DEVELOPMENT AND STEM CELLS
RESEARCH ARTICLE 1045
Development 138, 1045-1055 (2011) doi:10.1242/dev.056671
© 2011. Published by The Company of Biologists Ltd
EGF signaling regulates the proliferation of intestinal stem
cells in Drosophila
Benoît Biteau and Heinrich Jasper*
SUMMARY
Precise control of somatic stem cell proliferation is crucial to ensure maintenance of tissue homeostasis in high-turnover tissues. In
Drosophila, intestinal stem cells (ISCs) are essential for homeostatic turnover of the intestinal epithelium and ensure epithelial
regeneration after tissue damage. To accommodate these functions, ISC proliferation is regulated dynamically by various growth
factors and stress signaling pathways. How these signals are integrated is poorly understood. Here, we show that EGF receptor
signaling is required to maintain the proliferative capacity of ISCs. The EGF ligand Vein is expressed in the muscle surrounding the
intestinal epithelium, providing a permissive signal for ISC proliferation. We find that the AP-1 transcription factor FOS serves as a
convergence point for this signal and for the Jun N-terminal kinase (JNK) pathway, which promotes ISC proliferation in response
to stress. Our results support the notion that the visceral muscle serves as a functional ‘niche’ for ISCs, and identify FOS as a
central integrator of a niche-derived permissive signal with stress-induced instructive signals, adjusting ISC proliferation to
environmental conditions.
INTRODUCTION
In high-turnover tissues, the production of new differentiated cells
from stem cells is crucial to maintain homeostasis and prevent
attrition. In long-lived organisms, stem cell proliferation has to be
precisely regulated to maintain regenerative capacity while
preventing overproliferation and cancer (Radtke and Clevers, 2005;
Rando, 2006; Rossi et al., 2008; Sharpless and DePinho, 2007).
The properties of stem cells are regulated by signals from the
environment, the organism and, in many cases, a specialized stem
cell niche that provides essential growth factors and thus generates
a microenvironment that maintains stem cell function (Barker et al.,
2008; Bryder et al., 2006; Crosnier et al., 2006; Gopinath and
Rando, 2008; Morrison and Spradling, 2008). All of these inputs
need to be integrated within the stem cell population to respond to
changing environmental conditions with the production of the
appropriate number of differentiated cells. The signaling networks
that control stem cell maintenance and proliferation govern the
balance between tissue regeneration and tumor prevention in aging
animals and are therefore crucial to understand.
In Drosophila melanogaster, the integrity of the midgut
epithelium is maintained by multipotent intestinal stem cells (ISCs)
(Micchelli and Perrimon, 2006; Ohlstein and Spradling, 2006). The
ISC lineage consists of a non-dividing ISC daughter cell
[enteroblast (EB)] and two differentiated cell types [enterocytes
(EC), the main cell type in the intestine; and enteroendocrine cells
(EE)] (Micchelli and Perrimon, 2006; Ohlstein and Spradling,
2006). EB differentiation into ECs and EEs is controlled by Notch
and JAK (HOP – FlyBase)/STAT (STAT92E – FlyBase) signaling,
the decision between these two cell types being regulated by
differential Notch and JAK/STAT signaling activities (Beebe et al.,
Department of Biology, University of Rochester, River Campus Box 270211,
Rochester, NY 14627, USA.
*Author for correspondence ([email protected])
Accepted 21 December 2010
2010; Jiang et al., 2009; Lin et al., 2009; Micchelli and Perrimon,
2006; Ohlstein and Spradling, 2006; Ohlstein and Spradling, 2007).
ISC-mediated tissue regeneration is required to maintain tissue
homeostasis in the intestinal epithelium after tissue damage due to
infection, DNA damage and oxidative stress (Amcheslavsky et al.,
2009; Biteau et al., 2008; Buchon et al., 2009a; Jiang et al., 2009;
Pitsouli et al., 2009). If control of this regenerative process breaks
down, for example in old organisms or under conditions of
excessive stress, aberrant stem cell proliferation can occur, leading
to dysplasia of the intestinal epithelium. This dysplasia phenotype
is characterized by an accumulation of misdifferentiated cells at the
basal membrane and by disruption of the apicobasal organization
of the epithelium. This effect sensitizes flies to infection
(Apidianakis et al., 2009) and shortens lifespan (Biteau et al., 2008;
Biteau et al., 2010; Buchon et al., 2009a). Precise regulation of ISC
proliferation is thus crucial to limit overproliferation while
maintaining regenerative capacity, ensuring long-term functional
maintenance of this tissue.
ISC proliferation and self-renewal are regulated by the growth
factors insulin and WNT/WG, the JAK/STAT signaling pathway,
as well as by the MAP Kinase p38 (Amcheslavsky et al., 2009;
Beebe et al., 2010; Buchon et al., 2009a; Jiang et al., 2009; Lee et
al., 2009; Lin et al., 2008; Lin et al., 2009; Park et al., 2009). In
response to tissue damage, for example after exposure to genotoxic
or reactive oxygen species (ROS)-inducing compounds or
infection, ISC proliferation is further strongly promoted by multiple
stress-responsive signaling systems (JNK, JAK/STAT and
PVR/p38) (Amcheslavsky et al., 2009; Apidianakis et al., 2009;
Biteau et al., 2008; Buchon et al., 2009a; Buchon et al., 2009b;
Chatterjee and Ip, 2009; Choi et al., 2008; Cronin et al., 2009;
Jiang et al., 2009). The proper interplay of growth factor and stress
signals in ISCs is expected to be important for tissue function and
integrity. How these different types of biological information are
integrated to regulate proliferation rates of ISCs is unclear.
Here, we show that the EGF Receptor (EGFR) signaling
pathway plays a crucial role in the regulation of ISC proliferation.
We find that the EGFR ligand Vein is expressed in the circular
DEVELOPMENT
KEY WORDS: Drosophila, EGF signaling, Intestinal stem cells
1046 RESEARCH ARTICLE
MATERIALS AND METHODS
Drosophila stocks and culture
The following strains were obtained from the Bloomington Drosophila
Stock Center: w1118, UAS-RasV12, UAS-RasN17, UAS-DERDN, UASDER1act, UAS-RafGOF, rase1B, rase2F, HowGal4 and tub-Gal80ts. UASEGFRRNAi (#43267 and #107130), UAS-rasRNAi (#106642), UAS-rolledRNAi
(#43123) and UAS-bskRNAi (#34138) were obtained from the Vienna
Drosophila RNAi Center. The line esgGal4NP5130 was kindly provided by S.
Hayashi (RIKEN Center for Developmental Biology, Kobe, Japan), UASBskDN by M. Mlodzik (Mount Sinai Medical Center, New York, NY, USA)
and NP1Gal4 by D. Ferrandon (IBMC, Strasbourg, France).
The original UAS-rolledRNAi carries multiple insertions and is named
RolledRNAi2x. A single insertion on the second chromosome was isolated
and is referred as rolledRNAi.
UAS-fosRNAi and UAS-fos point mutant constructs were previously
described (Hyun et al., 2006). UAS-fosRNAi strong and UAS-fosRNAi weak
refer respectively to the FI39/15 and FI49 lines (Hyun et al., 2006).
The kay2 allele was described previously (Zeitlinger et al., 1997). The
kay3 allele is a transposon insertion in the kayak locus, lethal in trans with
the kay1 or kay2 alleles and causing a strong loss-of-function phenotype
(not shown).
All flies were raised on standard yeast and molasses-based food, at 25°C
and 65% humidity, on a 12-hour light/dark cycle, unless otherwise
indicated.
Conditional expression of UAS-linked transgenes
The TARGET system was used to conditionally express UAS-linked
transgenes in ISCs and EBs (McGuire et al., 2003). The esg-Gal4, HowGal4 and NP1-Gal4 drivers were combined with a ubiquitously expressed
temperature-sensitive Gal80 inhibitor (tub-Gal80ts). These conditional
drivers are termed esgGFPts, HowGal4ts and NP1Gal4ts. Crosses and flies
were kept at 18-20°C (permissive temperature), then shifted to 29°C to
allow expression of the transgenes.
