3880 RESEARCH ARTICLE
Development 139, 3880-3890 (2012) doi:10.1242/dev.083576
© 2012. Published by The Company of Biologists Ltd
The histone acetyltransferases CBP and Chameau integrate
developmental and DNA replication programs in Drosophila
ovarian follicle cells
Kristopher H. McConnell, Michael Dixon and Brian R. Calvi*
SUMMARY
DNA replication origin activity changes during development. Chromatin modifications are known to influence the genomic location
of origins and the time during S phase that they initiate replication in different cells. However, how chromatin regulates origins in
concert with cell differentiation remains poorly understood. Here, we use developmental gene amplification in Drosophila ovarian
follicle cells as a model to investigate how chromatin modifiers regulate origins in a developmental context. We find that the histone
acetyltransferase (HAT) Chameau (Chm) binds to amplicon origins and is partially required for their function. Depletion of Chm had
relatively mild effects on origins during gene amplification and genomic replication compared with previous knockdown of its
ortholog HBO1 in human cells, which has severe effects on origin function. We show that another HAT, CBP (Nejire), also binds
amplicon origins and is partially required for amplification. Knockdown of Chm and CBP together had a more severe effect on
nucleosome acetylation and amplicon origin activity than knockdown of either HAT alone, suggesting that these HATs collaborate
in origin regulation. In addition to their local function at the origin, we show that Chm and CBP also globally regulate the
developmental transition of follicle cells into the amplification stages of oogenesis. Our results reveal a complexity of origin
epigenetic regulation by multiple HATs during development and suggest that chromatin modifiers are a nexus that integrates
differentiation and DNA replication programs.
INTRODUCTION
A central unanswered question in DNA replication is the
mechanism by which multicellular eukaryotes select sites in their
genome to act as origins (Mechali, 2010). A strict DNA consensus
for origins has not been identified. Moreover, which loci are
selected to be origins and when they initiate during S phase can
change during development. In humans, origin misregulation is the
basis for specific heritable developmental syndromes and
contributes to genome instability and cancer (Bicknell et al., 2011a;
Bicknell et al., 2011b; Guernsey et al., 2011; Hook et al., 2007;
Shima et al., 2007). Evidence suggests that chromatin modification
plays an important role in origin developmental plasticity, but the
mechanism for origin specification and integration with
development remains little understood. In this study, we investigate
these questions using as a model the origins that mediate
developmental gene amplification in the Drosophila ovary.
Origin DNA is bound by a pre-replicative complex (pre-RC) that
is then activated to initiate replication during S phase (Remus and
Diffley, 2009). Analysis of origins in S. cerevisiae identified a DNA
consensus sequence for the binding site of the origin recognition
complex (ORC), a component of the pre-RC. In multicellular
eukaryotes, sites of pre-RC binding and replication initiation have
been mapped genome-wide in a number of organisms, yet a strict
DNA consensus for origins has not emerged (Bell et al., 2010;
Cadoret, 2008; Cayrou et al., 2011; Eaton et al., 2011; Hiratani et al.,
2008; MacAlpine et al., 2010; Schwaiger et al., 2009). Moreover,
metazoan ORC has little binding specificity in vitro, except for a bias
Department of Biology, Indiana University, Bloomington, IN 47405, USA.
*Author for correspondence ([email protected])
Accepted 29 July 2012
for poly(A)-poly(T) tracts and superhelical DNA (Bielinsky et al.,
2001; Remus et al., 2004; Vashee et al., 2003). Despite this apparent
lack of sequence specificity, replication initiation occurs at preferred
genomic sites in vivo. Which sites are selected to be origins and the
time that they initiate replication during S phase can both change
during development (Hiratani et al., 2008; Mechali, 2010; Nordman
and Orr-Weaver, 2012; Sasaki et al., 1999; Shinomiya and Ina,
1991). Despite recent advances, the mechanisms that determine
differential origin usage during development remain largely
undefined.
The developmental plasticity of origins provided early evidence
that epigenetic mechanisms might play an important role in origin
regulation in eukaryotes (Edenberg and Huberman, 1975; Hyrien
et al., 1995; Shinomiya and Ina, 1991). Recent genomic analyses
have shown a correlation between active origin loci and chromatin
status, including nucleosome position, histone modification and
histone variants (Bell et al., 2010; Cadoret, 2008; Cayrou et al.,
2011; Eaton et al., 2011; Hiratani et al., 2008; MacAlpine et al.,
2010; Muller et al., 2010; Schwaiger et al., 2009). Several studies
have demonstrated that the acetylation of nucleosomes promotes
ORC binding, active origin selection and early replication initiation
during S phase (Aggarwal and Calvi, 2004; Danis et al., 2004;
Hartl et al., 2007; Kim et al., 2011; Pappas et al., 2004; Schwaiger
et al., 2009; Vogelauer et al., 2002). Moreover, a number of specific
histone acetyltransferases (HATs) and histone deacetylases
(HDACs) have been shown to influence origin activity (Aggarwal
and Calvi, 2004; Doyon et al., 2006; Espinosa et al., 2010; Iizuka
et al., 2006; Iizuka and Stillman, 1999; Karmakar et al., 2010;
Miotto and Struhl, 2008; Miotto and Struhl, 2010; Pappas et al.,
2004; Vogelauer et al., 2002; Wong et al., 2010). Nevertheless, how
different HATs and HDACS regulate origins in concert with
development remains poorly understood.
DEVELOPMENT
KEY WORDS: DNA replication, Histone acetylation, Gene amplification
RESEARCH ARTICLE 3881
HATs in gene amplification
MATERIALS AND METHODS
Drosophila strains and genetics
Standard techniques were used for culture of Drosophila melanogaster at
25°C. UAS:Flag-Mcm6 (Schwed et al., 2002) and c323:Gal4 (Manseau et
al., 1997) and OregonRmodencode (Roy et al., 2010) were described
previously. UAS:Myc-chm and chm14 strains were a gift from Y. Graba and
J. Pradel (Grienenberger et al., 2002). Orc2dsRNA and chmdsRNA-2 were
obtained from the Vienna Drosophila RNAi Center (Dietzl et al., 2007).
chmdsRNA-1, chmshRNA, CBPdsRNA-3 and RNAi against mof, Taf1 and enok
were obtained from the Transgenic RNAi Project (TRiP) via the
Bloomington Drosophila Stock Center (BDSC) (Ni et al., 2008; Ni et al.,
2011). RNAi against Pcaf (GCN5) was also from the BDSC (Carre et al.,
2005). RNAi against Tip60 was a gift from F. Elefant (Zhu et al., 2007).
CBPdsRNA-1, CBPdsRNA-2 and CBP mutant flies were gifts from J. Kumar
(Kumar et al., 2004).
Immunolabeling and microscopy
Antibody, BrdU and DAPI labeling were performed as previously
described (Calvi and Lilly, 2004). We used the following antibodies and
concentrations: mouse anti-BrdU 1:20 (Becton Dickinson), rabbit anti-CBP
1:200 [gift from M. Mannervik (Lilja et al., 2003)], rabbit anti-H4K12ac
1:200 (Upstate Technologies), mouse anti-Cut 1:15 [Developmental
Studies Hybridoma Bank (Blochlinger et al., 1990)]. Secondary antibodies
Alexa 488 anti-rabbit, Alexa 488 anti-mouse, Alexa 568 anti-mouse and
Alexa 633 anti-mouse were used at 1:500 (Invitrogen). Images were taken
with a Leica DMRA2 widefield epifluorescence microscope, except for
Fig. 5 and Fig. 6A, which were taken with a Leica SP5 laser scanning
confocal microscope.
Quantification and statistical analysis
BrdU and DAPI fluorescence were quantified using Openlab v5.0.2
(Improvision). For quantification of BrdU fluorescence, the brightest
amplification focus in each nucleus was measured, which corresponds to
DAFC-66D. Only nuclei containing visible BrdU foci were included. For
both BrdU and DAPI fluorescence, 20 wild-type nuclei in each egg
chamber were measured to determine the wild-type average fluorescence.
Fluorescence intensity of nuclei in each mutant clone was normalized to
the average wild-type fluorescence within the same egg chamber. Statistical
significance was determined using an unpaired t-test, except for the
quantification of chm14 clone size compared with wild-type twin spot in
Fig. 3B, which used a paired t-test.
Generation of Chm antibody
The unique N-terminal 114 amino acids of Chm were cloned into pGEX6P-1 (GE Healthcare) and expressed in competent E. coli BL-21 cells
(Stratagene). GST-Chm1-114 was purified with Glutathione Sepharose 4B
beads (GE Healthcare), then eluted off the beads and sent to Covance
Research Products for injection into rabbits. Chm1-114 was then removed
from GST by PreScission Protease (GE Healthcare) cleavage, conjugated
to Affigel-10 (BioRad), and used for affinity purification of anti-Chm
antibody from serum.
