4070 RESEARCH ARTICLE
Development 140, 4070-4080 (2013) doi:10.1242/dev.099838
© 2013. Published by The Company of Biologists Ltd
The neogenin/DCC homolog UNC-40 promotes BMP
signaling via the RGM protein DRAG-1 in C. elegans
Chenxi Tian1,*, Herong Shi1, Shan Xiong2, Fenghua Hu1,3, Wen-Cheng Xiong2 and Jun Liu1,‡
SUMMARY
The deleted in colorectal cancer (DCC) homolog neogenin functions in both netrin- and repulsive guidance molecule (RGM)-mediated
axon guidance and in bone morphogenetic protein (BMP) signaling. How neogenin functions in mediating BMP signaling is not well
understood. We show that the sole C. elegans DCC/neogenin homolog UNC-40 positively modulates a BMP-like pathway by
functioning in the signal-receiving cells at the ligand/receptor level. This function of UNC-40 is independent of its role in netrinmediated axon guidance, but requires its association with the RGM protein DRAG-1. We have identified the key residues in the
extracellular domain of UNC-40 that are crucial for UNC-40–DRAG-1 interaction and UNC-40 function. Surprisingly, the extracellular
domain of UNC-40 is sufficient to promote BMP signaling, in clear contrast to the requirement of its intracellular domain in mediating
axon guidance. Mouse neogenin lacking the intracellular domain is also capable of mediating BMP signaling. These findings reveal
an unexpected mode of action for neogenin regulation of BMP signaling.
KEY WORDS: BMP signaling, Neogenin, DCC, UNC-40, RGM, DRAG-1, Caenorhabditis elegans
INTRODUCTION
The development of multicellular organisms requires the proper
spatial and temporal coordination of many intracellular and
extracellular signals. Among the extracellular signals are the bone
morphogenetic proteins (BMPs), which belong to the transforming
growth factor-β (TGFβ) superfamily of ligands. BMPs regulate a
variety of developmental processes (Wu and Hill, 2009).
Malfunction of this pathway causes many somatic and hereditary
disorders in humans, including skeletal abnormalities,
cardiovascular diseases and cancer (Gordon and Blobe, 2008;
Massagué, 2008; Cai et al., 2012). Activation of the canonical BMP
pathway starts with the formation of the BMP ligand-type I-type II
receptor ternary complex, which in turn leads to the phosphorylation
of the receptor-regulated Smads (R-Smads). These activated RSmads then complex with common-mediator Smads (co-Smads),
enter the nucleus and complex with transcriptional co-factors to
regulate downstream gene expression (Shi and Massagué, 2003).
Owing to the diverse functions of the BMP pathway, multiple
factors act as modulators to ensure proper spatiotemporal control
of BMP signaling (Balemans and Van Hul, 2002; Umulis et al.,
2009; Huang and Chen, 2012; Ramel and Hill, 2012). The
transmembrane protein neogenin is one such factor. Neogenin is
a member of the deleted in colorectal cancer (DCC) family and
serves as a receptor for the guidance cue netrin (Keino-Masu et
al., 1996) and the repulsive guidance molecules (RGMs) (Cole et
al., 2007; Rajagopalan et al., 2004) to regulate axon guidance.
Recent studies have shown that neogenin also plays a role in
modulating BMP signaling (Zhang et al., 2009; Lee et al., 2010;
Zhou et al., 2010). However, how neogenin modulates BMP
signaling is not well understood. Outstanding questions include
whether it acts in the signal-producing cell or the signal-receiving
cell, whether its role in BMP signaling is mediated through
binding or processing RGM proteins, and whether its roles in
mediating BMP signaling and netrin signaling are independent
processes (Tian and Liu, 2013). In this study, we provide evidence
that UNC-40, the single neogenin/DCC homolog in C. elegans,
positively promotes the BMP-like Sma/Mab (Small/Male tail
abnormal) pathway and that this function is independent of its role
in netrin signaling. Moreover, we found that UNC-40 functions in
the signal-receiving cells by interacting with the sole RGM protein
DRAG-1 to promote BMP signaling. We have identified the
critical residues in UNC-40 involved in the interaction with
DRAG-1. Our results also demonstrated that the extracellular
domain of UNC-40 is sufficient to mediate BMP signaling and
that this mode of action is conserved in mammals.
MATERIALS AND METHODS
C. elegans strains
Analyses were performed at 20°C unless otherwise noted. The following
mutations and integrated transgenes were used. Linkage group I (LG I):
drag-1(jj4); unc-40(e1430); unc-40(tr115); unc-40(ev457); unc-40(ev495);
unc-40(jj59); unc-40(e271); mec-4::gfp (zdIs5). LG II: sma-6(jj6). LG III:
lon-1(jj67), sma-3(jj3), ccIs4438(intrinsic CC::gfp). LG IV: unc-5(e53). LG
V: dbl-1(wk70). LG X: lon-2(e678); sma-9(cc604); unc-6(ev400).
1
Department of Molecular Biology and Genetics, Cornell University, Ithaca, NY
14853, USA. 2Institute of Molecular Medicine and Genetics and Department of
Neurology, Medical College of Georgia, Georgia Regents University, Augusta, GA
30912, USA. 3Weill Institute of Molecular and Cell Biology, Cornell University, Ithaca,
NY 14853, USA.
*Present address: Koch Institute for Integrative Cancer Research, Massachusetts
Institute of Technology, Cambridge, MA 02139, USA
‡
Author for correspondence ([email protected])
Accepted 24 July 2013
Constructs for tissue-specific expression of unc-40, mammalian cell culture
expression, DRAG-1 and UNC-40 vertebrate and C. elegans hybrid
construction, and for in vivo structure-function analysis of UNC-40 are
listed in supplementary material Table S1. pJKL449 (myo-2p::gfp::unc-54
3⬘UTR) was used as a co-injection marker for generating all the
extrachromosomal array-containing transgenic lines.
All the drag-1 expressing constructs (supplementary material Table S1)
were in the pCFJ151 plasmid backbone, which allows insertion into the
ttTi5605 Mos site (Frøkjaer-Jensen et al., 2008). The drag-1 portion in these
constructs was derived from pCXT183 (3.9kb drag-1p::drag-1 genomic
sequence without 3rd intron::gfp::1.7kb drag-1 3⬘UTR), which was a
Development
Plasmid constructs and transgenic lines
UNC-40/neogenin in BMP signaling
Body size measurement
Hermaphrodite animals at the gravid adult stage were collected and treated
with hypochlorite. The resulting embryos were allowed to hatch in M9
buffer at 16°C. Synchronized L1s were plated onto NGM plates and allowed
to grow for 48 or 72 hours before they were washed off the plates, treated
with 0.3% sodium azide, and mounted onto 2% agarose pads. Images of the
worms were taken on a Leica DMRA2 compound microscope with a
Hamamatsu Orca-ER camera using Openlab software (Improvision). To
overcome the slow growth phenotype of certain mutant strains, animals
whose vulva development was at the early Christmas tree stage were used
for body size measurement in certain experiments. Subsequent statistical
analyses were performed using Microsoft Excel.
RAD-SMAD reporter assay
Hermaphrodites carrying the RAD-SMAD reporter jjIs2437 II (Tian et al.,
2010) were treated with hypochlorite. The resulting embryos were allowed to
hatch in M9 buffer at 16°C. Synchronized L1s were plated onto NGM plates
and allowed to grow for 48 hours. The resulting L3 animals were anesthetized.
Images of the hypodermal cells were taken at 40× magnification on a Leica
DMRA2 compound microscope. Fluorescence intensity of the nuclear GFP
and background was measured in pairs using the Openlab software. Five
nuclei/background pairs were measured for each worm. A total of 40 worms
was measured per genotype. The mean signal value of each worm was
deduced by averaging nuclear signal minus background signal. Standard
deviation was then calculated using Microsoft Excel.
Assays to evaluate the Unc phenotypes of unc-40 mutants
Synchronized L1s were plated onto NGM plates and allowed to grow for
different lengths of time. Forty-eight hours post-plating, the AVM neuronal
migration defect was determined by examining AVM axon projection using
the mec-4::gfp (zdIs5) marker (Clark and Chiu, 2003). Animals that failed
to project the AVM axon ventrally were considered abnormal
(supplementary material Fig. S1). The movement defect was determined
by visually inspecting the movement of animals 72 hours post-plating. The
wild type-like moving animals were given a score of 1 and the animals that
rarely moved or moved in an extremely uncoordinated fashion upon
stimulation were given a score of 4. The egg-laying defective (Egl)
phenotype was determined at 100 hours post-plating by counting the
number of animals that died as a ‘bag of worms’ due to defective egg laying.
Immunofluorescence staining
Animal fixation, immunostaining, microscopy and image analysis were
performed as described previously (Tian et al., 2010). Guinea pig antiFOZI-1 (1:200) (Amin et al., 2007), mouse monoclonal anti-AJM-1 MH27
(1:100; Developmental Studies Hybridoma Bank, University of Iowa), rat
anti-MLS-2 (1:200) (Jiang et al., 2005) and goat anti-GFP (1:1000;
Rockland Immunochemicals) were used.
