1476 RESEARCH ARTICLE
Development 139, 1476-1486 (2012) doi:10.1242/dev.079608
© 2012. Published by The Company of Biologists Ltd
Xenopus Nanos1 is required to prevent endoderm gene
expression and apoptosis in primordial germ cells
Fangfang Lai1,2, Amar Singh3 and Mary Lou King1,*
SUMMARY
Nanos is expressed in multipotent cells, stem cells and primordial germ cells (PGCs) of organisms as diverse as jellyfish and
humans. It functions together with Pumilio to translationally repress targeted mRNAs. Here we show by loss-of-function
experiments that Xenopus Nanos1 is required to preserve PGC fate. Morpholino knockdown of maternal Nanos1 resulted in a
striking decrease in PGCs and a loss of germ cells from the gonads. Lineage tracing and TUNEL staining reveal that Nanos1deficient PGCs fail to migrate out of the endoderm. They appear to undergo apoptosis rather than convert to normal endoderm.
Whereas normal PGCs do not become transcriptionally active until neurula, Nanos1-depleted PGCs prematurely exhibit a
hyperphosphorylated RNA polymerase II C-terminal domain at the midblastula transition. Furthermore, they inappropriately
express somatic genes characteristic of endoderm regulated by maternal VegT, including Xsox17, Bix4, Mixer, GATA4 and Edd.
We further demonstrate that Pumilio specifically binds VegT RNA in vitro and represses, along with Nanos1, VegT translation
within PGCs. Repressed VegT RNA in wild-type PGCs is significantly less stable than VegT in Nanos1-depleted PGCs. Our data
indicate that maternal VegT RNA is an authentic target of Nanos1/Pumilio translational repression. We propose that Nanos1
functions to translationally repress RNAs that normally specify endoderm and promote apoptosis, thus preserving the germline.
INTRODUCTION
A persistent question in developmental biology is how germ cell
fate, with its characteristics of totipotency and immortality, is
preserved in the context of somatic cell differentiation. In Xenopus,
the germline is specified through the inheritance of germ plasm
formed during oogenesis and asymmetrically segregated into the
future germ cell lineage. At least three important activities appear
to be required in primordial germ cells (PGCs) to protect them
from a somatic fate: (1) repression of extant maternal messages
encoding somatic determinants; (2) activation of sequestered
maternal germline mRNAs; and (3) transient genome-wide
suppression of mRNA transcription to ensure that somatic
differentiation programs remain inactive when zygotic transcription
is initiated in the rest of the embryo. Genetic studies have identified
the conserved protein Nanos as being important in the first and last
of these activities, although the molecular pathways in which it
functions are largely uncharacterized.
nanos encodes an RNA-binding protein with two CCHC zinc
fingers that are evolutionarily conserved among all family
members in organisms as diverse as sponge and humans (Curtis et
al., 1997; Lai et al., 2011). Most recently, the structure of the zincfinger region has been solved and shown to be required for RNA
binding (Hashimoto et al., 2010). Together with Pumilio, Nanos is
part of a translational repression complex in which Pumilio
provides the RNA binding specificity and Nanos the repressive
activity (Jaruzelska et al., 2003; Lai et al., 2011; Sonoda and
1
Department of Cell Biology and 2Department of Biochemistry and Molecular
Biology, University of Miami School of Medicine, 1011 NW 15th St, Miami, FL
33136, USA. 3Department of Biochemistry and Molecular Biology, The University of
Georgia, 500 D.W. Brooks Drive, Athens, GA 30602, USA.
*Author for correspondence ([email protected])
Accepted 15 February 2012
Wharton, 1999; Sonoda and Wharton, 2001). Xenopus Pumilio can
physically interact with Nanos1, as shown by in vitro pull-down
assays, but evidence for direct interaction in vivo is lacking
(Nakahata et al., 2001).
Loss of Nanos from Caenorhabditis elegans, Drosophila,
zebrafish and mouse embryos results in multifaceted phenotypes
including precocious cell divisions, ectopic expression of somatic
genes, abnormal germ cell migration, and eventual loss of PGCs
through apoptosis (Forbes and Lehmann, 1998; Kobayashi et al.,
1996; Köprunner et al., 2001; Sato et al., 2007; Tsuda et al., 2003).
PGCs are normally transcriptionally repressed at times when
somatic cells are initially expressing their gene program
(Deshpande et al., 1999; Deshpande et al., 2005; Venkatarama et
al., 2010). In Drosophila and C. elegans, loss of Nanos results in
prematurely active transcription and the failure to establish
germline-specific histone modifications typical of transcriptionally
inactive chromatin (Schaner et al., 2003). Further, premature gene
activation results in the misexpression of the somatic genes Sexlethal, fushi tarazu and even skipped in the germline and,
subsequently, cell death (Deshpande et al., 1999; Sato et al., 2007).
However, the role of Nanos in transcriptional repression within the
germline is unknown.
Key to understanding the molecular mechanisms underlying
Nanos function in the germline is the identification and validation
of the targeted mRNAs that are repressed. Pumilio binds the RNA
target through a 3⬘UTR Pumilio binding element (PBE):
UGUAAAUA (Wharton et al., 1998). Surprisingly, although
general screens for the relevant mRNAs have been carried out with
Nanos (Fox et al., 2005; Suzuki et al., 2010; Suzuki and Saga,
2008), only five authentic RNA targets of Nanos repression have
been identified: (1) the cell cycle regulator cyclin B1, a target in
frogs and flies (Asaoka-Taguchi et al., 1999; Dalby and Glover,
1993; Kadyrova et al., 2007; Lai et al., 2011); (2) the Drosophila
promoter of apoptosis hid/skl (Hayashi et al., 2004; Sato et al.,
2007); (3,4) the somatic determinants hunchback (Murata and
DEVELOPMENT
KEY WORDS: Xenopus, PGCs, Nanos/Xcat2, VegT, Germline determination, Endoderm, Translational repression
Nanos1 preserves germline fate
MATERIALS AND METHODS
Xenopus embryos, MO injections and PGC isolation
Adult Xenopus laevis were purchased from Nasco. Embryos were
generated as described (Sive et al., 2000). Twenty nanograms of Nanos1MO or Nanos1-Ctrl-MO was injected into one-cell embryos. The nanos1mut RNA (0.4 ng) used in the rescue experiments contained three
mismatches within the MO complementary region and was not recognized
by Nanos1-MO. MO sequences (Gene Tools) are: Nanos1-MO,
CGCCATCCATGTTGGAATTGTTCTG; Nanos1-Ctrl-MO, CGCCATCgATcTTGcAAaTcTTCTG, with the five mismatches in lower case. PGCs
were isolated as described (Venkatarama et al., 2010).
Immunofluorescence microscopy
Immunofluorescence microscopy was performed as described (Lai et al.,
2011). Primary antibodies were: affinity purified goat anti-Nanos1 antibody
made against total recombinant expressed Nanos1 protein (Invitrogen),
1:50; rabbit anti-Xiwi [a gift from Dr Nelson Lau (Lau et al., 2009)],
1:1000; and H5 monoclonal antibody (Covance, #MMS-129R), 1:50.
Secondary antibodies (Invitrogen) were: Alexa Fluor 488 donkey antirabbit IgG (H+L), 1:500; Alexa Fluor 555 donkey anti-goat IgG (H+L),
1:500; Alexa Fluor 488 donkey anti-mouse IgG (H+L), 1:1000; and Alexa
Fluor 568 donkey anti-rabbit IgG (H+L), 1:1000.
Whole-mount in situ hybridization (WISH) and histology
WISH was performed as described (Houston et al., 1998). The Xpat
plasmid was linearized using NotI and the DsRED plasmid was linearized
by BamHI. The digoxigenin-labeled antisense probes were transcribed by
T7 RNA polymerase (Promega). PGCs were stained using BM Purple
(Roche). Histology was performed as described (Houston and King, 2000).