Chromatin immunoprecipitation (ChIP)
ChIP was performed as described (Negre et al., 2006). Whole ovaries were
isolated by blending well-conditioned females in cold PBS/0.02% Tween
20. Ovaries were allowed to settle for 2-3 minutes, then separated from
remaining fly tissue using wire mesh filters. Ovaries were then fixed for
15 minutes in 1.8% paraformaldehyde, during which cells were lysed using
a Potter homogenizer and dounce homogenizer (Kontes). This was
followed by quenching with 225 mM glycine. Lysates were sonicated to a
modal length of 500 bp. Immunoprecipitations were performed overnight
at 4°C with primary antibody, then incubated for 2 hours with Protein A
agarose beads (Invitrogen). Beads were centrifuged and washed four times
with lysis buffer, twice with Tris/EDTA, and eluted overnight at 65°C to
reverse crosslinks. Eluted material and input were treated with 1 g
RNaseA (Roche 11119915001) and 50 g proteinase K (New England
Biolabs). DNA was purified by phenol/chloroform extraction and ethanol
precipitated. qPCR analysis was performed as described (Liu et al., 2012)
using the following primers (5⬘-3⬘, forward and reverse): ACE3,
GCAGTGGCCTGAAAATTCTGCT and AGCTTAGTGCGGCAGTTTGGAA; Cp18, TCCCTCATACGGTGGTGGATA and CCGGAGTACTGAGATCCCACAT; Ori-, GACTCTTCCAAATGGGAACCAC and
CAACCGACCTGGAAACCATTAC; ACE3+10kb, GAGACAAGAGGACCAGCCCATC and GAAAGGGAACCCAAAGCAAACC; Rh2,
AGGACCTCAATGGGTTGAGAGA and CCATGGTTGGAGTAAATGACCA.
RESULTS
The Drosophila ortholog of HBO1, Chm, interacts
with the MCM complex in ovarian follicle cells
The unit of egg production during Drosophila oogenesis is the egg
chamber (Fig. 1A) (Bastock and St Johnston, 2008; Spradling,
1993). Egg chambers consist of one oocyte and 15 sister germline
nurse cells surrounded by an epithelial sheet of somatic follicle cells.
Egg chambers proceed through 14 defined stages of development as
they migrate down a structure called the ovariole (King, 1970). The
somatic follicle cells undergo transitions in the cell cycle program in
DEVELOPMENT
Early evidence for a role of histone acetylation in origin
regulation came from analysis of developmental gene amplification
in the Drosophila ovary (Aggarwal and Calvi, 2004; Hartl et al.,
2007). Late in oogenesis, the somatic follicle cells surrounding the
oocyte cease genomic replication and begin site-specific replication
from origins at only six loci (Calvi, 2006; Kim et al., 2011). The
reinitiation of replication from these origins results in the
amplification of DNA copy number for genes involved in eggshell
synthesis (Spradling, 1981). Similar to other origins, these
amplicon origins are bound by the pre-RC and regulated by the cell
cycle kinases CDK2 and CDC7 [Cdc2c and l(1)G0148 – FlyBase]
(Calvi, 2006; Calvi et al., 1998; Claycomb and Orr-Weaver, 2005;
Landis and Tower, 1999). Precisely at the onset of stage 10B,
nucleosomes at amplicon origins become hyperacetylated, ORC
binds and the origin becomes active (Aggarwal and Calvi, 2004;
Austin et al., 1999). At the best-characterized origin, DAFC-66D,
acetylation rapidly declines in stage 11/12, ORC departs and
replication initiation ceases, but replication forks continue to
migrate outwards (Aggarwal and Calvi, 2004; Austin et al., 1999).
Evidence suggested that nucleosome acetylation contributes to
amplicon origin locus specificity and the efficiency with which
they initiate replication (Aggarwal and Calvi, 2004). We recently
showed that multiple lysines on histones H3 and H4 are
hyperacetylated at the amplicon origins, and that acetylation of
certain lysines is dependent on different steps of pre-RC assembly
(Liu et al., 2012). The acetylation on multiple lysines suggested
that several HATs might regulate amplicon origins, but the identity
of these HATs is not known. Moreover, it is not known how
developmental signals integrate with chromatin modifiers to ensure
amplicon activity at the proper time in oogenesis.
Here, we use gene amplification in the Drosophila ovary to
investigate the epigenetic regulation of origins in a developmental
context. We show that the HAT Chameau (Chm) is required for
normal levels of amplification, but, unlike its human ortholog
HBO1, Chm is not absolutely required for gene amplification or
genomic replication. We further show that the HAT CBP (Nejire)
collaborates with Chm to promote wild-type levels of gene
amplification. Importantly, our data suggest that Chm and CBP
might function both locally at the amplicon origins and globally in
the developmental transition of follicle cells into the amplification
stage of oogenesis. Our results imply that epigenetic mechanisms
might have a more general role for the coordination of DNA
replication programs with cell development.
Fig. 1. Chm interacts with the MCM complex and binds the
DAFC-66D origin in amplification stage follicle cells. (A)Drosophila
egg chamber development during oogenesis. Development proceeds
from left to right as shown. The somatic follicle cells surrounding each
egg chamber originate from follicle stem cells (FSCs) in the germarium,
proliferate via the mitotic cycle in stages 1-6, proceed through three
endocycles in stages 7-10A, and then amplify specific loci in stages
10B-14. The stages during which c323:Gal4 becomes increasingly
active are indicated beneath by a graded line. (B)Myc-Chm interacts
with Flag-Mcm6. UAS:Myc-chm and/or UAS:Flag-Mcm6 were expressed
in stage 9-14 follicle cells using c323:Gal4. Ovary lysates were
immunoprecipitated (IP) with antibodies against Myc (lanes 3 and 4) or
Flag (lanes 7 and 8) and analyzed by western blot against either FlagMcm6 (lanes 1-4) or Myc-Chm (lanes 5-8). The presence (+) or absence
(–) of Flag-Mcm6 and Myc-Chm in the different fly strains is indicated
above each lane. (C)Endogenous Chm interacts with Flag-Mcm6.
c323:Gal4; UAS:Flag-Mcm6 ovary lysates were immunoprecipitated
with anti-Chm (lane 3) or normal rabbit serum (N, lane 2) and western
blots incubated with anti-Flag. (D)The endogenous MCM complex
interacts with Myc-Chm. c323:Gal4; UAS:Myc-chm ovaries were
immunoprecipitated with anti-pan-MCM (lane 6) or normal mouse
serum (N, lane 5) and western blots incubated with anti-Myc. Asterisk
indicates myc-Chm degradation product. (E)Myc-Chm binds the DAFC66D origin in vivo. ChIP of c323:Gal4; UAS:Myc-chm whole-ovary
lysates with anti-Myc. Enriched DNA was analyzed by qPCR using
primers to ACE3, Ori- and Cp18 regions of the DAFC-66D origin (map
below), a region 10 kb distal from the core origin, and the negative
control locus Rhodopsin 2 (Rh2). Fold enrichment in the pellet was
normalized to input and to the Rh2 locus. Plotted values represent the
average of two biological replicates and error bars represent the range.
Enrichment was not observed with pre-immune serum (data not
shown).
coordination with egg chamber development. Two follicle cell stem
cells (FSCs) reside in the anterior of the ovariole in a structure called
the germarium (Margolis and Spradling, 1995; Nystul and Spradling,
2007). FSC daughter cells proliferate and then form an epithelial
sheet around the germline cyst, which together bud off as a stage 1
egg chamber. Follicle cells increase in number by a canonical mitotic
Development 139 (20)
division cycle before stage 7, and then switch into an endocycle
comprising G and S phases without mitosis (Deng et al., 2001;
Lopez-Schier and St Johnston, 2001; Mahowald et al., 1979;
Shcherbata et al., 2004). Follicle cells undergo three endocycles
during stage 7-10A and then in stage 10B enter the amplification
stage during which only select loci reinitiate DNA replication (Calvi,
2006; Calvi et al., 1998; Claycomb and Orr-Weaver, 2005; Spradling
and Mahowald, 1980).
Nucleosome acetylation plays an important role in the
developmental activation of the amplicon origins. To determine
which HATs are responsible for this acetylation, we initially focused
on the gene chameau (chm), the Drosophila ortholog of human
HBO1 (KAT7 – Human Genome Nomenclature Committee). In
human cells, HBO1 associates with CDT1 and other pre-RC subunits
and acetylates nucleosomes at origins, which is required for
subsequent binding of the hexameric minichromosome maintenance
(MCM) helicase complex to origin DNA during pre-RC assembly
(Doyon et al., 2006; Iizuka et al., 2006; Iizuka and Stillman, 1999;
Miotto and Struhl, 2008; Miotto and Struhl, 2010). Human HBO1
protein also physically interacts with the Drosophila ortholog of the
MCM subunit Mcm2 in a yeast two-hybrid assay (Burke et al.,
2001). We had previously shown that Chm can stimulate gene
amplification in Drosophila when tethered to an amplicon origin in
vivo, suggesting that the function of HBO1/Chm in origin regulation
might be conserved from flies to humans (Aggarwal and Calvi,
2004). It is not known, however, whether Chm normally regulates
Drosophila origins during developmental gene amplification or
genomic replication. Previous characterization of chm mutants in
Drosophila showed that it is required as a transcriptional co-activator
during metamorphosis and also influences heterochromatic silencing,
but a role in DNA replication has not been explored (Grienenberger
et al., 2002; Miotto et al., 2006).
