1090 RESEARCH ARTICLE
Development 140, 1090-1099 (2013) doi:10.1242/dev.082008
© 2013. Published by The Company of Biologists Ltd
The transcription factor Vox represses endoderm
development by interacting with Casanova and Pou2
Jue Zhao1,2,3,4, Guillaume Lambert1,2,3, Annemarie H. Meijer5 and Frederic M. Rosa1,2,3,*
SUMMARY
Endoderm and mesoderm are both formed upon activation of Nodal signaling but how endoderm differentiates from mesoderm is
still poorly explored. The sox-related gene casanova (sox32) acts downstream of the Nodal signal, is essential for endoderm
development and requires the co-factor Pou2 (Pou5f1, Oct3, Oct4) in this process. Conversely, BMP signals have been shown to inhibit
endoderm development by an as yet unexplained mechanism. In a search for Casanova regulators in zebrafish, we identified two of
its binding partners as the transcription factors Pou2 and Vox, a member of the Vent group of proteins also involved in the patterning
of the gastrula. In overexpression studies we show that vox and/or Vent group genes inhibit the capacity of Casanova to induce
endoderm, even in the presence of its co-factor Pou2, and that Vox acts as a repressor in this process. We further show that vox, but
not other members of the Vent group, is essential for defining the proper endodermal domain size at gastrulation. In this process,
vox acts downstream of BMPs. Cell fate analysis further shows that Vox plays a key role downstream of BMP signals in regulating the
capacity of Nodal to induce endoderm versus mesoderm by modulating the activity of the Casanova/Pou2 regulatory system.
INTRODUCTION
The formation of the three germ layers – ectoderm, mesoderm and
endoderm – is crucial for vertebrate development. Whereas our
understanding of mesoderm formation has benefited from extensive
studies, knowledge about the gene network that regulates endoderm
development is still limited. Endoderm and mesoderm can first be
distinguished at gastrulation. At the onset of gastrulation, the
zebrafish embryo is organized as a cap lying on top of a large yolk
sphere. According to fate-mapping studies, the entire zebrafish
endoderm, as well as a portion of the mesoderm, arise from the
marginal-most four blastomere tiers at this stage, in which
endoderm and mesoderm precursors are intermingled, but they soon
separate during the involution process that brings both mesoderm
and endoderm to a deeper position within the embryo (Kimmel et
al., 1990; Warga and Nüsslein-Volhard, 1999; Kimelman and
Griffin, 2000).
Work carried out in mice, chicken, frogs and zebrafish has
revealed a high degree of conservation in the way that vertebrate
endoderm development is controlled. A two-step model of
endoderm specification and differentiation was initially proposed
in frogs (Yasuo and Lemaire, 1999) and appears to apply at least to
zebrafish. During early stages, maternal transcription factors, such
as VegT, activate the expression of downstream effectors including
Mix.1, Sox17α and several TGFβ/Nodal family members to specify
mesendoderm, a common precursor for mesoderm and endoderm.
During a second phase, several factors are recruited to induce the
endoderm genetic program that leads to endoderm commitment
(reviewed by Grapin-Botton and Constam, 2007; Zorn and Wells,
2007). In zebrafish, an equivalent of Xenopus VegT (Xanthos et al.,
1
INSERM U1024, F-75005 Paris, France. 2CNRS UMR 8197, F-75005 Paris, France.
IBENS, Institut de Biologie de l’Ecole Normale Supérieure, F-75230 Paris, France.
4
College of Life Sciences, Peking University, Beijing 100871, P. R. China. 5Institute of
Biology, Leiden University, 2300 Leiden, The Netherlands.
3
*Author for correspondence ([email protected])
Accepted 18 December 2012
2001) has not been identified but a maternally deposited signal from
the extra-embryonic yolk syncytial layer initiates mesendoderm
formation by activating Nodal-type ligands (Feldman et al., 1998;
Rebagliati et al., 1998). The activity of Nodal factors appears to be
one of the most conserved elements of the pathway leading to
endoderm formation (reviewed by Grapin-Botton and Constam,
2007; Zorn and Wells, 2007). Nodal and Nodal-related genes are
required for endoderm specification and commitment, and
activation of Nodal signaling is sufficient to induce this process
(Alexander and Stainier, 1999; Yasuo and Lemaire, 1999; David
and Rosa, 2001). Conversely, endoderm formation is inhibited by
the extracellular Nodal inhibitor lefty. Nodal factors bind and act
via a type II and a type I serine/threonine kinase receptor as well as
an EGF-CFC co-receptor (Renucci et al., 1996; Feldman et al.,
1998; Peyriéras et al., 1998; Zhang et al., 1998).
Endoderm formation requires, downstream of the Nodal ligandreceptor interaction, a set of transcription factors, which have been
characterized in zebrafish. They include the mix-like homeobox
transcription factors Bon (Kikuchi et al., 2000) and Mezzo (also
known as Sebox) (Poulain and Lepage, 2002) and the zinc-finger
transcription factor Gata5 (also known as Faust) (Reiter et al., 1999;
Rodaway et al., 1999; Reiter et al., 2001), which are induced by
activation of Nodal signaling. A fourth transcription factor encoded
by the sox-related gene casanova (cas; also known as sox32) acts
downstream of gata5, bon and mezzo and appears both necessary
and sufficient to induce an endodermal fate, at least within
mesendodermal territory (Alexander et al., 1999; Alexander and
Stainier, 1999; Dickmeis et al., 2001; Kikuchi et al., 2001; Aoki et
al., 2002). cas expression requires, in addition to Nodal signaling
activation, the presence of the maternal transcription factor Eomes
(Bjornson et al., 2005).
Apart from Nodal signaling, bone morphogenetic protein (BMP)
and fibroblast growth factor (FGF) signaling have also been
implicated in the control of endoderm formation and appear to
inhibit Nodal signaling action (Poulain et al., 2006). Whereas FGF
signaling inhibits Nodal signaling by inducing Cas phosphorylation,
the process mediating BMP activity in endoderm formation has
DEVELOPMENT
KEY WORDS: Zebrafish, Endoderm, Fate, Transcription, Nodal
Vox inhibits Cas
MATERIALS AND METHODS
Fish maintenance
Zebrafish were kept and staged as described (Westerfield, 1994).
Morpholinos
Morpholinos (MOs) were described previously: vox (Imai et al., 2001), vent
(Imai et al., 2001), ved (Shimizu et al., 2002).
Cloning and mutation
The cas cDNA was subcloned into pCS2 (Turner and Weintraub, 1994). Dcas and ΔN-vox were obtained from mutation of cas-pCS2 and vox-pSPE3,
respectively, using the Exsite PCR-Based Site-Directed Mutagenesis Kit
(Stratagene). The myc tag was subcloned in frame into D-cas-pCS2 or caspCS2 at the N-terminus. Enr and VP16 fragments were fused in frame with
ΔN-vox-pSPE3. The constructs for making capped mRNA were cloned into
different pSPE3 vectors (Roure et al., 2007). Primers used for mutation or
cloning were (5′-3′): D-cas-pCS2, CCAGCACAGACTTTGGACCACAGC and ACTGCGATCAAGCTGGTCCAAC; ΔN-vox-pSPE3,
CACCATGCCAAGAAACTGCTCATCTCCAAG and TCAGTAGTAATGATGTCTGGGCATCATG.
cDNA library construction and yeast screening
Total RNA was extracted with TRIzol Reagent (Invitrogen) from
gastrulation stage wild-type zebrafish embryos. Subsequently, mRNA was
isolated using the PolyATract Kit (Promega). For yeast two-hybrid
screening, the cDNA library was constructed using the HybriZAP-2.1 XR
cDNA Synthesis Kit and HybriZAP-2.1 XR Library Construction Kit
(Stratagene) according to the manufacturer’s instructions except that the
cDNAs were inserted into the ACTII phage vector at EcoRI and XhoI sites
and in vivo excised into pACTIIa plasmid (Meijer et al., 1998). D-cas cDNA
was fused in frame with the Gal4 DNA-binding domain sequence in the
pGBKT7 vector (Clontech). Yeast strain PJ69-4A (A.H.M.) was used to
carry out two-hybrid screening on –LWH +3AT selective medium plates.