MARCM and flip-out clones
Positively marked clones were generated by somatic recombination using
the following MARCM stocks: hsFlp;FRT40A tub-Gal80;tub-Gal4,UASGFP (gift from B. Ohlstein, Columbia University, New York, NY, USA);
hsFlp;FRT42D tub-Gal80;tub-Gal4,UAS-GFP; hsFlp;tub-Gal4,UASGFP;FRT82B tubGal80 (gift from N. Perrimon, Harvard University,
Boston, MA, USA). Virgins from the appropriate MARCM stock were
crossed to the following lines: FRT40A bsk170b; UAS-DERDN;FRT82B;
FRT82B rase1B; FRT82B rase2F; UAS-rlRNAi;FRT82B; FRT82B kay2;
FRT82B kay3; FRT40A;UAS-fosAA; FRT40A;UAS-fos7A; FRT42D
EgfrtopCO and FRT42D Egfrtsla (gifts from N. Baker, Albert Einstein
College of Medicine, Bronx, NY, USA).
Flip-out stock is hsFlp;act>CD2>Gal4,UAS-GFP.
2- to 4-day-old mated female flies were heat-shocked for 45 minutes at
37°C to induce somatic recombination. Clones were observed 7 days after
induction.
Immunostaining and microscopy
Intact guts were fixed at room temperature for 45 minutes in 100 mM
glutamic acid, 25 mM KCl, 20 mM MgSO4, 4 mM sodium phosphate, 1
mM MgCl2, 4% formaldehyde. All subsequent incubations were done in
PBS, 0.5% BSA, 0.1% TritonX-100 at 4°C.
The following primary antibodies were used: mouse anti-dpErk (Sigma;
1:100); mouse anti-BrdU (Becton Dickson; 1:200); mouse anti-Prospero,
anti-Armadillo and anti--galactosidase (Developmental Studies
Hybridoma Bank; 1:250, 1:100 and 1:500, respectively); rabbit anti-pH3
(Upstate; 1:1000). Fluorescent secondary antibodies were obtained from
Jackson ImmunoResearch. Hoechst was used to stain DNA.
Confocal images were collected using a Leica SP5 confocal system and
processed using the Leica software and Adobe Photoshop.
Western blot
Intact guts were dissected and proteins extracted in Laemmli buffer,
separated on 10% acrylamide gel and transferred according to standard
procedures. Antibodies directed against dpERK (M8159; 1:1000 dilution)
and ERK (M5670; 1:5000) are from Sigma. Total proteins from four guts
and one gut were used for dpERK and total ERK, respectively.
Analysis of gene expression in the gut
Young mated females were transferred for 7 days at 29°C to allow the
expression of RNAi constructs. Total RNA from six dissected guts was
extracted using Trizol (Invitrogen), according to manufacturer instructions.
cDNA was synthesized using an oligo-dT primer. Real-time PCR was
performed on a Bio-Rad iQ5 detection system using the following primers
(5⬘ to 3⬘): EGFR forward TGGCGATCGTTAAGTCATCCCTGT; EGFR
reverse TGCACTGATCCGAGCAAATGGTTC; vein forward TTCCGAGCTAATAGTGCGCTCCTT; vein reverse ATAGACCTCGTTGATGTCCGGGAT; actin5c forward CTCGCCACTTGCGTTTACAGT; actin5c
reverse TCCATATCGTCCCAGTTGGTC. Relative expression of Egfr and
vein were normalized to Actin5C levels.
Paraquat and bleomycin treatments
For all stress experiments, young mated females were cultured on standard
food at 29°C for 2 days, in order to induce transgene expression. Flies were
then starved for 6 hours in empty vials at room temperature and re-fed with
a sucrose solution (5%; mock) with or without 5 mM paraquat or 10 g/ml
bleomycin sulfate. Flies were maintained at 29°C and dissected 24-48
hours later.
Statistical analysis
For all experiments, the data is represented as mean ± s.e.m. All P-values
were calculated using unpaired two-tailed Student’s t-test.
RESULTS
EGFR activity is essential for ISC proliferation
EGF signaling is crucial for the development of the adult midgut
in Drosophila (Jiang and Edgar, 2009). The expression of
multiple EGF-like ligands in a temporally and spatially defined
manner ensures the proper proliferation of progenitors during
larval and pupal development. Recent studies indicated that
expression of these ligands is maintained in the adult intestine,
suggesting that epithelial regeneration might be influenced by
EGFR signaling (Buchon et al., 2009b; Jiang and Edgar, 2009).
To test this hypothesis, we generated Egfr homozygous mutant
ISC clones using the temperature-sensitive allele Egfrtsla (Kumar
et al., 1998), or a null allele [EgfrtopCO (Clifford and Schupbach,
1989)], as well as clones overexpressing a dominant negative
form of the EGF receptor (EGFRDN), in the posterior midgut
using somatic recombination through the mosaic analysis with a
repressible cell marker (MARCM) method (Lee and Luo, 1999).
In wild-type flies, GFP-marked ISC cell clones grew to ~10-12
cells within 7 days (Micchelli and Perrimon, 2006; Ohlstein and
Spradling, 2006) (Fig. 1A,B). However, Egfr mutant clones and
clones expressing DERDN showed very limited growth, mostly
DEVELOPMENT
muscle surrounding the intestinal epithelium, providing a
constitutive signal that activates the ERK (Rolled – FlyBase)
protein kinase in ISCs and is essential to maintain an optimal ISC
proliferative capacity. We show that the transcription factor FOS
(KAY – FlyBase) acts as an integrator of this EGFR/ERK signal
with stress signals mediated by the Jun N-terminal Kinase (JNK;
BSK – FlyBase) pathway in ISCs. FOS is required for EGFRmediated ISC proliferation, but also mediates the JNK-dependent
boost in proliferation rates in response to stress. FOS integrates
these two specific signals through distinct phosphorylation sites.
Our findings thus identify muscle-derived growth factors as crucial
regulators of proliferative competence of ISCs, strengthening the
notion that the visceral muscle serves as a functional niche for
ISCs. The integration of this permissive signal with stress-response
signaling pathways by FOS provides a model for the dynamic
regulation of ISC proliferation in homeostatic and stress conditions.
Development 138 (6)
EGF controls proliferation in the fly gut
RESEARCH ARTICLE 1047
consisting of single cells that maintain the expression of Delta, a
specific marker for ISCs in the posterior midgut, indicating that
ISC proliferation was significantly reduced, whereas ISC survival
was not affected (Fig. 1A-C). Accordingly, these single cell
clones were maintained in the intestinal epithelium for at least 15
days (see Fig. S1A,B in the supplementary material). EGFR is
thus essential for ISC proliferation, but is not required for ISC
survival.
Analysis of EGFR-deficient single cell-clones further suggests
that EGFR signaling is not required for EE or EC differentiation:
as somatic recombination occurs in the G2 stage of the cell cycle
of asymmetrically dividing ISCs, only 50% of the marked cells
generated by the MARCM method became clone-generating ISCs,
whereas the other 50% became EBs, which will undergo
differentiation into a single GFP-positive EE or EC. When Egfrnull or EGFRDN-expressing clones were generated, single GFPpositive EEs and ECs were observed in frequencies comparable
with wild-type conditions (see Fig. S1C in the supplementary
material).
To confirm further that EGFR is required for ISC proliferation,
we used an inducible system to express two independent dsRNA
constructs directed against the Egfr mRNA (EgfrRNAi) in ISCs and
EBs [using esgGal4 together with ubiquitously expressed
temperature-sensitive Gal80, tubGal80ts; combined with UASGFP, this system is termed esgGFPts here (Micchelli and Perrimon,
2006)]. Expression of either one of the EgfrRNAi constructs
efficiently repressed Egfr expression in the intestine (Fig. 1D),
confirming that Egfr is expressed in ISCs and/or EBs. We used the
mitotic marker phosphorylated histone H3 (pH3) to assess the
frequency of ISC divisions in the intestine (Choi et al., 2008;
Micchelli and Perrimon, 2006; Ohlstein and Spradling, 2006) (Fig.