To determine whether Chm regulates amplicon origins, we first
tested whether Chm physically interacts with the MCM complex
in Drosophila follicle cells during gene amplification. The
UAS:Myc-chm and UAS:Flag-Mcm6 epitope-tagged transgenes
were expressed in stage 9-14 follicle cells using the c323:Gal4
driver (Fig. 1A) (Grienenberger et al., 2002; Manseau et al., 1997).
We had previously used c323:Gal4 and UAS:Flag-Mcm6 to show
that Drosophila Mcm6 associates with the MCM complex and is
required for developmental gene amplification (Schwed et al.,
2002). Immunoprecipitation (IP) of Myc-Chm resulted in co-IP of
Flag-Mcm6 protein (Fig. 1B, lane 4), and the reciprocal IP of FlagMcm6 resulted in co-IP of Myc-Chm (Fig. 1B, lane 7). In controls,
anti-Myc did not result in IP of Flag-Mcm6 from fly strains lacking
Myc-Chm, nor did anti-Flag result in IP of Myc-Chm without FlagMcm6 (Fig. 1B, lanes 3 and 8).
To examine endogenous Chm protein, we generated a polyclonal
rabbit antibody against the unique N-terminal 114 amino acids of
Chm. IP of endogenous Chm protein with this anti-Chm antibody
resulted in co-IP of Flag-Mcm6 (Fig. 1C). IP of endogenous MCM
proteins with a pan-MCM antibody that recognizes all six subunits
of the MCM complex resulted in co-IP of Myc-Chm (Fig. 1D)
(Klemm and Bell, 2001). We were unable to detect co-IP of Chm
with the MCM complex in wild-type cells without overexpression.
Together, these results suggest that Chm physically interacts with
the MCM complex in follicle cells when amplification origins are
active and nucleosomes at the origins are acetylated.
Myc-Chm associates with the DAFC-66D origin
We next examined whether Chm associates with amplicon origins
in vivo. We used Myc-Chm for ChIP followed by qPCR for
DEVELOPMENT
3882 RESEARCH ARTICLE
DAFC-66D amplicon origin DNA, normalized to input and the
Rhodopsin 2 (Rh2) control locus. To achieve specificity for follicle
cells late in oogenesis during amplification, we again used
c323:Gal4 to drive expression of UAS:Myc-chm. ChIP with antiMyc antibodies showed that Myc-Chm was enriched at DAFC66D, including the ACE3 and Ori- regions, which are both
required in cis for origin function (Fig. 1E) (Heck and Spradling,
1990; Orr-Weaver and Spradling, 1986). Myc-Chm was also
enriched within the body of the Cp18 gene, but was less enriched
at a region 10 kb from ACE3 (Fig. 1E). This pattern of enrichment
is consistent with the broad domain of histone acetylation that was
previously defined at DAFC-66D (Kim et al., 2011; Liu et al.,
2012). Together, these results suggest that Chm protein associates
with the MCM complex and the DAFC-66D amplicon origin
during gene amplification in follicle cells late in oogenesis.
Chm HAT activity is required for wild-type
amplification levels
Our results suggested that Chm protein associates with and might
directly regulate amplicon origins. To genetically test whether chm is
required in the adult ovary, it was necessary to use conditional
knockdown because chm homozygous null mutants are pupal lethal
due to reduced expression of genes regulated by the JNK pathway
(Grienenberger et al., 2002; Miotto et al., 2006). We therefore
induced RNAi against chm by expressing UAS:hairpin RNA
transgenes in follicle cell clones using a Flp recombinase-inducible
Act:Gal4 (hereafter referred to as Flp-Out) (Pignoni and Zipursky,
1997). In this system, heat shock induction of hsp70:Flp recombinase
results in activation of Act:Gal4 in a single founder cell, which after
several days of cell proliferation results in a clone of cells in stage
10B egg chambers that expresses UAS:dsRed and the UAS:hairpin
RNA. We then assayed developmental amplification in these cells by
measuring BrdU incorporation into amplification foci using
fluorescence microscopy, and compared it with control cells not
expressing the UAS:hairpin RNA in the same egg chamber (Calvi
and Lilly, 2004). As proof of principle, we created clones expressing
dsRNA against the origin-binding protein Orc2, and analyzed
RESEARCH ARTICLE 3883
amplification 5 days later. Similar to loss-of-function mutants of
Orc2, knockdown of Orc2 by RNAi abolished BrdU incorporation
into amplification foci (Fig. 2B) (Landis et al., 1997). RNAi
knockdown of the pre-RC protein Double parked (Dup), which is the
fly ortholog of Cdt1, also abolished amplification (data not shown),
whereas clones expressing Gal4 alone had no effect (Fig. 2A).
We used three different Drosophila strains that contain Gal4inducible hairpin RNA for knockdown of Chm. These included two
separate dsRNA hairpins (dsRNA-1 and dsRNA-2) and one short
hairpin microRNA (shRNA) (Dietzl et al., 2007; Ni et al., 2008; Ni
et al., 2011). Clones expressing either chmdsRNA-1 or chmdsRNA-2
transgenes had prominent amplicon BrdU foci beginning in stage
10B (Fig. 2C,D). Quantification revealed, however, that there was
a small but significant reduction in the intensity of BrdU foci
within the chmdsRNA-expressing cells compared with control cells
in the same egg chambers (Fig. 2G). By contrast, expression of the
chmshRNA transgene resulted in a greater reduction in BrdU focal
intensity, including some cells with no detectable BrdU foci (Fig.
2E,G). In addition, some cells within each clone had BrdU
incorporation throughout the nucleus, indicating that the normal
site-specific replication in these cells was disrupted (Fig. 2E). The
RNAi results suggested that Chm is required for wild-type levels
of developmental gene amplification.
RNAi knockdown of Chm with different hairpin transgenes
resulted in different severities of phenotype. Although this could
be due to greater knockdown by chmshRNA, it was possible that the
more severe phenotype of chmshRNA was caused by the off-target
knockdown of other genes. We could not distinguish between these
possibilities with our Chm polyclonal antibody because it did not
reliably detect endogenous Chm protein in fixed tissues (data not
shown). Therefore, to further test whether Chm is required for
developmental gene amplification, we analyzed a chm14 null allele,
which is a ~8 kb deletion that removes the last three exons of the
gene and disrupts the conserved Myst family HAT domain
(Grienenberger et al., 2002). Since animals homozygous for this
allele die during metamorphosis, we created an FRT chm14
chromosome and generated homozygous mutant clones in
Fig. 2. Compromised Chm function reduces, but does not eliminate, amplification. (A-E)UAS:RNA hairpin transgenes corresponding to the
indicated gene were expressed in follicle cell clones using a Flp-inducible Act:Gal4 (Flp-Out), and assayed for gene amplification by incorporation of
BrdU, which labels sites of active amplification as foci. Gray, DAPI; red, anti-BrdU labeling. Clones expressing different hairpin RNA transgenes are
outlined in each panel. (A)Act:Gal4 alone, (B) Orc2dsRNA, (C) chmdsRNA-1, (D) chmdsRNA-2, (E) chmshRNA. (F)Gene amplification in permanent
chm14/chm14 stem cell clones was analyzed by BrdU labeling (red) and compared with control heterozygous chm14/GFP cells in the same egg
chamber. (A-F)Follicle cells from stage 10B egg chambers are shown. Scale bars: 10m. (G)Quantification of BrdU fluorescence intensity at DAFC66D in cells with reduced chm (red bars) relative to wild-type cells (blue bars) within the same egg chamber. n>40 nuclei from at least three
separate egg chambers. **P<0.01, ***P<0.0001. Error bars indicate s.e.m.
DEVELOPMENT
HATs in gene amplification
heterozygous chm14/chm+ Ubi:GFP animals. To maximize
depletion of Chm protein, stage 10 follicle cells were assayed for
amplification 10 days after heat induction of hsp70:Flp
recombinase, at which point permanent GFP-negative clones are
derived from a single homozygous chm14 FSC in the germarium
(Margolis and Spradling, 1995). These chm14 homozygous mutant
follicle cells had BrdU amplification foci of normal appearance
beginning in stage 10B (Fig. 2F). Quantification of fluorescence
intensity, however, showed that BrdU incorporation was slightly
but significantly reduced in the chm14 homozygous cells compared
with chm14 heterozygous cells in the same egg chamber (Fig. 2G).