Reverse transcription PCR (RT-PCR)
PGC isolation, RNA extraction and RT-PCR were performed as described
(Venkatarama et al., 2010) using 38 cycles with the following gene primers
and annealing temperatures: ODC at 53°C (Xanthos et al., 2001); Xsox17
at 56°C (Hudson et al., 1997); Xpat at 56°C (Hudson and Woodland,
1998); Bix4 at 56°C (Xanthos et al., 2001); Xbra at 56°C (Wilson and
Melton, 1994); Mixer at 55°C (Henry and Melton, 1998); GATA4/5/6 at
56°C (Xanthos et al., 2001); Endodermin (Edd) at 56°C (Xanthos et al.,
2001); Cerberus at 60°C (Darras et al., 1997); Xhex at 60°C (Chang and
Hemmati-Brivanlou, 2000); Chordin at 55°C (Zhang et al., 1998); Oct91
at 56°C; and Xwnt11 at 56°C.
Xenopus Pumilio1 RNA-binding domain (Xpum1 RBD) expression
and purification
The Xpum1 RBD (amino acids 825-1175) was cloned into pET28a vector
(Novagen) and the plasmid transformed into E. coli BL21 (DE3). Protein
expression was induced by 1 mM IPTG for 4-5 hours. The cells were
collected by centrifugation (2300 g) and the cell pellet was resuspended in
1⫻ binding buffer (included in the His-Protein Purification Kit, Novagen)
and sonicated on ice. After centrifugation, the supernatant was loaded onto
the prepared His-bind resin column according to the manufacturer’s
instructions. After several washes, the protein was eluted in 500 l elute
buffer containing 200-300 mM imidazole.
Non-radioactive RNA electrophoresis mobility shift assay (EMSA)
VegT 3⬘UTR fragment (112 nt, 2468-2579) containing the PBE was cloned
into pCR4-TOPO vector (Invitrogen) to produce TOPO-VegT PBE. The
PBE mutant (UAAAAAAA) was introduced by mutagenesis (QuikChange
II site-directed mutagenesis kit, Stratagene), generating TOPO-VegT PBE
mut. The RNA was transcribed using T7 RNA polymerase (Promega),
biotinylated at the 3⬘end (Thermo Scientific, 20160), and EMSA performed
using the LightShift chemiluminescent RNA EMSA kit (Thermo Scientific)
according to the manufacturer’s instructions.
In vivo reporter assay
Plasmid pCS2+Venus-DEADSouth 3⬘UTR was a gift from Dr Hidefumi Orii
(Kataoka et al., 2006). The red reporter DsRED-DS3⬘UTR was generated by
replacing Venus with the DsRED open reading frame. VegT 3⬘UTR (296 nt,
2336-2631) containing the PBE (UGUAAAUA) was subcloned downstream
of the DsRED open reading frame to produce DsRED-VegT PBE-DS3⬘UTR
(In-Fusion HD EcoDry Cloning System, Clontech). DsRED-VegT PBEDS3⬘UTR mutant was made by changing 3 nt within the PBE site (mutant
PBE, UAAAAAAA) using the QuikChange II site-directed mutagenesis kit.
Nanos1-MO was injected into one-cell stage embryos at the vegetal pole.
At approximately the 32-cell stage, fluorescent reporters were injected at 100
pg/cell into the germ plasm residing in the ‘dark area’ of four vegetal
blastomeres of control or Nanos1-depleted embryos (see Fig. 6B) (Ikenishi
and Nakazato, 1986). Images were collected from live embryos at about
stage 35 using a fluorescence stereomicroscope (Olympus SZX12).
Quantitative real-time PCR (qRT-PCR) and data analysis
PGCs from wild-type (WT) and Nanos1-depleted (Nanos1-MO) embryos
were isolated as described (Venkatarama et al., 2010). RNA extraction and
reverse transcription were performed as described (Lai et al., 2011). Realtime PCR was performed for 40 cycles using SsoAdvanced SYBR Green
Supermix (#172-5260, Bio-Rad) in the CFX96 system (Bio-Rad). Primer
sequences (5⬘-3⬘) and annealing temperatures were: VegT forward
AGAAACTGCTGTCGGGAA and reverse CGGATCTTACACTGAGGA,
53°C; GAPDH forward CTCCTCTCGCAAAGGTCATC and reverse
GGAAAGCCATTCCGGTTATT, 53°C. Primer specificity was monitored
by analyzing melting curves. All samples were analyzed in duplicate and
experiments were repeated three times.
The threshold cycles (CT) were determined by CFX Manager software
(Bio-Rad). VegT expression was normalized to the expression of
housekeeping gene GAPDH by ⌬CTCT (VegT)–CT(GAPDH). The relative
fold change was calculated as 2–⌬⌬CT, where ⌬⌬CT⌬CT (Nanos1MO)–⌬CT (WT). The statistical difference was determined by an unpaired
Student’s t-test.
Whole-mount fluorescent in situ hybridization followed by TUNEL
assay
Whole-mount fluorescent in situ hybridization (FISH) was performed
exactly as described (Lai et al., 2011). The TUNEL assay protocol was
taken from Henry and Gautier (Henry and Gautier, 1997) with a slight
modification: after whole-mount FISH, embryos were refixed in 4% PFA
DEVELOPMENT
Wharton, 1995; Wreden et al., 1997) and bicoid (Wharton and
Struhl, 1991); and (5) C. elegans fem-3, which regulates sex
determination (Ahringer and Kimble, 1991; Zhang et al., 1997).
Xenopus nanos1 RNA is first detected in early staged oocytes,
although it is not translated until after fertilization (Lai et al., 2011;
Luo et al., 2011; Mosquera et al., 1993; Zhou and King, 1996).
nanos1 RNA and protein persist until PGCs leave the endoderm at
late tailbud stages (Lai et al., 2011; Luo et al., 2011; MacArthur et
al., 1999). To determine the function of Nanos1 in Xenopus PGC
development, we used antisense morpholino oligonucleotides (MOs)
to block the translation of nanos1. Nanos1-depleted embryos showed
a dramatic decrease in PGC number and, as expected, a subsequent
loss of germ cells from the gonads. Importantly, the loss of PGCs
could be rescued by injection of a mutated nanos1 RNA that was
unaffected by the MO, demonstrating the specificity of the
knockdown. PGCs without Nanos1 remained in the endoderm and
eventually underwent apoptosis. Zygotic transcription, which is
normally repressed in PGCs until neurula stages, was activated
precociously at the start of gastrulation. Furthermore, PGCs deficient
in Nanos1 inappropriately expressed somatic genes downstream of
VegT that are required for endoderm specification. Pumilio was able
to specifically bind VegT RNA in vitro and repress, along with
Nanos1, VegT translation in PGCs. VegT RNA is significantly more
stable in PGCs lacking Nanos1 than in wild-type PGCs. Our data
point to maternal VegT RNA as an authentic target of
Nanos1/Pumilio translational repression. From these results, we
propose that Nanos1 is required to preserve Xenopus germline
identity by translationally repressing RNAs that normally promote
the endoderm developmental program and apoptosis.
RESEARCH ARTICLE 1477
1478 RESEARCH ARTICLE
Development 139 (8)
in PBST. The TUNEL signal was detected using the TSA system (Cy3
tyramide, NEN Life Science Products) as described (Lai et al., 2011).
Samples were analyzed using an inverted Zeiss LSM-510 laser-scanning
confocal microscope equipped with argon ion, helium-neon and green-neon
lasers. Fluorescein (FITC, Roche)-labeled Xpat antisense probe was
transcribed by T7 RNA polymerase (Ambion, #AM 2082).
-Gal assay
The -Gal assay for lacZ expression was performed as described (Takeuchi
et al., 2010).
RESULTS
Embryos depleted of Nanos1 are deficient in PGCs
To determine the function of Xenopus nanos1 in the germline, we
depleted Nanos1 protein using a morpholino antisense
oligonucleotide (MO) approach. Nanos1-MO blocked the
translation of nanos1 in a dose-dependent fashion as determined in
an in vitro translation assay. Neither a mutant of nanos1 with 5⬘
sequences non-complementary to the MO (nanos1-mut) nor a
control MO with five base changes (Nanos1-Ctrl-MO) had any
effect on nanos1 translation (data not shown). We have previously
shown that during early developmental stages, Nanos1 is found
within germ plasm, colocalizing with the germ plasm marker Xiwi
(Lai et al., 2011; Lau et al., 2009; Wilczynska et al., 2009).