1E). Because in young flies only a few pH3+ cells can be detected
(suggesting that unchallenged ISCs divide rarely or slowly), we
assessed the requirement of EGFR for ISC proliferation in
backgrounds with well-established increases in ISC proliferation
rates: in aging flies; after oxidative challenge (exposure to the
ROS-inducing compound paraquat); or when Notch signaling was
disrupted in ISCs and EBs. In old and ROS-challenged flies, ISC
DEVELOPMENT
Fig. 1. EGF receptor activity is essential for ISC proliferation. (A-C)MARCM clones overexpressing a dominant-negative form of EGFR (DERDN)
and homozygous mutant clones for Egfr (egfr–/–) fail to grow, demonstrating that components of the EGFR activity is required for ISC proliferation.
Boxed areas are magnified in the lower panels. Quantification of the clone size, measured by the number of cells per clone, 7 days after clone
induction [7d after heat shock (AHS)] is shown in B. Error bars represent s.e.m. FRT 42D, MARCM using Flip recombination target at 42D; FRT 82B,
MARCM using Flip recombination target at 82B. Staining for the ISC-specific marker Delta (red), indicates that Egfr-null single cell clones (egfrtopCO)
are non-dividing ISCs (C). (D)Egfr expression in the intestine, 5 days after induction of expression of dsRNA constructs against Egfr, using the
esgGal4 driver. Expression of the two distinct transgenes significantly alters Egfr expression compared with controls. (E)Knockdown of Egfr in ISCs
and EBs using the temperature-sensitive driver esgGFPts (esgGal4;tubGal80ts) is sufficient to prevent age-related induction of proliferation and
intestinal dysplasia. Proliferation was quantified by counting the number of pH3+ cells per gut after immunostaining, 15 days after transgenes
induction at 29°C. Representative confocal images are shown to illustrate the reduced number of pH3+ cells (indicated by arrowheads) and limited
intestinal dysplasia observed in esgGFPts>EgfrRNAi flies. Boxed areas are magnified in the lower panels. (F)Reduction of Egfr activity prevents
NotchRNAi-induced tumor formation. EgfrDN or EgfrRNAi transgenes were expressed together with NRNAi using esgGFPts. Ten days after induction,
tumors composed of esg+ and PROS+ cells accumulate in the posterior midgut of control flies (NRNAi alone), whereas the intestinal epithelium
architecture is preserved when EGFR activity is inhibited. In A, C, E and F, GFP expression is shown in green, cell boundaries are stained using
-Catenin/Armadillo (red, membrane), EEs are marked by the expression of Prospero (red nuclei) and DNA is labeled using Hoechst (blue).
EB, enteroblast; EE, enteroendocrine cells; ISC, intestinal stem cell; MARCM, mosaic analysis with a repressible cell marker.
1048 RESEARCH ARTICLE
Development 138 (6)
proliferation was strongly increased owing to activation of stress
signaling pathways. Loss of Notch prevents EB differentiation into
ECs, and causes unchecked expansion of ISCs and EEs into tumorlike structures (Biteau et al., 2008; Choi et al., 2008; Micchelli and
Perrimon, 2006; Ohlstein and Spradling, 2006). When EGFR
expression was knocked down, the prevalence of pH3+ cells and
the accumulation of esgGFP+ cells at 15 days of age was
significantly reduced, whereas paraquat-induced proliferation of
ISCs was inhibited by expression of EGFRDN (Fig. 1E; see Fig.
S1D in the supplementary material). Similarly, the formation of
Notch mutant ISC and EE tumors was significantly impaired,
indicating that loss of EGFR is sufficient to prevent ISC
proliferation independently of Notch signaling (Fig. 1F).
Altogether, our results demonstrate that the activity of the EGF
receptor is thus essential for ISC proliferation under normal
conditions, as well as in response to stress or mitogenic signals,
without affecting ISC survival or differentiation in the ISC lineage.
Expression of the EGFR ligand Vein in the muscle
is partially required for ISC proliferation
The requirement of EGFR/ERK signaling activity for ISC
proliferation suggests that an EGF-like ligand is secreted from a
neighboring source, generating a niche-like microenvironment for
ISCs that maintains proliferative competence. During the
development of the adult intestine, the muscle surrounding the
intestinal epithelium expresses the neuregulin homolog vein, one
of the Drosophila EGFR ligands, and it has been suggested that this
expression is preserved in adult intestines (Jiang and Edgar, 2009).
Using a reporter construct expressing nuclear -galactosidase, we
confirmed that vein promoter activity is maintained in the adult
visceral muscle, as indicated by the colocalization of galactosidase positive nuclei with GFP expressed under the control
of the muscle-specific HowGal4 driver and with phalloidin
staining, as well as with a basement membrane component,
vkgGFP (also known as collagen IV) (Fig. 3A-C). Importantly,
expression of two independent veinRNAi constructs in the muscle
using the HowGal4 driver was sufficient to strongly reduce the
expression of vein in the whole intestine, as determined by qRTPCR, whereas expressing these dsRNA constructs in ISCs/EBs or
ECs had no effect (Fig. 3D). The visceral muscle is thus the
primary source of Vein in the adult midgut and is a candidate for
providing the signal required for ISC proliferation. We first tested
this idea by assessing whether vein expression in the muscle is
required for ISC proliferation under normal conditions. Indeed,
inhibition of vein expression in the muscle for 5 days did not affect
Fig. 2. Components of the MAPK signaling pathway are required
for ISC proliferation. (A)MARCM clones homozygous for Ras loss-offunction alleles fail to grow compared with control clones (see Fig. 1A).
Boxed areas are magnified in the lower panels. (B)Quantification of
clone size 7 days after induction, including MARCM clones expressing
one copy of the rolledRNAi construct. Error bars represent s.e.m.
(C,D)Flip-out clones overexpressing two copies of the rolledRNAi
construct mostly remain as single stem cells, confirming the essential
role of ERK in ISC proliferation. The clone size, measured by the
number of cells per clone, 7 days after clone induction, is quantified in
D. (E)Inhibition of Ras and ERK prevents NotchRNAi-induced tumor
formation. Confocal images of posterior midguts co-expressing a
dominant form of Ras (rasN17) or two copies of the rolledRNAi construct
with NRNAi in ISCs and EBs, 10 days after induction at 29°C. In A, C and
E, GFP expression is shown in green, cell boundaries are stained using
-Catenin/Armadillo (red, membrane), EEs are marked by the
expression of Prospero (red nuclei) and DNA is labeled using Hoechst
(blue). EB, enteroblast; EE, enteroendocrine cells; ISC, intestinal stem
cell; MARCM, mosaic analysis with a repressible cell marker.
the number of ISCs (identified by the expression of Delta; Fig. 3E),
but significantly reduced the number of EBs in the intestinal
epithelium (identified by the expression of the GBE-Su(H)-lacZ
reporter; Fig. 3F), suggesting that ISC division is reduced in these
conditions. We assessed further the requirement for vein expression
in stress-induced ISC proliferation. Compared with wild-type
controls, the number of pH3+ cells detected after exposure to
paraquat or to the genotoxic compound bleomycin (Amcheslavsky
et al., 2009) was significantly lower in animals expressing veinRNAi
in the muscle (Fig. 3G,H). vein expression in the muscle is thus
required for optimal ISC proliferation.