Yeast transformations were performed by the LiAc method essentially as
described (Gietz and Schiestl, 1995). Target plasmids were isolated from
positive yeast colonies using the Y-DER Yeast DNA Extraction Reagent
Kit (Pierce) and retransformed into E. coli XL-1 blue MRF′ strain for DNA
amplification and sequencing.
In vitro binding assay
S35-labeled proteins were translated in vitro with the Flexi Rabbit
Reticulocyte Lysate Kit (Promega) from capped mRNA that was
synthesized by the mMESSAGE mMACHINE Kit (Ambion) and purified
using the RNeasy Kit (Qiagen). Immunoprecipitation (IP) was performed
with Protein G-agarose (Roche) and the 9E10 anti-c-myc or 3F10 anti-HA
antibody (Roche) essentially following the recommendations for the co-IP
procedure of these products (washing strength of NaCl 0.5-1 M).
Microinjection and in situ hybridization
Capped mRNA was injected into zebrafish early embryos as described
(Peyriéras et al., 1998). In situ hybridization was performed as described
(Hauptmann and Gerster, 1994). In Figs 3-7, representative embryos are
shown.
qRT-PCR
Primers were designed using Primer Express 3.0 (Applied Biosystems). The
amplified region included an intron to avoid amplifying genomic DNA. In
the reverse transcription, 15 bp oligo(dT) (Promega) was used under the
conditions suggested by the M-MLV Reverse Transcriptase Kit (Invitrogen).
qRT-PCR was performed with Platinum SYBR Green qPCR SuperMixUDG with the ROX Kit (Invitrogen) in an Applied Biosystems 7500 realtime PCR system. β-actin was used as an internal control to normalize
different samples. qRT-PCR results were averaged from at least triplicate
reactions (up to 11) carried out on RNA extracted from at least two
independent batches of embryos. Primers were as follows (5′-3′, forward
and reverse): axial, CGGCCAGTCGAACATAAACA and GCTGGATGGCCATGGTTATT; β-actin, CGGACAGGTCATCACCATTG and
GAGTTGAAAGTGGTCTCGTGGAT; gata5, GGGACGCCAGGGAACTCTAC and TGAGATTGAGCCGCAGTTCA; sox17, GGCCGAACGTCTACGAGTCA and GGGCTCCAATCGCTTGTTT.
Transplantations and fate analyses
Transplantations were carried out essentially as described (David and Rosa,
2001). GFP-positive cells from donor embryos injected at the 8-cell stage
in one of the eight cells with Tar* + GFP or Tar* + GFP + vox RNA were
grafted into the margin of untreated embryos at the sphere stage. Embryos
were then analyzed by combined brightfield and epifluorescence
microscopy at 30 hours (hpf) or at 3 days (dpf) post-fertilization.
Statistical analyses
Results from qRT-PCR and cell number counting were analyzed by the t-test
using the relevant control conditions (see figure legends). Results from
embryo counting (Figs 3 and 4) were analyzed by the χ2 test.
DEVELOPMENT
remained unclear. BMPs are also involved in the control of
dorsoventral (DV) patterning during gastrulation in frog and fish, a
process that is mediated, at least in part, by the Vent
(Vox/Vent/Vega/Ved) group of homeobox transcription factors
(Kawahara et al., 2000a; Kawahara et al., 2000b; Imai et al., 2001;
Shimizu et al., 2002).
Initially, similar to endoderm, mesoderm progenitor formation
also relies on the Nodal pathway, a situation found in zebrafish as
well as in other vertebrate species (Henry et al., 1996; Sasai et al.,
1996; Schier et al., 1997; Hudson et al., 1997; Kofron et al., 1999;
Reiter et al., 1999; Agius et al., 2000; Thisse et al., 2000; Brennan
et al., 2001; Dougan et al., 2003; Birsoy et al., 2006), and they
express similar molecular markers (Hammerschmidt and NüssleinVolhard, 1993; Ecochard et al., 1998; Lemaire et al., 1998;
Papaioannou and Silver, 1998; Rodaway et al., 1999; Wardle and
Smith, 2004). The differential induction of mesoderm and endoderm
seems to rely on different doses/duration of Nodal signaling
combined with the activity of other extracellular factors such as
BMPs and FGFs, but how these factors act intracellularly in
combination to generate the proper ratio between endoderm and
mesoderm is not clear.
Cas was identified as a high mobility group (HMG) protein of
the SoxF family (Dickmeis et al., 2001; Kikuchi et al., 2001) and
plays a crucial role in zebrafish endoderm development and
differentiation induced by Nodal factors (Aoki et al., 2002). cas
mutants completely lack endoderm precursors at the onset of
gastrulation, whereas the mesoderm and mesendoderm remain
largely normal (Alexander et al., 1999; Dickmeis et al., 2001). In
addition, the most marginal cells that are normally fated to
endoderm adopt a mesodermal fate in embryos devoid of cas
activity (Dickmeis et al., 2001). Thus, cas appears to be a crucial
regulator of endodermal versus mesodermal fate and the regulation
of its activity is likely to be essential for the proper ratio between
endoderm and mesoderm. Sox proteins have been generally
considered to function as transcriptional regulators that require
physical interaction with their co-factors (Ambrosetti et al., 1997;
Wilson and Koopman, 2002) and, in this respect, Cas requires and
can synergistically interact with Pou2 (also known as Pou5f1, Oct3
or Oct4) to promote endoderm development by binding to the sox17
promoter (Lunde et al., 2004; Reim et al., 2004; Chan et al., 2009).
To better understand the molecular mechanisms controlling
endoderm formation, we carried out a yeast two-hybrid screen for
Cas in order to identify the components with which it interacts. Our
results demonstrate, for the first time, that Vent group genes, and in
particular vox, which is a known effector of DV patterning acting
within the BMP signaling pathway, also have an important function
in regulating ventral endoderm development and the separation of
endoderm from mesoderm and ectoderm.
RESEARCH ARTICLE 1091
RESULTS
Deletion of the conserved EFDQYLN amino acid
sequence abolishes Cas endoderm-inducing
activity without altering its expression or
subcellular localization
In order to identify new partners for Cas we carried out a yeast twohybrid screen. Since Cas is thought to bind DNA and act as a
transcription factor, it might have generated false positives by
activating, in the absence of binding partners, transcription of the
target gene in yeast. We thus first generated and tested a modified
version of cas, D-cas, from which we removed the conserved
EFDQYLN peptide located in the C-terminal region of the protein
that is likely to act as an activation domain (Fig. 1A). Consistent
with this idea, wild-type cas overexpression induced strong sox17
ectopic expression (Fig. 1B,C), whereas D-cas was unable to do so
(Fig. 1D).
To ensure that D-cas retained the capacity to be expressed, we
overexpressed in zebrafish embryos an N-terminal myc-tagged DCas variant. Immunohistochemistry showed that D-Cas was
predominantly located in the nucleus, as expected (Fig. 1F). To
confirm that myc-D-cas can be efficiently expressed, myc-D-cas
was in vitro translated, resolved on an SDS-PAGE gel and probed
by western blot with anti-myc antibodies. Immunoprecipitation (IP)
results demonstrated that myc-D-Cas is expressed as fully as wildtype Cas in vitro (Fig. 1G).
Altogether, these results show that the deletion of a short
conserved amino acid sequence can abolish the endoderm-inducing
activity of Cas without altering its expression or subcellular
localization.