Cell culture and transient transfection
HEK293T cells (for co-immunoprecipitation experiments), HEK293 cells
(for BMP assays) and primary skin fibroblasts were maintained in
Dulbecco’s Modified Eagle Medium supplemented with 10% fetal calf
serum and 100 units/ml penicillin G and streptomycin (Gibco). HEK293 or
HEK293T cells were transfected by the calcium phosphate method as
described previously (Lee et al., 2010). Primary fibroblasts were plated at
a density of 106 cells per 10-cm culture dish and allowed to grow for 2448 hours before transfection using Lipofectamine 2000 (Invitrogen). Fortyeight hours after transfection, cells were washed, serum starved overnight,
and then treated with BMP2 (30 minutes for HEK293 cells and 60 minutes
for fibroblasts). Cells were then subjected to western blot or luciferase assay
analyses, respectively. Alternatively, cell media or cell lysates were
collected for co-immunoprecipitation assays as described below.
Luciferase assay
Luciferase assay was carried out as described previously (Zhou et al., 2010).
In brief, cells were washed with PBS and lysed in lysis buffer (Promega) for
20 minutes at room temperature. Then, 50 μl of lysate were used to
determine relative luciferase activity (firefly luciferase activity divided by
Renilla luciferase activity) using a dual luciferase assay system (Promega).
The luciferase activity data are the average of two independent cell
isolations, each performed in triplicate.
Co-immunoprecipitation assays
For proteins that were expressed as soluble proteins, including mutated and
wild-type Myc-FN5,6, DRAG-1 (mature domain)-FLAG, DRAG-1 (mature
domain)-Myc and FLAG-DBL-1 (mature domain), cell media were
collected 5 days after transfecting the corresponding protein-expressing
plasmids. For the remaining proteins, including mutated and wild-type
DRAG-1 (mature domain)-FLAG, Myc-SMA-6 and Myc-DAF-4, cell
lysates were collected 48 hours post-transfection. Anti-cMyc-conjugated
Sepharose beads (Sigma EzView; 8 μl beads per reaction) or anti-FLAGconjugated Sepharose beads (Sigma M2 EzView; 6 μl per reaction) were
first incubated with cell lysates or media containing the first protein for
4 hours at 4°C, then with cell lysates or media containing the second protein
for 4 hours or overnight at 4°C. The beads were then subjected to five
washes with lysis buffer (50 mM Tris pH 8.0, 150 mM NaCl, 1% Triton X100), boiled in SDS sample buffer and run on 10% SDS-PAGE gels.
Western blots were probed with mouse anti-FLAG (M2) or mouse anti-Myc
(9E10) antibodies (Sigma-Aldrich).
RESULTS
Mutations in the C. elegans neogenin homolog
unc-40 cause phenotypes resembling those of
Sma/Mab pathway mutants
The C. elegans BMP-like Sma/Mab pathway regulates body size
and male tail patterning (Savage-Dunn, 2005). Mutations in this
pathway can also suppress the mesodermal M lineage phenotypes
of sma-9(0) mutants (Foehr et al., 2006; Tian et al., 2010).
Specifically, the two coelomocytes (CCs) derived from the dorsal M
lineage (Fig. 1C) are missing in sma-9(0) mutants due to a dorsalto-ventral fate transformation in the M lineage (Fig. 1A,D). These
two CCs can be restored in double mutants between sma-9(0) and
mutations in Sma/Mab pathway members (Fig. 1B,C). In a largescale screen for mutations that could suppress the loss-of-M-derived
CCs phenotype of sma-9(cc604) mutants (the mutagenesis screen
will be described in a separate manuscript), we identified a recessive
mutation jj59 that exhibited a penetrance of 73.3% (n=195) of
suppression of the sma-9(cc604) M lineage phenotype (SOSMLP)
(Table 1). Genetic mapping, complementation test and sequencing
showed that jj59 is a nonsense mutation (Q628Stop, CAA to TAA)
in the sole C. elegans neogenin and DCC homolog unc-40 (Table 1,
Table 3A). A canonical unc-40 null allele, e1430 (Hedgecock et al.,
1990), also suppressed the M lineage phenotype of sma-9(cc604)
mutants (88.7%, n=150, Table 1). Both unc-40(jj59) and unc40(e1430) mutants also have a significantly smaller body size than
wild-type worms at the same developmental stage (Table 1). Thus,
unc-40 mutants exhibit phenotypes of Sma/Mab pathway mutants.
Mutations in the C. elegans netrin ortholog unc-6
and the netrin receptor gene unc-5 do not exhibit
Sma/Mab pathway mutant phenotypes
UNC-40 has been well studied as a DCC ortholog that functions as a
netrin receptor in both UNC-5-dependent and UNC-5-independent
pathways to mediate axonal and cellular movement guidance
(Hedgecock et al., 1990; Kennedy et al., 1994; Chan et al., 1996;
Development
derivative of pJKL849 (Tian et al., 2010) with sequences corresponding to
the third intron of drag-1 deleted. MosSCI single-copy insertion lines were
generated using the direct gonadal injection method following the protocol
described (Frøkjaer-Jensen et al., 2008). Primer pairs CXT310 (GCGGGATCATTTCTTACTAG)/CXT226 (ACTGACGAATTCCCTGAATTTGTAAATACTCTTC) and CXT312 (CAAGGACTTGGATAAATTGGC)/
CXT311 (GTGTATCTGCATTAACCAATA) were used to verify the
insertion in different transgenic lines.
RESEARCH ARTICLE 4071
Development 140 (19)
4072 RESEARCH ARTICLE
Fig. 1. unc-40, but not unc-5 or unc-6, mutants exhibit body size and
mesoderm defects. (A,B) Images illustrating the mesoderm phenotype
(lateral views with anterior to the left and dorsal up). CC::gfp labels all the
coelomocytes (CCs), including embryonically derived CCs (asterisks) and
M-derived CCs (red arrowheads). (C,D) Schematic representation of the M
lineage. sma-9(cc604) mutants (A,D) exhibit a dorsal-to-ventral fate
transformation in the M lineage, leading to the lack of M-derived CCs
compared with wild type (C) or unc-40(e1430); sma-9(cc604) double
mutants (B,C). SM, sex myoblast; a, anterior; d, dorsal; l, left; p, posterior; r,
right; v, ventral.
Colón-Ramos et al., 2007; Teichmann and Shen, 2011). We
investigated whether UNC-6/netrin and UNC-5 play a role in
modulating Sma/Mab signaling by examining the null mutants of
unc-6 and unc-5 for Sma/Mab pathway mutant phenotypes, including
the suppression of the sma-9(0) M lineage phenotype (SOSMLP) and
the small body size phenotype. Unlike unc-40 null mutants, null
mutants in unc-6(ev400) and unc-5(e53) (Hedgecock et al., 1990;
Wadsworth et al., 1996) did not exhibit any Sma/Mab pathway mutant
phenotypes (Table 1). Interestingly, Hedgecock and colleagues noted
a ‘DUMPY’ phenotype for unc-40, but not unc-5 and unc-6, alleles
(Hedgecock et al., 1990). Thus, UNC-40 appears to play a role in
Sma/Mab signaling independent of UNC-6 and UNC-5.
UNC-40 functions at the ligand-receptor level to
positively modulate Sma/Mab signaling
The shared phenotypes between unc-40 mutants and Sma/Mab
pathway mutants suggest that unc-40 might function in the
Sma/Mab pathway. This pathway includes the ligand DBL-1
(Morita et al., 1999; Suzuki et al., 1999), the type I receptor SMA6 (Krishna et al., 1999), the type II receptor DAF-4 (Estevez et al.,
1993) and R-Smads SMA-2 and SMA-3, as well as co-Smad SMA4 (Savage et al., 1996). We carried out two sets of experiments to
test this hypothesis. First, we examined the activity of the RADSMAD reporter in unc-40(e1430) null mutants. The RAD-SMAD
reporter activity positively correlates with Sma/Mab pathway
activity at the transcriptional level (Tian et al., 2010). The RADSMAD reporter activity was decreased in unc-40(e1430) mutants
compared with wild-type animals (Fig. 2C). As controls, the RADSMAD reporter activity is increased in lon-2(e678), an allele with
hyperactive Sma/Mab signaling (Gumienny et al., 2007), and
decreased in the ligand null dbl-1(wk70) (Morita et al., 1999; Suzuki
et al., 1999) and in an RGM protein null drag-1(jj4). These results
suggest that UNC-40 functions as a positive modulator of the
Sma/Mab pathway.
Second, we carried out genetic epistasis experiments by generating
double mutants between unc-40(e1430) and null mutations in various
Sma/Mab pathway components (Fig. 2A) and measuring their body
sizes. unc-40(e1430); sma-3(jj3) and unc-40(e1430); dbl-1(wk70)
double mutants were as small as sma-3(jj3) and dbl-1(wk70) single
mutants, respectively (Fig. 2B), suggesting that unc-40 is likely to
function within the Sma/Mab pathway in regulating body size. To
further determine where in the Sma/Mab pathway unc-40 might
function, we generated the following double mutants: unc-40(e1430);
lon-1(jj67) and unc-40(e1430); lon-2(e678). jj67 is an apparent null
mutation in lon-1, a gene negatively regulated by the Sma/Mab
pathway (Maduzia et al., 2002; Morita et al., 2002) (our unpublished
results). e678 is a null mutation in lon-2, which encodes a member of
the glypican family of heparan sulfate proteoglycans and acts as a
negative regulator of Sma/Mab signaling, presumably by sequestering
the DBL-1 ligand (Gumienny et al., 2007). We found that unc40(e1430); lon-1(jj67) mutants were as long as lon-1(jj67) mutants
(Fig. 2B), again suggesting that unc-40 functions within the Sma/Mab
pathway, upstream of lon-1, to regulate body size. Interestingly, unc40(e1430); lon-2(e678) mutants showed an intermediate body size
between unc-40(e1430) mutants and lon-2(e678) mutants. These
results suggest that unc-40 is likely to function in parallel to lon-2, a
negative regulator of the Sma/Mab pathway that acts at the ligandreceptor level. Taken together, our results indicate that unc-40 is likely
to function at the ligand-receptor level to positively modulate
Sma/Mab signaling.
