RESEARCH ARTICLE 2703
Development 139, 2703-2710 (2012) doi:10.1242/dev.081448
© 2012. Published by The Company of Biologists Ltd
Regulatory role for a conserved motif adjacent to the
homeodomain of Hox10 proteins
Isabel Guerreiro1,*, Ana Casaca1,§, Andreia Nunes1,‡,§, Sara Monteiro2, Ana Nóvoa1, Ricardo B. Ferreira2,3,
Joana Bom1 and Moisés Mallo1,4,¶
SUMMARY
Development of the vertebrate axial skeleton requires the concerted activity of several Hox genes. Among them, Hox genes
belonging to the paralog group 10 are essential for the formation of the lumbar region of the vertebral column, owing to their
capacity to block rib formation. In this work, we explored the basis for the rib-repressing activity of Hox10 proteins. Because genetic
experiments in mice demonstrated that Hox10 proteins are strongly redundant in this function, we first searched for common motifs
among the group members. We identified the presence of two small sequences flanking the homeodomain that are phylogenetically
conserved among Hox10 proteins and that seem to be specific for this group. We show here that one of these motifs is required
but not sufficient for the rib-repressing activity of Hox10 proteins. This motif includes two potential phosphorylation sites, which
are essential for protein activity as their mutation to alanines resulted in a total loss of rib-repressing properties. Our data indicates
that this motif has a significant regulatory function, modulating interactions with more N-terminal parts of the Hox protein,
eventually triggering the rib-repressing program. In addition, this motif might also regulate protein activity by alteration of the
protein’s DNA-binding affinity through changes in the phosphorylation state of two conserved tyrosine residues within the
homeodomain.
INTRODUCTION
Hox genes are key regulators of embryonic development
(Krumlauf, 1994; Pearson et al., 2005). Genes of this family are
typically organized in genomic clusters, although some exceptions
to this rule have been described recently (Duboule, 2007). Whereas
invertebrates contain a single Hox cluster, the Hox genes of
vertebrates are distributed in several clusters, which are thought to
have arisen by sequential duplication of a single ancestral cluster
(Duboule, 2007). As a consequence, individual Hox genes in a
given cluster have close relatives in one or more of the others. The
homologs in the different clusters, defined according to their
relative position and sequence similarities, constitute the so-called
paralog groups. There are 13 paralog groups in most vertebrates
(Duboule, 2007). Members of the same paralog group are often
redundant for particular functions (Mallo et al., 2010). This is most
evident for genes in paralog groups 9, 10 and 11 as their roles in
patterning the axial skeleton became evident only after
simultaneous inactivation of all members of the group (Wellik and
Capecchi, 2003; McIntyre et al., 2007). In addition, some Hox gene
functions are paralog specific and not shared by members of other
groups. This is illustrated by the distinct phenotypes obtained with
members of different paralog groups when assayed under the same
1
Instituto Gulbenkian de Ciência, 2780-156 Oeiras. Portugal. 2Instituto Superior de
Agronomia, Technical University of Lisbon, 1349-017 Lisbon, Portugal. 3Instituto de
Tecnologia Química e Biológica, New University of Lisbon, 2780-157 Oeiras,
Portugal. 4Department of Histology and Embryology, Faculty of Medicine, University
of Lisbon, 1649-028 Lisbon, Portugal.
*Present address: Department of Genetics and Evolution, University of Geneva,
Sciences III, 1211 Geneva 4, Switzerland
‡
Present address: Centro de Biologia Ambiental/Departamento Biologia Animal,
Faculdade de Ciências, Universidade de Lisboa, 1749-016 Lisbon, Portugal
§
These authors contributed equally to this work
¶
Author for correspondence ([email protected])
Accepted 9 May 2012
experimental conditions. For instance, when precociously
expressed in the presomitic mesoderm of transgenic embryos,
Hoxb6 induces ectopic ribs, Hoxa10 blocks rib formation, Hoxa11
produces fusions between adjacent ribs and vertebrae, and Hoxc13
truncates the axial skeleton (Carapuço et al., 2005; Vinagre et al.,
2010; Young et al., 2009). Interestingly, these phenotypes are
mostly consistent with functions assigned to them through other
experimental approaches (Wellik and Capecchi, 2003; McIntyre et
al., 2007; Mallo et al., 2010; Young et al., 2009). This indicates that
group-specific functions must derive from sequence or structural
characteristics intrinsic to the Hox proteins.
