is important in directing
the projections of Plxna4-expressing mossy fibers to the proximal
dendritic region of CA3 pyramidal cells: Sema6a is expressed in all
layers of the CA3 region, but mossy fibers target only the stratum
lucidum, where Plxna2 is present to neutralize Sema6a (Suto et al.,
2007). We propose a similar neutralization of repulsive signaling
occurs in the ventral eye vesicle, where both plxna2 and sema6a are
expressed. By contrast, in the dorsal eye vesicle, where plxna2 is
absent, Sema6a is repulsive. Zebrafish eye progenitors migrate
laterally and posteriorly into the evaginating eye vesicles, a process
that continues through to 14 somites (England et al., 2006; Kwan et al.,
2012). We hypothesize that some of these progenitors are sensitive to
Sema6a, avoid the repulsive dorsal domain and are directed into the
ventral domain. Motor axons entering the limb bud are presented with
a similar dorsal/ventral binary choice, mediated by ephrin/Eph
repellent signaling (Luria et al., 2008). An additional role for dorsal
Sema6a activity could be to restrict dorsoventral mixing of cells within
the vesicle. Thus, we propose that Sema6a/Plxna2 control the
movement of cells into and within the forming eye.
With knockdown of Plxna2 or Sema6a, we postulate that repellent
signaling within the ventral domain is activated aberrantly (Fig. 9B,C),
such that Sema6a is active both ventrally and dorsally. Whereas wildtype progenitors entering the eye vesicle are presented with a binary
choice, those that are sensitive to Sema6a select the ventral domain.
Ventral and dorsal domains become essentially equivalent in
morphants with regard to expression of active Sema6a repellent,
whether it be low (sema6a morphant), high (plxna2 morphant) or no
(double morphant) activity. With no clear preference for one domain
over the other, some of the progenitors that normally are directed
ventrally will end up inappropriately in the dorsal eye vesicle. In
support of this, the plxna2 morphant phenotype is not restricted to the
ventral eye vesicle, and expression of regionalized markers is altered in
both the single and double morphants. Further support for a
neutralization role for Plxna2 comes from the observation that in
plxna2 morphants some progenitors fail to enter the eye and collect in
the forebrain between the two eye vesicles, as seen by meis1
expression and live imaging, a phenotype that is concordant with high
Sema6a throughout the entire vesicle.
Why do progenitors leave the eye vesicle in single morphants?
A possible explanation is that once within the control eye vesicle,
most progenitors (except possibly those at the boundary between
dorsal and ventral domains) do not experience Sema6a repulsion:
those located in the dorsal domain presumably lack a mechanism
to sense Sema6a, and ventral progenitors sit in a domain where
Sema6a is neutralized. In contrast, Sema6a-responsive cells within
the morphant eye vesicle, either dorsally or ventrally, are exposed to
some level (either low or high) of Sema6a activity. This aberrant
repulsion impairs the ability of a cell to integrate into the epithelium.
Whether the cells are pushed from the epithelium, or simply fail to
associate with neighbors, is unclear. Regardless, the cells that fail
to integrate escape the eye vesicle. The double morphant data lend
support to the idea that aberrant regulation of repulsion within the
eye vesicle is what leads to the loss of eye cells from the forming
vesicle. Because virtually no repulsion would occur in the double
morphants, mis-positioned progenitors would not be forced out of
the eye epithelium. In agreement with this, regionalization but not
vesicle cohesion is defective in the double morphants. A similar
delamination phenotype is seen with knockdown of Foxg1a (Picker
et al., 2009), though the loss of cells appears to occur earlier in
plxna2 morphants. Loss of epithelial contacts could in part explain
DEVELOPMENT
RESEARCH ARTICLE
RESEARCH ARTICLE
MATERIALS AND METHODS
Zebrafish husbandry
Zebrafish embryos were developmentally staged as described previously
(Kimmel et al., 1995). Pigmentation was blocked by addition of 0.003%
phenylthiourea at 24 hpf. rx3:GFP and isl2b:GFP transgenic fish were
provided by Drs Wittbrodt (University of Heidelberg, Germany) and Chien
(University of Utah, USA), respectively. All procedures were approved by
the University of Calgary Animal Care Committee.