UNC-40 is expressed and functions in the Sma/Mab
signal-receiving cells
We next examined the expression pattern of an integrated UNC40::GFP transgene that is functional in mediating axon guidance
(Chan et al., 1996). This transgene rescued the small body size and
SOSMLP phenotypes of unc-40(e1430) mutants (Table 3B, the
Genotype
Molecular lesions
Relative body length
SOSMLP (%)
WT
unc-40(e1430)
unc-40(jj59)
unc-5(e53)
unc-6(ev400)
R157STOP (null)
Q628STOP
W283STOP (null)
Q78STOP (null)
1.16±0.06*** (n=27)
1.00±0.04 (n=50)
0.99±0.06 (n=46)
1.14±0.05*** (n=39)
1.14±0.06*** (n=20)
N.A.
88.7 (n=150)
73.3 (n=195)
1.7 (n=59)
0.5 (n=221)
Body length data shown here and in subsequent figures and tables were normalized over that of unc-40(e1430) mutants. Data are mean ± s.d. ***P<0.0001, unc-40(e1430)
versus other mutants (Student’s t-test).
SOSMLP, suppression of the sma-9 M lineage phenotype.
N.A., not applicable.
Development
Table 1. Summary of body size and mesodermal phenotypes in unc-40, unc-5 and unc-6 null mutants
UNC-40/neogenin in BMP signaling
RESEARCH ARTICLE 4073
Fig. 2. unc-40 functions at the ligand-receptor level to positively
regulate Sma/Mab signaling. (A) The Sma/Mab pathway. (B) Relative
body lengths of stage-matched wild-type (WT) and various mutant
worms measured at the Christmas tree stage of vulval development (see
Materials and methods). (C) Quantification of hypodermal RAD-SMAD
GFP signals in various mutants compared with wild-type animals (set to
1). (B,C) ***P<0.0001, **P<0.001, *P<0.05 (Student’s t-test). Error bars
represent s.d.
UNC-40 wild-type transgene). Sma/Mab pathway receptors and
Smads are known to be expressed and to function in the hypodermal
cells to regulate body size and in the M lineage to regulate M lineage
development (Yoshida et al., 2001; Wang et al., 2002; Foehr et al.,
2006). We found that, in addition to the previously reported
neuronal and muscle cell expression (Chan et al., 1996; Alexander
et al., 2009), the functional UNC-40::GFP transgene is expressed
in both hypodermal cells (Fig. 3A-C) and M lineage cells (Fig. 3DO). Thus, unc-40 is expressed in the signal-receiving cells of the
Sma/Mab pathway.
To determine whether UNC-40 functions in the signal-receiving
cells of the Sma/Mab pathway, we forced the expression of the unc40 cDNA in hypodermal cells using both the elt-3 and rol-6
promoters (Kramer and Johnson, 1993; Gilleard et al., 1999) and in
the M lineage using the hlh-8 promoter (Harfe et al., 1998). Forced
The extracellular domain of UNC-40 is sufficient to
modulate Sma/Mab signaling
unc-40 has been studied extensively in terms of its roles in axonal
and cell migration (Culotti and Merz, 1998; Blelloch et al., 1999;
Quinn and Wadsworth, 2008; Alexander et al., 2009). Thus,
multiple unc-40 alleles exist. To understand which domain of UNC40 is required for its role in Sma/Mab signaling, we examined
multiple unc-40 alleles for body size and SOSMLP phenotypes.
Four nonsense mutations, e1430 (R157STOP), ev457
(W460STOP), e271 [R827STOP (Hedgecock et al., 1990; Chan et
al., 1996)] and jj59 (Q628STOP), which truncate the extracellular
domain of UNC-40, all exhibited highly penetrant small body size
and SOSMLP phenotypes (Table 3A). However, ev495
(Q1075STOP; Joe Culotti, personal communication) and tr115
[W1107STOP (Alexander et al., 2009)], which truncate the UNC40 protein right before and right after the transmembrane (TM)
domain, respectively (Table 3A), failed to suppress the sma-9 M
lineage phenotype, and the body sizes of ev495 and tr115 mutants
were significantly longer than that of e1430 mutants and not
statistically different from that of wild-type worms (Table 3A). This
is in stark contrast to the axon guidance and cell migration defects
shared by all these mutant alleles (Table 3A).
The above findings raised the possibility that the extracellular
domain (EXD) of UNC-40 is sufficient to mediate Sma/Mab
signaling. To test this hypothesis and to rule out the possibility that
potential full-length UNC-40 proteins are present in ev495 and tr115
mutants due to alternative splicing, thus bypassing the nonsense
mutations, we generated a transgene containing UNC-40 EXD only
and introduced it into the null unc-40(e1430) background. Whereas
the full-length UNC-40 transgene rescued the body size, SOSMLP,
and axon and cell migration defects of unc-40(e1430) mutants, the
transgene containing UNC-40 EXD only rescued the body size and
SOSMLP phenotypes, but not the axon and cell migration defects of
unc-40(e1430) mutants (Table 3B). These results demonstrate that,
although the intracellular domain (ICD) of UNC-40 is essential for its
role in axon guidance and cell migration, this domain is not required
in mediating Sma/Mab signaling; instead, UNC-40 EXD is sufficient
Development
expression of unc-40 in hypodermal cells rescued the small body
size phenotype (Table 2), and forced expression of unc-40 in the M
lineage rescued the SOSMLP phenotype (SOSMLP down to 4.1%;
n=49), of unc-40(e1430) mutants. However, forced expression of
unc-40 in body-wall muscles using the myo-3 promoter (Fire et al.,
1998) failed to rescue the small body size phenotype (Table 2). As
a positive control, expression of unc-40 cDNA under the control of
its own promoter was able to rescue the small body size phenotype
of unc-40(e1430) mutants (Table 2). Similarly, expression of unc40 under its own promoter or under the pan-neuronal promoter unc119 (Maduro and Pilgrim, 1995), but not under hypodermal- or
muscle-specific promoters, rescued the axonal migration defects of
unc-40(e1430) mutants (Table 2), consistent with the fact that UNC40 functions as a netrin receptor in neuronal cells to regulate their
axonal path finding (Chan et al., 1996). Taken together, our findings
are consistent with UNC-40 functioning in the signal-receiving cells
to modulate Sma/Mab signaling. Interestingly, forced expression of
unc-40 in all neuronal cells using the unc-119 promoter partially
rescued the small body size phenotype of unc-40(e1430) mutants
(Table 2). This partial rescue could reflect a role of UNC-40 in the
signal-producing cells, as the DBL-1 ligand is produced in the
ventral nerve cord cells (Morita et al., 1999; Suzuki et al., 1999).
Alternatively, it could be an indirect result of the less uncoordinated
phenotype of the transgenic animals.
Development 140 (19)
4074 RESEARCH ARTICLE
Fig. 3. UNC-40 is expressed and functions in the Sma/Mab signal-receiving cells. (A-C) UNC-40::GFP (green) is localized to the cellular membrane
of the hypodermal seam cells (arrowheads in A), as indicated by anti-AJM-1 antibody staining (red, B). (D-O) UNC-40::GFP (green, D,G,J,M) is localized to
the surface of M lineage cells marked by anti-MLS-2 and anti-FOZI-1 antibody staining (E,H,K,N) from the 1-M to the 8-M stage. Only one focal plane is
shown for the 4-M (J-L) and 8-M (M-O) stage worms.
to function in Sma/Mab signaling. These results also suggest that the
function of UNC-40 in mediating Sma/Mab signaling is independent
from its function in axon guidance and cell migration.
The sixth fibronectin type III motif (FN6) of UNC40 is essential for its role in Sma/Mab signaling
Our analyses of the unc-40 mutant alleles also suggested that the
fifth and sixth fibronectin type III (FNIII) motifs are important for
UNC-40 function in Sma/Mab signaling (compare the SOSMLP
phenotypes of e271 and ev495 in Table 3A). To test this hypothesis
and to rule out the possibility that the phenotypes of these two
alleles were due to the absence of mutant UNC-40 proteins as a
result of nonsense-mediated decay of the mutant mRNAs, we
generated unc-40 transgenes with the fifth or the sixth or both of
these FNIII motifs deleted (ΔFN5, ΔFN6 or ΔFN5,6,
respectively). Whereas ΔFN5 rescued both the small body size
and the SOSMLP phenotypes of the null unc-40(e1430) mutants,
ΔFN6 and ΔFN5,6 failed to rescue these two phenotypes (Table
3B). All three deletion constructs completely rescued the axon
guidance and cell migration phenotypes of unc-40(e1430)
mutants. These results demonstrate that FN6 is absolutely required
for the function of UNC-40 in Sma/Mab signaling. Moreover, both
FN5 and FN6 are dispensable for the role of UNC-40 in axon
guidance and cell migration.