The specificity of Hox gene activity has been a subject of intense
research but it is still far from being understood. The activity of
Hox proteins depends to a large extent on their ability to control
gene expression as DNA-binding proteins (Pearson et al., 2005).
Hox proteins bind DNA through the homeodomain (HD), which is
the motif that defines these proteins as a family (Pearson et al.,
2005). Domain-swapping experiments have shown that, in some
cases, the HD plays a central role in dictating the functional
specificity of the protein (Chan and Mann, 1993). How the HD
could provide this specificity has been difficult to explain on the
basis of pure DNA-binding properties, as different Hox proteins
bind very similar target sequences (Ekker et al., 1994; Noyes et al.,
2008). In flies, the presence of co-factors can account for at least
part of this specificity (Mann et al., 2009). The most prominent of
those co-factors are Exd and Hth. Exd is able to bind both a
hexapeptide located N-terminal to the homeodomain in many Hox
proteins (Chan and Mann, 1996) and the UbdA motif, C-terminal
to the homeodomain of Ubx and AbdA (Merabet et al., 2007). Exd
(alone or together with Hth) has been shown to refine the DNAbinding properties of Hox proteins (Joshi et al., 2007; Slattery et
al., 2011), thus helping to explain functional specificities for some
Drosophila Hox proteins. Although the vertebrate homologs of Exd
and Htd (Pbx, Meis and Prep proteins) are also able to bind
DEVELOPMENT
KEY WORDS: Hox genes, Axial patterning, Transgenics, Vertebrate development, Mouse
2704 RESEARCH ARTICLE
MATERIALS AND METHODS
Sequence comparisons
Sequence alignments were performed with the ClustalW2 program using
Hox10 protein sequences from different species obtained from public
databases.
Production of mutant constructs and transgenic mice
All proteins used in this study contained a FLAG-tag at their N-terminal end.
The tags were first introduced into the Hoxa10 and Hoxb9 proteins by
cloning oligonucleotides encoding for a methionine followed by the FLAG
sequence into the 5⬘ end of their corresponding cDNAs, so that the FLAGtag was immediately downstream of the start codon and linked to the second
amino acid of the tagged protein. The cDNAs corresponding to the different
mutant and chimeric proteins were then produced on these basic cDNAs
using an overlapping PCR mutagenesis strategy. To construct Hoxa10NT,
the Hoxa10 cDNA was cut with SalI and HindIII, blunted by filling in with
the Klenow polymerase and re-ligated. The sequence of all constructs was
verified by direct sequencing. To express the cDNAs in cultured cells, they
were cloned into the pSport6.1 expression plasmid. To express the cDNAs
in transgenic embryos, they were cloned downstream of the msd enhancer of
the Dll1 gene (Beckers et al., 2000) and upstream of the SV40
polyadenylation signal. The constructs used in this work are summarized
schematically in Fig. 1. All cloning procedures were performed according to
standard cloning techniques (Sambrook et al., 1989).
To produce transgenic mice, the relevant constructs were liberated from
bacterial sequences and gel purified with the QIAquick gel extraction kit
(Qiagen). Transgenic animals were then produced by pronuclear
microinjection and oviduct transfer according to standard procedures
(Hogan et al., 1994). Transgenic fetuses were recovered by cesarean
section at embryonic day (E) 18.5 and the skeletal phenotypes analyzed by
Alcian Blue/Alizarin Red staining as previously described (Mallo and
Brändlin, 1997).
The significance of the absence of rib-repressing activity of the different
constructs considering the total number of transgenics analyzed was
estimated using a one-tailed two-proportion z-test (http://insilico.net/statistics/ztest/two-proportion), with significance at P<0.05.
Electrophoretic mobility shift assay (EMSA)
EMSAs were performed using nuclear extracts of HEK293T cells
transfected with expression constructs encoding the relevant wild-type or
mutant Hox proteins, using Lipofectamine 2000 (Invitrogen), according to
manufacturer’s specifications. Nuclear extracts were prepared as described
in Wadman et al. (Wadman et al., 1997). The amount of Hox proteins
obtained in these extracts was estimated by western blot using the anti-
Fig. 1. Schematic of the transgenic constructs used in this work.