Importantly, whereas Xiwi was readily detected, Nanos1 protein
was not observed in embryos previously injected with Nanos1-MO
(20 ng) after staining with anti-Nanos1 and anti-Xiwi antibodies
(Fig. 1A). By contrast, Nanos1-Ctrl-MO (20 ng)-injected embryos
could not be distinguished from uninjected siblings. No differences
were detected in the external development of embryos injected with
either Nanos1-MO or Nanos1-Ctrl-MO, indicating the lack of
toxicity of the MOs used.
The fate of PGCs in embryos depleted of Nanos1 activity was
followed by whole-mount in situ hybridization (WISH) with
Xpat probe, a specific marker for PGCs (Hudson and Woodland,
1998; Machado et al., 2005). Significant differences in numbers
were detected in the experimental population of PGCs starting at
tailbud stage 26, with a dramatic decline by stage 35/36 (Fig.
1B,C). Xpat expression as detected by RT-PCR was prematurely
lost by stage 30 instead of stage 39 (data not shown). From stage
26 to 39, PGCs actively migrate towards the dorsal aspect of the
gut, from which they will eventually leave the endoderm
(Nishiumi et al., 2005). The loss-of-PGC phenotype was rescued
by co-injection with the nanos1-mut transcript (0.4 ng) in which
three mismatches had been introduced to prevent recognition and
repression by Nanos1-MO (P0.012, one-way ANOVA) (Fig.
1B,C). Thus, our data show that Nanos1-MO acts specifically to
knock down nanos1 gene function. Loss of Nanos1 activity
results in the loss of PGCs at the time when PGCs are normally
at the end of their interlude in the endoderm and not before stage
26.
DEVELOPMENT
Fig. 1. Nanos1-depleted Xenopus embryos are deficient in PGCs.
(A)Nanos1-MO blocks the translation of endogenous nanos1. Confocal
analysis showing the expression of Nanos1 (red) and Xiwi (germ plasm
marker, green) at the eight-cell stage of embryos previously injected
with Nanos1-Ctrl-MO or Nanos1-MO at the one-cell stage. Uninjected
embryos served as controls. Arrows indicate Nanos1 signal.
(B)Knockdown of Nanos1 results in loss of PGCs. WISH Xpat analysis of
stage 37/38 wild-type (WT), Nanos1-Ctrl-MO- and Nanos1-MO-injected
embryos. For the rescue, Nanos1-MO embryos were injected with
nanos1-mut RNA. (C)Summary of PGC loss at different stages after
Nanos1 knockdown. P-values by one-way ANOVA. Error bars indicate
s.e. (D)Hematoxylin and Eosin-stained sections of gonads from WT
(stage 54), Nanos1-Ctrl-MO (stage 55), Nanos1-MO (stage 54) and
rescued (stage 54) embryos, Arrows indicate germ cells. Note that
nanos1 morphants were completely rescued by nanos1-mut RNA
injection. Scale bars: 130m in A; 100m in B; 20m in D.
Nanos1 preserves germline fate
RESEARCH ARTICLE 1479
Fig. 2. Nanos1-depleted PGCs enter
apoptosis. (A)PGCs deficient in Nanos1 are
not apoptotic throughout early development
(stage 18). WISH Xpat (germ plasm marker,
green) and TUNEL staining (red) of WT,
Nanos1-Ctrl-MO- and Nanos1-MO-injected
embryos. Arrows indicate TUNEL-positive cells
in neural ectoderm. (B)TUNEL-positive PGCs
are detected during tailbud stage (stage 28) in
Nanos1-depleted embryos, but not in control
embryos. Arrows indicate TUNEL-positive
PGCs. Confocal images were taken from the
region indicated in the diagram (red box).
Scale bars: 100m in A; 150m in B.
PGCs deficient in Nanos1 activity undergo
apoptosis
Is the PGC loss in nanos1 morphant embryos due to apoptosis or
does it reflect PGC transdifferentiation into normal endoderm?
Embryos injected with Nanos1-Ctrl-MO or Nanos1-MO and
uninjected siblings were subjected to the TUNEL assay. PGCs were
identified by FISH with Xpat and all double-labeled cells were
scored positively for apoptosis. As expected, apoptosis was not
detected at time points before the decline in PGC numbers observed
in the Nanos1-MO embryos (stage 18, n52 PGCs; Fig. 2A). In
early tailbud embryos (stages 26-30), when Nanos1-deficient
embryos showed a 27.2-56.3% decline in PGC numbers, 9.1% of
PGCs were apoptotic (n154 PGCs; Fig. 2B). Control-MO embryos
were indistinguishable from uninjected embryos, with 1.8%
apoptotic PGCs (n340 PGCs). As apoptosis occurs relatively
quickly (reviewed by Majno and Joris, 1995), at any one time we
would expect only a few, and not all, PGCs to be TUNEL positive.
To follow the fate of Nanos1-depleted PGCs later in
development, we used lacZ fused with the 3⬘UTR of
DEADSouth (NLD) as a germline lineage tracer (Takeuchi et al.,
2010). The DEADSouth 3⬘UTR contains germ plasm
localization information that restricts the reporter protein
expression to PGCs. Any RNA remaining in the somatic cells is
degraded, most probably by microRNA activity (Kataoka et al.,
2006; MacArthur et al., 2000). Therefore, the expression of lacZ
is PGC specific. After MOs were injected at the one-cell stage,
the NLD message was injected into the vegetal blastomeres at
the 32-cell stage. Embryos were allowed to develop until stages
46-48, fixed and processed for -Gal staining (Takeuchi et al.,
2010) (Fig. 3A). As expected, control embryos showed lacZpositive cells migrating within the dorsal mesenchyme (Nishiumi
et al., 2005). By contrast, Nanos1-depleted embryos revealed
very few lacZ-positive cells, a phenotype that was rescued by
injection of nanos1-mut (0.4 ng) (P<0.001, one-way ANOVA)
(Fig. 3B,C). A few PGCs were found in the gut tissue in both
control and experimental embryos, but never at other ectopic
locations. Histological examination of rare lacZ-positive cells in
gut tissue revealed round cells that displayed no evidence of
cellular differentiation and that subsequently disappeared from
this tissue (data not shown) (Ikenishi et al., 2007). These data
indicate that Nanos1-deficient PGCs undergo apoptosis and do
not contribute to normal gut tissue. Further, we saw no evidence
of abnormal migration, as occurs in Xdazl or XDead end
morphants (Horvay et al., 2006; Houston and King, 2000), prior
to PGCs becoming apoptotic, arguing that apoptosis is the
primary reason that mutant PGCs do not leave the endoderm.
PGCs deficient in Nanos1 exhibit CTD-PSer2
prematurely
During the period when PGCs are transcriptionally silent, they do
not exhibit the phosphorylated form of serine 2 (PSer2) in the Cterminal domain (CTD) of RNA polymerase II (Pol II), an event
that is highly correlated with transcriptional elongation (Hirose and
Ohkuma, 2007; Venkatarama et al., 2010). However Pol II CTDPSer5 is present in all blastomeres even prior to the midblastula
transition (MBT), signifying that initiation complexes are formed
and machinery poised for transcription (Venkatarama et al., 2010).
We hypothesized that in the absence of Nanos1, Pol II CTD-Ser2
is prematurely phosphorylated at the MBT, permitting possible
misexpression of somatic genes in PGCs, similar to Drosophila
nanos mutants (Deshpande et al., 2005; Venkatarama et al., 2010).
DEVELOPMENT
An alternative explanation to a loss of PGCs is that the
premature loss of Xpat instead reflects its instability in the absence
of Nanos1. To address this concern, we carried out a histological
examination of developing gonads at a time when they are richly
populated by germ cells (Fig. 1D). We observed a significant loss
of germ cells in the Nanos1-deficient tadpoles (n5). The example
shown in Fig. 1D represents the greatest number of germ cells
detected after Nanos1 knockdown (~4-5 oocytes), as compared
with the dense cluster of germ cells found in control tadpoles.
Importantly, the loss of gonadal germ cells was rescued by
introducing a nanos1 mutant message that is not recognized by the
Nanos1-MO. Thus, Xpat is a reliable indicator for loss of PGCs.
Taken together, we conclude that Nanos1 is required to maintain
the PGC lineage.