Cas binds Vox and/or Pou2
HMG domain-containing Sox proteins play a key role in the
regulation of embryonic development and in cell fate control, and
frequently regulate their target genes by cooperating with partners
in a cell-specific manner (Wegner, 1999; Bowles et al., 2000;
Kamachi et al., 2000). We thus searched for putative Cas partners
by carrying out a yeast two-hybrid screen using D-Cas as bait.
Among candidate partners, two clones were of particular interest.
One of the clones encoded pou2, a gene already known to
genetically interact with cas (Reim et al., 2004; Lunde et al., 2004),
Development 140 (5)
thus confirming the specificity of our screening approach. Among
other potential partners, Vox was identified as one of the strongest,
but neither Vent (also known as Vega2) nor Ved could be identified
as strong Cas interactors in this assay, even when their cDNA was
specifically transformed into yeast to perform the two-hybrid test.
The capacity of the Vox and Pou2 proteins to bind Cas was
confirmed using an in vitro binding assay coupled to IP, following
in vitro translation of the candidate RNAs (Fig. 2A, lanes 2-4).
Interestingly, Ved was also able to bind Cas in this assay, although
because Ved could bind GFP this prevented us from identifying it as
a bona fide interactor (Fig. 2C). Vent did not bind Cas consistently
or reproducibly. Using the same assay, we also found that Pou2
binds Vox (Fig. 2A, lane 5).
Homo- or heterodimerization has been considered a means by
which transcription factors can regulate target genes with limited
DNA binding sites and some of the homeodomain proteins work in
this way (Chan and Mann, 1996; Ryan and Rosenfeld, 1997; Smit
et al., 2000). We thus tested whether Vox can homodimerize.
Consistent with this notion, Vox co-precipitated with Vox-HA
(Fig. 2B). This result was confirmed by yeast two-hybrid analysis
(data not shown). Altogether, these results demonstrate that Vox can
form heterodimers with Cas and/or Pou2, and that Vox can form
homodimers as well, raising the possibility that Vox, Cas and Pou2
can form a multimeric complex.
We then attempted to define the region of the Vox protein that is
required for interaction with its different partners. Vox is composed
of a central homeodomain flanked by N- and C-terminal domains.
In vitro binding assays were carried out with tagged forms of either
Cas, Pou2 or Vox and radiolabeled variants of Vox lacking either
its N-terminus (ΔN-Vox) or C-terminus (ΔC-Vox) (Fig. 2D), which
are efficiently translated in vitro (data not shown). Whereas ΔNVox retained the capacity to bind either Cas, Pou2 or Vox, ΔC-Vox
appeared unable to do so (Fig. 2E-G). Thus, the Vox C-terminal
domain is essential for binding to these three proteins. However,
similar experiments involving a fusion between GFP and the Vox Cterminus showed that this latter domain itself is not sufficient to
allow binding to Cas, Pou2 or Vox (data not shown). Thus, the
integrity of Vox is important for the interaction with its co-factors.
The Vox C-terminus is thus necessary, but not sufficient, to allow
physical interaction between Vox partners.
Fig. 1. Structure, endoderm-inducing activity and subcellular
localization of wild-type cas and a deletion variant. (A) D-Cas
contains a deletion of the conserved EFDQYLN peptide located in
the C-terminal region (red in the wild type) that is likely to act as
an activation domain. cas and D-cas RNAs were used for injection.
(B-F) Zebrafish embryos were left uninjected (B) or injected with
the RNA indicated bottom right and probed by in situ
hybridization for sox17 (B-D) or by immunohistochemistry with
anti-myc antibody (E,F). The inset in F indicates the position of
myc-positive nuclei (arrows). (G) Immunoprecipitation (IP) for mycD-Cas and myc-Cas. The myc-Cas and myc-D-Cas proteins are
detected at 45 kDa.
DEVELOPMENT
1092 RESEARCH ARTICLE
Fig. 2. In vitro binding assay between Cas, Pou2 and Vox.
(A-C,E-G) Co-IP experiments. The RNAs indicated below each panel were
translated in vitro in the presence (untagged proteins) or absence (mycor HA-tagged proteins) of radiolabeled methionine, except for C, where
tagged protein was also radiolabeled, then processed for IP with the
relevant antibody and resolved by SDS-PAGE. The expected position of
the tested proteins is indicated on the left of each panel. Note that Vox
and Pou2 artifactually migrate as a doublet in A,B,G. (D) Structure of the
vox RNA variant open reading frames used for translation, illustrating the
deletions in the ΔN-Vox and ΔC-Vox variants.
Vox inhibits Cas activity and acts as a repressor
We then probed the potential effect of vox, ved and vent on cas
function. Cas is a key regulator of endoderm development, and in
particular can strongly upregulate the endoderm marker sox17 when
overexpressed in zebrafish embryos (Alexander et al., 1999;
Dickmeis et al., 2001; Kikuchi et al., 2001; Aoki et al., 2002). We
ectopically expressed cas alone or together with vox or ved or vent
by introducing RNAs into zebrafish embryos and probed for sox17
expression by in situ hybridization. qRT-PCR was performed in
parallel to allow independent quantification of the effects of
overexpression. Injection of cas RNA alone led to large ectopic
domains of sox17 expression during gastrulation (in 46% of
embryos, n=127; Fig. 3B,F), whereas co-expression of vox (16.7%,
n=191; P<0.005) or ved (28%, n=64; 0.05<P<0.1) but not vent
(37.5%, n=56; P>0.2) reduced both the occurrence and the size of
the ectopic domains (Fig. 3C-F). qRT-PCR analyses gave similar
results, although, in contrast to the in situ analyses, vent also
appeared to have some effect, the discrepancy being potentially
explained by the fact that it is not possible to precisely quantitate the
size of the ectopic domain by in situ analysis. Thus, vox, ved and
vent inhibit the sox17- and endoderm-inducing activity of cas.
pou2 is required for cas activity and has been reported to
synergistically enhance the capacity of cas to induce endoderm
(Lunde et al., 2004; Reim et al., 2004; Chan et al., 2009). We tested
RESEARCH ARTICLE 1093
the capacity of vox to inhibit cas sox17-inducing activity in the
presence of an excess of pou2. As previously reported,
overexpression of cas and pou2 led to embryos that exhibit more
frequent ectopic sox17 domains (63%, n=51) than with
overexpression of cas alone (46%, n=127) (Fig. 3H,I). By contrast,
overexpression of cas, pou2 and vox inhibited this effect (16.6%,
n=48; P<0.005), as seen by in situ hybridization, indicating that vox
can also inhibit the combination of cas and pou2 (Fig. 3J). This
conclusion is supported by the qRT-PCR results (Fig. 3K).
To determine which domain of Vox is required to inhibit cas
function and if, in particular, the C-terminal domain that is required
for binding to Cas is important, cas RNA was injected alone or coinjected with either vox, ΔN-vox or ΔC-vox RNA into wild-type
embryos, which were then probed for sox17 expression during
gastrulation or analyzed by qRT-PCR. Compared with cas RNA
injections, both deleted forms led to a similar percentage of embryos
exhibiting ectopic domains (cas + ΔN-vox: 43.4%, n=53, P>0.5;
cas + ΔC-vox: 45.4%, n=44, P>0.9), a result consistent with the
qRT-PCR analysis, demonstrating that these deletions lead to a
decrease in Vox inhibitory activity (Fig. 4A-F). Thus, both the Nterminus and the C-terminus appear to be essential for Vox to inhibit
cas endoderm-inducing activity. Furthermore, the reduction in the
inhibitory activity of ΔC-vox is consistent with the fact that Vox
binding is required to inhibit cas activity.