The FN6 motif is required for UNC-40 and DRAG-1
interaction and is essential for UNC-40 function in
Sma/Mab signaling
Neogenin, but not DCC, has been shown to directly bind to RGMc
through the FN6 motif (Yang et al., 2008). Both neogenin and
RGMc have been implicated in BMP signaling (Corradini et al.,
2009; Severyn et al., 2009). We have previously shown that the C.
elegans RGM protein DRAG-1 is a positive modulator of Sma/Mab
signaling (Tian et al., 2010). The finding that the FN6 motif is
crucial for UNC-40 function in Sma/Mab signaling led us to
hypothesize that UNC-40 might function together with the C.
elegans RGM protein DRAG-1 through the FN6 motif. To test this,
we transiently expressed the FN5,6 fragment of UNC-40 and the
mature portion of DRAG-1 lacking the N- and C-terminal signal
sequences in HEK293T cells and performed coimmunoprecipitation (co-IP) assays. We found that FLAG-tagged
DRAG-1 could co-immunoprecipitate with Myc-tagged FN5,6
fragment of UNC-40 (Fig. 4C).
To identify the specific sequences in FN6 that are required for
the UNC-40–DRAG-1 interaction, we took advantage of the crystal
structure of the FN5,6 motifs of human neogenin (Yang et al., 2011).
The amino acids involved in neogenin-RGM interaction are
predicted to be exposed to the surface of FN6 and to be divergent
between human neogenin and DCC (Yang et al., 2011). We also
expected them to be conserved among the UNC-40 proteins in
different Caenorhabditis species. Based on these criteria, we picked
three clusters of amino acids located in the C-C⬘ loop, C⬘ strand or
the E-F loop based on the crystal structure of the human neogenin
FN6 domain (Yang et al., 2011) (Fig. 4A,B). We tested the
importance of each of the three regions by mutating the residues in
each region to their corresponding sequences in the human DCC
protein. We then examined the consequences of each mutation on
the interaction between UNC-40 and DRAG-1 using the co-IP assay
and on the in vivo function of UNC-40 using the transgene rescue
assay described above. Mutations in the E-F loop, but not those in
unc-40 alleles
Transgenes
Unc
Egl (%)
AVM migration defect (%)
Relative body length
WT
unc-40(e1430)
unc-40(e1430)
unc-40(e1430)
unc-40(e1430)
unc-40(e1430)
unc-40(e1430)
None
None
unc-40p::unc-40 cDNA
elt-3p::unc-40 cDNA
rol-6p::unc-40 cDNA
unc-119p::unc-40 cDNA
myo-3p::unc-40 cDNA
1 (n>100)
3.2 (n=54)
1.6 (n=50)
2.7 (n=37)
2.8 (n=90)
1.9 (n=58)
2.5 (n=103)
0 (n>100)
33.3 (n=54)
16 (n=50)
21.6 (n=37)
26.7 (n=90)
15.9 (n=63)
25.4 (n=114)
0 (n>100)
25.4 (n=51)
14.8 (n=108)
28.0 (n=118)
27.9 (n=106)
10.2 (n=117)
22.9 (n=109)
1.16±0.06*** (n=27)
1.00±0.04 (n=50)
1.11±0.04*** (n=73)
1.09±0.05*** (n=62)
1.10±0.04*** (n=60)
1.03±0.04*** (n=70)
1.00±0.05 (n=80)
For axon guidance defects, see supplementary material Fig. S1. Body length was normalized over that of unc-40(e1430) mutants. For all the measurements on transgenic
worms in Tables 2-5, data from two transgenic lines were pooled and averaged. ***P<0.0001.
Unc, uncoordinated movement; Egl, egg-laying defective.
Development
Table 2. Rescue of axon guidance defects (Unc, Egl and AVM migration) and Sma/Mab signaling defects (body size) of unc40(e1430) worms by tissue-specific expression of unc-40 cDNA
UNC-40/neogenin in BMP signaling
RESEARCH ARTICLE 4075
Table 3. The UNC-40 EXD is sufficient to function in Sma/Mab signaling and requires the FN6 motif
(A) Axon guidance defects (Unc, Egl and AVM migration) and Sma/Mab signaling defects (body size and SOSMLP) in different unc-40 mutant
backgrounds
AVM migration
Genotype
Endogenous UNC-40
Unc
Egl (%)
defect (%)
Relative body length
SOSMLP (%)
WT
1 (n>100)
0 (n>100)
0 (n>100)
1.16±0.06*** (n=27)
3.0 (n=54)
33.3 (n=54)
25.4 (n=51)
1.00±0.04 (n=50)
unc-40(e1430)
R157STOP
unc-40(ev457)
N.D.
N.D.
N.D.
N.D.
W460STOP
unc-40(jj59)
N.D.
N.D.
N.D.
0.99±0.06 (n=46)
Q628STOP
unc-40(e271)
N.D.
N.D.
N.D.
N.D.
R827STOP
unc-40(ev495)
3.2 (n=50)
34 (n=50)
27.9 (n=61)
1.14±0.05*** (n=28)
Q1075STOP
unc-40(tr115)
3.0 (n=50)
32 (n=50)
42.3 (n=52)
1.13±0.04*** (n=28)
W1107STOP
(B) Axon guidance defects and Sma/Mab signaling defects in unc-40(e1430) mutants expressing different unc-40 transgenes
AVM migration
Genotype
Unc
Egl (%)
defect (%)
Relative body length
WT
1 (n>100)
0 (n>100)
0 (n>100)
1.16±0.06*** (n=27)
unc-40(e1430)
3.0 (n=54)
33.3 (n=54)
25.4 (n=51)
1.00±0.04 (n=50)
2.3 (n=101)
25.7 (n=101)
14.5 (n=117)
1.12±0.05*** (n=51)
UNC-40 WT in unc-40(e1430)
N.A.
88.7 (n=150)
72.8 (n=158)
73.3 (n=195)
73.1 (n=188)
2.7 (n=221)
0 (n=166)
SOSMLP (%)
N.A.
88.7 (n=150)
1.8 (n=57)
UNC-40 ΔFN5 in unc-40(e1430)
2.2 (n=107)
25.0 (n=124)
21.6 (n=111)
1.13±0.05*** (n=55)
3.3 (n=61)
UNC-40 ΔFN6 in unc-40(e1430)
2.2 (n=100)
22.3 (n=130)
11.5 (n=122)
0.98±0.06 (n=53)
93.6 (n=47)
UNC-40 ΔFN5,6 in unc-40(e1430)
2.2 (n=76)
28.9 (n=76)
13.9 (n=108)
0.98±0.06 (n=56)
96.9 (n=64)
UNC-40 EXD in unc-40(e1430)
3.3 (n=123)
43.1 (n=144)
31.7 (n=104)
1.08±0.04*** (n=50)
8.3 (n=48)
Mouse Neo1 in unc-40(e1430)
N.D.
N.D.
N.D.
1.05±0.03*** (n=21)
75.9 (n=323)
Mouse DCC in unc-40(e1430)
N.D.
N.D.
N.D.
1.00±0.05 (n=66)
97.2 (n=109)
the C-C⬘ loop and C⬘ strand, abolished both the interaction between
UNC-40 and DRAG-1 (Fig. 4C) and the function of UNC-40 in
vivo (Table 4). All three mutant unc-40 transgenes could still
function in mediating axon guidance (Table 4), again confirming
that axon guidance and Sma/Mab signaling are two independent
functions mediated by different regions of the UNC-40 protein.
These results also indicated that the interaction between UNC-40
and DRAG-1 is crucial for UNC-40 function in Sma/Mab signaling
in vivo.
The function of DRAG-1 in modulating Sma/Mab
signaling requires DRAG-1–UNC-40 interaction
We next asked whether disrupting the interaction between DRAG1 and UNC-40 also compromises the function of DRAG-1 in
modulating Sma/Mab signaling. Mutations in RGMc (HFE2) cause
juvenile hemochromatosis (JH) (Papanikolaou et al., 2004).
Previous studies on the JH-causing mutations in RGMc showed that
the G320V mutation disrupted the interaction between RGMc and
neogenin (Kuns-Hashimoto et al., 2008). Glycine G320 is
absolutely conserved and corresponds to G272 in DRAG-1
(supplementary material Fig. S2). We made a corresponding G272V
mutation in DRAG-1 and tested its effect on DRAG-1–UNC-40
interaction via the co-IP assay and on DRAG-1 function in vivo
using the transgenic rescue assay. DRAG-1G272V exhibited a greatly
reduced ability to interact with the FN5,6 fragment of UNC-40
(Fig. 5A,B), and it failed to function in vivo (Table 5), even though
it is expressed at similar levels to a wild-type drag-1 transgene
(Fig. 5C). These results indicated that, as for UNC-40, DRAG1–UNC-40 interaction is crucial for DRAG-1 function in Sma/Mab
signaling.
Taken together, our findings suggested that DRAG-1 and UNC40 are likely to function together to promote Sma/Mab signaling.
Consistent with this, genetic epistasis analysis between unc-40 and
drag-1 showed that, regarding body size regulation, DRAG-1 and
UNC-40 have largely overlapping functions. drag-1(jj4) unc40(e1430) double mutants are only slightly smaller than either drag1(jj4) or unc-40(e1430) single mutants (Fig. 2B), which does not
appear to be a result of either additive or synergistic effects of the
two mutations.