1480 RESEARCH ARTICLE
Development 139 (8)
Fig. 4. Nanos1-depleted PGCs exhibit CTD-PSer2 prematurely.
(A)Confocal analysis of WT, Nanos1-Ctrl-MO- and Nanos1-MOinjected embryos at stage 11, showing double immunostaining with H5
monoclonal antibody (CTD-PSer2, green) and rabbit anti-Xiwi antibody
(germ plasm, red). Merged images are shown at the top, with separate
channels beneath. Images were taken from the endoderm core (see the
diagram in Fig. 5). Scale bars: 50m. (B)PGCs immunopositive for H5
(which is specific for the CTD-PSer2 epitope) in Nanos1-MO (74%) as
compared with WT (21%) and Nanos1-Ctrl-MO (16%) embryos.
Differences between each group were highly significant by one-way
ANOVA. The experiment was repeated three times.
To assess the phosphorylated state of CTD-Ser2 in PGCs we
performed double immunofluorescence using the H5 monoclonal
antibody, which is specific for the PSer2 epitope, together with the
anti-Xiwi antibody to identify germ plasm. CTD-PSer2 was
detected during early gastrulation in 71% of the PGCs counted in
Nanos1-MO-injected embryos from three independent experiments
(n44/62). By contrast, PGCs in Nanos1-Ctrl-MO-injected and
uninjected WT embryos expressed the PSer2 epitope at
significantly lower frequencies (n11/45, 24% Nanos1-Ctrl-MO;
PGCs deficient in Nanos1 activity express somatic
genes
Previous results showed that the maternal determinant for
endoderm, VegT RNA, is present in PGCs and would, of necessity,
have to be repressed (Venkatarama et al., 2010). Do PGCs depleted
of Nanos1 activity now mistakenly initiate endoderm specification
and thus lose Xpat expression (Machado et al., 2005)? To explore
this possibility, we isolated PGCs from uninjected, Nanos1-CtrlMO- or Nanos1-MO-injected embryos. We asked whether PGCs
now expressed endoderm or mesoderm markers as assessed by
semi-quantitative RT-PCR on isolated PGCs. We choose Xsox17
(Hudson et al., 1997) and Bix4 (Casey et al., 1999) to detect
endoderm as both are direct downstream targets of maternal VegT
and both are required for endoderm fate. The mesoderm marker
Xbra was also assessed to determine whether other fates were
initiated besides endoderm (Smith et al., 1991).
Knockdown of Nanos1 resulted in expression of the endoderm
markers Xsox17 and Bix4, but not of Xbra, in stage 10/11 PGCs
(Fig. 5A). This suggested that PGCs deficient in Nanos1 enter an
endoderm, but not a mesoderm, differentiation program. Further,
Xsox17 and Bix4 were expressed at times comparable to
endoderm expression during gastrulation. As expected, Bix4 was
not detected in the excised endoderm core sample (circled in Fig.
5) as it is expressed during gastrulation within the endomesoderm
just outside the core (Casey et al., 1999). ornithine decarboxylase
DEVELOPMENT
Fig. 3. Nanos1-depleted PGCs fail to migrate from the endoderm.
(A)Experimental design for lineage tracing of PGCs. MOs were injected
at stage 1. Germline lineage tracer NLD mRNA was injected into germ
plasm-containing blastomeres at the 32-cell stage. Embryos were
allowed to develop until stage 46/47 and stained for lacZ expression.
(B)Whole-mount lineage analysis at stage 46/47 showing lacZ-positive
PGCs (blue) in WT, Nanos1-Ctrl-MO- and Nanos1-MO-injected
embryos. PGCs migrating in the dorsal mesenchyme are circled (red).
PGCs were not detected in Nanos1-depleted embryos in this region.
Black arrows indicate wild-type ectopic PGCs in the gut. In the sagittal
paraffin section of a WT embryo stained with Eosin, PGCs are indicated
by blue arrows. Scale bars: 100m. (C)Summary of lineage traced
PGCs in stage 46/47 tadpoles. Ectopic PGCs within the gut occurred in
both control and experimental embryos. Statistical analysis was
performed only for PGCs in the genital ridges (Student’s t-test for twogroup analysis, one-way ANOVA for three-group analysis). Error bars
indicate s.e. for the green bars.
n9/48, 19% WT). One such experiment is shown in Fig. 4. We
conclude that Nanos1 is required to prevent zygotic transcription
in PGCs.
Nanos1 preserves germline fate
RESEARCH ARTICLE 1481
(ODC) served as an internal control. To confirm these RT-PCR
results in vivo, we examined whole embryos by FISH (tyramide)
to detect Xsox17 RNA and identified germ plasm by
immunostaining with anti-Xiwi antibody (Fig. 5B). These
experiments indicated that, in the absence of Nanos1, PGCs
expressed Xsox17 coincident with endoderm specification at
gastrulation.
To better understand which specific differentiation programs are
active in Nanos1-depleted PGCs, we examined gene expression at
a later time point when distinctive germ layer expression patterns
are established. At stage 15 neurula, additional downstream gene
targets of maternal VegT were detected in PGCs, including the
endoderm-specific markers Mixer and Edd (Fig. 5C). GATA4 was
detected, but not GATA5/6, Xhex, Chordin or Cerberus, which are
all expressed in more anterior mesendoderm and involved in
anterior patterning (Bouwmeester et al., 1996; Gove et al., 1997;
Henig et al., 1998; Henry and Melton, 1998; Kelley et al., 1993;
Smithers and Jones, 2002; Tao et al., 2005; Weber et al., 2000;
Xanthos et al., 2001). Xwnt11, an anterior dorsalizing factor that
lies upstream of Xhex activity, was not expressed in Nanos1depleted PGCs. Interestingly, the pluripotent factor Oct91 was
expressed by both endoderm and PGCs regardless of Nanos
activity. The RT-PCR results in Fig. 5C indicate that Nanos1depleted PGCs were differentiating toward posterior gut endoderm
and not other regions. The most likely explanation for our results
is that Nanos1 is required to repress VegT expression in PGCs.
VegT is translationally repressed by
Nanos1/Pumilio in PGCs
A search of the VegT 3⬘UTR revealed a canonical PBE:
UGUAAAUA. As a first step in determining whether
Nanos1/Pumilio could repress VegT translation, we examined
whether the VegT PBE could be recognized and bound by Xenopus
Pumilio. Xenopus Pumilio1 containing the RNA-binding domain
(Xpum1 RBD, amino acids 825-1175) was tested with biotinylated
VegT PBE RNA (112 nt, 2468-2579) in an EMSA. Xpum1 RBD
(20 ng) was able to bind VegT PBE (1 ng) but not the VegT PBE
mutant (1 ng) (Fig. 6A). This binding interaction was competed by
unlabeled VegT PBE RNA (250 ng). We conclude that Pumilio can
specifically bind the VegT PBE in vitro.
To determine whether Nanos1 represses VegT translation in
PGCs, we developed an in vivo fluorescent reporter assay (Fig.
6B). The DEADSouth 3⬘UTR contains germ plasm localization
information as described above. Therefore, Venus-DEADSouth
3⬘UTR (Kataoka et al., 2006) and DsRED-DEADSouth 3⬘UTR
both serve as germline lineage tracers. A 296 nt fragment of the
VegT 3⬘UTR containing the PBE was cloned into DsREDDEADSouth 3⬘UTR, generating DsRED-VegT PBE-DS3⬘UTR.
Three point mutations were introduced into the PBE site
(UGUAAAUA), generating DsRED-VegT PBE mut-DS3⬘UTR
(PBE mut, UAAAAAAA). One point mutation (G2A) in the PBE
site has been shown to result in a 33-fold lower efficiency of
Pumilio binding (Cheong and Hall, 2006). The images shown in
Fig. 6C were taken at stage 34/35 at a time when PGCs have
migrated laterally towards the body surface. The surface location
facilitated detection of the fluorescent signal in live embryos using
a fluorescence stereomicroscope. The results indicate that the VegT
PBE can mediate the repression of DsRED translation in the
germline (93.10% repression, n19 embryos). Importantly, this
repression was not observed in embryos with the PBE mutation
(83.15% expression, n18 embryos), nor in embryos depleted of
Nanos1 (86.58% expression, n26 embryos). These results strongly
suggest that Nanos1 is required to repress VegT translation in PGCs
through the PBE.