Vox (which is also known as Vega1) has been reported to act as
a repressor of dharma (also known as boz or dha) activity in
zebrafish DV patterning and its N-terminal domain is required for
this repressive activity (Kawahara et al., 2000a; Kawahara et al.,
2000b). To determine whether Vox acts as an activator or repressor
of cas activity, we fused ΔN-vox with either the repressor domain of
Engrailed (EnR-ΔN-vox) or the activation domain of VP16 (VP16ΔN-vox). Similar to, but more efficiently than the ectopic expression
of full-length Vox (18.5%, n=243), expression of EnR-ΔN-vox
mRNA repressed sox17 (56%, n=46; P<0.005; Fig. 4H,I), whereas
VP16-ΔN-vox barely attenuated sox17 expression during
gastrulation, both in terms of the number of embryos affected and
the reduction of the sox17-positive domain (15.8%, n=38; P<0.2;
Fig. 4J). A similar result was obtained by qRT-PCR (Fig. 4K). Thus,
our results show that Vox is a strong repressor of cas endoderminducing activity.
Vox is an endogenous regulator of endoderm
development
We then tested whether vox, vent or ved could regulate endogenous
endoderm formation. First, we checked the expression pattern of
vox during gastrulation. vox is expressed in a large domain centered
on the ventral side. Similarly, vent and ved are progressively
excluded from dorsal territories but encompass prospective
endoderm territories on the ventral side (Kawahara et al., 2000a;
Melby et al., 2000). Analysis of sections of zebrafish gastrula
showed that vox is expressed throughout the depth of the blastoderm
in this domain, and particularly in the deepest blastodermal cells
that encompass endoderm (data not shown). Thus, cas and vox, vent
and ved are expressed in overlapping domains, consistent with a
cell-autonomous interaction, potentially by physical interaction in
the case of vox and cas.
Gain- and loss-of-function strategies were carried out by vox, vent
and ved RNA or MO injection into zebrafish embryos. Injection of
either vox, vent or ved RNA induced a decrease in sox17 expression
(Fig. 5C, arrowhead; 5D) and in two other endoderm markers: axial
(also known as foxa2) (Fig. 5G,H) and gata5 (Fig. 5L). By contrast,
vox but not vent or ved MO injection (Imai et al., 2001; Shimizu et
DEVELOPMENT
Vox inhibits Cas
1094 RESEARCH ARTICLE
Development 140 (5)
Fig. 3. Effect of cas, vox and pou2 overexpression on endoderm formation. (A-E,G-J) Zebrafish embryos were either left uninjected (A,G) or
injected with the RNA indicated bottom right (B-E,H-J), then processed for in situ hybridization with a sox17 probe. (F,K) qRT-PCR analysis. Embryos were
injected with the indicated RNA(s). RNA was then extracted and processed for qRT-PCR analysis of sox17. Levels relative to uninjected controls (WT, set
at 1) are plotted. For statistical analyses, samples cas+vox or cas+ved or cas+vent are compared with cas (F) or cas+pou2+vox with cas+pou2 (K);
***P<0.005; error bars indicate s.d.
The inhibition of ventral endoderm progenitor
formation by BMPs is mediated by vox
BMPs are required for zebrafish endoderm formation. BMP signals
have been shown to control endoderm DV patterning and to inhibit
endoderm formation on the ventral side of the zebrafish gastrula
(Tiso et al., 2002; Poulain et al., 2006). However, the molecular
mechanism responsible for the inhibitory action of BMPs on ventral
endoderm is unknown. Vent group genes act upstream and/or
downstream of BMP signals to control DV patterning of the
gastrula, suggesting that they could also act upstream or
downstream of BMP signals to control the generation of ventral
endoderm in the early gastrula (Imai et al., 2001; Shimizu et al.,
2002). To address this issue, we tested the potential epistatic
relationship between vox, ved and vent and BMP signals in the
control of endoderm formation.
First, bmp2, bmp4 and bmp7 RNAs (Poulain et al., 2006) were
injected into zebrafish embryos together with, or without, MOs
directed against ved, vent or vox (Fig. 6B-E). In ~20% (n=113) of
the embryos, BMP overexpression led to a gap in the ventral
endoderm and to a marked decrease in endoderm precursor numbers
(Fig. 6B; Table 2A). Co-injection of vox, but not vent or ved, MO
inhibited this effect (Fig. 6C-E; Table 2A), both by reducing the
number of embryos presenting gaps and by restoring the proper
number of cells in the remaining embryos, suggesting that vox is
required downstream of BMP to control ventral endoderm
formation. Co-injection of vent, ved and vox MO did not lead to a
stronger effect than vox MO alone (data not shown).
Conversely, BMP signaling inhibition by expression of a
dominant-negative mutant of BMP receptor, ΔmBMPR (Suzuki et
al., 1994), induced an expansion in the sox17-positive progenitor
domain in a fraction (27%, n=86) of the embryos (Fig. 6F; Table
Fig. 4. Structure-function analyses of effect of vox activity on Cas function. (A-E,G-J) Zebrafish embryos were either left uninjected (A,G) or
injected with the RNA indicated bottom right (B-E,H-J) and allowed to develop until 80% epiboly, then processed for in situ hybridization with sox17
probe. (F,K) qRT-PCR analysis as in Fig. 3. For statistical analyses, samples cas+vox or casΔN-vox or cas+ΔC-vox are compared with cas RNA-injected
samples (F) and vox, EnR-ΔN-vox, VP16-ΔN-vox with uninjected samples (K); ***P<0.005, **P<0.05; error bars indicate s.d.
DEVELOPMENT
al., 2002) led to a percentage of the population (17%, n=67)
exhibiting a significantly higher number of sox17-positive or axialpositive cells than the uninjected control (Fig. 5B,D,F,H; Table 1).
We then determined whether vox inhibits mesoderm as well as
endoderm development in early stage zebrafish embryos by
analyzing the expression of the pan mesodermal marker ntl
(Schulte-Merker et al., 1994) at shield stage, at which time
endoderm becomes committed (Ho and Kimmel, 1993; David and
Rosa, 2001). Neither vox MO (Fig. 5J) nor vox mRNA (Fig. 5K)
could alter the expression domain of ntl at this stage.
Taken together, our results show that Vent group genes can
downregulate the endoderm population but that only vox appears to
be required for regulating the size of the endodermal, but not the
mesodermal, domain during early gastrulation.
Vox inhibits Cas
RESEARCH ARTICLE 1095
Fig. 5. vox is required for endogenous endoderm
development. (A-C,E-G,I-K) Zebrafish embryos were
either left uninjected (A,E,I) or injected with the RNA or
MO indicated bottom right, then processed for in situ
hybridization with sox17 (A-C; lateral view with dorsal to
the right), axial (E-G; dorsal view) or ntl (I-K) probe.
Arrowhead in C indicates a region depleted of sox17expressing cells. (D,H,L) qRT-PCR analysis (as in Fig. 3) for
sox17 (D), axial (H) and gata5 (L). ***P<0.005, **P<0.05,
versus uninjected controls; error bars indicate s.d.
2B). We tested the capacity of either vox, ved or vent to inhibit this
effect. Consistent with previous results (Figs 3 and 5), the three Vent
group mRNAs were able to override the effect of ΔmBMPR and to
significantly inhibit sox17 expression on the ventral side of the
gastrula, but vox was the most efficient both in terms of the number
of embryos affected [85% (n=87) versus 25/40% (n=92/84) for
ved/vent, respectively] and the decrease in sox17-positive cells
(Fig. 6F-I; Table 2B). Taken together, our results show that vox acts
downstream of, or in parallel to, BMPs in the control of ventral
endoderm formation.
Vox controls the fate of endoderm progenitors
Endoderm is induced by the activation of Nodal signaling, the
activity of which is mediated by cas. Activation of Nodal signaling
or overexpression of Cas is sufficient to induce an endoderm fate in
early zebrafish blastomeres. Conversely, reduction in Nodal
signaling or inhibition of cas activity leads to the reduction/absence
of the endoderm fate. In addition, loss of cas function leads to a
change in the fate of the most marginal cells of the gastrula from
endoderm to mesoderm. Since vox regulates the activity of cas in
endoderm formation, we wondered whether it is also involved in
controlling the fate of endodermal cells.