ERK activation is a permissive signal required to
promote cell proliferation
To monitor the activity of the EGFR signaling pathway in the
intestinal epithelium, we detected the active, double-phosphorylated
(dp) form of ERK using immunohistochemistry (Gabay et al.,
DEVELOPMENT
The MAPK signaling pathway is required for ISC
proliferation
EGFR signaling is transduced by the MAPK signaling pathway in
Drosophila, including the small GTPase RAS (encoded by
Drosophila Ras85D) and the MAP kinase ERK [encoded by
Drosophila gene rolled (rl)] (Shilo, 2005). We assessed whether
these downstream components are also required for stem cell
proliferation using the MARCM and flip-out lineage tracing
techniques (Lee and Luo, 1999; Pignoni and Zipursky, 1997).
Similar to Egfr loss-of-function conditions, ISCs homozygous for
Ras loss-of-function alleles or expressing a dominant negative form
of RAS or rolledRNAi failed to generate multi-cell clones (Fig. 2AD). Inhibition of RAS and ERK is also sufficient to inhibit NRNAiand paraquat-induced proliferation (Fig. 2E; see Fig. S1D in the
supplementary material), confirming that the MAPK/ERK pathway
is required to maintain proliferative competence of ISCs.
EGF controls proliferation in the fly gut
RESEARCH ARTICLE 1049
1997). In the posterior midgut of young flies, dpERK could be
detected in ISCs (Fig. 4A) and enteroendocrine cells (not shown),
but not in ECs. Interestingly, the vast majority of these cells were
dpERK positive (>80% of esg-positive cells), even though under
unstressed conditions most ISCs were not or only slowly dividing
(Biteau et al., 2008; Choi et al., 2008; Micchelli and Perrimon,
2006; Ohlstein and Spradling, 2006) (Fig. 4E; in young flies, only
10% of esg+ cells incorporate BrdU within 48 hours, not shown).
This suggests that the level of ERK activity in ISCs under such
basal, non-stressed conditions is not sufficient to promote high rates
of cell division. The lack of mitotic activity in the majority of cells
does not seem to be due to fluctuations of ERK activity, as the
intensity of dpERK staining in pH3+ and pH3 ISCs was
indistinguishable (Fig. 4B). Although we cannot formally exclude
the possibility that ERK is activated very transiently during early
phases of the cell cycle, we deduce that ERK activation in these
cells provides a permissive, but not inductive, signal for
proliferation. Interestingly, however, expression of an oncogenic
form of RAS is sufficient to promote widespread ISC division
(Apidianakis et al., 2009), indicating that strong EGFR gain-of-
function conditions can overcome a threshold and provide a
sufficient signal for ISC division. To confirm this interpretation, we
expressed activated forms of EGFR [DER-ellipse (Baker and Rubin,
1989)], RAS [rasV12 (Karim and Rubin, 1998)], RAF [rafGOF (Brand
and Perrimon, 1994)] and ERK [rolledSEM (Brunner et al., 1994)]
using the esgGFPts driver. Expression of any of these constructs for
2 days resulted in strongly increased levels of activated ERK in the
intestine (Fig. 4C) and correspondingly very high numbers of pH3+
cells in the intestinal epithelium accompanied by a dramatic
expansion of esg+ cells (Fig. 4D,E). Strong activation of ERK is
thus sufficient to promote ISC proliferation. Importantly, however,
expression of the JNK Kinase Hemipterous [HEP (Biteau et al.,
2008)] strongly increased ISC proliferation without significantly
increasing ERK phosphorylation in the intestine (Fig. 4E,F),
suggesting that, as in other biological contexts, RAS and HEP signal
through independent signaling pathways to induce ISC proliferation
(Ciapponi et al., 2001; Kockel et al., 2001; Luo et al., 2007;
Suzanne et al., 2001; Weston and Davis, 2002). These findings
further support the notion that elevated ERK phosphorylation is not
required to induce ISC proliferation under stress conditions, and that
the basal activity of ERK that is maintained by muscle-derived Vein
constitutes a permissive signal for ISC division. In this model,
EGFR signaling is required to maintain proliferative competence of
ISCs, whereas activation of JNK signaling or other stress-responsive
signaling pathways is required to stimulate proliferation of ISCs in
response to oxidative stress, tissue damage or infection
(Amcheslavsky et al., 2009; Apidianakis et al., 2009; Biteau et al.,
2008; Buchon et al., 2009a; Buchon et al., 2009b; Chatterjee and Ip,
2009; Choi et al., 2008; Cronin et al., 2009; Jiang et al., 2009).
Accordingly, JNK [encoded by the Drosophila gene basket (bsk)] is
DEVELOPMENT
Fig. 3. The EGFR ligand vein is expressed in the intestinal muscle
and is required for ISC proliferation. (A-C)The Vein-lacZ
transcriptional reporter is expressed in muscle. Nuclear -galactosidase
expression is detected by immunostaining (red), in longitudinal rows of
cells located basally, along the entire posterior midgut (indicated by
arrowheads). Cells positive for the Vein-lacZ reporter also express GFP
when driven with the muscle-specific HowGal4 driver (A, inserts show
single channel images of the boxed area), demonstrating that Vein-lacZ
is expressed in muscle. Co-localization with vkgGFP (a GFP fusion with
the basement membrane component collagen IV) and phalloidin
(staining F-actin) further demonstrates the basal position of
-galactosidase+ cells in the epithelium (B,C). (D)vein mRNA can be
detected in the intestine and is expressed in muscle. Expression of
dsRNA constructs against Vein in the muscle (HowGal4ts driver) is
sufficient to significantly reduce mRNA level in the intestine, whereas
expression of vnRNAi constructs in ISCs or EBs (esgGFPts driver) or in
enterocytes (NP1Gal4ts driver) has no effect. The expression of vein is
measured by real-time RT-PCR, relative to the expression of Actin5c.
(E)vein knockdown in the muscle does not affect ISC maintenance. The
proportion of Delta-positive cells is similar in the epithelium of control
and HowGal4ts>vnRNAi flies 5 days after transgenes induction.
Representative images are shown to illustrate the maintenance of small
Delta-positive cells in the epithelium of HowGal4ts>vnRNAi flies (shown
in red). (F)vein knockdown reduces the number of EBs. The proportion
of cells positive for the EB marker GBE-Su(H)-lacZ is significantly lower
in the intestine of HowGal4ts>vnRNAi flies compared with wild-type
controls. (G,H)Knocking down vein expression in the muscle limits
stress-induced proliferation. The number of pH3-positive cells, in mocktreated flies or after exposure to paraquat or bleomycin (for 24 and 48
hours, respectively) was measured in the epithelium of control and
HowGal4ts>vnRNAi flies. EB, enteroblast; ISC, intestinal stem cell.
1050 RESEARCH ARTICLE
Development 138 (6)
required for oxidative stress and DNA damage-induced proliferation
of ISCs, but not for proliferation under homeostatic conditions:
inhibition of JNK, by expressing either dominant-negative bsk
[BskDN (Weber et al., 2000) or a dsRNA against bsk [BskRNAi (HullThompson et al., 2009)] in ISCs and EBs significantly decreased
paraquat- and bleomycin-induced proliferation (see Fig. S2B,C in
the supplementary material), whereas ISCs homozygous for the bsk
loss-of-function alleles bsk2 and bsk170B generated normally sized
clones in unchallenged flies (see Fig. S2A in the supplementary
material). Confirming the permissive versus inductive nature of
EGFR/ERK and JNK signaling in ISC proliferation, JNK activity
was not required for RAS-induced overproliferation of ISCs (Fig.
4H). Conversely, EGFR signaling is required for JNK-induced
proliferation (Fig. 4G; see Fig. S3 in the supplementary material).