Injections
Antisense morpholino oligonucleotides (Gene Tools), mRNA or
combinations of the two, were injected at the one-cell stage (Kimmel
et al., 1995). Morpholino concentrations and sequences were as follows:
plxna2, 2 ng (AAAAGCGATGTCTTTCTCACCTTCC); sema6a, 4 ng
(TGCTGATATCCTGCACTCACCTCAC). To isolate full-length zebrafish
sema6a, cDNA was obtained from total mRNA of 20 hpf zebrafish
using Trizol and reverse transcriptase (Invitrogen), according to the
manufacturer’s protocols. The PCR product generated with specific
primers GATCGGATGTGATCGGGATTT (forward) and GATTATGTGCAGGAGTCTCC (reverse) was subcloned into the pCRII topo vector.
Sequencing of the full-length coding sequence of sema6a showed 100%
identity with data previously published (NM_199992) between
nucleotides 20 and 3026. sema6a mRNA and human PLXNA2 mRNA
(Origene) were injected at 175-200 pg/embryo.
RNA in situ hybridization
RNA in situ hybridization was performed as described previously (Thisse and
Thisse, 2008). Antisense riboprobes were made using the following primers:
plxna2 forward, ATGTGATACAGGAGCCGAGG; plxna2 reverse, AGAGTCAGAAGGCTGTCGGA; sema6a forward, ATGCGAGCGCAGGCCCTGC; sema6a reverse, CACGTTGGCGTGTTTGGCGT; foxg1a forward,
GCAGGAAGAAAAACGGGACGC; foxg1a reverse, GATGGGTGAGGGACATGGGG. rx3, six3 and nkx2.1 constructs were provided by Dr Kurrasch
(University of Calgary, Canada), and the meis1 construct by Dr Waskiewicz
(University of Alberta, Canada).
RNA isolation and RT-PCR
Total RNA from 72 hpf embryos was prepared using Trizol/chloroform
(Invitrogen). First-strand cDNA was made using the Superscript II RT-PCR
protocol (Invitrogen) and amplified by PCR using Taq polymerase (Fermentas)
and the following primers for plxna2: forward, CTTTGAACCACTCAGCACCA; reverse, CGTATTCCAGTCGACCCTGT.
Confocal imaging
rx3:GFP transgenic embryos were imaged with a 10 or 20× objective using
step sizes of 3 µm after mounting in 0.5% low melt agarose on glass bottom
dishes (Mat-Tek) on a Zeiss LSM 510 Meta or LSM 700 inverted
microscope. Time-lapse stacks were taken every 5 min over a 3.5 h window.
Stacks were subjected to a Kalman stack filter in Image J or processed in Zen
Lite and are presented as maximum intensity projections.
Histology
Embryos were fixed in 4% PFA, infiltrated with 35% sucrose (EM Science)
and embedded in optimal cutting temperature (OCT; Tissue Tek).
Transverse sections were performed on a Microm HM 500 OM cryostat at
12 µm. The following antibodies were used: activated caspase 3 (G7481,
1:500; Promega), laminin (L9393, 1:200; Sigma), Pax6 (PRB-278P, 1:500;
Covance), ZN8 (1:1000; Developmental Hybridoma Studies Bank),
rhodopsin (MAB5356, 1:1000; Chemicon), pHH3 ( pHH3-06-570, 1:500;
Millipore), ZO-1 (339100, 1:150; Invitrogen), and anti-mouse or anti-rabbit
Alexa Fluor 546 (mouse-A11030, rabbit-A11030, 1:1000; Invitrogen).