Overexpression of the constitutively active form of the type I
transforming growth factor (TGFβ) or the ALK4-related zebrafish
type I receptor taram-a (also known as acvr1b) (Tar*) can
promote endoderm formation and transfate naïve cells in wildtype embryos (Peyriéras et al., 1998; Alexander and Stainier,
1999; David and Rosa, 2001; Nair et al., 2007). To determine
whether Vox controls the endoderm fate, we injected a mixture of
Tar* mRNA and GFP mRNA as a tracer, with or without vox
RNA, into donor wild-type embryos and transplanted GFPpositive cells into the margin of host unlabeled embryos at the
sphere stage (David and Rosa, 2001). As previously described,
GFP-positive cells, in the absence of vox RNA, almost
systematically adopt an endodermal fate and are located in
classical endodermal locations in 30-hour embryos, including the
pharyngeal endoderm, the gut and the mesendodermal hatching
gland (Fig. 7A-D; Table 3). Co-expression of vox dramatically
altered this fate and prevented cells from participating in
endoderm territories. By contrast, vox co-expressing cells
appeared as mesodermal (predominantly muscle and
mesenchyme) as well as ectodermal (hindbrain, posterior neural
tube, otic vesicle and epidermis) derivatives (Fig. 7E-J; Table 3).
We conclude from this experiment that vox controls the endoderm
fate that is generated by the activation of Nodal signaling.
DISCUSSION
Cas, Pou2 and Vox physically interact
To better understand how the activity of the sox-related protein Cas
is regulated, we searched for binding partners for Cas. Several
potential partners were identified by yeast two-hybrid screens, two
of which are described here, both of which were confirmed by coIP. The first partner is Pou2, a result fully consistent with the pou2
gene being required for the endoderm-inducing activity of cas and
MO injected at the 1-cell stage
Control
vox
vent
ved
Average number of sox17-positive cells per embryo
Number of embryos analyzed
Number of embryos with apparent cell number phenotype
Total number of embryos
340±22
14
1
70
430±33***
10
11
67
320±35*
13
15
69
378±52**
10
10
67
Average number of axial-positive cells per embryo‡
Number of embryos analyzed
Number of embryos with apparent cell number phenotype
Total number of embryos
278±30
12
2
84
370±21***
13
14
83
260±42
10
13
74
251±34*
12
16
71
Embryos injected with MOs as indicated were sorted into those exhibiting a wild-type phenotype and those with an apparent modification in cell number, of which a
portion were used for counting cells positive for sox17 or axial expression. ***P<0.005, **P<0.05, *P<0.1, versus uninjected controls.
‡
Excluding cells belonging to the nascent axis.
DEVELOPMENT
Table 1. Inhibition of vox activity causes the formation of an excess of endoderm precursors at 75% epiboly
Development 140 (5)
1096 RESEARCH ARTICLE
Fig. 6. Epistatic analysis of
vox and BMPs during
endoderm specification.
Zebrafish embryos were either
left uninjected (A) or injected
with the RNA/MO combination
indicated bottom right (B-I),
allowed to develop until the
75% epiboly stage, then
processed for in situ
hybridization with sox17.
Ventral views are presented.
the presence of Pou2 binding sites within the sox17 promoter region
and neighboring the Cas binding sites. However, the requirement
for pou2 for cas activity could be direct or indirect. Our binding
results favor a direct physical interaction of Cas with Pou2 to induce
endoderm. This is also consistent with the known requirement of
sox-related transcription factors for Pou domain-containing
partners. For instance, the Pou domain factor Oct3 (also known as
Pou5f1) interacts with the HMG domain protein Sox2 and
collaborates with Sox2 to bind the Fgf4 enhancer (Dailey et al.,
1994; Ambrosetti et al., 1997; Ambrosetti et al., 2000). In vivo,
Sox2-Oct3 complex formation is essential for transcriptional
regulation of Fgf4. The identification of Pou2 as one of the major
Cas binding partners validates the relevance of our screening
approach.
Using the same approach, we also identified another homeoboxcontaining gene, vox, as a cas binding partner. By contrast, neither
Ved nor Vent appears to efficiently and specifically bind Cas. Thus,
within the three Vent group genes, only vox appears to be a cas
binding partner. This is in contrast to the fact that Vox, Vent and
Ved efficiently bind the Gsc transcription factor, suggesting that
binding to Gsc and to Cas might involve different regions of the
Vent group proteins. Consistent with this idea, comparison of the
Vox C-terminal region, a domain required for the interaction with
Cas, with the Vent/Ved C-terminal regions failed to reveal any
strong homology (Kawahara et al., 2000b) (our results). Structurefunction analyses and, in particular, domain swapping experiments
are required to further define the regions of the Vent group proteins
that are crucial for interaction with Cas.
We further show that, in addition to binding to Cas, Vox also
binds to Pou2 and itself. It is thus possible that Vox, Cas and/or Pou2
are assembled into a multimeric complex or that there is an
equilibrium between binary complexes involving either of these
components, with different activities. Attempts to detect in vivo
binding between Cas and Vox or Pou2 or both have been
unsuccessful, raising the possibility that the functional interactions
between these proteins are indirect. However, several reports have
shown that co-activator interactions with Pou or Sox proteins can
often be weak and transient and thus a direct functional interaction
remains a likely scenario at this stage, particularly because of our in
vitro interaction results (Wang et al., 2006; Van den Berg et al.,
2010; Engelen et al., 2011). Further biochemical experiments are
needed to resolve this point.
Vox controls endoderm formation
Overexpression of vox (and, more generally, the Vent group genes)
and cas shows that vox inhibits the capacity of cas to induce sox17
expression. In this process, Vox behaves as a repressor and its Nterminus is required, at least in part, in the repressive activity. This
situation is strikingly similar to the genetic interaction between Vent
group genes and gsc, in which the Vent proteins also physically
interact with Gsc and behave as repressors of gsc transcription.
However, the biological significance of this latter physical
Table 2. vox acts downstream of BMP to repress endoderm precursor formation at 75% epiboly
A. vox MO inhibits the capacity of BMP to repress endoderm precursor formation
RNA injected
MO injected
Average number of sox17-positive cells per ventral half of embryo
Total number of sox17-positive cells per embryo
Number of embryos analyzed
Number of embryos exhibiting an apparent variation in cell number
Total number of embryos
No
Bmp2,4,7
Bmp2,4,7
Bmp2,4,7
Bmp2,4,7
No
No
vox
vent
ved
98±10
294±35
10
2
45
12±11
192±14
12
23
113
82±15***
264±29***
10
10
94
16±4
202±33
11
36
101
19±12
214±25**
8
50
124
RNA injected
Average number of sox17-positive cells per ventral half of embryo
Total number of sox17-positive cells per embryo
Number of embryos analyzed
Number of embryos exhibiting an apparent variation in cell number
Total number of embryos
ΔmBMPR
ΔmBMPR + vox
ΔmBMPR + vent
ΔmBMPR + ved
163±23
417±46
10
23
86
24±9***
234±33***
10
74
87
86±10***
343±24***
9
38
84
65±13***
319±31***
11
23
92
Embryos injected with MOs or RNAs or both, as indicated, were sorted into those exhibiting a wild-type phenotype and those with an apparent modification in cell
number, of which a portion were used for counting sox17-positive cells. Both ventral and total cell numbers per embryo were counted to ensure that variations did not
result from improper localization of cells. ***P<0.005, **P<0.05, samples are compared to Bmp2,4,7-injected (A) or ΔmBMPR-injected (B) embryos.