Although for simplicity it is not indicated in the scheme or in their
names, all constructs used in this work contain a FLAG tag at their Nterminal end. For the Hoxa10 protein, the conserved features identified
in Fig. 2 are represented, including the M1 motif (red), the
homeodomain (HD, blue), the M2 motif (yellow) and the sequences Nterminal to the M1 motif (N-T, green). Also indicated are the conserved
Thr and Ser within the M1 motif (dark red and dark green circles,
respectively), and the conserved tyrosines within the homeodomain
(dark blue circles). Mutant proteins containing mutations in these
residues into an alanine (A) or a phenylalanine (F) are indicated by
replacing the circle for an A or an F. The corresponding regions of
Hoxb9 are indicated with a similar set of colors but lighter.
DEVELOPMENT
vertebrate Hox proteins (Phelan et al., 1995), it is not clear from
genetic experiments to what extent they contribute to Hox gene
function in general or specificity in particular (Capellini et al.,
2006; Capellini et al., 2008; Moens and Selleri, 2006).
A number of reports indicate that not only does functional
specificity reside outside the HD for some Hox proteins, but
different functions for a given Hox protein might also depend on
different areas of the protein. One example of this is provided by
the Drosophila and Artemia Ubx proteins; although they are both
capable of inducing abdominal characteristics in thoracic segments,
only the Drosophila protein was able to inhibit limb formation
(Ronshaugen et al., 2002). This latter function was mapped to
sequences C-terminal to the homeodomain and does not depend on
differential DNA-binding properties between the two Ubx
molecules (Galant and Carroll, 2002; Ronshaugen et al., 2002). In
vertebrates, when the Hoxa11 HD was replaced with that of
Hoxa13, Hoxa10 or Hoxa4, the resulting chimeric alleles were still
able to fulfill Hoxa11 patterning activity in the skeleton, but had
different effects in the Hoxa11-dependent development of other
structures (Zhao and Potter, 2001; Zhao and Potter, 2002). For
instance, whereas Hoxa11 containing either the Hoxa13 or Hoxa10
HD was able to fulfill Hoxa11 functions in the male reproductive
tract, Hoxa11 with the Hoxa13, Hoxa10 or Hoxa4 homeodomains
failed to promote normal development of the limbs and female
reproductive tract (Zhao and Potter, 2001; Zhao and Potter, 2002).
Similarly, the differential regulation of Six2 by Hoxa2 and Hox11
proteins has been shown to depend not on the identity of their HDs
but on N- and C-terminal regions flanking this domain (Yallowitz
et al., 2009)
Genes of the paralog group 10 are unique among vertebrate Hox
genes in their ability to block rib formation, a characteristic that
plays a central role in the evolution of the vertebrate axial skeleton
(Wellik and Capecchi, 2003; Mallo et al., 2010). Genetic
experiments showed that this property is shared by all group 10
members (Wellik and Capecchi, 2003), thus providing the grounds
for comparisons to identify the molecular determinants for this
activity. In addition, transgenic Hoxa10 expression in the
presomitic mesoderm produces totally rib-less embryos (Carapuço
et al., 2005), which provides a convenient functional test for the
gene’s activity. In this work, we show that a conserved sequence
located adjacent to the N-terminal end of the homeodomain of
Hox10 proteins is required for their rib-repressing activity in mice.
This motif includes two potential phosphorylation sites, which are
essential for Hoxa10 activity, as their mutation into alanines
resulted in a total loss of rib-repressing properties. The activity of
this motif seems to require interactions with more N-terminal parts
of the Hox protein. In addition, it might also modulate protein
activity by alteration of the protein’s DNA-binding affinity through
changes in the phosphorylation state of two conserved tyrosine
residues within the HD.