This mild phenotype for the chm14 null cells, which are derived
from null stem cells after 10 days and ~8 cell divisions, was similar
to that of chmdsRNA-1 and chmdsRNA-2. It is likely, therefore, that the
more severe phenotype of chmshRNA is due to off-target effects, and
thus this hairpin construct was not analyzed further. The combined
results of this genetic mosaic analysis suggested that Chm is at
least partially required for developmental gene amplification.
Chm knockdown has mild effects on cell
proliferation and genomic DNA replication
Knockdown of HBO1 in human cells in culture results in severe
defects in MCM loading at origins, which impairs DNA replication
and cell proliferation (Doyon et al., 2006; Iizuka et al., 2006; Iizuka
and Stillman, 1999; Miotto and Struhl, 2008; Miotto and Struhl,
2010). Therefore, we were surprised to observe large clones of
follicle cells after RNAi knockdown and from the mutant chm14
FSC. This suggests that depletion of Chm does not significantly
affect FSC divisions or the mitotic proliferation of follicle cells that
occurs before stage 7 of oogenesis. To quantify this, we counted the
number of cells in the Flp-Out dsRed+ transient clones expressing
chmdsRNA-2, and compared them with control clones generated in
animals that do not have a UAS:RNAi transgene. Although
chmdsRNA-2-expressing clones had a wide range of cell numbers, this
range was comparable to that of control clones, suggesting that
depletion of Chm does not affect cell proliferation (Fig. 3A).
However, the RNAi and FSC clones do not have a wild-type ‘twin
spot’ to facilitate direct comparison of proliferation rates between
Chm-depleted and wild-type cells in the same egg chambers.
Therefore, we generated transient chm14 homozygous mutant clones,
and compared the number of cells in these GFP-negative clones with
the corresponding wild-type GFP+/GFP+ twin spots derived from
the same recombination event. The number of cells in chm14 mutant
clones was not significantly different from the twin spot controls
Development 139 (20)
(Fig. 3B). Together, the chm14 and RNAi results suggest that
depletion of Chm does not have a detectable effect on the
proliferation of follicle cells that occurs before stage 7 of oogenesis.
We also determined whether depletion of Chm compromises
endoreplication of DNA during the three follicle cell endocycles
that occur during stages 7-10A. During each endocycle, DNA
endoreplication results in an approximate doubling of cellular DNA
content and total DAPI fluorescence (Calvi et al., 1998; Mahowald
et al., 1979; Maqbool et al., 2010). To assay final DNA content, we
measured DAPI fluorescence in cells of stage 10B mutant clones
and compared it with wild-type cells within the same egg
chambers. Follicle cells within the permanent chm14 clones had
similar DAPI fluorescence to wild-type cells (Fig. 3C). DAPI
fluorescence was also similar between chmdsRNA-2 and control cells
(Fig. 3C). To directly analyze endoreplication, we labeled ovaries
with BrdU. Examination of endocycling follicle cells during stages
7-10A indicated that chm14 clones are indistinguishable from wild
type in the appearance and fraction of BrdU-labeled cells (Fig. 3D).
These data suggest that depletion of Chm has, at most, only a mild
effect on endoreplication.
Knockdown of the Drosophila CBP/p300 ortholog
Nejire impairs gene amplification
The biochemical results suggested that Chm associates with the
MCM complex and amplicon origins, but genetic depletion did not
completely eliminate amplification. We therefore considered the
possibility that the function of Chm at the amplicon origins is
partially redundant with other HATs. In support of this hypothesis,
we recently found that numerous lysines on histones H3 and H4
are hyperacetylated during gene amplification, suggesting that
multiple HATs might regulate origins in follicle cells (Liu et al.,
2012). To determine whether other HATs regulate gene
amplification, we expressed UAS hairpin RNAs against different
HATs using the Flp-Out system. These included RNAi transgenes
against Pcaf (GCN5), mof, enok, Taf1, Tip60 and CBP (see
Materials and methods). From this candidate screen, we found that
knockdown of Nejire (Nej), which is the Drosophila ortholog of
the HAT CBP/p300, impaired amplification (Akimaru et al., 1997).
We used two strains that have the same UAS:CBP hairpin RNA
inserted in different genomic positions and have been shown to
disrupt normal eye development (Kumar et al., 2004). Expression of
UAS:CBPdsRNA-1 severely reduced incorporation of BrdU into
amplification foci, whereas UAS:CBPdsRNA-2 did not, the likely result
of a genomic position effect on hairpin RNA expression
Fig. 3. Compromised Chm function has mild effects on cell proliferation and genomic replication. (A)The number of nuclei in Flp-Out
clones. n9 stage 7-9 egg chambers representing more than 700 cells per genotype. (B)The number of nuclei in homozygous chm14 clones
compared with their homozygous wild-type ‘twin spot’ (GFP/GFP). n21 egg chambers and more than 400 cells per genotype. (C)To assess
polyploid DNA content after endocycles, total DAPI fluorescence was measured within stage 10B follicle cells with reduced Chm (red bars) relative
to wild-type cells (blue bars) within the same egg chamber. Error bars indicate s.e.m. (D) BrdU labeling of endocycling chm14 cells from a stage 9
egg chamber. Scale bar: 25m.
DEVELOPMENT
3884 RESEARCH ARTICLE
HATs in gene amplification
RESEARCH ARTICLE 3885
(Fig. 4A,B,I). Consistent with the severity of phenotypes,
UAS:CBPdsRNA-2 clones had reduced but detectable CBP protein,
whereas CBP protein was undetectable in UAS:CBPdsRNA-1 clones
(Fig. 4E,F). Expression of a third CBP hairpin RNA, UAS:CBPdsRNA3
, also severely disrupted amplification and greatly reduced CBP
protein levels (Fig. 4C,G) (Ni et al., 2008). In addition, some cells in
the UAS:CBPdsRNA-3 and UAS:CBPdsRNA-1 clones had BrdU labeling
throughout the nucleus (Fig. 4A,C). We attempted to validate these
RNAi results by clonal analysis of CBP loss-of-function alleles using
the Flp/FRT system. Clones of the mild alleles CBP131 and CBPS342
did not have an effect on BrdU incorporation at amplicon loci (Fig.
4D,I; data not shown). CBP131 clones also had no effect on CBP
protein levels (Fig. 4H). We could not recover follicle cell clones of
more severe CBP alleles, indicating that they are cell lethal and
precluding our ability to test their effect on gene amplification (data
not shown). Nonetheless, the RNAi results suggested that CBP is
required for normal developmental gene amplification, a result that
we pursue further below.
follicle cells had anti-CBP labeling throughout the nucleus, with a
significantly brighter focus of CBP labeling. This focus colocalized with the brightest BrdU amplification focus, which
corresponds to DAFC-66D (Fig. 5A-C) (Calvi et al., 1998). In the
neighboring CBPdsRNA-1-expressing cells, both the overall levels
and focal labeling of CBP at DAFC-66D were reduced or
eliminated, indicating that focal anti-CBP labeling in wild-type
cells reflects enrichment of CBP protein at DAFC-66D.
To quantify the binding of CBP to DAFC-66D with higher
resolution, we used anti-CBP antibodies for ChIP on whole ovaries
from wild-type flies. This showed that CBP is 2-fold enriched at
ACE3 relative to the Rh2 control locus (Fig. 5D). CBP enrichment
was lower at Ori- and within the body of the Cp18 gene, and was
not enriched 10 kb from ACE3 (Fig. 5D). Since these experiments
used chromatin from whole ovaries, this is a conservative estimate
for CBP occupancy at DAFC-66D in amplification stage follicle
cells. The combined imaging and ChIP results suggest that CBP
associates with, and might act locally at, DAFC-66D.
CBP associates with the DAFC-66D origin
To test whether CBP functions locally at amplicon origins, we
determined whether CBP co-localizes with BrdU amplification foci
in follicle cells. Ovaries clonally expressing CBPdsRNA-1 were
labeled for BrdU and CBP (Lilja et al., 2003). Wild-type stage 10B
Combined knockdown of chm and CBP
compromises nucleosome acetylation and
severely reduces amplification
Our results suggested that both Chm and CBP associate with the
DAFC-66D amplicon origin and contribute to normal levels of
Fig. 5. CBP associates with the amplification origin at DAFC-66D. (A-C)Stage 10B egg chamber containing CBPdsRNA-1-expressing clones colabeled with anti-CBP (A green) and BrdU (B red). (C)Merged image of A and B shows co-localization of CBP and BrdU foci. Insets show higher
magnification image of a single nucleus. (D)ChIP with anti-CBP from Oregon-R whole ovaries followed by qPCR for DAFC-66D as described in Fig.
1E. Error bars indicate represent the range of two biological replicates. Scale bars: 10m.