DEVELOPMENT
B. Vent group gene overexpression represses endoderm precursor formation when BMP signaling is inhibited
Vox inhibits Cas
RESEARCH ARTICLE 1097
Fig. 7. vox represses endodermal fates. Cells were
grafted from donor sphere stage zebrafish embryos
expressing either Tar*+GFP (A-D) or Tar*+vox+GFP
RNAs (E-J) into host uninjected embryos from the
same stage, which were allowed to develop and then
examined by a combination of epifluorescence and
brightfield microscopy at 30 hpf, except in F, which
presents a 3-dpf embryo. Lateral views with anterior
to the left, except for I which is a dorsal view.
(A-D) The main fates induced by Tar* (a constitutively
active form of taram-a) expression: pharyngeal
endoderm (arrowheads in A,B, where the arrowhead
in B points to the forming endodermal pharyngeal
pouch), intestine (C, the inset from A; arrowheads
points to two cells within the intestine, the contour of
which is delineated by dotted lines) and the
mesendodermal hatching gland (arrowheads in D).
(E-J) The fates induced in Tar*+vox RNA-expressing
cells: (E) trunk muscle cells (arrowheads) within the
somites (delineated by dotted lines); (F) mesenchymal
cells (surrounding the notochord, black arrowheads)
and neural tube (white arrowheads); (G) hindbrain
cells with their characteristic elongated shape; (H,I)
posterior neural tube (arrowheads in H), I is a
magnified dorsal view from the inset in H; (J) otic
vesicle (black arrowheads) and epidermis (white
arrowheads). e, eye; mhb, mid-hindbrain boundary;
not, notochord; nt, neural tube; yb, yolk ball; yt, yolk
tube.
endoderm cells are transfated to mesoderm and ectoderm
derivatives when co-expressing vox, which is in part similar to the
transfating of the most marginal early gastrula cells from endoderm
to mesoderm in the absence of functional cas. However, the fact
that ectoderm derivatives are also generated in the presence of vox
could suggest that vox is also involved in repressing the mesodermal
fate. Taken together, our results show that vox together with cas and
pou2 control the endoderm versus mesoderm/ectoderm fate by
regulating cas transcriptional activity, presumably by direct physical
interaction.
Vox mediates the activity of BMPs on endoderm
Interference with vox activity leads to an enlarged endodermal
domain, consistent with its inhibitory effect on cas function. This
phenotype is highly reminiscent of the action of BMPs on endoderm
development. Since vox, vent and ved are regulators and effectors of
BMP signals (Kawahara et al., 2000a; Kawahara et al., 2000b;
Shimizu et al., 2002; Gilardelli et al., 2004), vox could act upstream
and/or downstream of BMPs in endoderm regulation. By epistatic
analysis, we find that vox acts downstream of, or in parallel to,
BMPs, a situation that is consistent with the fact that vox is induced
by BMPs during gastrulation (Ladher et al., 1996; Melby et al.,
1999). Interestingly, vox involvement in endoderm repression
downstream of BMPs does not seem to strictly parallel its role in
Table 3. vox inhibits endodermal fates
Injection
n
Pharyngeal
endoderm
Intestine
Hatching
gland
Muscle
Tar* + GFP
Tar* + GFP + vox
12
27
11
1
10
0
6
1
0
13
Mesenchyme
Posterior
+ ICM
Hindbrain neural tube
0
7
0
9
0
5
Otic
vesicle
0
2
Epidermis
1
2
The phenotype of grafted cells was scored when host embryos had reached 30 hpf and was confirmed at 3 dpf. Indicated is the number of embryos with at least one cell
participating in a given tissue. In each embryo, the number of cells incorporated into each type of derivative could not be precisely determined.
ICM, intermediate cell mass.
DEVELOPMENT
interaction has not been explored, probably owing to the absence
of an assay for gsc transcriptional activity at the time.
Since sox17 is a direct target of cas and its transcriptional
regulatory region has been partly defined, we were able to approach
this problem in more detail. Although we cannot exclude an indirect
action of vox on cas, two arguments are in favor of a simple model
in which Vox binds Cas and/or Pou2 and prevents transcription of
sox17. First, analysis of the sox17 regulatory region shows that it
contains several potential binding sites for Vox within 100 bp of the
Pou2 or the Cas binding sites. Removal of one or two of these
binding sites leads to increased expression of sox17, suggesting that
this region indeed contains target elements for a repressor (data not
shown). Second, Vox binds both Cas and Pou2 and removal of the
Vox C-terminus prevents binding and leads to a reduction in Vox
inhibitory activity, consistent with the idea that binding is required
for this latter process. However, whereas binding is no longer
detectable with the ΔC-Vox constructs, the inhibition is not totally
lost, suggesting that vox can also inhibit cas activity through a
binding-independent mechanism, potentially by indirectly activating
the BMP/Vent regulatory loop.
Gain- and loss-of-function experiments show that vox negatively
regulates the size of the endogenous endodermal domain, fully
consistent with the known role of cas as an essential gene in
endoderm fate development. Cell fate analysis further indicates that
DV gastrula patterning. First, vox does not appear to be essential
for DV gastrula patterning but has been shown to act nonredundantly with vent and ved in this process. Second, in contrast to
their common activity in DV gastrula patterning, although ved and
vent can inhibit endoderm formation when BMP signaling is
reduced, only vox appears required for BMP inhibition of ventral
endoderm development. Thus, vox appears to be a specific repressor
of endoderm development within the Vent group, while this group
has a more general role in gastrula DV patterning as a whole.
In conclusion, our results together with those of others show that
proper endoderm development relies on the integration of three
distinct signaling pathways: the Nodal pathway, which is
responsible for the induction of cas, and the FGF and BMP
pathways, which further control cas transcriptional activity.
Whereas FGF signaling negatively regulates Cas by
phosphorylation, BMPs act via induction of the vox repressor, which
is a binding partner for both cas and pou2.
Acknowledgements
We thank A. Roure and P. Lemaire for pSPE3 vectors; Y. Kikuchi for the sox17
promoter; F. A. Bouallague for excellent fish care; and all members of INSERM
U368 and U784 for thoughtful discussion and invaluable technical assistance.
Funding
This work was supported by the EU [grant ZF-HEALTH] and Association pour la
Recherche contre le Cancer [grant 3845] to F.M.R.; Fondation pour la
Recherche Médicale [grant ACE20061208841] to J.Z; and partly by a grant
from the National Basic Research Program of the Chinese Ministry of Science
and Technology [973 grant 2012CB944503].
Competing interests statement
The authors declare no competing financial interests.
References
Agius, E., Oelgeschläger, M., Wessely, O., Kemp, C. and De Robertis, E. M.
(2000). Endodermal Nodal-related signals and mesoderm induction in
Xenopus. Development 127, 1173-1183.
Alexander, J. and Stainier, D. Y. (1999). A molecular pathway leading to
endoderm formation in zebrafish. Curr. Biol. 9, 1147-1157.
Alexander, J., Rothenberg, M., Henry, G. L. and Stainier, D. Y. (1999).
casanova plays an early and essential role in endoderm formation in zebrafish.
Dev. Biol. 215, 343-357.
Ambrosetti, D. C., Basilico, C. and Dailey, L. (1997). Synergistic activation of
the fibroblast growth factor 4 enhancer by Sox2 and Oct-3 depends on
protein-protein interactions facilitated by a specific spatial arrangement of
factor binding sites. Mol. Cell. Biol. 17, 6321-6329.
Ambrosetti, D. C., Schöler, H. R., Dailey, L. and Basilico, C. (2000). Modulation
of the activity of multiple transcriptional activation domains by the DNA
binding domains mediates the synergistic action of Sox2 and Oct-3 on the
fibroblast growth factor-4 enhancer. J. Biol. Chem. 275, 23387-23397.
Aoki, T. O., David, N. B., Minchiotti, G., Saint-Etienne, L., Dickmeis, T.,
Persico, G. M., Strähle, U., Mourrain, P. and Rosa, F. M. (2002). Molecular
integration of casanova in the Nodal signalling pathway controlling endoderm
formation. Development 129, 275-286.