The transcription factor FOS is required for JNKand ERK-induced ISC proliferation
The proliferative response of ISCs both to activation of JNK and
of EGFR/ERK signaling pathways raises the possibility that a
common downstream effector might mediate these responses and
thus integrate permissive and inductive signals. The AP-1
transcription factor FOS is a well-described target of JNK signaling
in Drosophila and has been shown to also respond to EGFR
signaling in various biological contexts, such as developing
imaginal discs (Ciapponi et al., 2001). FOS might thus serve as a
convergence point for JNK and ERK responses in ISCs. To test this
idea, we first assessed the requirement for FOS in proliferating
ISCs. We generated homozygous mutant clones for the fos loss-offunction alleles kay2 and kay3. The resulting GFP-positive clones
DEVELOPMENT
Fig. 4. The MAPK signaling pathway is active in ISCs and its activation is sufficient to promote ISC proliferation. (A)The active, doublephosphorylated (dp) form of ERK can be detected by immunostaining in the ISCs under normal conditions (red, left-hand panel; monochrome,
right-hand panel). (B)Similar dpERK staining is observed in dividing (pH3-positive; open arrowhead) and non-dividing ISCs (solid arrowhead).
(C)Expression of activated forms of the EGFR (DERact) or RAS (rasV12), using the esgGFPts driver, dramatically increases the level of activated ERK in
the intestine. dpERK is detected by Western blot from dissected midguts 2 days after transgene induction at 29°C. Levels of total ERK protein serve
as loading control. (D,E)Activation of the EGFR/MAPK and JNK signaling pathways is sufficient to induce ISC proliferation, resulting in intestinal
dysplasia. Activated forms of DER (DERact), RAS (rasV12), RAF (rafGOF) and ERK (rolledSEM; rlSEM) or HEP (Hep) were expressed for 2 days in ISCs using
the temperature-sensitive driver (esg-Gal4,UAS-GFP;tub-Gal80ts). Proliferation rates in the midgut were quantified (E) by counting the number of
pH3+ cells per gut in the same genetic conditions. (F)Activation of JNK in ISCs and EBs does not significantly elevate dpERK levels. dpERK is
detected by Western blot from dissected midguts 2 days after transgene induction at 29°C. Levels of total ERK protein serve as loading control.
(G)Overexpression of HEP in ISCs and EBs results in dyplastic phenotype in the intestinal epithelium (esgGFPts>Hep). Co-expression of dominant
forms of EGFR (DERDN) and ras (rasN17), or a dsRNA construct directed against ERK (rolledRNAi), is sufficient to prevent HEP-induced dysplasia.
(H)RAS-induced dysplasia specifically requires ERK activity. Inhibiting ERK (rolledRNAi) prevents the expansion of esg+ cells observed when RasV12 is
expressed under the control of the esgGFPts driver. Co-expression of a JNK dominant form (BskDN) does not affect this phenotype. Boxed areas are
enlarged in lower panels. EB, enteroblast; ISC, intestinal stem cell.
EGF controls proliferation in the fly gut
RESEARCH ARTICLE 1051
failed to grow, and often remained restricted to a single stem cell
(Fig. 5A,B). This result suggests that FOS is required for ISC
proliferation. kay2 [a hypomorphic mutant allele that does not result
in cell lethality (Zeitlinger et al., 1997)] clones were induced at
frequencies comparable to wild-type clones, but clones
homozygous for the strong loss-of-function allele kay3 (a P-element
insertion into the kay locus) were recovered at much lower
frequency, suggesting that strongly reducing FOS function in ISCs
affects stem cell survival. To confirm these effects of fos loss-offunction on ISC proliferation and survival, we used two distinct
transgenic constructs allowing mild or strong expression of dsRNA
directed against FOS [fosRNAi (Hyun et al., 2006)]. Flip-out clones
expressing fosRNAi weak show much reduced growth compared with
wild-type clones (see Fig. S4A,B in the supplementary material).
In addition, expression of fosRNAi strong for 10 days in ISCs and EBs
using esgGal4 results in the complete loss of esg+ cells in the
intestinal epithelium. This cell loss could be rescued by
overexpressing the anti-apoptotic protein p35, demonstrating that
strong knockdown of FOS in ISCs results in their death by
apoptosis (Fig. 5C). Similarly, strong inhibition of FOS in a Notch
loss-of-function background (esgGFPts>NRNAi) prevented ISC
overproliferation and resulted in the apoptotic death of esg-positive
cells. However, preventing apoptosis of these Notch mutant ISCs
did not restore proliferation (Fig. 5D), supporting the conclusion
that FOS activity is essential for both ISC proliferation and
survival, and demonstrating that these functions of FOS are
separable.
Next, we wanted to investigate whether FOS relays EGFR/ERK
and JNK signaling in the regulation of stem cell proliferation. To test
this idea directly, we assessed the effect of impairing FOS function
on JNK- or RAS-induced proliferation. When FosRNAi was expressed
together with either HEP or RasV12 using the esgGal4 driver, no
expansion of esg+ cells or increase in pH3+ cells was observed (Fig.
5E; see Fig. S4C in the supplementary material). Note that, when
RasV12 and FosRNAi were co-expressed, the size of the esg+ cells
increased, probably owing to fos-independent effects of RAS
activation on cell growth. Similarly, we found that FOS is required
for the paraquat-induced increase in the frequency of pH3+ cells and
BrdU incorporation in the intestinal epithelium (Fig. 5F; see Fig.
S4D in the supplementary material).
Distinct phosphorylation sites in FOS mediate
JNK- and RAS/ERK-induced ISC proliferation
These results strongly suggest that FOS is essential for both JNK
and EGFR-mediated proliferation in ISCs. It remains possible,
however, that FOS acts primarily as an ERK target and is thus
DEVELOPMENT
Fig. 5. FOS is required for stem cell survival and
proliferation, downstream of JNK and RAS. (A,B)FOS is
required in ISCs for clone formation. Posterior midguts showing
MARCM clones homozygous for fos (kay) loss-of-function
alleles, 7 days after induction. Mutant clones remain smaller
than controls, often limited to single stem cells, and are
recovered less frequently for the kay3 allele. Boxed areas are
enlarged in lower panels. Clone size (number of cells per clone)
is quantified in B. FRT 82B, MARCM using Flip recombination
target at 82B. (C)Prolonged inhibition of FOS results in ISC
death by apoptosis. Expression of the fosRNAi construct that
causes strong knockdown of FOS expression, using the
esgGFPts driver, leads to the disappearance of esg+ cells. This
phenotype is rescued when the anti-apoptotic protein p35 is
co-expressed, whereas expression of p35 alone has no effect.
(D)A similar experiment performed in N loss-of-function
background demonstrates that p35 expression rescues cell
death but is unable to restore NRNAi-induced proliferation and
tumor formation, suggesting that FOS affects both survival and
proliferative capacity of ISCs. (E)FOS is required for HEP- and
RAS-induced ISC proliferation. Intestines 5 days after induction
of HEP or rasV12 together with fosRNAi, using the temperaturesensitive esgGal4 driver. The HEP- and rasV12-induced
expansion of esg+ cells is entirely blocked by fosRNAi,
demonstrating that FOS is required downstream of JNK and
RAS. Note that knocking down FOS does not block RASinduced cell growth. (F)Paraquat-induced ISC proliferation
requires FOS. Expression of two different fosRNAi constructs,
using esgGFPts (for 2 days at 29°C prior to treatment),
significantly reduces Paraquat-induced proliferation in the
intestinal epithelium, as shown by the limited number of pH3+
cells per gut 48 hours after paraquat exposure. In A, C and D
GFP is shown in green, armadillo (Arm) outlines cell boundaries
(red), prospero (Pros) identifies EEs (nuclear red), DNA is shown
in blue. AHS, after heat shock; EE, enteroendocrine cells; ISC,
intestinal stem cell; MARCM, mosaic analysis with a repressible
cell marker.
1052 RESEARCH ARTICLE
Development 138 (6)
generally required for ISC proliferation, but does not directly
respond to the JNK-mediated inductive signal. Interestingly, a
function of FOS directly downstream of JNK and ERK in
Drosophila has been suggested, as the two kinases can
phosphorylate FOS on overlapping and distinct sites (Ciapponi et
al., 2001). This suggests a potential mechanism by which FOS
might integrate permissive and instructive signals to regulate ISC
proliferation. In vitro, JNK phosphorylates two residues located in
the N-terminal part of the FOS protein, whereas both ERK and
JNK can phosphorylate residues in the C-terminal domain
(Ciapponi et al., 2001) (Fig. 6A). The importance of these distinct
phosphorylation sites for FOS function in vivo has been tested in
developmental contexts. Expression of a mutant form of FOS
carrying alanine substitutions of the N-terminal phosphorylation
sites (FOSN-Ala) dominantly interferes with JNK-dependent thorax
closure, but has no effect on ERK-dependent wing vein formation.