DRAG-1 interacts with both the ligand and
receptors of the Sma/Mab pathway
RGM proteins are known to bind the ligand as well as both the
type I and type II receptors of the BMP pathway (Babitt et al.,
Development
***P<0.0001. Purple squares, Immunoglobin domains (IGs); blue ovals, fibronectin type III domains (FNs); double black lines, transmembrane domain (TM); white ovals,
P1, P2, P3 motifs; red cross, domain(s) deleted. The mouse Neo1 (shaded purple) and DCC (shaded yellow) constructs are described in Materials and methods and
supplementary material Table S1.
N.A., not applicable; N.D., not determined.
Development 140 (19)
4076 RESEARCH ARTICLE
Fig. 4. The E-F loop in FN6 of UNC-40 is crucial for interaction with DRAG-1 and for UNC-40 function in Sma/Mab signaling. (A) Crystal structure
of human neogenin FN5 and FN6 domains [PDB ID: 3P4L (Yang et al., 2011)] in ribbon (left) and surface view (right) as presented by Chimera software
(Pettersen et al., 2004), with the C-C⬘ loop (yellow), C⬘ strand (purple) and E-F loop (red) highlighted. (B) Alignment of the FN6 domains of C. elegans
UNC-40 and its vertebrate and nematode homologs. Conserved residues are in blue. Small red boxes highlight the divergent residues between human
neogenin and other vertebrate neogenins. Small green boxes highlight the divergent residues between C. elegans UNC-40 and UNC-40 from other
nematode species. (C) Co-immunoprecipitation (co-IP) between DRAG-1-FLAG and Myc-tagged FN5,6, or Myc-tagged FN5,6 with the C-C⬘ loop, C⬘
strand or E-F loop mutated.
2005; Samad et al., 2005; Babitt et al., 2006). Thus, we tested
whether DRAG-1 can bind to the ligand and receptors of the
Sma/Mab pathway. For co-IP assays we expressed all the factors
in HEK293T cells. As a control, the ligand DBL-1 interacts with
the type I receptor SMA-6 but not the type II receptor DAF-4
(Fig. 5E), consistent with previous findings that BMP2 and BMP4,
the closest homologs of DBL-1, have a higher affinity to type I
receptors than to type II receptors (Allendorph et al., 2006). Like
its vertebrate homologs, DRAG-1 also interacts with the ligand
DBL-1, the type I receptor SMA-6, and the type II receptor DAF4 (Fig. 5D,E).
The interaction between DRAG-1 and DBL-1 also appears to
be important for DRAG-1 function in vivo. A G68V mutation in
DRAG-1, which corresponds to G99V in human RGMc, which
disrupts RGMc-BMP interaction (Kuns-Hashimoto et al., 2008),
significantly affected the function of DRAG-1, as the drag-1G68V
transgene only partially rescued the small body size and
SOSMLP phenotypes of drag-1(jj4) mutants (Fig. 5A, Table 5).
A drag-1 transgene containing a D127E mutation, drag-1D127E,
rescued the small body size and SOSMLP phenotypes of drag-
1(jj4) mutants, just like the wild-type drag-1 transgene (Fig. 5A,
Table 5). D127E in DRAG-1 corresponds to D172E in human
RGMc, which disrupts the intramolecular cleavage of RGMc
(Kuns-Hashimoto et al., 2008). Thus, DRAG-1 might not
undergo autocleavage in C. elegans, or this cleavage is not crucial
for DRAG-1 function.
Evolutionarily conserved functions of RGM/DRAG1 and neogenin/UNC-40 in modulating BMP
signaling
The similarities in function between DRAG-1 and vertebrate RGMs
and between UNC-40 and neogenin prompted us to examine
whether vertebrate neogenin and RGMs can substitute for the
functions of DRAG-1 and UNC-40, respectively, in C. elegans.
Directly expressing the mouse Rgmb cDNA under the control of the
drag-1 promoter failed to rescue the drag-1(jj4) mutant phenotypes
(data not shown). However, hybrid transgenes with the DRAG-1
mature protein sequence replaced by those of mouse RGMb (mouse
Rgmb-drag-1) or human RGMc (human Rgmc-drag-1), when
driven by the drag-1 promoter, could partially rescue the small body
unc-40 alleles
Transgenes
Unc
Egl (%)
AVM migration defect (%)
Relative body length
SOSMLP (%)
WT
unc-40(e1430)
unc-40(e1430)
unc-40(e1430)
unc-40(e1430)
unc-40(e1430)
None
None
unc-40 WT
unc-40 C-C′
unc-40 C′
unc-40 E-F
1 (n>100)
3.0 (n=54)
2.3 (n=101)
1.2 (n=111)
1.3 (n=114)
1.3 (n=103)
0 (n>100)
33.3 (n=54)
25.7 (n=101)
22.1 (n=104)
18.3 (n=104)
25.2 (n=103)
0 (n>100)
25.4 (n=51)
14.5 (n=117)
18.8 (n=106)
15.7 (n=108)
16.7 (n=114)
1.16±0.06*** (n=27)
1.00±0.04 (n=50)
1.12±0.05*** (n=51)
1.13±0.05*** (n=51)
1.11±0.06*** (n=54)
1.01±0.05 (n=43)
N.A.
88.7 (n=150)
1.8 (n=57)
0 (n=108)
3.9 (n=158)
81.8 (n=143)
***P<0.0001.
Development
Table 4. Rescue of axon guidance defects (Unc, Egl and AVM migration) and Sma/Mab signaling defects (body size and SOSMLP)
of unc-40(e1430) mutants by various unc-40 transgenes
UNC-40/neogenin in BMP signaling
RESEARCH ARTICLE 4077
enhanced BMP2-stimulated phosphorylation of Smad1/5/8 to a
similar extent (Fig. 6A,B). Second, we transfected Neo and
NeoΔICD into primary fibroblast cells derived from neogenin
hypomorphic mutant mice (Zhou et al., 2010) and determined their
ability to rescue the defective expression of a BMP signaling
reporter (9XSBE-Luc) upon BMP2 stimulation. Both Neo and
NeoΔICD restored the BMP2-stimulated expression of the BMP
signaling reporter to a similar extent (Fig. 6C). These results
demonstrate that, like C. elegans UNC-40, the ICD of mouse
neogenin is not required for proper BMP signaling.
Fig. 5. DRAG-1 mediation of Sma/Mab signaling is most likely
dependent on its physical association with UNC-40. (A) The DRAG-1
protein, illustrating the point mutations tested. See supplementary
material Fig. S2 for details. (B) co-IP between DRAG-1 or DRAG-1G272V and
UNC-40 FN5,6. (C) Western blot on worm lysates from Mos-mediated
single-copy insertion lines carrying the wild-type or mutant drag-1::gfp
transgenes listed in Table 5. DRAG-1::GFP proteins are recognized by antiGFP. Actin is used as a loading control. (D,E) Co-IP between DRAG-1 and
SMA-6 (D), DAF-4 (D) and DBL-1 (E), and between DBL-1 and SMA-6 or
DAF-4 (E). The separated blots on the far right in E are non-abutting lanes
cut from the same film.
size and SOSMLP phenotypes of drag-1(jj4) mutants (Table 5).
Similarly, a hybrid transgene with the signal sequence of mouse
neogenin (Neo1) replaced by that of UNC-40 could partially rescue
the small body size and SOSMLP phenotypes of unc-40(e1430)
mutants (Table 3B). By contrast, a similar hybrid transgene
containing mouse DCC failed to rescue the small body size and
SOSMLP phenotypes of unc-40(e1430) mutants (Table 3B). These
results suggest that DRAG-1 and UNC-40 and their corresponding
vertebrate counterparts share evolutionarily conserved functions in
modulating BMP signaling.
Mouse neogenin does not require its intracellular
domain to promote BMP signaling
We have described that the EXD of UNC-40 is sufficient to mediate
Sma/Mab signaling in C. elegans. Because of the functional
conservation between UNC-40 and mouse neogenin, we next tested
whether mouse neogenin requires its ICD to promote BMP
signaling using two independent assays. First, we expressed fulllength neogenin (Neo) or neogenin with the ICD deleted
(NeoΔICD) in HEK293 cells and determined their effect on BMP2stimulated phosphorylation of Smad1/5/8. Both Neo and NeoΔICD
DISCUSSION
UNC-40/neogenin positively modulates BMP
signaling
As a close homolog of DCC, neogenin was initially recognized as
an axon guidance receptor that is required for axon and cell
migration (Cole et al., 2007; Wilson and Key, 2007; Yamashita et
al., 2007). Recent reports suggest that neogenin is also involved in
modulating BMP signaling, but how it does so has been
controversial (Tian and Liu, 2013). On the one hand, neogenin
positively potentiates BMP signaling to regulate the expression of
hepcidin for body iron metabolism and endochondral ossification in
mice (Lee et al., 2010; Zhou et al., 2010) or human liver cells
(Zhang et al., 2009). On the other hand, neogenin negatively
modulates BMP2-induced osteoblastic differentiation of C2C12
cells (Hagihara et al., 2011). Neogenin also increases the secretion
of soluble RGMc, which may cause downregulation of BMP
signaling (Zhang et al., 2005; Zhang et al., 2007).