Birsoy, B., Kofron, M., Schaible, K., Wylie, C. and Heasman, J. (2006). Vg 1 is
an essential signaling molecule in Xenopus development. Development 133,
15-20.
Bjornson, C. R., Griffin, K. J., Farr, G. H., 3rd, Terashima, A., Himeda, C.,
Kikuchi, Y. and Kimelman, D. (2005). Eomesodermin is a localized maternal
determinant required for endoderm induction in zebrafish. Dev. Cell 9, 523533.
Bowles, J., Schepers, G. and Koopman, P. (2000). Phylogeny of the SOX family
of developmental transcription factors based on sequence and structural
indicators. Dev. Biol. 227, 239-255.
Brennan, J., Lu, C. C., Norris, D. P., Rodriguez, T. A., Beddington, R. S. and
Robertson, E. J. (2001). Nodal signalling in the epiblast patterns the early
mouse embryo. Nature 411, 965-969.
Chan, S. K. and Mann, R. S. (1996). A structural model for a homeotic proteinextradenticle-DNA complex accounts for the choice of HOX protein in the
heterodimer. Proc. Natl. Acad. Sci. USA 93, 5223-5228.
Chan, T. M., Chao, C. H., Wang, H. D., Yu, Y. J. and Yuh, C. H. (2009). Functional
analysis of the evolutionarily conserved cis-regulatory elements on the sox17
gene in zebrafish. Dev. Biol. 326, 456-470.
Development 140 (5)
Dailey, L., Yuan, H. and Basilico, C. (1994). Interaction between a novel F9specific factor and octamer-binding proteins is required for cell-type-restricted
activity of the fibroblast growth factor 4 enhancer. Mol. Cell. Biol. 14, 7758-7769.
David, N. B. and Rosa, F. M. (2001). Cell autonomous commitment to an
endodermal fate and behaviour by activation of Nodal signalling. Development
128, 3937-3947.
Dickmeis, T., Mourrain, P., Saint-Etienne, L., Fischer, N., Aanstad, P., Clark,
M., Strähle, U. and Rosa, F. (2001). A crucial component of the endoderm
formation pathway, CASANOVA, is encoded by a novel sox-related gene. Genes
Dev. 15, 1487-1492.
Dougan, S. T., Warga, R. M., Kane, D. A., Schier, A. F. and Talbot, W. S. (2003).
The role of the zebrafish nodal-related genes squint and cyclops in patterning
of mesendoderm. Development 130, 1837-1851.
Ecochard, V., Cayrol, C., Rey, S., Foulquier, F., Caillol, D., Lemaire, P. and
Duprat, A. M. (1998). A novel Xenopus mix-like gene milk involved in the
control of the endomesodermal fates. Development 125, 2577-2585.
Engelen, E., Akinci, U., Bryne, J. C., Hou, J., Gontan, C., Moen, M., Szumska,
D., Kockx, C., van Ijcken, W., Dekkers, D. H. et al. (2011). Sox2 cooperates
with Chd7 to regulate genes that are mutated in human syndromes. Nat.
Genet. 43, 607-611.
Feldman, B., Gates, M. A., Egan, E. S., Dougan, S. T., Rennebeck, G., Sirotkin,
H. I., Schier, A. F. and Talbot, W. S. (1998). Zebrafish organizer development
and germ-layer formation require nodal-related signals. Nature 395, 181-185.
Gietz, R. and Schiestl, R. (1995). Transforming yeast with DNA. Methods Mol. Cell.
Biol. 5, 255-269.
Gilardelli, C. N., Pozzoli, O., Sordino, P., Matassi, G. and Cotelli, F. (2004).
Functional and hierarchical interactions among zebrafish vox/vent homeobox
genes. Dev. Dyn. 230, 494-508.
Grapin-Botton, A. and Constam, D. (2007). Evolution of the mechanisms and
molecular control of endoderm formation. Mech. Dev. 124, 253-278.
Hammerschmidt, M. and Nüsslein-Volhard, C. (1993). The expression of a
zebrafish gene homologous to Drosophila snail suggests a conserved function
in invertebrate and vertebrate gastrulation. Development 119, 1107-1118.
Hauptmann, G. and Gerster, T. (1994). Two-color whole-mount in situ
hybridization to vertebrate and Drosophila embryos. Trends Genet. 10, 266.
Henry, G. L., Brivanlou, I. H., Kessler, D. S., Hemmati-Brivanlou, A. and
Melton, D. A. (1996). TGF-beta signals and a pattern in Xenopus laevis
endodermal development. Development 122, 1007-1015.
Ho, R. K. and Kimmel, C. B. (1993). Commitment of cell fate in the early
zebrafish embryo. Science 261, 109-111.
Hudson, C., Clements, D., Friday, R. V., Stott, D. and Woodland, H. R. (1997).
Xsox17alpha and -beta mediate endoderm formation in Xenopus. Cell 91, 397405.
Imai, Y., Gates, M. A., Melby, A. E., Kimelman, D., Schier, A. F. and Talbot, W.
S. (2001). The homeobox genes vox and vent are redundant repressors of
dorsal fates in zebrafish. Development 128, 2407-2420.
Kamachi, Y., Uchikawa, M. and Kondoh, H. (2000). Pairing SOX off: with
partners in the regulation of embryonic development. Trends Genet. 16, 182187.
Kawahara, A., Wilm, T., Solnica-Krezel, L. and Dawid, I. B. (2000a).
Antagonistic role of vega1 and bozozok/dharma homeobox genes in
organizer formation. Proc. Natl. Acad. Sci. USA 97, 12121-12126.
Kawahara, A., Wilm, T., Solnica-Krezel, L. and Dawid, I. B. (2000b). Functional
interaction of vega2 and goosecoid homeobox genes in zebrafish. Genesis 28,
58-67.
Kikuchi, Y., Trinh, L. A., Reiter, J. F., Alexander, J., Yelon, D. and Stainier, D. Y.
(2000). The zebrafish bonnie and clyde gene encodes a Mix family
homeodomain protein that regulates the generation of endodermal
precursors. Genes Dev. 14, 1279-1289.
Kikuchi, Y., Agathon, A., Alexander, J., Thisse, C., Waldron, S., Yelon, D.,
Thisse, B. and Stainier, D. Y. (2001). casanova encodes a novel Sox-related
protein necessary and sufficient for early endoderm formation in zebrafish.
Genes Dev. 15, 1493-1505.
Kimelman, D. and Griffin, K. J. (2000). Vertebrate mesendoderm induction and
patterning. Curr. Opin. Genet. Dev. 10, 350-356.
Kimmel, C. B., Warga, R. M. and Schilling, T. F. (1990). Origin and organization
of the zebrafish fate map. Development 108, 581-594.
Kofron, M., Demel, T., Xanthos, J., Lohr, J., Sun, B., Sive, H., Osada, S.,
Wright, C., Wylie, C. and Heasman, J. (1999). Mesoderm induction in
Xenopus is a zygotic event regulated by maternal VegT via TGFbeta growth
factors. Development 126, 5759-5770.
Ladher, R., Mohun, T. J., Smith, J. C. and Snape, A. M. (1996). Xom: a Xenopus
homeobox gene that mediates the early effects of BMP-4. Development 122,
2385-2394.
Lemaire, P., Darras, S., Caillol, D. and Kodjabachian, L. (1998). A role for the
vegetally expressed Xenopus gene Mix.1 in endoderm formation and in the
restriction of mesoderm to the marginal zone. Development 125, 2371-2380.
Lunde, K., Belting, H. G. and Driever, W. (2004). Zebrafish pou5f1/pou2,
homolog of mammalian Oct4, functions in the endoderm specification
cascade. Curr. Biol. 14, 48-55.
DEVELOPMENT
1098 RESEARCH ARTICLE
Meijer, A. H., Ouwerkerk, P. B. and Hoge, J. H. (1998). Vectors for transcription
factor cloning and target site identification by means of genetic selection in
yeast. Yeast 14, 1407-1416.