Development 139 (15)
FLAG M2 antibody (Sigma). The EMSA probe consisted of the sequence
AAAGGCATGACTAATTGCATGGTAACTGGAGAAATGCTTTCTCTC
TCTCTGGGGTGAAGCCTGCATG, corresponding to the H1 enhancer of
Myf5 (Buchberger et al., 2007), obtained by PCR, end labeled with 32P
using polynucleotide kinase and purified with the QIAquick PCR
Purification Kit (Qiagen). EMSA reactions (20 l) contained 10 mM Hepes
(pH 7.9), 75 mM KCl, 2.5 mM MgCl2, 0.2 mM EDTA, 1 mM DTT, 3%
Ficoll, 2 mg/ml BSA, 0.2 mg/ml polydI/dC, 2 l of protein (corresponding
to 1:50 of the nuclear extract obtained from a confluent 35 mm plate) and
2 l of probe. Binding reactions were incubated at room temperature for
30 minutes and separated on a 5% polyacrylamide gel in 0.5⫻ TBE
(45 mM Tris, 45 mM boric acid, 1 mM EDTA).
RESULTS
Hox10 proteins contain group-specific protein
motifs
The strong redundancy observed among Hox10 genes in their
ability to block lumbar rib formation (Wellik and Capecchi, 2003)
suggests that the rib-repressing properties of the corresponding
proteins must reside in parts shared by the three group members.
Alignment of the mouse Hoxa10, Hoxc10 and Hoxd10 protein
sequences revealed the presence of a few conserved areas outside
the HD (Fig. 2A). These included two small sequences,
NWLTAKS and RENRIRELT, located immediately adjacent to the
N- and C-terminal ends of the HD, respectively (for simplicity, we
will refer to these sequences as M1 and M2 motifs, respectively).
Extension of these analyses to Hox10 proteins of other vertebrate
species revealed a strong phylogenetic conservation of these motifs
(Fig. 2B). We did not find the M2 motif or a similar sequence in
any other vertebrate or invertebrate Hox protein. However, we
found a sequence with similarity to M1 in Hox paralog group 9
proteins (NWLHARS), which has been considered to be a
modified hexapeptide/linker region (LaRonde-LeBlanc and
Wolberger, 2003). Despite their resemblance, the motifs in Hox9
and Hox10 proteins differ in two out of the seven residues and we
could not find a Hox10-type M1 motif in any Hox9 protein or vice
RESEARCH ARTICLE 2705
versa, indicating that they are paralog group specific. One of the
differences between the motifs observed in Hox9 and Hox10
proteins is the presence of a histidine or a threonine in position –4
(relative to the homeodomain), respectively. The crystal structure
of HOXA9 suggests an essential role for His –4 in the three
dimensional structure of this motif (LaRonde-LeBlanc and
Wolberger, 2003). Therefore, the presence of a Thr residue in this
position might have significant influence on the structural and/or
functional properties of the Hox10 proteins. Taken together, these
analyses indicate that the M1 and M2 motifs are hallmarks of
Hox10 proteins and suggest that they might be involved in
activities common to all of them, among which rib repression is the
best documented (Wellik and Capecchi, 2003).
The M1 motif is necessary but not sufficient for
Hoxa10 rib-repressing activity
To test whether the M1 and M2 motifs are required for Hoxa10 ribrepressing activity, we first generated deletion mutants and tested
their activity by expressing them in transgenic mice. Hoxa10
proteins lacking the M2 motif (Hoxa10M2) retained the ability to
block rib formation (Fig. 3C and Table 1). This indicates that,
despite its strong conservation among Hox10 proteins, M2 seems
not to be involved in this redundant Hox10 function. Analysis of
M1 deletion mutants (Hoxa10M1) gave a different result, as we
could not find any Dll1-Hoxa10M1 transgenic embryo with the
typical rib-less phenotype (Table 1). In two out of the 16
transgenics analyzed we observed significant rib defects, but these
were much weaker than those typically observed in Dll1-Hoxa10
embryos (Fig. 3D and Table 1). These results indicate that Hoxa10
lacking M1 is almost unable to repress rib formation, thus
demonstrating the requirement of the M1 motif for this function.
For some Drosophila Hox proteins, the HD together with the
conserved sequences adjacent to its N-terminal end have been
shown to be sufficient to produce a functional protein
(Papadopoulos et al., 2010). To test whether this was also the case
Fig. 2. Comparison of Hox10 protein
sequences. (A)Alignment of the protein
sequences of mouse Hoxa10, Hoxc10 and
Hoxd10. The homeodomain is highlighted in
blue. Identical amino acids outside the
homeodomain are highlighted in red.