DEVELOPMENT
Fig. 5. PGCs deficient in Nanos1 activity express
endoderm-specific genes. (A,C)RT-PCR analysis of PGCs
or endoderm cells isolated from the endoderm core at stage
11 (circled in red, surrounded by endomesoderm in blue) (A)
and stage 15 (C). P, primordial germ cells; E, endoderm; WE,
whole embryo. Xpat is a germ plasm marker, Xsox17 an
endoderm marker, Bix4 an endomesoderm marker and Xbra
a mesoderm marker. ODC provides an internal control. The
asterisk marks endoderm cell contamination. (B)Confocal
analysis of WT, Nanos1-Ctrl-MO- and Nanos1-MO-injected
embryos at stage 11. Xsox17 RNA (red) was detected by
WISH and PGCs (outlined by dashed line) were identified by
Xiwi immunostaining (green). Merged images are shown at
the top, with separate channels beneath. Images were taken
from the endoderm core. Scale bars: 50m.
1482 RESEARCH ARTICLE
Development 139 (8)
Fig. 6. Nanos1 represses VegT
translation in PGCs. (A)RNA EMSA
analysis shows that the Xenopus
Pumilio1 RNA-binding domain
(Xpum1 RBD) can bind biotin-labeled
VegT PBE (1 ng) but not the mutant
VegT PBE. This binding reaction was
competed by unlabeled VegT PBE.
(B)Experimental design for results
shown in C. Venus-DEADSouth 3⬘UTR
and DsRED-DEADSouth 3⬘UTR are
germline lineage tracers. VegT PBE or
its mutant was subcloned downstream
of the DsRED open reading frame.
Nanos1-MO was injected at stage 1.
Germline lineage reporters were
injected into four germ plasmcontaining blastomeres at the 32-cell
stage. Embryos were allowed to
develop until stage 35 and the
fluorescent images were taken from
live embryos. (C)In vivo fluorescent
reporter assay indicates that VegT PBE
mediates translational repression of
DsRED (red) in PGCs (green).
Repression was lost in embryos
bearing a PBE mutation or that were
depleted of Nanos1. Reporters
injected are noted across the top. This
experiment was repeated three times.
Arrows indicate DsRED signal detected
in PGCs. Data from one experiment
are presented beneath the images for
each group. Scale bars: 50m.
DISCUSSION
Nanos1 impacts gene expression at two levels, promoting both
transcriptional and translational repression. Our studies show that
Xenopus Nanos1 is required to prevent PGCs from expressing an
endoderm gene program and undergoing cell death (Fig. 8).
Importantly, our work defines a new target for translational
repression by Nanos1 and Pumilio, the endoderm determinant
VegT. Given that Nanos strictly partitions with the Xenopus
germline (Lai et al., 2011), our results explain how VegT repression
is restricted to PGCs while neighboring blastomeres express VegT
and are specified as endoderm.
PGCs are lost from nanos1 morphants
Knockdown of Nanos1 resulted in a dramatic decrease in PGC
number and the subsequent loss of germ cells from the gonads,
similar to what has been observed in other organisms (Forbes and
Lehmann, 1998; Kobayashi et al., 1996; Köprunner et al., 2001;
Sato et al., 2007; Tsuda et al., 2003). In Nanos1-depleted embryos
of Drosophila, C. elegans, zebrafish, mouse and now Xenopus (this
work), germ cells enter programmed cell death indicating that
Nanos function as an anti-apoptotic factor has been conserved
across species. In Drosophila germ cells, Nanos translationally
DEVELOPMENT
The absence of the DsRED signal in reporters bearing the
PBE could be explained by repression or by targeted DsRED
RNA degradation, or both. WISH with the DsRED antisense
probe revealed that the DsRED-VegT PBE-DS3⬘UTR RNA was
indeed degraded in wild-type PGCs, whereas the reporter lacking
the PBE was unaffected (Fig. 7A). These data suggest that the
VegT PBE and Pumilio binding mediate the translational
repression of DsRED in part by destabilizing the reporter RNA.
To address whether Nanos1 is required for this activity, we
compared the endogenous VegT RNA level in PGCs with and
without Nanos1 knockdown. The qRT-PCR results (Fig. 7B)
indicate that VegT RNA is significantly more stable in Nanos1depleted PGCs than in wild-type PGCs at stage 10 (1.63-fold
increase, P0.03). Importantly, the VegT level was similar in
both wild-type and Nanos1-depleted PGC samples at stage 8,
well after nanos1 is translated (Fig. 7B). We conclude that the
Nanos1-Pumilio complex is required and sufficient to repress
VegT translation in PGCs. Further, the data support repression as
the primary cause and RNA degradation as secondary to
eliminating germline VegT activity. Our findings identify a new
downstream target for Nanos1/Pumilio repression and explain
how PGCs avoid differentiation as endoderm.
Nanos1 preserves germline fate
RESEARCH ARTICLE 1483
Ectopic migration has been observed in Nanos-depleted germ
cells of Drosophila, zebrafish and mice. In zebrafish, migration is
initiated early during gastrulation and nanos is required for PGC
directed active movement (Köprunner et al., 2001). After Nanos1
knockdown, germ cells migrate abnormally to somites and the head
region. However, our data have shown that Xenopus PGCs
deficient in Nanos1 do not migrate to ectopic locations, but remain
in the endoderm. Thus, Nanos1 involvement in Drosophila and
zebrafish PGC migration appears to differ from that in Xenopus.
It is worth noting that not only Nanos1-depleted germ cells
remaining in the endoderm undergo apoptosis, but wild-type PGCs
that failed to migrate do so as well (Ikenishi et al., 2007; Köprunner
et al., 2001). It is likely that a mechanism is in place that triggers
apoptosis in any PGC that ‘veers’ off course from the normal
migration pathway. Such observations contrast with those of Wylie
et al. (Wylie et al., 1985), who found that Xenopus labeled PGCs
placed in the blastocoel were able to incorporate normally into
somatic tissue belonging to any of the three primary germ layers.
Why wild-type PGCs remaining in the endoderm did not adopt an
endoderm fate is not clear.
represses two activators of caspase, head involution defective (hid;
Wrinkled – FlyBase) and sickle (skl), protecting germ cells from
cell death (Sato et al., 2007). In Drosophila, if apoptosis is
prevented by genetic means, PGCs are incorporated into endoderm
and express somatic genes (Hayashi et al., 2004). The few
Drosophila nanos mutant pole cells that migrate into the gonads
fail to develop (Hayashi et al., 2004). In mouse, Nanos3–/– PGCs
die even though the Bax-dependent apoptotic pathway is blocked.
These results suggest that multiple ‘death’ pathways might be
operating in PGCs. Interestingly, somatic gene expression does not
occur in Nanos3–/– PGCs, indicating distinct functions among the
three mouse Nanos genes (Suzuki et al., 2008). Nanos1 might carry
out all these different functions as it is the only Nanos member in
Xenopus. An important question is whether blocking apoptosis in
Xenopus Nanos1-deficient PGCs will cause PGCs to
transdifferentiate into endoderm. Alternatively, will they continue
to migrate into the gonads but fail to generate functional gametes,
as occurs in Drosophila nanos mutants? Our attempts to block
apoptosis in Xenopus were repeatedly unsuccessful, leaving this
question open for future work.
Expression of endoderm genes in nanos1
morphants
The second molecular aberration that we observed in Nanos1deficient PGCs was the expression of the endoderm transcription
factor Xsox17, during gastrulation and well before PGC numbers
declined. The expression of Xsox17 and Bix4 in Nanos1-depleted
PGCs indicated VegT activity on their respective promoters and
that zygotic transcription had indeed occurred prematurely. These
results are entirely consistent with the observed premature CTDPSer2 staining in PGCs. The endoderm-specific markers Mixer and
DEVELOPMENT
Fig. 7. VegT RNA is stabilized in PGCs after Nanos1 knockdown.
(A)VegT PBE mediates the degradation of the reporter message DsRED.