Images were taken on a Leica DMR compound microscope using a
Magnafire camera (Optronics). Images were processed in Adobe Photoshop
for brightness and contrast. pHH3 immunostaining was performed in
wholemounts, and pHH3+ cells within the GFP+ eye vesicle counted under
a fluorescent Zeiss compound stereomicroscope. Statistical analyses
throughout the study were performed with GraphPad software. For H&E
staining, slides were bathed in consecutive 5 min washes of aqueous Eosin
and Hematoxylin (Sigma-Aldrich). Slides were imaged on a Zeiss
StemiSV11 stereomicroscope using Axiovision imaging software.
Eye size measurements
Fixed 12-somite rx3:GFP embryos were photographed dorsal side upwards
by using a Zeiss StemiSv11 stereomicroscope and Axiovision software. The
area (not including the optic stalk) and/or length of the GFP or meis1+ left
eye vesicle was measured using Axiovision software. Alternatively,
embryos were grown to 72 hpf, embedded in JB4 (Polysciences) and
sectioned, and imaged and measured using SPOT imaging software. Retinal
height was measured from dorsal to ventral surfaces, through the lens.
Eye explants
Six somite control and morphant eyes were dissected and each placed in
an individual well of a 96-well plate in modified Barth’s solution with
10 mg/ml gentamycin. Select explants were incubated with human
recombinant Sema6a-Fc (300 ng/ml) (R&D Systems). Explants were
incubated at 28°C for 6 h. Images were taken on a Zeiss Axiovert 40 CFL
compound fluorescent microscope, and the numbers of GFP+ progenitors
that exited the eye vesicle were quantified.
2481
DEVELOPMENT
the reduction of mitotically active cells in morphant vesicles, in that
cultured neuroepithelial cells prevented from aggregating leave the
cell cycle (Gao et al., 1991; Temple and Davis, 1994). Alternatively,
Sema6a/Plxna2 signaling could function to directly regulate
progenitor proliferation (Kigel et al., 2011).
Our model requires that a subset of eye progenitors expresses a Plxn
in order to respond to ‘activated’ Sema6a. It is possible that Plxna2 is
the receptor. The double morphant data argue that some residual
Plxna2 remains in the single plxna2 morphants. Alternatively, eye
progenitors may express a different Plxn with which to respond to the
Sema6a. Indeed, Plxna4 allows hippocampal axons to sense Sema6a+
in all CA3 layers, except where Plxna2 is also expressed (Suto et al.,
2007). Future experiments will need to address the involvement of
additional Plxn receptors.
Time-lapse imaging suggests that cells in different domains of the
zebrafish eye vesicle do not intermingle (Kwan et al., 2012). Thus,
tissue cohesion is likely to be important not only for an entire organ, but
also for subdomains within a tissue. The cellular and molecular
mechanisms that underlie such cohesion are unknown. Here, we
propose that Sema6a/Plxna2 promote the formation of cohesive
collections of cells within subdomains of the eye vesicle by establishing
within the vesicle a repulsive and a non-repulsive domain. The latter
arises from neutralization of repulsion, which may be a key mechanism
to promote interactions of cells within a tissue domain by allowing
adhesive mechanisms between like-cells to predominate. Thus, antirepellent and adhesive mechanisms between like cells may cooperate to
induce and maintain tissue cohesion. Eventually, the maintenance of
these cellular domains by dynamic cellular signaling would be
unnecessary as a tight epithelium becomes established.
Eye formation depends on the successful completion of a series of
segregation events that involve distinct molecular mechanisms. Ephrin/
Eph signaling mediates cell dispersal required for retinal progenitors to
access the Xenopus eye field (Moore et al., 2004), and allows the
zebrafish eye field to remain segregated from adjacent neural plate
regions (Cavodeassi et al., 2013). Subsequent morphogenesis of the
eye field may involve non-canonical Wnt signaling (Cavodeassi et al.,
2005). We propose that the Plxn signaling pathway then promotes
positioning of cells within the eye vesicle to help establish and maintain
early regionalization of the developing eye. Understanding how
repellent signals promote tissue subdomain organization will be
important in determining how developing organs form.