Our findings clearly demonstrate that the sole DCC/neogenin
homolog UNC-40 is a positive modulator of the BMP-like
Sma/Mab pathway in C. elegans: (1) unc-40(0) mutants share
similar body size and SOSMLP phenotypes with those of Sma/Mab
pathway loss-of-function mutants; (2) unc-40(0) mutants exhibit
reduced activity of the Sma/Mab reporter, RAD-SMAD; and (3)
unc-40 acts in the Sma/Mab pathway to regulate body size, as
indicated by the genetic epistasis analysis. We further showed that
UNC-40 functions at the ligand-receptor level in the signalreceiving cells to modulate Sma/Mab signaling. Because mouse
neogenin can partially rescue the Sma/Mab pathway phenotypes of
unc-40(0) mutants, we suggest that, like its function in axon
guidance and cell migration, the function of UNC-40 in modulating
BMP signaling is also evolutionarily conserved.
UNC-40 independently mediates BMP signaling
and netrin signaling
DCC is well established as a receptor for netrin in axon guidance
and migration (Kennedy et al., 1994; Colavita and Culotti, 1998;
Hong et al., 1999; Qin et al., 2007). Unlike DCC, which does not
bind RGM proteins, neogenin can bind to both netrin and RGM
Genotype
Relative body length
SOSMLP (%)
WT
drag-1(jj4)
drag-1(jj4) + drag-1 cDNA
drag-1(jj4) + mouse Rgmb cDNA
drag-1(jj4) + human Rgmc cDNA
drag-1(jj4) + Mos-SCI drag-1::gfp
drag-1(jj4) + Mos-SCI drag-1(G68V)::gfp
drag-1(jj4) + Mos-SCI drag-1(D127E)::gfp
drag-1(jj4) + Mos-SCI drag-1(G272V)::gfp
1.18±0.05*** (n=48)
1.00±0.05 (n=50)
1.10±0.06*** (n=25)
1.04±0.04*** (n=34)
1.03±0.04*** (n=72)
1.17±0.04*** (n=96)
1.02±0.04* (n=47)
1.04±0.04*** (n=76)
1.01±0.04 (n=98)
N.A.
98.5 (n=201)
82.1 (n=106)
85.4 (n=82)
76.6 (n=143)
1.2 (n=498)
79.3 (n=554)
0.8 (n=515)
94.9 (n=414)
Body length was normalized to that of drag-1(jj4) mutants. Data are mean ± s.d. ***P<0.0001, *P<0.05, drag-1(jj4) versus worms of different genotypes (Student’s t-test).
Development
Table 5. Body size and SOSMLP phenotypes of drag-1(jj4) mutants expressing various transgenes
4078 RESEARCH ARTICLE
Development 140 (19)
Fig. 6. Mouse neogenin lacking the intracellular domain is sufficient to mediate BMP signaling. (A) Western blot showing BMP2-induced
pSmad1/5/8 in HEK293 cells expressing neogenin and neogeninΔICD. (B) Quantitative analysis of data from A. The levels of phosphorylation of
Smad1/5/8 were quantified by ImageJ and normalized with the control. Data are mean ± s.d., n=3; *P<0.05 versus control (Student’s t-test). (C) Rescue of
defective BMP reporter expression by both neogenin and neogeninΔICD. Wild-type and neogenin mutant fibroblasts were transiently transfected with
vector (control), neogenin, or neogeninΔICD plus the BMP signaling reporter plasmid (9XSBE-Luc). Two days after transfection, cells were stimulated
with BMP2 (see Materials and methods). Luciferase activity was measured, normalized to the control without BMP2, and presented as mean ± s.d. of
triplicates from a representative experiment. *P<0.05 versus the absence of BMP2 stimulation (Student’s t-test).
pathway and the BMP pathway, neogenin independently mediates
these two pathways via distinct effectors. Although the ICD is
clearly required for UNC-40/neogenin to mediate netrin signaling in
axon guidance, it is dispensable for the role of UNC-40/neogenin in
mediating BMP signaling. Consistently, the netrin-binding motif
and the RGM-binding motif have been mapped to two independent
regions of neogenin (Rajagopalan et al., 2004).
Our finding that the EXD of UNC-40 is sufficient to mediate
BMP signaling suggests the intriguing possibility that UNC-40
might undergo proteolytic processing in vivo to release its EXD. In
fact, both DCC and neogenin have previously been reported to
undergo metalloprotease-mediated ectodomain shedding (Galko
and Tessier-Lavigne, 2000; Okamura et al., 2011). Whether UNC40 undergoes ectodomain shedding, and, if so, how this process is
regulated spatially and temporally will be areas of future
investigation.
A model for UNC-40/neogenin function in
regulating BMP signaling
Results from our in vitro and in vivo experiments demonstrated that
the EXD of UNC-40 binds to DRAG-1 and that this interaction is
crucial for their function in Sma/Mab signaling. Moreover, both
Fig. 7. A model of UNC-40 function in promoting BMP
signaling. By interacting with DRAG-1 through its FN6 motif
and through interactions with other, as yet unidentified, factors
(???), UNC-40 allows an increased local concentration or stability
of the ligand-receptor complex on the surface of the signalreceiving cell, thereby promoting Sma/Mab signaling. UNC-40
protein might be processed via ‘ectodomain shedding’. The
intracellular domain (ICD) of UNC-40 is depicted in dotted
outline, as it is not required for Sma/Mab signaling. UNC-40
might also function in the signal-producing cells, which is not
depicted here.
Development
proteins, and it has netrin-dependent roles in axon guidance, cellcell adhesion and tissue organization (Srinivasan et al., 2003; Kang
et al., 2004; Wilson and Key, 2006; Lejmi et al., 2008) and functions
in BMP signaling (Zhang et al., 2009; Zhou et al., 2010). We have
shown that, in addition to its previously reported roles in netrinmediated axon guidance and cell migration, the single C. elegans
DCC/neogenin homolog UNC-40 is capable of promoting BMP
signaling by binding to the RGM protein DRAG-1. Importantly,
these two functions of UNC-40 are independent of each other: (1)
null mutations in genes that encode UNC-6/netrin and another netrin
receptor, UNC-5, do not cause any defects in Sma/Mab signaling;
(2) UNC-40 protein lacking the ICD is defective in netrin-mediated
axon guidance and cell migration, but exhibits wild-type activity in
Sma/Mab signaling; and (3) UNC-40 proteins lacking the sixth
FNIII motif (FN6), or carrying mutations in the E-F loop of FN6,
are defective in Sma/Mab signaling, but exhibit wild-type activity
in netrin-mediated axon guidance and migration. Importantly, the
role of UNC-40 in promoting Sma/Mab signaling requires its
interaction with the RGM protein DRAG-1, which on its own does
not appear to play any significant role in axon guidance and cell
migration (our unpublished data). These findings suggest that, rather
than acting as a convergent point between the netrin-mediated
proteins function in cis in the same signal-receiving cells to promote
BMP signaling (Tian et al., 2010) (this study). Because DRAG-1
binds to both the ligand and the receptors of the Sma/Mab pathway,
we propose that the binding of UNC-40 to DRAG-1 might allow an
increased local concentration or stability of the ligand/receptor
complex, thereby promoting Sma/Mab signaling (Fig. 7). This is
consistent with a model proposed by Zhou and colleagues in which
neogenin positively modulates BMP signaling by promoting the
formation of BMP-induced super-receptor complexes that include
RGMs, neogenin and BMP receptors in membrane microdomains
(Zhou et al., 2010).
DRAG-1, however, does not appear to be the only factor that
interacts with UNC-40 to mediate its function in Sma/Mab
signaling: (1) cell fractionation experiments showed that the EXD
of UNC-40 is membrane associated and that this association is
independent of DRAG-1 (data not shown); and (2) two additional
unc-40 alleles – ev546, which carries a G774R mutation in the FN4
motif (Alexander et al., 2010), and tm5504, which deletes the FN1
and FN2 motifs, exhibit incompletely penetrant SOSMLP
phenotypes [12.16% (n=74) for ev546 and 39.5% (n=215) for
tm5504]. These FNIII motifs might be required for UNC-40 to
interact with other components of the BMP pathway. Consistently,
neogenin has been shown to directly bind to BMP ligand (Hagihara
et al., 2011) but not BMP receptors (Zhou et al., 2010).
Future work will be directed towards identifying the other
factors that interact with UNC-40 and how they function together
to allow efficient BMP signaling. In light of the importance of the
BMP pathway in regulating multiple developmental and
homeostatic processes and the fact that mutations in RGMc cause
JH, results from these studies are likely to have significant
implications.
Acknowledgements
We thank the Caenorhabditis Genetics Center (CGC) (funded by the National
Institutes of Health, Office of Research Infrastructure Programs P40
OD010440), Daniel Colon-Ramos, Joe Culotti, Eric Jorgensen, Keith Nehrke,
Shohei Mitani, Peter Roy, Tarek Samad, Kang Shen, Stephen Strittmatter,
William Wadsworth and Yimin Zou for strains and plasmids; Joe Culotti for
sharing unpublished results; and Ken Kemphues, Mariana Wolfner and
members of the J.L. lab for comments and suggestions.
Funding
This work was supported by grants from the National Institutes of Health [NIH
GM066953 to J.L.; and NIH NS06648 to W.-C.X.] and from the Department of
Veterans Affairs [VA BX00838 to W.-C.X.]. Deposited in PMC for release after
12 months.
Competing interests statement
The authors declare no competing financial interests.
Author contributions
C.T., H.S. and J.L. performed the experiments; S.X. performed the experiments
presented in Fig. 6 under the supervision of W.-C.X.; F.H. provided reagents
and contributed to discussion of the data; C.T. and J.L. conceived the project,
designed the experiments, analyzed the data and wrote the manuscript.