PGCs were detected by either WISH for Xpat (top panels) or for DsRED
antisense probe (bottom panels) in tailbud stage 31 embryos. Note that
the DsRED reporter with a PBE was specifically degraded. Arrows
indicate PGCs. (B)Real-time PCR analysis of VegT expression at stages 8
and 10. Expression of VegT in Nanos1 knockdown samples was
normalized to that of wild-type samples. Real-time PCR was performed
in duplicate, and experiments were repeated three times and showed a
similar pattern. Error bars indicate s.e. P-value by unpaired Student’s
t-test.
Loss of transcriptional repression in nanos1
morphants
In many organisms, including Xenopus, PGCs are protected from
acquiring somatic fates in part by their state of transcriptional
repression while somatic expression programs are initiated
(Batchelder et al., 1999; Hanyu-Nakamura et al., 2008;
Venkatarama et al., 2010; Zhang et al., 2003). A common target for
global transcriptional repression is the kinase Positive transcription
elongation factor b (P-TEFb), which phosphorylates CTD-Ser2
thus initiating transcriptional elongation events. In Drosophila, the
germline protein Pgc physically interacts with P-TEFb and inhibits
its recruitment to transcription sites, resulting in transcriptional
repression. PIE-1 performs a similar function in C. elegans
(Batchelder et al., 1999; Hanyu-Nakamura et al., 2008; Zhang et
al., 2003). The first molecular aberration we observed in Nanos1deficient PGCs was the premature appearance of CTD-PSer2 at the
MBT. Loss of nanos in Drosophila also results in the premature
phosphorylation of CTD-Ser2, but how this is mechanistically
related to Pgc sequestration of P-TEFb function is not known.
Thus, Nanos1 is in some way linked to the suppression of CTDSer2 phosphorylation in both the vertebrate and invertebrate
germlines. Cdk9, which encodes the kinase in P-TEFb, contains a
PBE in its 3⬘UTR, suggesting that it might be a target for
Nanos1/Pumilio translational repression. However, our unpublished
data indicate that CDK9 protein is expressed in the nucleus of wildtype PGCs during gastrulation and thus is unlikely to be the
limiting factor. Further work will be required to establish how
Nanos1 is linked to the repression of CTD-Ser2 phosphorylation
and whether this depends on Nanos1 function as a translational
inhibitor.
1484 RESEARCH ARTICLE
Edd, and GATA4, a potent inducer of endoderm-specific gene
expression, were detected in Nanos1-depleted PGCs (Henry and
Melton, 1998; Kelley et al., 1993; Xanthos et al., 2001).
Interestingly, we found that zygotic expression of Oct91 in PGCs
does not depend on Nanos1 activity (Fig. 5C). Oct91, a homolog
of Oct3/4 (Pou5f1) in mammals, functions as a pluripotent factor
to preserve the uncommitted states of early blastomeres (Cao et al.,
2007; Henig et al., 1998) and the germline (F.L. and M.L.K.,
unpublished) (Venkatarama et al., 2010). It is possible that the
pluripotent program initiated by Oct91 is incompatible with the
misexpressed endoderm program and, as a result, contributes to
triggering apoptosis in nanos1 morphants.
Other genes expressed in more anterior endoderm (GATA5,
Xhex, Cerberus), presumptive mesoderm (GATA6) or prechordal
plate and notochord (Chordin) (Bouwmeester et al., 1996; Gove et
al., 1997; Smithers and Jones, 2002; Weber et al., 2000; Xanthos
et al., 2001) were not detected in Nanos1-deficient PGCs at later
stages. Although we do not know which transcription sites are
active in Nanos1-deficient germ cells, our data are most consistent
with transcription being activated in a targeted, regional manner for
posterior endoderm specification, the location of normal PGC
development. Such inappropriate gene expression would explain
why PGCs did not leave the endoderm and migrate into ectopic
locations as has been noted for nanos mutants in zebrafish and
Drosophila. Importantly, injection of nanos1 RNA completely
rescued this phenotype. We conclude that, in Xenopus, Nanos1 is
required and sufficient to block endoderm gene expression in the
germline.
Nanos1/Pumilio repress VegT translation and
promote its degradation
Our work has identified a novel target for Nanos1/Pumilio
repression in the maternally localized VegT RNA. Nanos/Pumilio
repression has been implicated in blocking or modulating the cell
cycle, apoptosis and meiosis (Ahringer and Kimble, 1991; AsaokaTaguchi et al., 1999; Dalby and Glover, 1993; Hayashi et al., 2004;
Kadyrova et al., 2007; Lai et al., 2011; Sato et al., 2007; Wharton
and Struhl, 1991; Wreden et al., 1997; Zhang et al., 1997), and now
we add the first example of a somatic determinant as a target. In
Xenopus, embryonic patterning is regulated by maternal RNAs
localized to the vegetal pole, the same region where germ plasm is
found. How PGCs arise from the endodermal region, but avoid the
endoderm differentiation programs, is a dilemma not previously
explained in other systems. The strict localization of nanos1 to the
germ plasm, while Pumilio is not regulated, explains how the
repression of VegT translation can occur exclusively in the
germline. By contrast, zebrafish nanos1 is initially expressed
throughout the whole embryo and is gradually restricted to PGCs
by microRNA-mediated degradation of nanos1 RNA in the soma
(Mishima et al., 2006).
Our data further support a role, either direct or indirect, for
Nanos and Pumilio in destabilizing VegT RNA within PGCs. VegT
RNA stability was related to both the presence of Nanos1 and the
VegT PBE in our studies. The absence of Nanos could result
indirectly in stabilization of VegT RNA, as translated RNAs are
protected from degradation by the translation machinery.
Alternatively, Nanos1/Pumilio could play a direct role in recruiting
the CCR4-NOT deadenylation complex, as demonstrated in the
mouse germline (Suzuki et al., 2010). Ultimately, Nanos1/Pumilio
binding leads to message degradation. However, for VegT RNA the
degradation process occurred over several stages of embryogenesis
and begins well after Nanos1 has been synthesized (Luo et al.,
2011). Therefore, we favor the model whereby Nanos1/Pumilio
repression is not primarily based on degradation of VegT RNA.
Taken together, our data indicate that the primary function of
Xenopus Nanos1 is to prevent endoderm differentiation programs
and thus preserve germline totipotent fate (Fig. 8). What role Nanos1
plays in blocking apoptotic pathways and in supporting
transcriptional repression in vertebrate systems remains an active
area of research. Clearly, further functions for Nanos1 in the
germline remain to be discovered. The diverse phenotypes described
for nanos1 mutants underscore the importance of identifying the
RNA targets of Nanos1 repression and of determining the pathways
within which these repressed targets operate during embryogenesis.
Acknowledgements
We thank Drs Nelson Lau for Xiwi antibody, Tohru Komiya for the lacZDEADSouth 3⬘UTR (NLD) construct and Dr Hidefumi Orii for the pCS2+VenusDEADSouth 3⬘UTR construct, whose generosity in sharing reagents and
methods was crucial to the success of our studies. We thank Dr Xueting Luo
for the pCS2+DsRED-DEADSouth 3⬘UTR and pET28a-Xpum1RBD constructs.
Dr Karen Newman provided excellent histology technical support.
Funding
This work was supported by the National Institutes of Health [grant GM33932
to M.L.K.] and by American Cancer Society Florida (ACS-FL) [grant M0701156
to M.L.K. to support A.S.]. Deposited in PMC for release after 12 months.
Competing interests statement
The authors declare no competing financial interests.
References
Ahringer, J. and Kimble, J. (1991). Control of the sperm-oocyte switch in
Caenorhabditis elegans hermaphrodites by the fem-3 3⬘ untranslated region.
Nature 349, 346-348.
Asaoka-Taguchi, M., Yamada, M., Nakamura, A., Hanyu, K. and Kobayashi,
S. (1999). Maternal Pumilio acts together with Nanos in germline development
in Drosophila embryos. Nat. Cell Biol. 1, 431-437.
Batchelder, C., Dunn, M. A., Choy, B., Suh, Y., Cassie, C., Shim, E. Y., Shin, T.
H., Mello, C., Seydoux, G. and Blackwell, T. K. (1999). Transcriptional
repression by the Caenorhabditis elegans germ-line protein PIE-1. Genes Dev.
13, 202-212.
Bouwmeester, T., Kim, S., Sasai, Y., Lu, B. and De Robertis, E. M. (1996).