(B)Phylogenetic comparison of the
homeodomain (HD, in blue) and adjacent
sequences of Hox10 proteins. The conserved
amino acids are highlighted in red and the
positions of the conserved motifs
(M1NWLTAKS; M2RENRIRELT) are
indicated.
DEVELOPMENT
Regulation of Hox10 function
2706 RESEARCH ARTICLE
Development 139 (15)
Fig. 3. Skeletal phenotypes of wild-type and of transgenic mice
expressing different versions of the Hoxa10 protein. Each panel
shows a lateral view of the skeleton of an E18.5 fetus, the dissected
axial skeleton including the ossified part of the ribs (when present) and
a dissection of the sternum with the associated cartilaginous part of the
ribs (when present). In all but the wild-type specimen, the collar bone
was left attached to the sternum. (A)Wild-type specimen. (B)Dll1Hoxa10 transgenic. (C)Dll1-Hoxa10M2 transgenic. (D)Dll1-Hoxa10M1
transgenic with the strongest phenotype of all the fetuses obtained
with this transgene. Arrows indicate the remaining cartilaginous part of
the ribs.
for Hoxa10, we generated a version of Hoxa10 lacking most of the
protein’s N-terminal region (Hoxa10NT) but conserving M1, HD
and M2 (Fig. 1) that resembles a naturally occurring Hoxa10
variant (Benson et al., 1995). Transgenic embryos expressing this
protein (Dll1-Hoxa10NT) had no abnormal rib phenotypes (Table
1), indicating that the fragment containing M1, HD and M2 is not
sufficient for Hoxa10 activity, which requires interactions with
other parts of the protein.
To understand further the role of the M1 motif in rib repression,
we replaced the M1-like sequence of Hoxb9 for the M1 motif of
Hox10 proteins (Hoxb9M1). Hoxb9 was selected because even
though it possesses a motif with homologies to M1 we have never
detected abnormal rib phenotypes upon its overexpression in the
presomitic mesoderm, contrary to what is observed with the
overexpression of Hoxa10 driven by the same promoter (Table 1).
Three of the Dll1-Hoxb9M1 transgenic fetuses exhibited small
alterations in rib development (Fig. 4A and Table 1). The most
affected of them contained a ribcage with a moderate reduction in
the rib number, affecting the most rostral and caudal elements of
the ribcage (Fig. 4A). Surprisingly, the three Dll1-Hoxb9M1
transgenics with skeletal anomalies (including that with the smaller
ribcage) contained small ribs attached to the cervical vertebrae
(Fig. 4A). Ectopic formation of cervical ribs is a characteristic
reminiscent of what we observed upon precocious expression of
Hoxb6 (Vinagre et al., 2010) but was never seen in either Dll1Hoxa10 or Dll1-Hoxb9 transgenic fetuses. This indicates that,
although the presence of a typical Hox10 M1 motif is clearly not
sufficient to provide full rib-repressing properties to a Hox protein,
M1 activity requires its conserved
phosphorylatable residues
One of the fingerprints of the M1 motif of Hox10 proteins is the
presence of a Thr at –4 position. Threonine is a target for
phosphorylation, a modification that often modulates protein
function, including that of Hox proteins (Berry and Gehring, 2000;
Jaffe et al., 1997; Taghli-Lamallem et al., 2008). To understand
whether such a modification could play a role in Hoxa10 ribrepressing activity, we replaced the Thr –4 for an alanine
(Hoxa10T>A) and tested its activity in transgenic mice. Hoxa10T>A
retained at least a large part of its rib-repressing activity, as revealed
by the presence of transgenic fetuses with strong rib phenotypes (Fig.
4D,E and Table 1). One of these transgenics was totally rib-less (Fig.
4D), resembling the phenotype typically observed in Dll-Hoxa10
transgenics. In addition, we had two additional Dll1-Hoxa10T>A
specimens with strong rib deficiencies, although they were clearly
far from complete (Fig. 4E and Table 1). The presence of these
intermediate rib phenotypes, which, as discussed above, we never
observed upon expression of the wild-type Hoxa10, indicates that
although Hoxa10T>A is competent to promote full rib repression, its
activity might not be as strong as that of the wild-type Hoxa10.