Conversely, expression of a mutant form in which the C-terminal
phosphorylation sites are replaced (FOSC-Ala), recapitulates ERK
mutant phenotypes in the developing wing, without affecting JNK
function during thorax closure (Ciapponi et al., 2001). These
mutants thus provide unique tools to selectively perturb JNK- or
ERK-specific signaling to FOS.
To assess the effect of ERK or JNK-specific FOS
phosphorylation on ISC proliferation, we generated MARCM
clones overexpressing these different phosphorylation point
mutants of FOS and tested their influence on ISC proliferation
under normal conditions. Expression of FOS mutant for ERK Cterminal phosphorylation sites (FOSC-Ala) prevented the formation
of large clones in the posterior midgut, whereas overexpression of
FOSN-Ala had no effect on clone size (Fig. 6B,C). Similarly,
DEVELOPMENT
Fig. 6. FOS integrates JNK and ERK signaling pathways through distinct phosphorylation sites. (A)Schematic representation of the FOS
protein and the different mutants carrying substitution of JNK and/or ERK phosphorylation sites. Red lines indicate phosphorylation sites.
(B,C)Posterior midguts showing MARCM clones overexpressing fosC-Ala and fosN-Ala, 7 days after induction. Expression of FOS carrying substitution
ERK phosphorylation sites (fosC-Ala) prevents the formation of large clones. Insets show enlarged cells. Clone size (number of cells per clone) is
quantified in C. (D)Expression of FOS mutant forms in ISCs and EBs does not affect the architecture of the posterior midgut. (E)ERK
phosphorylation sites are required for N loss-of-function tumor formation. Intestines 10 days after induction of NRNAi and fos mutants carrying
substitution of JNK and/or ERK phosphorylation sites. Expression of the mutant forms lacking ERK phosphorylation prevents NRNAi-induced ISC
overproliferation. (F)ERK and JNK phosphorylation sites are required for HEP-induced proliferation. Representative confocal images of intestines
5 days after induction of JNK and HEP together with the wild-type or mutant forms of FOS in ISCs/EBs. The HEP-induced expansion of esg+ cells is
blocked by all the FOS mutant forms. (G)Overexpression of FOS mutant forms partially prevents paraquat-induced stem cell proliferation, as shown
by reduced number of pH3+ cells, 48 hours after paraquat exposure. In B, D and E, GFP is shown in green, armadillo (Arm) outlines cell boundaries
(red), prospero (Pros) identifies EEs (nuclear red), DNA is shown in blue. (H)Model representing the role of the EGFR signaling pathway and circular
muscle acting as a niche for ICS and the integration of EGFR and JNK signaling by FOS in ISCs to regulate proliferation. EB, enteroblast;
EE, enteroendocrine cells; ISC, intestinal stem cell; MARCM, mosaic analysis with a repressible cell marker.
expressing FOS mutants in which the ERK phosphorylation sites
were replaced, strongly reduced NRNAi-induced proliferation and
tumor formation, whereas mutating JNK phosphorylation sites had
no effect (Fig. 6D-F). This strongly suggests that ERK-dependent
phosphorylation of FOS is a permissive signal required for stem
cell proliferation, and confirms that JNK-dependent regulation of
FOS is not required under normal conditions.
To further confirm this model, we assessed the consequences of
expressing these FOS variants in conditions in which ISC
proliferation is induced by JNK. The expression of any of the three
mutant forms of FOS (JNK-specific, FOSN-Ala; ERK-specific,
FOSC-Ala; and combined, FOSpan-Ala) was sufficient to prevent
HEP-induced expansion of esg+ cells (Fig. 6F), and significantly
reduced paraquat-induced proliferation (Fig. 6G), further
supporting the notion that JNK-mediated phosphorylation of FOS
is required in addition to ERK phosphorylation to mediate the
instructive signal promoting ISC proliferation in response to stress.
DISCUSSION
Our findings establish a crucial role for EGF signaling in the
regulation of ISC proliferation, and thus support the notion that the
visceral muscle surrounding the intestinal epithelium has the
characteristics of a functional niche. vein expression in the muscle
maintains the competence of ISCs to enter rapid proliferation in
responses to stress and JNK signaling, and is thus expected to
regulate epithelial homeostasis. Interestingly, we find that both the
EGFR-mediated permissive signal and the JNK-derived inductive
signal are relayed by FOS, establishing an integrated molecular
mechanism for the control of ISC proliferation (Fig. 6H).
The visceral muscle: a niche for ISCs?
Many stem cell populations are regulated by their
microenvironments, and larval ISC progenitors are regulated by a
transient niche (Mathur et al., 2010). However, ISCs in adult flies
apparently lack such a closely associated cell population within the
intestinal epithelium. By contrast, control of ISC maintenance by
muscle-derived Wingless suggested this tissue as a potential
functional niche for adult ISCs (Lin and Xi, 2008; Lin et al., 2008).
Our results support and extend this idea by identifying a second
growth factor derived from the visceral muscle that controls ISC
proliferation. In its regulation of stem cell function through
Wingless and Vein, and in the close association of ISCs and muscle
cells, the muscle thus shares characteristics of stem cell niches in
other systems, yet it also differs from these in important ways. In
mammals, as well as in the Drosophila and C. elegans gonads, the
niche of most stem cell populations maintains stem cell quiescence
and prevents differentiation (Jones and Wagers, 2008; Morrison
and Spradling, 2008; Voog and Jones, 2010). The EGF signal
originating from the muscle, however, maintains the capacity of
ISCs to divide, allowing these cells to respond to stimulating
signals while not affecting ISC differentiation. Interestingly, EGFR
signaling has not been described so far as crucial for interactions
between the niche and stem cell populations in other systems, and
our findings raise the possibility that this signaling pathway might
also regulate the function of other stem cell populations in both
invertebrates and vertebrates.
Potential function for additional EGF-like ligands
Whereas knocking down the expression of vein in the muscle
partially affects the ability of ISCs to proliferate under normal
conditions and in response to stress, the inhibition of EGFR
completely abolishes stem cell division. This might reflect the
RESEARCH ARTICLE 1053
inefficiency of the veinRNAi constructs used in our study, but might
also suggest a contribution of other EGFR ligands to the regulation
of ISC function. Accordingly, a genome-wide analysis of the
transcriptional response of the adult intestine to bacterial infection
suggests that expression of vein, as well as of two other genes
encoding EGFR ligands, Keren and spitz, is increased after immune
challenge (Buchon et al., 2009b). However, the potential role for
these additional EGF-like ligands in regulating ISC function
remains to be investigated and the cells expressing spitz and Keren
in the adult intestine have yet to be identified.
Integration of mitogenic and stress signals by FOS
ISC function is regulated by systemic [insulin-like peptides
expressed by neurosecretory cells in the brain (Amcheslavsky et
al., 2009)], muscle-derived [vein and wingless (this study) (Lin et
al., 2008)], local [unpaired cytokines expressed by ECs (Buchon et
al., 2009a; Buchon et al., 2009b; Chatterjee and Ip, 2009; Cronin
et al., 2009; Jiang et al., 2009; Lin et al., 2009)] and cell-intrinsic
[JNK and PVR/p38 signaling (Biteau et al., 2008; Buchon et al.,
2009a; Choi et al., 2008; Park et al., 2009)] signals. These multiple
signals are integrated in ISCs to adapt their proliferation rate and
differentiation program to environmental and physiological
challenges. To fully understand stem cell regulation in this highturnover tissue, the molecular structure of this signaling network
has to be unraveled. Our findings introduce the transcription factor
FOS as a crucial regulator of ISC proliferation that integrates
mitogenic and stress signals, and indicate that JNK and ERK
regulate FOS activity directly by phosphorylation on distinct
residues, controlling ISC proliferation in a combinatorial fashion.