DEVELOPMENT
Fig. 4. RNAi knockdown of CBP reduces amplification. (A-C,E-G) Three separate hairpin RNA transgenes against CBP were expressed in clones
using the Flp-Out system and labeled with BrdU (red, A-C) or anti-CBP (green, E-G). (D)CBP131 clones were generated by Flp/FRT and labeled with
BrdU. (H)CBP131 clones labeled with anti-CBP. (I)Quantification of BrdU fluorescence intensity in UAS:hairpin RNA-expressing clones. n>40 nuclei
from at least three egg chambers. ***P<0.0001. Error bars indicate s.e.m. Scale bars: 10m.
gene amplification. To further explore whether both HATs
contribute to amplification, we co-expressed hairpin RNA against
Chm and CBP using the Flp-Out method. To examine possible
synergism between these knockdowns, we chose to co-express
chmdsRNA-1 and CBPdsRNA-2 because each of these hairpins on their
own had little to no effect on gene amplification (Fig. 2C and Fig.
4B). By contrast, co-expression of both these RNAi hairpins
together resulted in severe reductions in BrdU incorporation at
amplicon foci. Foci were undetectable in most cells, and some cells
had incorporation of BrdU throughout the nucleus (Fig. 6A). CBP
protein levels were similar between the chmdsRNA-1; CBPdsRNA-2
double- and CBPdsRNA-2 single-knockdown cells, suggesting that
the severe phenotype of the double knockdown was not caused by
further reductions in CBP protein (Fig. 6B and Fig. 4F). The
synergistic phenotype of Chm and CBP double RNAi further
suggests that these HATs are both important for the regulation of
developmental gene amplification.
To evaluate whether Chm and CBP are required for histone
acetylation in follicle cells, we labeled clones expressing
Fig. 6. Combined knockdown of Chm and CBP causes a severe
reduction in amplification. (A)chmdsRNA-1 and CBPdsRNA-2 were both
expressed in clones using the Flp-Out system and labeled with BrdU.
(B)chmdsRNA-1; CBPdsRNA-2 double-RNAi clones labeled with anti-CBP.
(C)chmdsRNA-1; CBPdsRNA-2 double-RNAi clone labeled with antiH4K12Ac. (D)The same clone from C labeled with DAPI.
(E-G)Magnified images of nuclei from C and D (boxed regions).
(E)Anti-H4K12Ac, (F) DAPI, (G) merged image. H4K12Ac foci
corresponding to amplicons are indicated by arrows and the islands of
H4K12Ac near the DAPI-bright heterochromatin are indicated by
arrowheads. Scale bars: 10m.
Development 139 (20)
UAS:hairpin RNA transgenes with antibodies against histone H4
acetylated on lysine 12 (anti-H4K12Ac), a modification that we
showed is greatly enriched at amplicon origins when they are
active (Liu et al., 2012). Anti-H4K12Ac antibodies labels
throughout follicle cell nuclei, with more prominent labeling at foci
that correspond to the hyperacetylated and active amplicon origins
(Fig. 6C-G) (Liu et al., 2012). In addition, anti-H4K12Ac brightly
labels a focus that corresponds to a chromatin domain near the
heterochromatic DAPI bright spot (Fig. 6C-G). Although
knockdown of either HAT alone did not have a detectable effect on
H4K12 acetylation (data not shown), co-expressing chmdsRNA-1;
CBPdsRNA-2 reduced both total nuclear and focal labeling of
H4K12ac at the amplicons, but did not affect the H4K12Ac focus
near the DAPI-bright spot (Fig. 6C-G). Together, these results
suggest that Chm and CBP collaborate to acetylate H4K12 and
regulate amplification origins in follicle cells.
Knockdown of chm and CBP compromises the
developmental transition to amplification
The imaging and ChIP results suggested that Chm and CBP
proteins might act locally at the amplicon origins. However,
knockdown of CBP resulted in nucleus-wide incorporation of BrdU
in some cells, a cellular phenotype that was also frequent in the
chm; CBP double knockdown (Fig. 4A,C and Fig. 6A). To explain
this result, we considered the possibility that Chm and CBP might
be globally required for the transition of follicle cells from
endocycles to amplification during stage 10A/B. To address this,
we used an antibody against the transcription factor Cut, which is
normally undetectable during endocycles but increases to higher
levels at the onset of amplification in stage 10B (Blochlinger et al.,
1990; Sun and Deng, 2005). Cut expression in stage 10B egg
chambers was slightly reduced by expression of chmdsRNA-1 or
chmdsRNA-2, and not detectably reduced after expression of
CBPdsRNA-2, all of which had only mild effects on amplification
(Fig. 7A-C). By contrast, CBPdsRNA-1 single knockdown, which had
a more severe amplification phenotype, reduced Cut labeling
further (Fig. 7D). Importantly, the double knockdown with
chmdsRNA-1; CBPdsRNA-2, each of which had mild effects on
amplification on its own, had much lower levels of Cut, consistent
with the strong effect of this double knockdown on amplification
(Fig. 7E). chmdsRNA-1; CBPdsRNA-2 double-knockdown clones also
showed an increase in the levels of Hindsight (Hnt; Pebbled –
FlyBase), which is normally downregulated during the transition
from endocycles to amplification (data not shown) (Sun and Deng,
2007).
There are two possible explanations for persistent genomic
replication in stage 10B. Either the normal three follicle cell
endocycles are delayed relative to egg chamber development, or
follicle cells are undergoing an additional fourth endocycle. DAPI
fluorescence intensity was not significantly different in the
chmdsRNA-1; CBPdsRNA-2 double-knockdown clones in stage 10B or
stage 12 (Fig. 7F). Therefore, we could not distinguish whether
follicle cells are just finishing a delayed third, or just beginning a
new fourth, genomic endoreplication. In summary, the results
suggest that Chm and CBP, in addition to acting locally at
amplicons, might act globally to regulate the developmental
transition of follicle cells from endocycles to gene amplification.
DISCUSSION
We investigated which HAT enzymes participate in the epigenetic
regulation of gene amplification origins in the Drosophila ovary.
We found that the HAT Chm, which is the Drosophila ortholog of
DEVELOPMENT
3886 RESEARCH ARTICLE
HATs in gene amplification
RESEARCH ARTICLE 3887
Fig. 7. Knockdown of Chm and CBP perturbs the developmental
transition to amplification. (A-E)Stage 10B follicle cell Flp-Out clones
were labeled with anti-Cut (green). (A)chmdsRNA-1, (B) chmdsRNA-2, (C)
CBPdsRNA-2, (D) CBPdsRNA-1, or (E) chmdsRNA-1; CBPdsRNA-2.
(F)Quantification of total DAPI fluorescence in stage 10B and stage 12
follicle cells expressing chmdsRNA-1; CBPdsRNA-2 (red) compared with wildtype cells in the same egg chamber (blue). n60 nuclei from three egg
chambers. Error bars indicate s.e.m. Scale bars: 10m.
human HBO1, is important for DNA replication programs in
ovarian follicle cells. However, in stark contrast to the absolute
requirement of HBO1 at mammalian origins, knockdown of chm
did not completely eliminate gene amplification in follicle cells and
had only mild effects on endoreplication and cell proliferation. Our
results suggest that a second HAT, CBP, collaborates with Chm,
and that both HATs act locally to acetylate nucleosomes at the
origin to stimulate gene amplification. In addition to this local
function, our data suggest that these HATs might also be globally
required for follicle cells to undergo the developmental transition
from endocycles into the amplification stage of oogenesis. These
data imply that Chm and CBP integrate follicle cell development
with DNA replication programs, and raise the possibility that the
coordination of origin activity with cell differentiation by
chromatin modifiers might be a general theme in development.
Acetylation at amplicon origins
We and others had shown that amplicon origins become
hyperacetylated when they are active beginning in stage 10B, and
that this acetylation is important for origin specification and
efficiency (Aggarwal and Calvi, 2004; Hartl et al., 2007). However,
which HATs are responsible for the developmental regulation of
amplicon origins remained unknown. Our data suggest that the
HAT Chm binds the MCM complex, associates with amplicon
DNA, and is required for normal amplicon origin activity in follicle
cells late in oogenesis (Fig. 8). These data are consistent with the
requirement of HBO1 for loading the MCM complex during preRC formation in human cells and frog extracts (Doyon et al., 2006;
Iizuka et al., 2006; Iizuka and Stillman, 1999; Miotto and Struhl,
2008; Miotto and Struhl, 2010). Furthermore, we have previously
shown that tethering Chm directly to DAFC-66D promotes
amplification (Aggarwal and Calvi, 2004). However, whereas
depletion of HBO1 has severe effects on origin activity and cellular
proliferation, the depletion of Chm did not completely eliminate
amplification, had only mild effects on endoreplication, and no
demonstrable effects on cell proliferation. One possibility is that
we have not completely eliminated Chm activity. We were unable
to directly assess the degree of knockdown among the different
genotypes because our Chm antibody recognizes overexpressed
protein but does not detect endogenous levels of Chm. Moreover,
because the knockdown was only in a subset of follicle cells, we
were unable to assess the relative levels of chm mRNA by qPCR.
Importantly, the chm14 allele, which deletes essential regions of the
Myst family HAT domain, had mild effects on DNA replication in
follicle cell clones, and imaginal discs of homozygous chm14 larvae
also did not have defects in cell proliferation (data not shown).