Cerberus is a head-inducing secreted factor expressed in the anterior endoderm
of Spemann’s organizer. Nature 382, 595-601.
Cao, Y., Siegel, D., Donow, C., Knöchel, S., Yuan, L. and Knöchel, W. (2007).
POU-V factors antagonize maternal VegT activity and beta-Catenin signaling in
Xenopus embryos. EMBO J. 26, 2942-2954.
Casey, E. S., Tada, M., Fairclough, L., Wylie, C. C., Heasman, J. and Smith, J.
C. (1999). Bix4 is activated directly by VegT and mediates endoderm formation
in Xenopus development. Development 126, 4193-4200.
DEVELOPMENT
Fig. 8. Model for Nanos1 function in Xenopus PGCs. Xenopus
Nanos1 preserves the germline fate through multiple functions:
preventing endoderm gene expression by repressing VegT translation,
blocking RNA Pol II transcription at MBT, and inhibiting apoptosis.
PUM, Pumilio.
Development 139 (8)
Chang, C. and Hemmati-Brivanlou, A. (2000). A post-mid-blastula transition
requirement for TGFbeta signaling in early endodermal specification. Mech. Dev.
90, 227-235.
Cheong, C. G. and Hall, T. M. (2006). Engineering RNA sequence specificity of
Pumilio repeats. Proc. Natl. Acad. Sci. USA 103, 13635-13639.
Curtis, D., Treiber, D. K., Tao, F., Zamore, P. D., Williamson, J. R. and
Lehmann, R. (1997). A CCHC metal-binding domain in Nanos is essential for
translational regulation. EMBO J. 4, 834-843.
Dalby, B. and Glover, D. M. (1993). Discrete sequence elements control posterior
pole accumulation and translational repression of maternal cyclin B RNA in
Drosophila. EMBO J. 12, 1219-1227.
Darras, S., Marikawa, Y., Elinson, R. P. and Lemaire, P. (1997). Animal and
vegetal pole cells of early Xenopus embryos respond differently to maternal
dorsal determinants: implications for the patterning of the organiser.
Development 124, 4275-4286.
Deshpande, G., Calhoun, G., Yanowitz, J. L. and Schedl, P. D. (1999). Novel
functions of Nanos in downregulating mitosis and transcription during the
development of the Drosophila germline. Cell 99, 271-281.
Deshpande, G., Calhoun, G., Jinks, T. M., Polydorides, A. D. and Schedl, P.
(2005). Nanos downregulates transcription and modulates CTD phosphorylation
in the soma of early Drosophila embryos. Mech. Dev. 122, 645-657.
Forbes, A. and Lehmann, R. (1998). Nanos and Pumilio have critical roles in the
development and function of Drosophila germline stem cells. Development 125,
679-690.
Fox, M., Urano, J. and Reijo Pera, R. A. (2005). Identification and
characterization of RNA sequences to which human PUMILIO-2 (PUM2) and
Deleted in azoospermia-like (DAZL) bind. Genomics 85, 92-105.
Gove, C., Walmsley, M., Nijjar, S., Bertwistle, D., Guille, M., Partington, G.,
Bomford, A. and Patient, R. (1997). Over-expression of GATA-6 in Xenopus
embryos blocks differentiation of heart precursors. EMBO J. 16, 355-368.
Hanyu-Nakamura, K., Sonobe-Nojima, H., Tanigawa, A., Lasko, P. and
Nakamura, A. (2008). Drosophila Pgc protein inhibits P-TEFb recruitment to
chromatin in primordial germ cells. Nature 451, 730-733.
Hashimoto, H., Hara, K., Hishiki, A., Kawaguchi, S., Shichijo, N., Nakamura,
K., Unzai, S., Tamaru, Y., Shimizu, T. and Sato, M. (2010). Crystal structure
of zinc-finger domain of Nanos and its functional implications. EMBO Rep. 11,
848-853.
Hayashi, Y., Hayashi, M. and Kobayashi, S. (2004). Nanos suppresses somatic
cell fate in Drosophila germ line. Proc. Natl. Acad. Sci. USA 101, 10338-10342.
Henig, C., Elias, S. and Frank, D. (1998). A POU protein regulates mesodermal
competence to FGF in Xenopus. Mech. Dev. 71, 131-142.
Henry, C. and Gautier, J. (1997). A developmental timer that regulates apoptosis
at the onset of gastrulation. Mech. Dev. 69, 183-195.
Henry, G. L. and Melton, D. A. (1998). Mixer, a homeobox gene required for
endoderm development. Science 281, 91-96.
Hirose, Y. and Ohkuma, Y. (2007). Phosphorylation of the C-terminal domain of
RNA polymerase II plays central roles in the integrated events of eukaryotic gene
expression. J. Biochem. 141, 601-608.
Horvay, K., Claussen, M., Katzer, M., Landgrebe, J. and Pieler, T. (2006).
Xenopus Dead End mRNA is a localized maternal determinant that serves a
conserved function in germ cell development. Dev. Biol. 291, 1-11.
Houston, D. W. and King, M. L. (2000). A critical role for Xdazl, a germ plasmlocalized RNA, in the differentiation of primordial germ cells in Xenopus.
Development 127, 447-456.
Houston, D. W., Zhang, J., Maines, J. Z., Wasserman, S. A. and King, M. L.
(1998). A Xenopus DAZ-like gene encodes an RNA component of germ plasm
and is a functional homologue of Drosophila Boule. Development 125, 171-180.
Hudson, C. and Woodland, H. R. (1998). Xpat, a gene expressed specifically in
germ plasm and primordial germ cells of Xenopus laevis. Mech. Dev. 73, 159168.
Hudson, C., Clements, D., Friday, R. V., Stott, D. and Woodland, H. R. (1997).
Xsox17alpha and -beta mediate endoderm formation in Xenopus. Cell 91, 397405.
Ikenishi, K. and Nakazato, S. (1986). A natural marker for blastomeres of the
germ line in cleavage stage Xenopus embryos. Dev. Biol. 113, 259-262.
Ikenishi, K., Ohno, T. and Komiya, T. (2007). Ectopic germline cells in embryos
of Xenopus laevis. Dev. Growth Differ. 49, 561-570.
Jaruzelska, J., Kotecki, M., Kusz, K., Spik, A., Firpo, M. and Reijo Pera, R. A.
(2003). Conservation of a Pumilio-Nanos complex from Drosophila germ plasm
to human germ cells. Dev. Genes Evol. 213, 120-126.
Kadyrova, L. Y., Habara, Y., Lee, T. H. and Wharton, R. P. (2007). Translational
control of maternal Cyclin B mRNA by Nanos in the Drosophila germline.
Development 134, 1519-1527.
Kataoka, K., Yamaguchi, T., Orii, H., Tazaki, A., Watanabe, K. and Mochii, M.
(2006). Visualization of the Xenopus primordial germ cells using a green
fluorescent protein controlled by cis elements of the 3⬘ untranslated region of
the DEADSouth gene. Mech. Dev. 123, 746-760.
Kelley, C., Blumberg, H., Zon, L. I. and Evans, T. (1993). GATA-4 is a novel
transcription factor expressed in endocardium of the developing heart.
Development 118, 817-827.
RESEARCH ARTICLE 1485
Kobayashi, S., Yamada, M., Asaoka, M. and Kitamura, T. (1996). Essential role
of the posterior morphogen nanos for germline development in Drosophila.
Nature 380, 708-711.
Köprunner, M., Thisse, C., Thisse, B. and Raz, E. (2001). A zebrafish nanosrelated gene is essential for development of primordial germ cells. Genes Dev.
15, 2877-2885.
Lai, F., Zhou, Y., Luo, X., Fox, J. and King, M. L. (2011). Nanos1 functions as a
translational repressor in the Xenopus germline. Mech. Dev. 128, 153-163.
Lau, N. C., Ohsumi, T., Borowsky, M., Kingston, R. E. and Blower, M. D.
(2009). Systematic and single cell analysis of Xenopus Piwi-interacting RNAs and
Xiwi. EMBO J. 28, 2945-2958.
Luo, X., Nerlick, S., An, W. and King, M. L. (2011). Xenopus germline nanos1 is
translationally repressed by a novel structure based mechanism. Development
138, 589-598.