This signal-specific mode of FOS regulation by ERK and JNK in
Drosophila had previously been described in the context of
morphogenetic movements (in which FOS is regulated by JNK)
and of eye and wing growth during development (in which it is
regulated by ERK and JNK) (Ciapponi et al., 2001).
How FOS promotes ISC proliferation remains unclear. In
developing imaginal discs, inhibition of FOS causes an
accumulation of cells in the G2/M phase of the cell cycle, probably
owing to a loss of Cyclin B expression, an essential regulator of the
G2/M transition (Hyun et al., 2006). Interestingly, in ISCs,
expression of FosRNAi not only inhibits stress-induced accumulation
of pH3+ cells, but also represses BrdU incorporation (see Fig. S4D
in the supplementary material), indicating that FOS regulates entry
into S phase. In these cells, FOS might thus regulate the
transcription of essential S phase components. Further studies will
be required to identify such ISC-specific FOS target genes.
AP-1 and intestinal homeostasis
The maintenance of stem cells in a primed state, ready to respond
to inductive mitogenic stress signals, is likely to be crucial for highturnover tissues like the intestinal epithelium, which require rapid
activation of stem cell division for an efficient regenerative
response to tissue damage. At the same time, this enhanced
mitogenic potential of ISCs might contribute to the loss of tissue
homeostasis in the aging gut (Biteau et al., 2008), and contribute
to cancer formation in mammalian intestinal epithelia (Barker et
al., 2009; van der Flier and Clevers, 2009). Interestingly, a
conserved role of AP-1 transcription factors and JNK signaling in
the regulation of intestinal stem cell proliferation and intestinal
cancer is emerging in mice. JNK activation is sufficient to induce
cell proliferation in the intestinal crypt and increases tumor
incidence and tumor growth in an inflammation-induced colon
cancer model (Sancho et al., 2009). These effects of JNK signaling
DEVELOPMENT
EGF controls proliferation in the fly gut
are mediated by the FOS binding partner JUN, as shown by the
requirement for JNK-mediated phosphorylation of JUN for
APCmin/+-induced tumorigenesis (Nateri et al., 2005). Strikingly,
ISC-specific activation of WNT signaling, by mutating APC or
expressing an active form of -catenin or wingless itself, is
sufficient to induce the formation of tumor-like stem cell clusters
in the fly intestine (Lee et al., 2009; Lin et al., 2008). A potential
interaction of WNT signaling with JNK and JUN or FOS in ISCs
remains to be tested in Drosophila. Interestingly, increased FOS
activity has also recently been shown to be sufficient to promote
hematopoietic stem cell self-renewal in mice, further illustrating
the conserved function of FOS in the regulation of stem cell
function (Deneault et al., 2009). AP-1 transcription factors are thus
emerging as conserved essential regulators of stem cell function
and our findings provide an important starting point for further
studies characterizing stem cell-specific signaling networks that
integrate mitogenic, survival and stress signals to control stem cell
maintenance, quiescence and proliferation, and thus influence the
balance between regeneration and tumor suppression in high
turnover tissues.
Acknowledgements
We thank Dirk Bohmann, Jason Karpac and Christine Hochmuth for comments
on the manuscript. This work was supported by the National Institute on
Aging (NIH RO1 AG028127), NYSTEM (grant # N08G-048) and the Ellison
Medical Foundation (AG-SS-2224-08) to H.J., as well as an AFAR/Ellison
Medical Foundation postdoctoral fellowship to B.B. Deposited in PMC for
release after 12 months.
Competing interests statement
The authors declare no competing financial interests.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/lookup/suppl/doi:10.1242/dev.056671/-/DC1
References
Amcheslavsky, A., Jiang, J. and Ip, Y. T. (2009). Tissue damage-induced
intestinal stem cell division in Drosophila. Cell Stem Cell 4, 49-61.
Apidianakis, Y., Pitsouli, C., Perrimon, N. and Rahme, L. (2009). Synergy
between bacterial infection and genetic predisposition in intestinal dysplasia.
Proc. Natl. Acad. Sci. USA 106, 20883-20888.
Baker, N. E. and Rubin, G. M. (1989). Effect on eye development of dominant
mutations in Drosophila homologue of the EGF receptor. Nature 340, 150-153.
Barker, N., van de Wetering, M. and Clevers, H. (2008). The intestinal stem
cell. Genes Dev. 22, 1856-1864.
Barker, N., Ridgway, R. A., van Es, J. H., van de Wetering, M., Begthel, H.,
van den Born, M., Danenberg, E., Clarke, A. R., Sansom, O. J. and Clevers,
H. (2009). Crypt stem cells as the cells-of-origin of intestinal cancer. Nature 457,
608-611.
Beebe, K., Lee, W. C. and Micchelli, C. A. (2010). JAK/STAT signaling coordinates
stem cell proliferation and multilineage differentiation in the Drosophila
intestinal stem cell lineage. Dev. Biol. 338, 28-37.
Biteau, B., Hochmuth, C. E. and Jasper, H. (2008). JNK activity in somatic stem
cells causes loss of tissue homeostasis in the aging Drosophila gut. Cell Stem Cell
3, 442-455.
Biteau, B., Karpac, J., Supoyo, S., Degennaro, M., Lehmann, R. and Jasper,
H. (2010). Lifespan extension by preserving proliferative homeostasis in
Drosophila. PLoS Genet. 6, e1001159.
Brand, A. H. and Perrimon, N. (1994). Raf acts downstream of the EGF receptor
to determine dorsoventral polarity during Drosophila oogenesis. Genes Dev. 8,
629-639.
Brunner, D., Oellers, N., Szabad, J., Biggs, W. H., 3rd, Zipursky, S. L. and
Hafen, E. (1994). A gain-of-function mutation in Drosophila MAP kinase
activates multiple receptor tyrosine kinase signaling pathways. Cell 76, 875-888.
Bryder, D., Rossi, D. J. and Weissman, I. L. (2006). Hematopoietic stem cells: the
paradigmatic tissue-specific stem cell. Am. J. Pathol. 169, 338-346.
Buchon, N., Broderick, N. A., Chakrabarti, S. and Lemaitre, B. (2009a).
Invasive and indigenous microbiota impact intestinal stem cell activity through
multiple pathways in Drosophila. Genes Dev. 23, 2333-2344.
Buchon, N., Broderick, N. A., Poidevin, M., Pradervand, S. and Lemaitre, B.
(2009b). Drosophila intestinal response to bacterial infection: activation of host
defense and stem cell proliferation. Cell Host Microbe 5, 200-211.
Development 138 (6)
Chatterjee, M. and Ip, Y. T. (2009). Pathogenic stimulation of intestinal stem cell
response in Drosophila. J. Cell. Physiol. 220, 664-671.
Choi, N. H., Kim, J. G., Yang, D. J., Kim, Y. S. and Yoo, M. A. (2008). Agerelated changes in Drosophila midgut are associated with PVF2, a PDGF/VEGFlike growth factor. Aging Cell 7, 318-334.
Ciapponi, L., Jackson, D. B., Mlodzik, M. and Bohmann, D. (2001). Drosophila
Fos mediates ERK and JNK signals via distinct phosphorylation sites. Genes Dev.
15, 1540-1553.
Clifford, R. J. and Schupbach, T. (1989). Coordinately and differentially mutable
activities of torpedo, the Drosophila melanogaster homolog of the vertebrate
EGF receptor gene. Genetics 123, 771-787.
Cronin, S. J., Nehme, N. T., Limmer, S., Liegeois, S., Pospisilik, J. A.,
Schramek, D., Leibbrandt, A., Simoes Rde, M., Gruber, S., Puc, U. et al.