Supplementary material
Supplementary material available online at
http://dev.biologists.org/lookup/suppl/doi:10.1242/dev.099838/-/DC1
References
Alexander, M., Chan, K. K., Byrne, A. B., Selman, G., Lee, T., Ono, J., Wong, E.,
Puckrin, R., Dixon, S. J. and Roy, P. J. (2009). An UNC-40 pathway directs
postsynaptic membrane extension in Caenorhabditis elegans. Development
136, 911-922.
Alexander, M., Selman, G., Seetharaman, A., Chan, K. K., D’Souza, S. A.,
Byrne, A. B. and Roy, P. J. (2010). MADD-2, a homolog of the Opitz syndrome
protein MID1, regulates guidance to the midline through UNC-40 in
Caenorhabditis elegans. Dev. Cell 18, 961-972.
RESEARCH ARTICLE 4079
Allendorph, G. P., Vale, W. W. and Choe, S. (2006). Structure of the ternary
signaling complex of a TGF-beta superfamily member. Proc. Natl. Acad. Sci. USA
103, 7643-7648.
Amin, N. M., Hu, K., Pruyne, D., Terzic, D., Bretscher, A. and Liu, J. (2007). A
Zn-finger/FH2-domain containing protein, FOZI-1, acts redundantly with
CeMyoD to specify striated body wall muscle fates in the Caenorhabditis
elegans postembryonic mesoderm. Development 1, 19-29.
Babitt, J. L., Zhang, Y., Samad, T. A., Xia, Y., Tang, J., Campagna, J. A.,
Schneyer, A. L., Woolf, C. J. and Lin, H. Y. (2005). Repulsive guidance
molecule (RGMa), a DRAGON homologue, is a bone morphogenetic protein
co-receptor. J. Biol. Chem. 280, 29820-29827.
Babitt, J. L., Huang, F. W., Wrighting, D. M., Xia, Y., Sidis, Y., Samad, T. A.,
Campagna, J. A., Chung, R. T., Schneyer, A. L., Woolf, C. J. et al. (2006).
Bone morphogenetic protein signaling by hemojuvelin regulates hepcidin
expression. Nat. Genet. 38, 531-539.
Balemans, W. and Van Hul, W. (2002). Extracellular regulation of BMP signaling
in vertebrates: a cocktail of modulators. Dev. Biol. 250, 231-250.
Blelloch, R., Newman, C. and Kimble, J. (1999). Control of cell migration during
Caenorhabditis elegans development. Curr. Opin. Cell Biol. 11, 608-613.
Cai, J., Pardali, E., Sánchez-Duffhues, G. and ten Dijke, P. (2012). BMP
signaling in vascular diseases. FEBS Lett. 586, 1993-2002.
Chan, S. S., Zheng, H., Su, M. W., Wilk, R., Killeen, M. T., Hedgecock, E. M.
and Culotti, J. G. (1996). UNC-40, a C. elegans homolog of DCC (Deleted in
Colorectal Cancer), is required in motile cells responding to UNC-6 netrin cues.
Cell 87, 187-195.
Clark, S. G. and Chiu, C. (2003). C. elegans ZAG-1, a Zn-finger-homeodomain
protein, regulates axonal development and neuronal differentiation.
Development 130, 3781-3794.
Colavita, A. and Culotti, J. G. (1998). Suppressors of ectopic UNC-5 growth
cone steering identify eight genes involved in axon guidance in
Caenorhabditis elegans. Dev. Biol. 194, 72-85.
Cole, S. J., Bradford, D. and Cooper, H. M. (2007). Neogenin: a multi-functional
receptor regulating diverse developmental processes. Int. J. Biochem. Cell Biol.
39, 1569-1575.
Colón-Ramos, D. A., Margeta, M. A. and Shen, K. (2007). Glia promote local
synaptogenesis through UNC-6 (netrin) signaling in C. elegans. Science 318,
103-106.
Corradini, E., Babitt, J. L. and Lin, H. Y. (2009). The RGM/DRAGON family of
BMP co-receptors. Cytokine Growth Factor Rev. 20, 389-398.
Culotti, J. G. and Merz, D. C. (1998). DCC and netrins. Curr. Opin. Cell Biol. 10,
609-613.
Estevez, M., Attisano, L., Wrana, J. L., Albert, P. S., Massagué, J. and Riddle,
D. L. (1993). The daf-4 gene encodes a bone morphogenetic protein receptor
controlling C. elegans dauer larva development. Nature 365, 644-649.
Fire, A., Xu, S., Montgomery, M. K., Kostas, S. A., Driver, S. E. and Mello, C. C.
(1998). Potent and specific genetic interference by double-stranded RNA in
Caenorhabditis elegans. Nature 391, 806-811.
Foehr, M. L., Lindy, A. S., Fairbank, R. C., Amin, N. M., Xu, M., Yanowitz, J.,
Fire, A. Z. and Liu, J. (2006). An antagonistic role for the C. elegans Schnurri
homolog SMA-9 in modulating TGFbeta signaling during mesodermal
patterning. Development 133, 2887-2896.
Frøkjaer-Jensen, C., Davis, M. W., Hopkins, C. E., Newman, B. J., Thummel, J.
M., Olesen, S. P., Grunnet, M. and Jorgensen, E. M. (2008). Single-copy
insertion of transgenes in Caenorhabditis elegans. Nat. Genet. 40, 1375-1383.
Galko, M. J. and Tessier-Lavigne, M. (2000). Function of an axonal
chemoattractant modulated by metalloprotease activity. Science 289, 13651367.
Gilleard, J. S., Shafi, Y., Barry, J. D. and McGhee, J. D. (1999). ELT-3: A
Caenorhabditis elegans GATA factor expressed in the embryonic epidermis
during morphogenesis. Dev. Biol. 208, 265-280.
Gordon, K. J. and Blobe, G. C. (2008). Role of transforming growth factor-beta
superfamily signaling pathways in human disease. Biochim. Biophys. Acta 1782,
197-228.
Gumienny, T. L., MacNeil, L. T., Wang, H., de Bono, M., Wrana, J. L. and
Padgett, R. W. (2007). Glypican LON-2 is a conserved negative regulator of
BMP-like signaling in Caenorhabditis elegans. Curr. Biol. 17, 159-164.
Hagihara, M., Endo, M., Hata, K., Higuchi, C., Takaoka, K., Yoshikawa, H. and
Yamashita, T. (2011). Neogenin, a receptor for bone morphogenetic proteins.
J. Biol. Chem. 286, 5157-5165.
Harfe, B. D., Vaz Gomes, A., Kenyon, C., Liu, J., Krause, M. and Fire, A. (1998).
Analysis of a Caenorhabditis elegans Twist homolog identifies conserved and
divergent aspects of mesodermal patterning. Genes Dev. 12, 2623-2635.
Hedgecock, E. M., Culotti, J. G. and Hall, D. H. (1990). The unc-5, unc-6, and
unc-40 genes guide circumferential migrations of pioneer axons and
mesodermal cells on the epidermis in C. elegans. Neuron 4, 61-85.
Hong, K., Hinck, L., Nishiyama, M., Poo, M. M., Tessier-Lavigne, M. and
Stein, E. (1999). A ligand-gated association between cytoplasmic domains of
UNC5 and DCC family receptors converts netrin-induced growth cone
attraction to repulsion. Cell 97, 927-941.
Development
UNC-40/neogenin in BMP signaling
Huang, F., and Chen, Y.G. (2012). Regulation of TGF-beta receptor activity. Cell.
Biosci. 9-3701-2-9.
Jiang, Y., Horner, V. and Liu, J. (2005). The HMX homeodomain protein MLS-2
regulates cleavage orientation, cell proliferation and cell fate specification in
the C. elegans postembryonic mesoderm. Development 132, 4119-4130.
Kang, J. S., Yi, M. J., Zhang, W., Feinleib, J. L., Cole, F. and Krauss, R. S. (2004).
Netrins and neogenin promote myotube formation. J. Cell Biol. 167, 493-504.
Keino-Masu, K., Masu, M., Hinck, L., Leonardo, E. D., Chan, S. S., Culotti, J. G.
and Tessier-Lavigne, M. (1996). Deleted in Colorectal Cancer (DCC) encodes
a netrin receptor. Cell 87, 175-185.
Kennedy, T. E., Serafini, T., de la Torre, J. R. and Tessier-Lavigne, M. (1994).
Netrins are diffusible chemotropic factors for commissural axons in the
embryonic spinal cord. Cell 78, 425-435.
Kramer, J. M. and Johnson, J. J. (1993). Analysis of mutations in the sqt-1 and
rol-6 collagen genes of Caenorhabditis elegans. Genetics 135, 1035-1045.
Krishna, S., Maduzia, L. L. and Padgett, R. W. (1999). Specificity of TGFbeta
signaling is conferred by distinct type I receptors and their associated SMAD
proteins in Caenorhabditis elegans. Development 126, 251-260.
Kuns-Hashimoto, R., Kuninger, D., Nili, M. and Rotwein, P. (2008). Selective
binding of RGMc/hemojuvelin, a key protein in systemic iron metabolism, to
BMP-2 and neogenin. Am. J. Physiol. 294, C994-C1003.
Lanzara, C., Roetto, A., Daraio, F., Rivard, S., Ficarella, R., Simard, H., Cox, T.
M., Cazzola, M., Piperno, A., Gimenez-Roqueplo, A. P. et al. (2004).