Development (2014) 141, 2473-2482 doi:10.1242/dev.103499
Acknowledgements
The authors thank Drs Schuurmans and Kurrasch for helpful suggestions, A. Zuba
for technical assistance, Dr Bertolesi and J. Johnston for identification of zebrafish
sema6a, Drs Kurrasch and Waskiewicz for constructs, and Drs Chien and Wittbrodt
for transgenic lines.
Competing interests
The authors declare no competing financial interests.
Author contributions
A.M.E. contributed Figs 1-3 and 5-9 and supplementary material Figs S1 and S3,
analyzed data (Figs 8 and 9, supplementary material Fig. S3), and participated in
writing. S.J.C. provided tools, generated data (Fig. 3), edited the manuscript, and
provided intellectual input. C.L.H. contributed data (Figs 2-5 and 7) and edited the
manuscript. P.B.C. generated data for Figs 4O-Q and 5G-N and supplementary
material Fig. S2. S.M. contributed to experimental design, performed data analysis
(Figs 1,2,5,6 and 7) and wrote the manuscript.
Funding
A.M.E. was supported by fellowships from Alberta Innovates-Health Solutions (AI-HS),
Canadian Institutes of Health Research (CIHR) and the Foundation for Fighting
Blindness. S.M. was a Tier II Canada Research Chair (CRC) in Developmental
Neurobiology and is an AI-HS Scientist. S.J.C. was a Tier II CRC in Angiogenesis and
Genetics and is an AI-HS Senior Scholar. CIHR operating grants to S.M. [MOP#14138]
and S.J.C. [MOP#97787] supported this research.
Supplementary material
Supplementary material available online at
http://dev.biologists.org/lookup/suppl/doi:10.1242/dev.103499/-/DC1
References
Cavodeassi, F., Carreira-Barbosa, F., Young, R. M., Concha, M. L., Allende, M. L.,
Houart, C., Tada, M. and Wilson, S. W. (2005). Early stages of zebrafish eye
formation require the coordinated activity of Wnt11, Fz5, and the Wnt/beta-catenin
pathway. Neuron 47, 43-56.
Cavodeassi, F., Ivanovitch, K. and Wilson, S. W. (2013). Eph/Ephrin signalling
maintains eye field segregation from adjacent neural plate territories during
forebrain morphogenesis. Development 140, 4193-4202.
Cooke, J. E., Kemp, H. A. and Moens, C. B. (2005). EphA4 is required for cell adhesion
and rhombomere-boundary formation in the zebrafish. Curr. Biol. 15, 536-542.
Ebert, A. M., Lamont, R. E., Childs, S. J. and McFarlane, S. (2012). Neuronal
expression of class 6 semaphorins in zebrafish. Gene Expr. Patterns 12, 117-122.
England, S. J., Blanchard, G. B., Mahadevan, L. and Adams, R. J. (2006). A
dynamic fate map of the forebrain shows how vertebrate eyes form and explains
two causes of cyclopia. Development 133, 4613-4617.
Erickson, T., French, C. R. and Waskiewicz, A. J. (2010). Meis1 specifies
positional information in the retina and tectum to organize the zebrafish visual
system. Neural Dev. 5, 22.
Foty, R. (2011). A simple hanging drop cell culture protocol for generation of 3D
spheroids. J. Vis. Exp. 51, 2720.
Fuhrmann, S. (2010). Eye morphogenesis and patterning of the optic vesicle. Curr.
Top. Dev. Biol. 93, 61-84.
Gao, W.-Q., Heintz, N. and Hatten, M. E. (1991). Cerebellar granule cell
neurogenesis is regulated by cell-cell interactions in vitro. Neuron 6, 705-715.
Graw, J. (2010). Eye development. Curr. Top. Dev. Biol. 90, 343-386.
Haklai-Topper, L., Mlechkovich, G., Savariego, D., Gokhman, I. and Yaron, A.
(2010). Cis interaction between Semaphorin6A and Plexin-A4 modulates the
repulsive response to Sema6A. EMBO J. 29, 2635-2645.
Kemp, H. A., Cooke, J. E. and Moens, C. B. (2009). EphA4 and EfnB2a maintain
rhombomere coherence by independently regulating intercalation of progenitor
cells in the zebrafish neural keel. Dev. Biol. 327, 313-326.