(2009). Genome-wide RNAi screen identifies genes involved in intestinal
pathogenic bacterial infection. Science 325, 340-343.
Crosnier, C., Stamataki, D. and Lewis, J. (2006). Organizing cell renewal in the
intestine: stem cells, signals and combinatorial control. Nat. Rev. Genet. 7, 349359.
Deneault, E., Cellot, S., Faubert, A., Laverdure, J. P., Frechette, M.,
Chagraoui, J., Mayotte, N., Sauvageau, M., Ting, S. B. and Sauvageau, G.
(2009). A functional screen to identify novel effectors of hematopoietic stem cell
activity. Cell 137, 369-379.
Gabay, L., Seger, R. and Shilo, B. Z. (1997). In situ activation pattern of
Drosophila EGF receptor pathway during development. Science 277, 11031106.
Gopinath, S. D. and Rando, T. A. (2008). Stem cell review series: aging of the
skeletal muscle stem cell niche. Aging Cell 7, 590-598.
Hull-Thompson, J., Muffat, J., Sanchez, D., Walker, D. W., Benzer, S.,
Ganfornina, M. D. and Jasper, H. (2009). Control of metabolic homeostasis by
stress signaling is mediated by the lipocalin NLaz. PLoS Genet. 5, e1000460.
Hyun, J., Becam, I., Yanicostas, C. and Bohmann, D. (2006). Control of G2/M
transition by Drosophila Fos. Mol. Cell. Biol. 26, 8293-8302.
Jiang, H. and Edgar, B. A. (2009). EGFR signaling regulates the proliferation of
Drosophila adult midgut progenitors. Development 136, 483-493.
Jiang, H., Patel, P. H., Kohlmaier, A., Grenley, M. O., McEwen, D. G. and
Edgar, B. A. (2009). Cytokine/Jak/Stat signaling mediates regeneration and
homeostasis in the Drosophila midgut. Cell 137, 1343-1355.
Jones, D. L. and Wagers, A. J. (2008). No place like home: anatomy and function
of the stem cell niche. Nat. Rev. Mol. Cell Biol. 9, 11-21.
Karim, F. D. and Rubin, G. M. (1998). Ectopic expression of activated Ras1
induces hyperplastic growth and increased cell death in Drosophila imaginal
tissues. Development 125, 1-9.
Kockel, L., Homsy, J. G. and Bohmann, D. (2001). Drosophila AP-1: lessons from
an invertebrate. Oncogene 20, 2347-2364.
Kumar, J. P., Tio, M., Hsiung, F., Akopyan, S., Gabay, L., Seger, R., Shilo, B. Z.
and Moses, K. (1998). Dissecting the roles of the Drosophila EGF receptor in
eye development and MAP kinase activation. Development 125, 3875-3885.
Lee, T. and Luo, L. (1999). Mosaic analysis with a repressible cell marker for
studies of gene function in neuronal morphogenesis. Neuron 22, 451-461.
Lee, W. C., Beebe, K., Sudmeier, L. and Micchelli, C. A. (2009). Adenomatous
polyposis coli regulates Drosophila intestinal stem cell proliferation. Development
136, 2255-2264.
Lin, G. and Xi, R. (2008). Intestinal stem cell, muscular niche and Wingless
signaling. Fly 2, 310-312.
Lin, G., Xu, N. and Xi, R. (2008). Paracrine Wingless signalling controls selfrenewal of Drosophila intestinal stem cells. Nature 455, 1119-1123.
Lin, G., Xu, N. and Xi, R. (2009). Paracrine unpaired signaling through the
JAK/STAT pathway controls self-renewal and lineage differentiation of
Drosophila intestinal stem cells. J. Mol. Cell Biol. 2, 37-49.
Luo, X., Puig, O., Hyun, J., Bohmann, D. and Jasper, H. (2007). Foxo and Fos
regulate the decision between cell death and survival in response to UV
irradiation. EMBO J. 26, 380-390.
Mathur, D., Bost, A., Driver, I. and Ohlstein, B. (2010). A transient niche
regulates the specification of Drosophila intestinal stem cells. Science 327, 210213.
McGuire, S. E., Le, P. T., Osborn, A. J., Matsumoto, K. and Davis, R. L. (2003).
Spatiotemporal rescue of memory dysfunction in Drosophila. Science 302, 17651768.
Micchelli, C. A. and Perrimon, N. (2006). Evidence that stem cells reside in the
adult Drosophila midgut epithelium. Nature 439, 475-479.
Morrison, S. J. and Spradling, A. C. (2008). Stem cells and niches: mechanisms
that promote stem cell maintenance throughout life. Cell 132, 598-611.
Nateri, A. S., Spencer-Dene, B. and Behrens, A. (2005). Interaction of
phosphorylated c-Jun with TCF4 regulates intestinal cancer development. Nature
437, 281-285.
Ohlstein, B. and Spradling, A. (2006). The adult Drosophila posterior midgut is
maintained by pluripotent stem cells. Nature 439, 470-474.
Ohlstein, B. and Spradling, A. (2007). Multipotent Drosophila intestinal stem
cells specify daughter cell fates by differential notch signaling. Science 315, 988992.
DEVELOPMENT
1054 RESEARCH ARTICLE
Park, J.-S., Kim, Y.-S. and Yoo, M.-A. (2009). The role of p38b MAPK in agerelated modulation of intestinal stem cell proliferation and differentiation in
Drosophila. Aging 1, 637-651.
Pignoni, F. and Zipursky, S. L. (1997). Induction of Drosophila eye development
by decapentaplegic. Development 124, 271-278.
Pitsouli, C., Apidianakis, Y. and Perrimon, N. (2009). Homeostasis in infected
epithelia: stem cells take the lead. Cell Host Microbe 6, 301-307.
Radtke, F. and Clevers, H. (2005). Self-renewal and cancer of the gut: two sides
of a coin. Science 307, 1904-1909.
Rando, T. A. (2006). Stem cells, ageing and the quest for immortality. Nature 441,
1080-1086.
Rossi, D. J., Jamieson, C. H. and Weissman, I. L. (2008). Stems cells and the
pathways to aging and cancer. Cell 132, 681-696.
Sancho, R., Nateri, A. S., de Vinuesa, A. G., Aguilera, C., Nye, E., SpencerDene, B. and Behrens, A. (2009). JNK signalling modulates intestinal
homeostasis and tumourigenesis in mice. EMBO J. 28, 1843-1854.
Sharpless, N. E. and DePinho, R. A. (2007). How stem cells age and why this
makes us grow old. Nat. Rev. Mol. Cell Biol. 8, 703-713.
RESEARCH ARTICLE 1055
Shilo, B. Z. (2005). Regulating the dynamics of EGF receptor signaling in space
and time. Development 132, 4017-4027.
Suzanne, M., Perrimon, N. and Noselli, S. (2001). The Drosophila JNK pathway
controls the morphogenesis of the egg dorsal appendages and micropyle. Dev.
Biol. 237, 282-294.
van der Flier, L. G. and Clevers, H. (2009). Stem cells, self-renewal, and
differentiation in the intestinal epithelium. Annu. Rev. Physiol. 71, 241-260.
Voog, J. and Jones, D. L. (2010). Stem cells and the niche: a dynamic duo. Cell
Stem Cell 6, 103-115.
Weber, U., Paricio, N. and Mlodzik, M. (2000). Jun mediates Frizzled-induced
R3/R4 cell fate distinction and planar polarity determination in the Drosophila
eye. Development 127, 3619-3629.
Weston, C. R. and Davis, R. J. (2002). The JNK signal transduction pathway. Curr.
Opin. Genet. Dev. 12, 14-21.
Zeitlinger, J., Kockel, L., Peverali, F. A., Jackson, D. B., Mlodzik, M. and
Bohmann, D. (1997). Defective dorsal closure and loss of epidermal
decapentaplegic expression in Drosophila fos mutants. EMBO J. 16, 73937401.
DEVELOPMENT
EGF controls proliferation in the fly gut