Together, our data suggest that, although Chm associates with and
regulates origins similar to its mammalian ortholog HBO1, Chm
might not be absolutely essential for the function of all origins.
The relatively mild phenotype of chm mutants raised the
possibility that there is a developmental complexity of origin
regulation by multiple HATs that has not been revealed by the
analysis of cells in culture. In agreement with this interpretation,
we found that the HAT CBP also associated with amplicon origin
DAFC-66D, and that CBP knockdown partially compromised gene
amplification (Fig. 8). While some of the hairpin RNAs against
Chm and CBP had mild phenotypes, using these hairpin RNAs to
knockdown both HATs together resulted in a synergistic, more
severe replication phenotype and also reduced acetylation of
H4K12. One interpretation is that these HATs are partially
redundant in function or contribute in parallel in a non-additive
way to origin activity. This idea is consistent with recent evidence
that the level of nucleosome hyperacetylation quantitatively
correlates with the number of initiation events at different amplicon
origins (Kim et al., 2011; Liu et al., 2012). Our recent finding that
a multitude of lysines are hyperacetylated on nucleosomes when
these origins are active also raises the possibility that other HATs
DEVELOPMENT
Fig. 8. Model for regulation of developmental gene amplification
by Chm and CBP. Chm and CBP are globally required for the
developmental transition of follicle cells from endocycles to
amplification stages (above). In addition, Chm and CBP are locally
required during amplification stages for acetylation of H4K12 and for
activity of the amplicon origins. See text for details.
regulate amplicon origins and await discovery. An important future
goal is to identify the cadre of HATs and HDACS at these origins
and determine how the balance of their activity regulates origin
specificity and developmental timing.
Although our data suggest that both Chm and CBP have a local
function at amplicon origins, the mechanism by which acetylation
promotes origin activity remains unclear. Our previous evidence
suggested that nucleosome acetylation correlates with the locus
specificity of ORC binding, but recent evidence also suggests that
acetylation on some lysines occurs during pre-RC assembly and is
downstream of, and depends on, ORC binding (Aggarwal and
Calvi, 2004; Liu et al., 2012). It is also possible that Chm or CBP
regulates the origin by acetylating pre-RC or other non-histone
proteins, consistent with recent evidence from other systems
(Glozak and Seto, 2009; Iizuka et al., 2006). Another important
question is how these HATs are recruited specifically to the
amplicon origins. Two transcription factor complexes have been
shown to bind to the amplicons and to be required for normal levels
of amplification: the Myeloblastosis-Multivulva B complex (MybMuvB) and the steroid hormone Ecdysone receptor-Ultraspiracle
(EcR-Usp) (Beall et al., 2002; Hackney et al., 2007; Shea et al.,
1990). It might be that one or both of these complexes mediates
chromatin regulation of the origins by recruiting HATs and other
chromatin modifiers. In fact, CBP is known to be a transcriptional
co-activator of Myb in both Drosophila and mammalian cells (Dai
et al., 1996; Hou et al., 1997).
Integration of DNA replication programs with
development
Our data suggest that CBP and Chm also contribute indirectly to
amplicon origin activity by globally regulating the development of
follicle cells (Fig. 8). The most severe knockdown of these HATs
resulted in reduced expression of Cut and persistent Hnt, two
developmental markers for the endocycle-to-amplification stage
transition (Sun and Deng, 2005). One possibility is that Chm and
CBP control the expression of genes that are important for this
developmental transition, consistent with their known activity as
transcriptional regulators from flies to humans (Chan and La
Thangue, 2001; Doyon et al., 2006; Miotto et al., 2006; Miotto and
Struhl, 2006). The evidence for both local and global activity of
these HATs suggest that they integrate the activity of amplicon
origins with follicle cell development.
Our results using the model amplicon origins might have wider
implications for understanding how plastic origin activity is
coordinated with development. DNA replication programs can vary
widely in development, with both the genomic location of origins
and the time that they initiate during S phase differing among cells
(Mechali, 2010; Nordman and Orr-Weaver, 2012). These variations
in DNA replication mirror changes in the modification of the
epigenome during development and underscore the important
contribution of acetylation and other chromatin modifications to
origin activity. Highly relevant to our results, mammalian CBP, as
part of the DARRT complex, is required for transcription of the globin genes and for the initiation of DNA replication at the globin locus early during S phase in erythroid cells (Aladjem,
2007; Dhar et al., 1988; Karmakar et al., 2010). Disruption of the
DARRT complex not only prevents transcription and origin
function locally, but also affects cell differentiation globally
(Karmakar et al., 2010). In light of this and other emerging
evidence in the field, our results raise the possibility that epigenetic
regulators actively coordinate DNA replication programs with cell
differentiation as a general theme during development.
Development 139 (20)
Acknowledgements
We thank Y. Graba, J. Pradel, J. Kumar, F. Elefant, the Bloomington Drosophila
Stock Center and the Vienna Drosophila RNAi Center for fly stocks; M.
Mannervik for the generous gift of anti-CBP antibody; Jim Powers and the
Indiana Light Microscopy and Imaging Center (LMIC) for assistance with
confocal microscopy; and members of the B.R.C. laboratory for critical reading
of the manuscript and helpful discussion.
Funding
This work was supported by the National Institutes of Health (NIH)
[postdoctoral fellowship F32 GM080089 to K.H.M., R01 GM61290-11 to
B.R.C.]. Deposited in PMC for release after 12 months.
Competing interests statement
The authors declare no competing financial interests.
References
Aggarwal, B. D. and Calvi, B. R. (2004). Chromatin regulates origin activity in
Drosophila follicle cells. Nature 430, 372-376.
Akimaru, H., Chen, Y., Dai, P., Hou, D. X., Nonaka, M., Smolik, S. M.,
Armstrong, S., Goodman, R. H. and Ishii, S. (1997). Drosophila CBP is a coactivator of cubitus interruptus in hedgehog signalling. Nature 386, 735-738.
Aladjem, M. I. (2007). Replication in context: dynamic regulation of DNA
replication patterns in metazoans. Nat. Rev. Genet. 8, 588-600.
Austin, R. J., Orr-Weaver, T. L. and Bell, S. P. (1999). Drosophila ORC specifically
binds to ACE3, an origin of DNA replication control element. Genes Dev. 13,
2639-2649.
Bastock, R. and St Johnston, D. (2008). Drosophila oogenesis. Curr. Biol. 18,
R1082-R1087.
Beall, E. L., Manak, J. R., Zhou, S., Bell, M., Lipsick, J. S. and Botchan, M. R.
(2002). Role for a Drosophila Myb-containing protein complex in site-specific
DNA replication. Nature 420, 833-837.
Bell, O., Schwaiger, M., Oakeley, E. J., Lienert, F., Beisel, C., Stadler, M. B.
and Schubeler, D. (2010). Accessibility of the Drosophila genome discriminates
PcG repression, H4K16 acetylation and replication timing. Nat. Struct. Mol. Biol.
17, 894-900.
Bicknell, L. S., Bongers, E. M., Leitch, A., Brown, S., Schoots, J., Harley, M. E.,
Aftimos, S., Al-Aama, J. Y., Bober, M., Brown, P. A. et al. (2011a). Mutations
in the pre-replication complex cause Meier-Gorlin syndrome. Nat. Genet. 43,
356-359.
Bicknell, L. S., Walker, S., Klingseisen, A., Stiff, T., Leitch, A., Kerzendorfer,
C., Martin, C. A., Yeyati, P., Al Sanna, N., Bober, M. et al. (2011b).
Mutations in ORC1, encoding the largest subunit of the origin recognition
complex, cause microcephalic primordial dwarfism resembling Meier-Gorlin
syndrome. Nat. Genet. 43, 350-355.
Bielinsky, A. K., Blitzblau, H., Beall, E. L., Ezrokhi, M., Smith, H. S., Botchan,
M. R. and Gerbi, S. A. (2001). Origin recognition complex binding to a
metazoan replication origin. Curr. Biol. 11, 1427-1431.
Blochlinger, K., Bodmer, R., Jan, L. Y. and Jan, Y. N. (1990). Patterns of
expression of cut, a protein required for external sensory organ development in
wild-type and cut mutant Drosophila embryos. Genes Dev. 4, 1322-1331.
Burke, T. W., Cook, J. G., Asano, M. and Nevins, J. R. (2001). Replication
factors MCM2 and ORC1 interact with the histone acetyltransferase HBO1. J.
Biol. Chem. 276, 15397-15408.
Cadoret, J. C. (2008). Genome-wide studies highlight indirect links between
human replication origins and gene regulation. Proc. Natl. Acad. Sci. USA 105,
15837-15842.
Calvi, B. R. (2006). Developmental DNA amplification. In DNA Replication and
Human Disease (ed. M. L. DePamphilis), pp. 233-255. Cold Spring Harbor, NY:
Cold Spring Harbor Laboratory Press.