Kigel, B., Rabinowicz, N., Varshavsky, A., Kessler, O. and Neufeld, G. (2011).
Plexin-A4 promotes tumor progression and tumor angiogenesis by enhancement
of VEGF and bFGF signaling. Blood 118, 4285-4296.
Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B. and Schilling, T. F.
(1995). Stages of embryonic development of the zebrafish. Dev. Dyn. 203, 253-310.
Koshiba-Takeuchi, K., Takeuchi, J. K., Matsumoto, K., Momose, T., Uno, K.,
Hoepker, V., Ogura, K., Takahashi, N., Nakamura, H., Yasuda, K. et al. (2000).
Tbx5 and the retinotectum projection. Science 287, 134-137.
Krens, S. F. G. and Heisenberg, C.-P. (2011). Cell sorting in development. Curr.
Top. Dev. Biol. 95, 189-213.
Kwan, K. M., Otsuna, H., Kidokoro, H., Carney, K. R., Saijoh, Y. and Chien, C.-B.
(2012). A complex choreography of cell movements shapes the vertebrate eye.
Development 139, 359-372.
Link, B. A., Fadool, J. M., Malicki, J. and Dowling, J. E. (2000). The zebrafish
young mutation acts non-cell-autonomously to uncouple differentiation from
specification for all retinal cells. Development 127, 2177-2188.
2482
Development (2014) 141, 2473-2482 doi:10.1242/dev.103499
Liu, W., Lagutin, O., Swindell, E., Jamrich, M. and Oliver, G. (2010). Neuroretina
specification in mouse embryos requires Six3-mediated suppression of Wnt8b in
the anterior neural plate. J. Clin. Invest. 120, 3568-3577.
Loosli, F., Staub, W., Finger-Baier, K. C., Ober, E. A., Verkade, H., Wittbrodt, J.
and Baier, H. (2003). Loss of eyes in zebrafish caused by mutation of chokh/rx3.
EMBO Rep. 4, 894-899.
Luria, V., Krawchuk, D., Jessell, T. M., Laufer, E. and Kania, A. (2008).
Specification of motor axon trajectory by ephrin-B:EphB signaling: symmetrical
control of axonal patterning in the developing limb. Neuron 60, 1039-1053.
Marin, O., Baker, J., Puelles, L. and Rubenstein, J. L. (2002). Patterning of the
basal telencephalon and hypothalamus is essential for guidance of cortical
projections. Development 129, 761-773.
Mauti, O., Domanitskaya, E., Andermatt, I., Sadhu, R. and Stoeckli, E. T. (2007).
Semaphorin6A acts as a gate keeper between the central and the peripheral
nervous system. Neural Dev. 2, 28.
Moore, K. B., Mood, K., Daar, I. O. and Moody, S. A. (2004). Morphogenetic
movements underlying eye field formation require interactions between the FGF
and ephrinB1 signaling pathways. Dev. Cell 6, 55-67.
Nakao, F., Hudson, M. L., Suzuki, M., Peckler, Z., Kurokawa, R., Liu, Z., GengyoAndo, K., Nukazuka, A., Fujii, T., Suto, F. et al. (2007). The PLEXIN PLX-2 and the
ephrin EFN-4 have distinct roles in MAB-20/Semaphorin 2A signaling in
Caenorhabditis elegans morphogenesis. Genetics 176, 1591-1607.
Nandadasa, S., Tao, Q., Menon, N. R., Heasman, J. and Wylie, C. (2009). N- and
E-cadherins in Xenopus are specifically required in the neural and non-neural
ectoderm, respectively, for F-actin assembly and morphogenetic movements.
Development 136, 1327-1338.
Picker, A., Cavodeassi, F., Machate, A., Bernauer, S., Hans, S., Abe, G.,
Kawakami, K., Wilson, S. W. and Brand, M. (2009). Dynamic coupling of pattern
formation and morphogenesis in the developing vertebrate retina. PLoS Biol. 7,
e1000214.