MacArthur, H., Bubunenko, M., Houston, D. W. and King, M. L. (1999). Xcat2
RNA is a translationally sequestered germ plasm component in Xenopus. Mech.
Dev. 84, 75-88.
MacArthur, H., Houston, D. W., Bubunenko, M., Mosquera, L. and King, M.
L. (2000). DEADSouth is a germ plasm specific DEAD-box RNA helicase in
Xenopus related to eIF4A. Mech. Dev. 95, 291-295.
Machado, R. J., Moore, W., Hames, R., Houliston, E., Chang, P., King, M. L.
and Woodland, H. R. (2005). Xenopus Xpat protein is a major component of
germ plasm and may function in its organisation and positioning. Dev. Biol. 287,
289-300.
Majno, G. and Joris, I. (1995). Apoptosis, oncosis, and necrosis. An overview of
cell death. Am. J. Pathol. 146, 3-15.
Mishima, Y., Giraldez, A. J., Takeda, Y., Fujiwara, T., Sakamoto, H., Schier, A.
F. and Inoue, K. (2006). Differential regulation of germline mRNAs in soma and
germ cells by zebrafish miR-430. Curr. Biol. 16, 2135-2142.
Mosquera, L., Forristall, C., Zhou, Y. and King, M. L. (1993). A mRNA localized
to the vegetal cortex of Xenopus oocytes encodes a protein with a nanos-like
zinc finger domain. Development 117, 377-386.
Murata, Y. and Wharton, R. P. (1995). Binding of pumilio to maternal hunchback
mRNA is required for posterior patterning in Drosophila embryos. Cell 80, 747756.
Nakahata, S., Katsu, Y., Mita, K., Inoue, K., Nagahama, Y. and Yamashita, M.
(2001). Biochemical identification of Xenopus Pumilio as a sequence-specific
Cyclin B1 mRNA-binding protein that physically interacts with a Nanos homolog,
Xcat-2, and a cytoplasmic polyadenylation element-binding protein. J. Biol.
Chem. 276, 20945-20953.
Nishiumi, F., Komiya, T. and Ikenishi, K. (2005). The mode and molecular
mechanisms of the migration of presumptive PGC in the endoderm cell mass of
Xenopus embryos. Dev. Growth Differ. 47, 37-48.
Sato, K., Hayashi, Y., Ninomiya, Y., Shigenobu, S., Arita, K., Mukai, M. and
Kobayashi, S. (2007). Maternal Nanos represses hid/skl-dependent apoptosis to
maintain the germ line in Drosophila embryos. Proc. Natl. Acad. Sci. USA 104,
7455-7460.
Schaner, C. E., Deshpande, G., Schedl, P. D. and Kelly, W. G. (2003). A
conserved chromatin architecture marks and maintains the restricted germ cell
lineage in worms and flies. Dev. Cell 5, 747-757.
Sive, H., Grainger, R. and Harland, R. (2000). Early Development of Xenopus
laevis: A Laboratory Manual. Cold Spring Harbor, New York: Cold Spring Harbor
Laboratory Press.
Smith, J. C., Price, B. M., Green, J. B., Weigel, D. and Herrmann, B. G. (1991).
Expression of a Xenopus homolog of Brachyury (T) is an immediate-early
response to mesoderm induction. Cell 67, 79-87.
Smithers, L. E. and Jones, C. M. (2002). Xhex-expressing endodermal tissues are
essential for anterior patterning in Xenopus. Mech. Dev. 119, 191-200.
Sonoda, J. and Wharton, R. P. (1999). Recruitment of Nanos to Hunchback
mRNA by Pumilio. Genes Dev. 13, 2704-2712.
Sonoda, J. and Wharton, R. P. (2001). Drosophila Brain tumor is a translational
repressor. Genes Dev. 15, 762-773.
Suzuki, A. and Saga, Y. (2008). Nanos2 suppresses meiosis and promotes male
germ cell differentiation. Genes Dev. 22, 430-435.
Suzuki, A., Igarashi, K., Aisaki, K., Kanno, J. and Saga, Y. (2010). NANOS2
interacts with the CCR4-NOT deadenylation complex and leads to suppression
of specific RNAs. Proc. Natl. Acad. Sci. USA 107, 3594-3599.
Suzuki, H., Tsuda, M., Kiso, M. and Saga, Y. (2008). Nanos3 maintains the germ
cell lineage in the mouse by suppressing both Bax-dependent and -independent
apoptotic pathways. Dev. Biol. 318, 133-142.
Takeuchi, T., Tanigawa, Y., Minamide, R., Ikenishi, K. and Komiya, T. (2010).
Analysis of SDF-1/CXCR4 signaling in primordial germ cell migration and survival
or differentiation in Xenopus laevis. Mech. Dev. 127, 146-158.
Tao, Q., Yokota, C., Puck, H., Kofron, M., Birsoy, B., Yan, D., Asashima, M.,
Wylie, C. C., Lin, X. and Heasman, J. (2005). Maternal wnt11 activates the
canonical wnt signaling pathway required for axis formation in Xenopus
embryos. Cell 120, 857-871.
Tsuda, M., Sasaoka, Y., Kiso, M., Abe, K., Haraguchi, S., Kobayashi, S. and
Saga, Y. (2003). Conserved role of nanos proteins in germ cell development.
Science 301, 1239-1241.
DEVELOPMENT
Nanos1 preserves germline fate
Venkatarama, T., Lai, F., Luo, X., Zhou, Y., Newman, K. and King, M. L.
(2010). Repression of zygotic gene expression in the Xenopus germline.
Development 137, 651-660.
Weber, H., Symes, C. E., Walmsley, M. E., Rodaway, A. R. and Patient, R. K.
(2000). A role for GATA5 in Xenopus endoderm specification. Development
127, 4345-4360.
Wharton, R. P. and Struhl, G. (1991). RNA regulatory elements mediate control of
Drosophila body pattern by the posterior morphogen Nanos. Cell 67, 955-967.
Wharton, R. P., Sonoda, J., Lee, T., Patterson, M. and Murata, Y. (1998). The
Pumilio RNA-binding domain is also a translational regulator. Mol. Cell 1, 863-872.
Wilczynska, A., Minshall, N., Armisen, J., Miska, E. A. and Standart, N.
(2009). Two Piwi proteins, Xiwi and Xili, are expressed in the Xenopus female
germline. RNA 15, 337-345.
Wilson, P. A. and Melton, D. A. (1994). Mesodermal patterning by an inducer
gradient depends on secondary cell-cell communication. Curr. Biol. 4, 676-686.
Wreden, C., Verrotti, A. C., Schisa, J. A., Lieberfarb, M. E. and Strickland, S.
(1997). Nanos and Pumilio establish embryonic polarity in Drosophila by
promoting posterior deadenylation of Hunchback mRNA. Development 124,
3015-3023.
Development 139 (8)
Wylie, C. C., Heasman, J., Snape, A., O’Driscoll, M. and Holwill, S. (1985).
Primordial germ cells of Xenopus laevis are not irreversibly determined early in
development. Dev. Biol. 112, 66-72.
Xanthos, J. B., Kofron, M., Wylie, C. and Heasman, J. (2001). Maternal VegT is
the Initiator of a molecular network specifying endoderm in Xenopus laevis.
Development 128, 167-180.
Zhang, B., Gallegos, M., Puoti, A., Durkin, E., Fields, S., Kimble, J. and
Wickens, M. P. (1997). A conserved RNA-binding protein that regulates sexual
fates in the C. elegans hermaphrodite germ line. Nature 390, 477-484.
Zhang, F., Barboric, M., Blackwell, T. K. and Peterlin, B. M. (2003). A model of
repression: CTD analogs and PIE-1 inhibit transcriptional elongation by P-TEFb.
Genes Dev. 17, 748-758.
Zhang, J., Houston, D. W., King, M. L., Payne, C., Wylie, C. and Heasman, J.
(1998). The role of maternal VegT in establishing the primary germ layers in
Xenopus embryos. Cell 94, 515-524.
Zhou, Y. and King, M. L. (1996). Localization of Xcat-2 RNA, a putative germ
plasm component, to the mitochondrial cloud in Xenopus stage I oocytes.
Development 122, 2947-2953.
DEVELOPMENT
1486 RESEARCH ARTICLE