Melby, A. E., Clements, W. K. and Kimelman, D. (1999). Regulation of dorsal
gene expression in Xenopus by the ventralizing homeodomain gene Vox. Dev.
Biol. 211, 293-305.
Melby, A. E., Beach, C., Mullins, M. and Kimelman, D. (2000). Patterning the
early zebrafish by the opposing actions of bozozok and vox/vent. Dev. Biol.
224, 275-285.
Nair, S., Li, W., Cornell, R. and Schilling, T. F. (2007). Requirements for
Endothelin type-A receptors and Endothelin-1 signaling in the facial ectoderm
for the patterning of skeletogenic neural crest cells in zebrafish. Development
134, 335-345.
Papaioannou, V. E. and Silver, L. M. (1998). The T-box gene family. BioEssays 20,
9-19.
Peyriéras, N., Strähle, U. and Rosa, F. (1998). Conversion of zebrafish
blastomeres to an endodermal fate by TGF-beta-related signaling. Curr. Biol. 8,
783-788.
Poulain, M. and Lepage, T. (2002). Mezzo, a paired-like homeobox protein is an
immediate target of Nodal signalling and regulates endoderm specification in
zebrafish. Development 129, 4901-4914.
Poulain, M., Fürthauer, M., Thisse, B., Thisse, C. and Lepage, T. (2006).
Zebrafish endoderm formation is regulated by combinatorial Nodal, FGF and
BMP signalling. Development 133, 2189-2200.
Rebagliati, M. R., Toyama, R., Haffter, P. and Dawid, I. B. (1998). cyclops
encodes a nodal-related factor involved in midline signaling. Proc. Natl. Acad.
Sci. USA 95, 9932-9937.
Reim, G., Mizoguchi, T., Stainier, D. Y., Kikuchi, Y. and Brand, M. (2004). The
POU domain protein spg (pou2/Oct4) is essential for endoderm formation in
cooperation with the HMG domain protein casanova. Dev. Cell 6, 91-101.
Reiter, J. F., Alexander, J., Rodaway, A., Yelon, D., Patient, R., Holder, N. and
Stainier, D. Y. (1999). Gata5 is required for the development of the heart and
endoderm in zebrafish. Genes Dev. 13, 2983-2995.
Reiter, J. F., Kikuchi, Y. and Stainier, D. Y. (2001). Multiple roles for Gata5 in
zebrafish endoderm formation. Development 128, 125-135.
Renucci, A., Lemarchandel, V. and Rosa, F. (1996). An activated form of type I
serine/threonine kinase receptor TARAM-A reveals a specific signalling
pathway involved in fish head organiser formation. Development 122, 37353743.
Rodaway, A., Takeda, H., Koshida, S., Broadbent, J., Price, B., Smith, J. C.,
Patient, R. and Holder, N. (1999). Induction of the mesendoderm in the
zebrafish germ ring by yolk cell-derived TGF-beta family signals and
discrimination of mesoderm and endoderm by FGF. Development 126, 30673078.
Roure, A., Rothbächer, U., Robin, F., Kalmar, E., Ferone, G., Lamy, C.,
Missero, C., Mueller, F. and Lemaire, P. (2007). A multicassette Gateway
vector set for high throughput and comparative analyses in ciona and
vertebrate embryos. PLoS ONE 2, e916.
Ryan, A. K. and Rosenfeld, M. G. (1997). POU domain family values: flexibility,
partnerships, and developmental codes. Genes Dev. 11, 1207-1225.
Sasai, Y., Lu, B., Piccolo, S. and De Robertis, E. M. (1996). Endoderm induction
by the organizer-secreted factors chordin and noggin in Xenopus animal caps.
EMBO J. 15, 4547-4555.
RESEARCH ARTICLE 1099
Schier, A. F., Neuhauss, S. C., Helde, K. A., Talbot, W. S. and Driever, W.
(1997). The one-eyed pinhead gene functions in mesoderm and endoderm
formation in zebrafish and interacts with no tail. Development 124, 327-342.
Schulte-Merker, S., van Eeden, F. J., Halpern, M. E., Kimmel, C. B. and
Nüsslein-Volhard, C. (1994). no tail (ntl) is the zebrafish homologue of the
mouse T (Brachyury) gene. Development 120, 1009-1015.
Shimizu, T., Yamanaka, Y., Nojima, H., Yabe, T., Hibi, M. and Hirano, T. (2002).
A novel repressor-type homeobox gene, ved, is involved in dharma/bozozokmediated dorsal organizer formation in zebrafish. Mech. Dev. 118, 125-138.
Smit, D. J., Smith, A. G., Parsons, P. G., Muscat, G. E. and Sturm, R. A. (2000).
Domains of Brn-2 that mediate homodimerization and interaction with
general and melanocytic transcription factors. Eur. J. Biochem. 267, 6413-6422.
Suzuki, A., Thies, R. S., Yamaji, N., Song, J. J., Wozney, J. M., Murakami, K.
and Ueno, N. (1994). A truncated bone morphogenetic protein receptor
affects dorsal-ventral patterning in the early Xenopus embryo. Proc. Natl. Acad.
Sci. USA 91, 10255-10259.
Thisse, B., Wright, C. V. and Thisse, C. (2000). Activin- and Nodal-related factors
control antero-posterior patterning of the zebrafish embryo. Nature 403, 425428.
Tiso, N., Filippi, A., Pauls, S., Bortolussi, M. and Argenton, F. (2002). BMP
signalling regulates anteroposterior endoderm patterning in zebrafish. Mech.
Dev. 118, 29-37.
Turner, D. L. and Weintraub, H. (1994). Expression of achaete-scute homolog 3
in Xenopus embryos converts ectodermal cells to a neural fate. Genes Dev. 8,
1434-1447.
van den Berg, D. L., Snoek, T., Mullin, N. P., Yates, A., Bezstarosti, K.,
Demmers, J., Chambers, I. and Poot, R. A. (2010). An Oct4-centered protein
interaction network in embryonic stem cells. Cell Stem Cell 6, 369-381.
Wang, J., Rao, S., Chu, J., Shen, X., Levasseur, D. N., Theunissen, T. W. and
Orkin, S. H. (2006). A protein interaction network for pluripotency of
embryonic stem cells. Nature 444, 364-368.
Wardle, F. C. and Smith, J. C. (2004). Refinement of gene expression patterns in
the early Xenopus embryo. Development 131, 4687-4696.
Warga, R. M. and Nüsslein-Volhard, C. (1999). Origin and development of the
zebrafish endoderm. Development 126, 827-838.
Wegner, M. (1999). From head to toes: the multiple facets of Sox proteins.
Nucleic Acids Res. 27, 1409-1420.
Westerfield, M. (1994). The Zebrafish Book. Eugene, Oregon: University of Oregon
Press.
Wilson, M. and Koopman, P. (2002). Matching SOX: partner proteins and cofactors of the SOX family of transcriptional regulators. Curr. Opin. Genet. Dev. 12,
441-446.
Xanthos, J. B., Kofron, M., Wylie, C. and Heasman, J. (2001). Maternal VegT is
the initiator of a molecular network specifying endoderm in Xenopus laevis.
Development 128, 167-180.
Yasuo, H. and Lemaire, P. (1999). A two-step model for the fate determination
of presumptive endodermal blastomeres in Xenopus embryos. Curr. Biol. 9,
869-879.
Zhang, J., Talbot, W. S. and Schier, A. F. (1998). Positional cloning identifies
zebrafish one-eyed pinhead as a permissive EGF-related ligand required
during gastrulation. Cell 92, 241-251.
Zorn, A. M. and Wells, J. M. (2007). Molecular basis of vertebrate endoderm
development. Int. Rev. Cytol. 259, 49-111.
DEVELOPMENT
Vox inhibits Cas