Calvi, B. R. and Lilly, M. A. (2004). BrdU labeling and nuclear flow sorting of the
Drosophila ovary. In Drosophila Cytogenetics Protocols (ed. D. Henderson), pp.
203-213. Totowa: Humana Press.
Calvi, B. R., Lilly, M. A. and Spradling, A. C. (1998). Cell cycle control of chorion
gene amplification. Genes Dev. 12, 734-744.
Carre, C., Szymczak, D., Pidoux, J. and Antoniewski, C. (2005). The histone H3
acetylase dGcn5 is a key player in Drosophila melanogaster metamorphosis.
Mol. Cell. Biol. 25, 8228-8238.
Cayrou, C., Coulombe, P., Vigneron, A., Stanojcic, S., Ganier, O., Peiffer, I.,
Rivals, E., Puy, A., Laurent-Chabalier, S., Desprat, R. et al. (2011). Genomescale analysis of metazoan replication origins reveals their organization in
specific but flexible sites defined by conserved features. Genome Res. 21, 14381449.
Chan, H. M. and La Thangue, N. B. (2001). p300/CBP proteins: HATs for
transcriptional bridges and scaffolds. J. Cell Sci. 114, 2363-2373.
Claycomb, J. M. and Orr-Weaver, T. L. (2005). Developmental gene
amplification: insights into DNA replication and gene expression. Trends Genet.
21, 149-162.
DEVELOPMENT
3888 RESEARCH ARTICLE
Dai, P., Akimaru, H., Tanaka, Y., Hou, D. X., Yasukawa, T., Kanei-Ishii, C.,
Takahashi, T. and Ishii, S. (1996). CBP as a transcriptional coactivator of cMyb. Genes Dev. 10, 528-540.
Danis, E., Brodolin, K., Menut, S., Maiorano, D., Girard-Reydet, C. and
Mechali, M. (2004). Specification of a DNA replication origin by a transcription
complex. Nat. Cell Biol. 6, 721-730.
Deng, W. M., Althauser, C. and Ruohola-Baker, H. (2001). Notch-Delta
signaling induces a transition from mitotic cell cycle to endocycle in Drosophila
follicle cells. Development 128, 4737-4746.
Dhar, V., Mager, D., Iqbal, A. and Schildkraut, C. L. (1988). The coordinate
replication of the human beta-globin gene domain reflects its transcriptional
activity and nuclease hypersensitivity. Mol. Cell. Biol. 8, 4958-4965.
Dietzl, G., Chen, D., Schnorrer, F., Su, K. C., Barinova, Y., Fellner, M., Gasser,
B., Kinsey, K., Oppel, S., Scheiblauer, S. et al. (2007). A genome-wide
transgenic RNAi library for conditional gene inactivation in Drosophila. Nature
448, 151-156.
Doyon, Y., Cayrou, C., Ullah, M., Landry, A. J., Cote, V., Selleck, W., Lane, W.
S., Tan, S., Yang, X. J. and Cote, J. (2006). ING tumor suppressor proteins are
critical regulators of chromatin acetylation required for genome expression and
perpetuation. Mol. Cell 21, 51-64.
Eaton, M. L., Prinz, J. A., MacAlpine, H. K., Tretyakov, G., Kharchenko, P. V.
and MacAlpine, D. M. (2011). Chromatin signatures of the Drosophila
replication program. Genome Res. 21, 164-174.
Edenberg, H. J. and Huberman, J. A. (1975). Eukaryotic chromosome
replication. Annu. Rev. Genet. 9, 245-284.
Espinosa, M. C., Rehman, M. A., Chisamore-Robert, P., Jeffery, D. and
Yankulov, K. (2010). GCN5 is a positive regulator of origins of DNA replication
in Saccharomyces cerevisiae. PLoS ONE 5, e8964.
Glozak, M. A. and Seto, E. (2009). Acetylation/deacetylation modulates the
stability of DNA replication licensing factor Cdt1. J. Biol. Chem. 284, 1144611453.
Grienenberger, A., Miotto, B., Sagnier, T., Cavalli, G., Schramke, V., Geli, V.,
Mariol, M. C., Berenger, H., Graba, Y. and Pradel, J. (2002). The MYST
domain acetyltransferase Chameau functions in epigenetic mechanisms of
transcriptional repression. Curr. Biol. 12, 762-766.
Guernsey, D. L., Matsuoka, M., Jiang, H., Evans, S., Macgillivray, C.,
Nightingale, M., Perry, S., Ferguson, M., LeBlanc, M., Paquette, J. et al.
(2011). Mutations in origin recognition complex gene ORC4 cause Meier-Gorlin
syndrome. Nat. Genet. 43, 360-364.
Hackney, J. F., Pucci, C., Naes, E. and Dobens, L. (2007). Ras signaling
modulates activity of the ecdysone receptor EcR during cell migration in the
Drosophila ovary. Dev. Dyn. 236, 1213-1226.
Hartl, T., Boswell, C., Orr-Weaver, T. L. and Bosco, G. (2007). Developmentally
regulated histone modifications in Drosophila follicle cells: initiation of gene
amplification is associated with histone H3 and H4 hyperacetylation and H1
phosphorylation. Chromosoma 116, 197-214.
Heck, M. and Spradling, A. (1990). Multiple replication origins are used during
Drosophila chorion gene amplification. J. Cell Biol. 110, 903-914.
Hiratani, I., Ryba, T., Itoh, M., Yokochi, T., Schwaiger, M., Chang, C. W.,
Lyou, Y., Townes, T. M., Schubeler, D. and Gilbert, D. M. (2008). Global
reorganization of replication domains during embryonic stem cell differentiation.
PLoS Biol. 6, e245.
Hook, S. S., Lin, J. J. and Dutta, A. (2007). Mechanisms to control rereplication
and implications for cancer. Curr. Opin. Cell Biol. 19, 663-671.
Hou, D. X., Akimaru, H. and Ishii, S. (1997). Trans-activation by the Drosophila
myb gene product requires a Drosophila homologue of CBP. FEBS Lett. 413, 6064.
Hyrien, O., Maric, C. and Mechali, M. (1995). Transition in specification of
embryonic metazoan DNA replication origins. Science 270, 994-997.
Iizuka, M. and Stillman, B. (1999). Histone acetyltransferase HBO1 interacts with
the ORC1 subunit of the human initiator protein. J. Biol. Chem. 274, 2302723034.
Iizuka, M., Matsui, T., Takisawa, H. and Smith, M. M. (2006). Regulation of
replication licensing by acetyltransferase Hbo1. Mol. Cell. Biol. 26, 1098-1108.
Karmakar, S., Mahajan, M. C., Schulz, V., Boyapaty, G. and Weissman, S. M.
(2010). A multiprotein complex necessary for both transcription and DNA
replication at the beta-globin locus. EMBO J. 29, 3260-3271.
Kim, J. C., Nordman, J., Xie, F., Kashevsky, H., Eng, T., Li, S., MacAlpine, D.
M. and Orr-Weaver, T. L. (2011). Integrative analysis of gene amplification in
Drosophila follicle cells: parameters of origin activation and repression. Genes
Dev. 25, 1384-1398.
King, R. C. (1970). Ovarian Development in Drosophila melanogaster. New York:
Academic Press.
Klemm, R. D. and Bell, S. P. (2001). ATP bound to the origin recognition complex
is important for preRC formation. Proc. Natl. Acad. Sci. USA 98, 8361-8367.
Kumar, J. P., Jamal, T., Doetsch, A., Turner, F. R. and Duffy, J. B. (2004). CREB
binding protein functions during successive stages of eye development in
Drosophila. Genetics 168, 877-893.
RESEARCH ARTICLE 3889
Landis, G. and Tower, J. (1999). The Drosophila chiffon gene is required for
chorion gene amplification, and is related to the yeast Dbf4 regulator of DNA
replication and cell cycle. Development 126, 4281-4293.
Landis, G., Kelley, R., Spradling, A. and Tower, J. (1997). The k43 gene,
required for chorion gene amplification and diploid cell chromosome replication,
encodes the Drosophila homolog of yeast origin recognition complex subunit 2.
Proc. Natl. Acad. Sci. USA 94, 3888-3892.
Lilja, T., Qi, D., Stabell, M. and Mannervik, M. (2003). The CBP coactivator
functions both upstream and downstream of Dpp/Screw signaling in the early
Drosophila embryo. Dev. Biol. 262, 294-302.
Liu, J., McConnell, K., Dixon, M. and Calvi, B. R. (2012). Analysis of model
replication origins in Drosophila reveals new aspects of the chromatin landscape
and its relationship to origin activity and the prereplicative complex. Mol. Biol.
Cell 23, 200-212.
Lopez-Schier, H. and St Johnston, D. (2001). Delta signaling from the germ line
controls the proliferation and differentiation of the somatic follicle cells during
Drosophila oogenesis. Genes Dev. 15, 1393-1405.