Pittman, A. J., Gaynes, J. A. and Chien, C.-B. (2010). nev (cyfip2) is required for
retinal lamination and axon guidance in the zebrafish retinotectal system. Dev.
Biol. 344, 784-794.
Rembold, M., Loosli, F., Adams, R. J. and Wittbrodt, J. (2006). Individual cell
migration serves as the driving force for optic vesicle evagination. Science 313,
1130-1134.
Renaud, J., Kerjan, G., Sumita, I., Zagar, Y., Georget, V., Kim, D., Fouquet, C., Suda,
K., Sanbo, M., Suto, F. et al. (2008). Plexin-A2 and its ligand, Sema6A, control
nucleus-centrosome coupling in migrating granule cells. Nat. Neurosci. 11, 440-449.
Robu, M. E., Larson, J. D., Nasevicius, A., Beiraghi, S., Brenner, C., Farber, S. A.
and Ekker, S. C. (2007). p53 activation by knockdown technologies. PLoS Genet. 3,
e78.
Rohani, N., Canty, L., Luu, O., Fagotto, F. and Winklbauer, R. (2011). EphrinB/
EphB signaling controls embryonic germ layer separation by contact-induced cell
detachment. PLoS Biol. 9, e1000597.
Stigloher, C., Ninkovic, J., Laplante, M., Geling, A., Tannhä user, B., Topp, S.,
Kikuta, H., Becker, T. S., Houart, C. and Bally-Cuif, L. (2006). Segregation of
telencephalic and eye-field identities inside the zebrafish forebrain territory is
controlled by Rx3. Development 133, 2925-2935.
Suto, F., Tsuboi, M., Kamiya, H., Mizuno, H., Kiyama, Y., Komai, S., Shimizu, M.,
Sanbo, M., Yagi, T., Hiromi, Y. et al. (2007). Interactions between plexin-A2,
plexin-A4, and semaphorin 6A control lamina-restricted projection of hippocampal
mossy fibers. Neuron 53, 535-547.
Take-uchi, M., Clarke, J. D. W. and Wilson, S. W. (2003). Hedgehog signalling
maintains the optic stalk-retinal interface through the regulation of Vax gene
activity. Development 130, 955-968.
Tawarayama, H., Yoshida, Y., Suto, F., Mitchell, K. J. and Fujisawa, H. (2010).
Roles of semaphorin-6B and plexin-A2 in lamina-restricted projection of
hippocampal mossy fibers. J. Neurosci. 30, 7049-7060.
Temple, S. and Davis, A. A. (1994). Isolated rat cortical progenitor cells are
maintained in division in vitro by membrane-associated factors. Development
120, 999-1008.
Thisse, C. and Thisse, B. (2008). High-resolution in situ hybridization to wholemount zebrafish embryos. Nat. Protoc. 3, 59-69.
Toyofuku, T., Zhang, H., Kumanogoh, A., Takegahara, N., Yabuki, M., Harada, K.,
Hori, M. and Kikutani, H. (2004). Guidance of myocardial patterning in cardiac
development by Sema6D reverse signalling. Nat. Cell Biol. 6, 1204-1211.
Watanabe, T. and Takahashi, Y. (2010). Tissue morphogenesis coupled with cell
shape changes. Curr. Opin. Genet. Dev. 20, 443-447.
Wilson, S. W. and Houart, C. (2004). Early steps in the development of the
forebrain. Dev. Cell 6, 167-181.
Yaron, A. and Sprinzak, D. (2012). The cis side of juxtacrine signaling: a new role in
the development of the nervous system. Trends Neurosci. 35, 230-239.
Yazdani, U. and Terman, J. R. (2006). The semaphorins. Genome Biol. 7, 211.
Zhou, Y., Gunput, R.-A. F. and Pasterkamp, R. J. (2008). Semaphorin signaling:
progress made and promises ahead. Trends Biochem. Sci. 33, 161-170.
DEVELOPMENT
RESEARCH ARTICLE