Spectrum of hemojuvelin gene mutations in 1q-linked juvenile
hemochromatosis. Blood 103, 4317-4321.
Lee, D. H., Zhou, L. J., Zhou, Z., Xie, J. X., Jung, J. U., Liu, Y., Xi, C. X., Mei, L.
and Xiong, W. C. (2010). Neogenin inhibits HJV secretion and regulates
BMP-induced hepcidin expression and iron homeostasis. Blood 115, 31363145.
Lejmi, E., Leconte, L., Pédron-Mazoyer, S., Ropert, S., Raoul, W., Lavalette,
S., Bouras, I., Feron, J. G., Maitre-Boube, M., Assayag, F. et al. (2008).
Netrin-4 inhibits angiogenesis via binding to neogenin and recruitment of
Unc5B. Proc. Natl. Acad. Sci. USA 105, 12491-12496.
Maduro, M. and Pilgrim, D. (1995). Identification and cloning of unc-119, a
gene expressed in the Caenorhabditis elegans nervous system. Genetics 141,
977-988.
Maduzia, L. L., Gumienny, T. L., Zimmerman, C. M., Wang, H., Shetgiri, P.,
Krishna, S., Roberts, A. F. and Padgett, R. W. (2002). lon-1 regulates
Caenorhabditis elegans body size downstream of the dbl-1 TGF beta signaling
pathway. Dev. Biol. 246, 418-428.
Massagué, J. (2008). TGFbeta in Cancer. Cell 134, 215-230.
Morita, K., Chow, K. L. and Ueno, N. (1999). Regulation of body length and
male tail ray pattern formation of Caenorhabditis elegans by a member of
TGF-beta family. Development 126, 1337-1347.
Morita, K., Flemming, A. J., Sugihara, Y., Mochii, M., Suzuki, Y., Yoshida, S.,
Wood, W. B., Kohara, Y., Leroi, A. M. and Ueno, N. (2002). A Caenorhabditis
elegans TGF-beta, DBL-1, controls the expression of LON-1, a PR-related
protein, that regulates polyploidization and body length. EMBO J. 21, 10631073.
Okamura, Y., Kohmura, E. and Yamashita, T. (2011). TACE cleaves neogenin to
desensitize cortical neurons to the repulsive guidance molecule. Neurosci. Res.
71, 63-70.
Papanikolaou, G., Samuels, M. E., Ludwig, E. H., MacDonald, M. L.,
Franchini, P. L., Dubé, M. P., Andres, L., MacFarlane, J., Sakellaropoulos,
N., Politou, M. et al. (2004). Mutations in HFE2 cause iron overload in
chromosome 1q-linked juvenile hemochromatosis. Nat. Genet. 36, 77-82.
Pettersen, E. F., Goddard, T. D., Huang, C. C., Couch, G. S., Greenblatt, D. M.,
Meng, E. C. and Ferrin, T. E. (2004). UCSF Chimera – a visualization system for
exploratory research and analysis. J. Comput. Chem. 25, 1605-1612.
Qin, S., Yu, L., Gao, Y., Zhou, R. and Zhang, C. (2007). Characterization of the
receptors for axon guidance factor netrin-4 and identification of the binding
domains. Mol. Cell. Neurosci. 34, 243-250.
Quinn, C. C. and Wadsworth, W. G. (2008). Axon guidance: asymmetric
signaling orients polarized outgrowth. Trends Cell Biol. 18, 597-603.
Rajagopalan, S., Deitinghoff, L., Davis, D., Conrad, S., Skutella, T., Chedotal,
A., Mueller, B. K. and Strittmatter, S. M. (2004). Neogenin mediates the
action of repulsive guidance molecule. Nat. Cell Biol. 6, 756-762.
Ramel, M. C. and Hill, C. S. (2012). Spatial regulation of BMP activity. FEBS Lett.
586, 1929-1941.
Development 140 (19)
Samad, T. A., Rebbapragada, A., Bell, E., Zhang, Y., Sidis, Y., Jeong, S. J.,
Campagna, J. A., Perusini, S., Fabrizio, D. A., Schneyer, A. L. et al. (2005).
DRAGON, a bone morphogenetic protein co-receptor. J. Biol. Chem. 280,
14122-14129.
Savage, C., Das, P., Finelli, A. L., Townsend, S. R., Sun, C. Y., Baird, S. E. and
Padgett, R. W. (1996). Caenorhabditis elegans genes sma-2, sma-3, and sma-4
define a conserved family of transforming growth factor beta pathway
components. Proc. Natl. Acad. Sci. USA 93, 790-794.
Savage-Dunn, C. (2005). TGF-beta signaling. WormBook
doi:10.1895.wormbook.1.22.1.
Severyn, C. J., Shinde, U. and Rotwein, P. (2009). Molecular biology, genetics
and biochemistry of the repulsive guidance molecule family. Biochem. J. 422,
393-403.
Shi, Y. and Massagué, J. (2003). Mechanisms of TGF-beta signaling from cell
membrane to the nucleus. Cell 113, 685-700.
Srinivasan, K., Strickland, P., Valdes, A., Shin, G. C. and Hinck, L. (2003).
Netrin-1/neogenin interaction stabilizes multipotent progenitor cap cells
during mammary gland morphogenesis. Dev. Cell 4, 371-382.
Suzuki, Y., Yandell, M. D., Roy, P. J., Krishna, S., Savage-Dunn, C., Ross, R. M.,
Padgett, R. W. and Wood, W. B. (1999). A BMP homolog acts as a dosedependent regulator of body size and male tail patterning in Caenorhabditis
elegans. Development 126, 241-250.
Teichmann, H. M. and Shen, K. (2011). UNC-6 and UNC-40 promote dendritic
growth through PAR-4 in Caenorhabditis elegans neurons. Nat. Neurosci. 14,
165-172.
Tian, C. and Liu, J. (2013). Repulsive guidance molecules (RGMs) and neogenin
in bone morphogenetic protein (BMP) signaling. Mol. Rep. Dev. 9999, 1-18.
Tian, C., Sen, D., Shi, H., Foehr, M. L., Plavskin, Y., Vatamaniuk, O. K. and Liu,
J. (2010). The RGM protein DRAG-1 positively regulates a BMP-like signaling
pathway in Caenorhabditis elegans. Development 137, 2375-2384.
Umulis, D., O’Connor, M. B. and Blair, S. S. (2009). The extracellular regulation
of bone morphogenetic protein signaling. Development 136, 3715-3728.
Wadsworth, W. G., Bhatt, H. and Hedgecock, E. M. (1996). Neuroglia and
pioneer neurons express UNC-6 to provide global and local netrin cues for
guiding migrations in C. elegans. Neuron 16, 35-46.
Wang, J., Tokarz, R. and Savage-Dunn, C. (2002). The expression of TGFbeta
signal transducers in the hypodermis regulates body size in C. elegans.
Development 129, 4989-4998.
Wilson, N. H. and Key, B. (2006). Neogenin interacts with RGMa and netrin-1 to
guide axons within the embryonic vertebrate forebrain. Dev. Biol. 296, 485-498.
Wilson, N. H. and Key, B. (2007). Neogenin: one receptor, many functions. Int. J.
Biochem. Cell Biol. 39, 874-878.
Wu, M. Y. and Hill, C. S. (2009). Tgf-beta superfamily signaling in embryonic
development and homeostasis. Dev. Cell 16, 329-343.
Yamashita, T., Mueller, B. K. and Hata, K. (2007). Neogenin and repulsive
guidance molecule signaling in the central nervous system. Curr. Opin.
Neurobiol. 17, 29-34.
Yang, F., West, A. P., Jr, Allendorph, G. P., Choe, S. and Bjorkman, P. J. (2008).
Neogenin interacts with hemojuvelin through its two membrane-proximal
fibronectin type III domains. Biochemistry 47, 4237-4245.
Yang, F., West, A. P., Jr and Bjorkman, P. J. (2011). Crystal structure of a
hemojuvelin-binding fragment of neogenin at 1.8Å. J. Struct. Biol. 174, 239244.
Yoshida, S., Morita, K., Mochii, M. and Ueno, N. (2001). Hypodermal
expression of Caenorhabditis elegans TGF-beta type I receptor SMA-6 is
essential for the growth and maintenance of body length. Dev. Biol. 240, 32-45.
Zhang, A. S., West, A. P., Jr, Wyman, A. E., Bjorkman, P. J. and Enns, C. A.
(2005). Interaction of hemojuvelin with neogenin results in iron accumulation
in human embryonic kidney 293 cells. J. Biol. Chem. 280, 33885-33894.
Zhang, A. S., Anderson, S. A., Meyers, K. R., Hernandez, C., Eisenstein, R. S.
and Enns, C. A. (2007). Evidence that inhibition of hemojuvelin shedding in
response to iron is mediated through neogenin. J. Biol. Chem. 282, 1254712556.
Zhang, A. S., Yang, F., Wang, J., Tsukamoto, H. and Enns, C. A. (2009).
Hemojuvelin-neogenin interaction is required for bone morphogenic protein4-induced hepcidin expression. J. Biol. Chem. 284, 22580-22589.
Zhou, Z., Xie, J., Lee, D., Liu, Y., Jung, J., Zhou, L., Xiong, S., Mei, L. and
Xiong, W. C. (2010). Neogenin regulation of BMP-induced canonical Smad
signaling and endochondral bone formation. Dev. Cell 19, 90-102.
Development
4080 RESEARCH ARTICLE