MacAlpine, H. K., Gordan, R., Powell, S. K., Hartemink, A. J. and MacAlpine,
D. M. (2010). Drosophila ORC localizes to open chromatin and marks sites of
cohesin complex loading. Genome Res. 20, 201-211.
Mahowald, A., Caulton, J., Edwards, M. and Floyd, A. (1979). Loss of
centrioles and polyploidization in follicle cells of Drosophila melanogaster. Exp.
Cell Res. 118, 404-410.
Manseau, L., Baradaran, A., Brower, D., Budhu, A., Elefant, F., Phan, H.,
Philp, A. V., Yang, M., Glover, D., Kaiser, K. et al. (1997). GAL4 enhancer
traps expressed in the embryo, larval brain, imaginal discs, and ovary of
Drosophila. Dev. Dyn. 209, 310-322.
Maqbool, S. B., Mehrotra, S., Kolpakas, A., Durden, C., Zhang, B., Zhong, H.
and Calvi, B. R. (2010). Dampened activity of E2F1-DP and Myb-MuvB
transcription factors in Drosophila endocycling cells. J. Cell Sci. 123, 4095-4106.
Margolis, J. and Spradling, A. (1995). Identification and behavior of epithelial
stem cells in the Drosophila ovary. Development 121, 3797-3807.
Mechali, M. (2010). Eukaryotic DNA replication origins: many choices for
appropriate answers. Nat. Rev. Mol. Cell Biol. 11, 728-738.
Miotto, B. and Struhl, K. (2006). Differential gene regulation by selective
association of transcriptional coactivators and bZIP DNA-binding domains. Mol.
Cell. Biol. 26, 5969-5982.
Miotto, B. and Struhl, K. (2008). HBO1 histone acetylase is a coactivator of the
replication licensing factor Cdt1. Genes Dev. 22, 2633-2638.
Miotto, B. and Struhl, K. (2010). HBO1 histone acetylase activity is essential for
DNA replication licensing and inhibited by Geminin. Mol. Cell 37, 57-66.
Miotto, B., Sagnier, T., Berenger, H., Bohmann, D., Pradel, J. and Graba, Y.
(2006). Chameau HAT and DRpd3 HDAC function as antagonistic cofactors of
JNK/AP-1-dependent transcription during Drosophila metamorphosis. Genes
Dev. 20, 101-112.
Muller, P., Park, S., Shor, E., Huebert, D. J., Warren, C. L., Ansari, A. Z.,
Weinreich, M., Eaton, M. L., MacAlpine, D. M. and Fox, C. A. (2010). The
conserved bromo-adjacent homology domain of yeast Orc1 functions in the
selection of DNA replication origins within chromatin. Genes Dev. 24, 14181433.
Negre, N., Lavrov, S., Hennetin, J., Bellis, M. and Cavalli, G. (2006). Mapping
the distribution of chromatin proteins by ChIP on chip. Methods Enzymol. 410,
316-341.
Ni, J. Q., Markstein, M., Binari, R., Pfeiffer, B., Liu, L. P., Villalta, C., Booker,
M., Perkins, L. and Perrimon, N. (2008). Vector and parameters for targeted
transgenic RNA interference in Drosophila melanogaster. Nat. Methods 5, 49-51.
Ni, J. Q., Zhou, R., Czech, B., Liu, L. P., Holderbaum, L., Yang-Zhou, D., Shim,
H. S., Tao, R., Handler, D., Karpowicz, P. et al. (2011). A genome-scale shRNA
resource for transgenic RNAi in Drosophila. Nat. Methods 8, 405-407.
Nordman, J. and Orr-Weaver, T. L. (2012). Regulation of DNA replication during
development. Development 139, 455-464.
Nystul, T. and Spradling, A. (2007). An epithelial niche in the Drosophila ovary
undergoes long-range stem cell replacement. Cell Stem Cell 1, 277-285.
Orr-Weaver, T. and Spradling, A. (1986). Drosophila chorion gene amplification
requires an upstream region regulating s18 transcription. Mol. Cell. Biol. 6,
4624-4633.
Pappas, D. L., Jr, Frisch, R. and Weinreich, M. (2004). The NAD(+)-dependent
Sir2p histone deacetylase is a negative regulator of chromosomal DNA
replication. Genes Dev. 18, 769-781.
Pignoni, F. and Zipursky, S. L. (1997). Induction of Drosophila eye development
by decapentaplegic. Development 124, 271-278.
Remus, D. and Diffley, J. F. (2009). Eukaryotic DNA replication control: Lock and
load, then fire. Curr. Opin. Cell Biol. 21, 771-777.
Remus, D., Beall, E. L. and Botchan, M. R. (2004). DNA topology, not DNA
sequence, is a critical determinant for Drosophila ORC-DNA binding. EMBO J.
23, 897-907.
Roy, S., Ernst, J., Kharchenko, P. V., Kheradpour, P., Negre, N., Eaton, M. L.,
Landolin, J. M., Bristow, C. A., Ma, L., Lin, M. F. et al. (2010). Identification
of functional elements and regulatory circuits by Drosophila modENCODE.
Science 330, 1787-1797.
DEVELOPMENT
HATs in gene amplification
Sasaki, T., Sawado, T., Yamaguchi, M. and Shinomiya, T. (1999). Specification
of regions of DNA replication initiation during embryogenesis in the 65-kilobase
DNApolalpha-dE2F locus of Drosophila melanogaster. Mol. Cell. Biol. 19, 547-555.
Schwaiger, M., Stadler, M. B., Bell, O., Kohler, H., Oakeley, E. J. and
Schubeler, D. (2009). Chromatin state marks cell-type- and gender-specific
replication of the Drosophila genome. Genes Dev. 23, 589-601.
Schwed, G., May, N., Pechersky, Y. and Calvi, B. R. (2002). Drosophila
minichromosome maintenance 6 is required for chorion gene amplification and
genomic replication. Mol. Biol. Cell 13, 607-620.
Shcherbata, H. R., Althauser, C., Findley, S. D. and Ruohola-Baker, H. (2004).
The mitotic-to-endocycle switch in Drosophila follicle cells is executed by Notchdependent regulation of G1/S, G2/M and M/G1 cell-cycle transitions.
Development 131, 3169-3181.
Shea, M., King, D., Conboy, M., Mariani, B. and Kafatos, F. (1990). Proteins
that bind to chorion cis-regulatory elements: A new C2H2 protein and a C2C2
steroid receptor-like component. Genes Dev. 4, 1128-1140.
Shima, N., Alcaraz, A., Liachko, I., Buske, T. R., Andrews, C. A., Munroe, R. J.,
Hartford, S. A., Tye, B. K. and Schimenti, J. C. (2007). A viable allele of
Mcm4 causes chromosome instability and mammary adenocarcinomas in mice.
Nat. Genet. 39, 93-98.
Shinomiya, T. and Ina, S. (1991). Analysis of chromosomal replicons in early
embryos of Drosophila melanogaster by two-dimensional gel electrophoresis.
Nucleic Acids Res. 19, 3935-3941.
Spradling, A. (1981). The organization and amplification of two chromosomal
domains containing Drosophila chorion genes. Cell 27, 193-201.
Development 139 (20)
Spradling, A. (1993). Developmental genetics of oogenesis. In The Development
of Drosophila melanogaster (ed. M. Bate and A. Martinez-Arias), pp. 1-70. Cold
Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
Spradling, A. and Mahowald, A. (1980). Amplification of genes for chorion
proteins during oogenesis in Drosophila melanogaster. Proc. Natl. Acad. Sci. USA
77, 1096-1100.
Sun, J. and Deng, W. M. (2005). Notch-dependent downregulation of the
homeodomain gene cut is required for the mitotic cycle/endocycle switch and
cell differentiation in Drosophila follicle cells. Development 132, 4299-4308.
Sun, J. and Deng, W. M. (2007). Hindsight mediates the role of notch in
suppressing hedgehog signaling and cell proliferation. Dev. Cell 12, 431-442.
Vashee, S., Cvetic, C., Lu, W., Simancek, P., Kelly, T. J. and Walter, J. C. (2003).
Sequence-independent DNA binding and replication initiation by the human
origin recognition complex. Genes Dev. 17, 1894-1908.
Vogelauer, M., Rubbi, L., Lucas, I., Brewer, B. J. and Grunstein, M. (2002).
Histone acetylation regulates the time of replication origin firing. Mol. Cell 10,
1223-1233.
Wong, P. G., Glozak, M. A., Cao, T. V., Vaziri, C., Seto, E. and Alexandrow, M.
(2010). Chromatin unfolding by Cdt1 regulates MCM loading via opposing
functions of HBO1 and HDAC11-geminin. Cell Cycle 9, 4351-4363.
Zhu, X., Singh, N., Donnelly, C., Boimel, P. and Elefant, F. (2007). The cloning
and characterization of the histone acetyltransferase human homolog
Dmel\TIP60 in Drosophila melanogaster: Dmel\TIP60 is essential for multicellular
development. Genetics 175, 1229-1240.
DEVELOPMENT
3890 RESEARCH ARTICLE