However, despite this, our results indicate that phosphorylation of
Thr –4 is not essential to confer full repressing activity to Hoxa10.
The M1 motif also contains a serine at –1 position, raising the
possibility that phosphorylation at this residue could compensate for
an eventual need of this modification at Thr –4. To test this, we
changed Ser –1 to Ala both alone (Hoxa10S>A) or combined with a
similar change in Thr –4 (Hoxa10ST>AA) and evaluated the activity
of these proteins in transgenic mice. Hoxa10S>A seemed to retain full
rib-repressing activity, as the rib phenotypes found in Dll1Hoxa10S>A transgenic fetuses were either a complete absence of ribs
or very minor defects in the ribs at the borders of the rib cage (Fig.
4C and Table 1), thus resembling typical phenotypes of Dll1-Hoxa10
transgenics. However, we were unable to detect skeletal
abnormalities in any of the Dll1-Hoxa10ST>AA fetuses that we
generated (Fig. 4F and Table 1). Together, these results indicate that
the presence of at least one hydroxyl group in M1 is required to
confer rib-repressing activity to Hoxa10, which is consistent with the
involvement of phosphorylation within M1 in the regulation of
Hoxa10 rib-repressing activity.
DNA-binding properties of the Hoxa10 mutant
versions
The most common mechanism of Hox activity requires HDmediated binding to DNA (Pearson et al., 2005). As the M1 motif
is located adjacent to this DNA-binding domain, it is possible that
DEVELOPMENT
it seems that it is able to link the protein to the networks controlling
rib development. It further suggests that the outcome of such
interaction might depend on other areas of the Hox protein.
Interestingly, the activity of Hoxb9M1 was different to that of a
similar molecule consisting of the N-terminal region of Hoxb9
linked to M1, HD and M2 of Hoxa10 (Hoxb9NT/a10CT). In particular,
Hoxb9NT/a10CT also lacked rib-repressing properties, but we could
not identify any sign of cervical rib formation in any Dll1Hoxb9NT/a10CT fetus (Table 1). Altogether, our results suggest that
the rib-repressing activity of Hoxa10 might require interaction
between M1 and the N-terminal part of the Hoxa10 protein. In
addition, although the HD and/or M2 of Hoxa10, together with M1,
are not enough to promote inhibition of rib formation, they might
still participate in the interactions between M1 and other parts of
the protein that control rib development.
Regulation of Hox10 function
RESEARCH ARTICLE 2707
Table 1. Summary of the transgenics analyzed and the phenotypes obtained for the different constructs with a brief description
of the intermediate rib phenotypes observed for some of the constructs
Rib phenotypes observed
Construct*
Total
analyzed
Rib-less
Hoxa10
Hoxa10M1
10
16
3
0
0
2
Hoxa10M2
Hoxa10NT
11
9
2
0
0
0
Hoxa10S>A
Hoxa10T>A
11
11
4
1
0
2
9
0
0
Hoxa10ST>AA/YY>FF
10
0
1
Hoxb9
15
0
0
Hoxb9M1
9
0
1¶
Hoxb9NT/a10CT
8
0
0
Hoxa10ST>AA
Intermediate phenotypes
(1) Three ribs missing at the rib cage borders; five
sternal ribs with affected cartilaginous part;
defects in rib attachment to sternum (this fetus
is shown in Fig. 3D)
(2) Three ribs missing at the rib cage borders; two
sternal ribs with minor defects in their
cartilaginous part
(1) Seven ribs missing at the rib cage borders; three
sternal ribs with affected cartilaginous part;
defects in rib attachment to sternum (this fetus
is shown in Fig. 4E)
(2) Four ribs missing at the rib cage borders; one
sternal rib with affected cartilaginous part;
scrambled rib attachment to sternum
Minimal‡
2
2
yes
no
(P=0.010)
3
0
yes
no
(P=0.036)
yes
yes
3
1
0
Rib deficiencies at T10-T13; ribs in T1 did not
contact the sternum
3
0
Three ribs missing at the rib cage borders; smaller
ribs; defects in rib attachment to sternum
Full
activity§
2¶
1
no
(P=0.036)
no
(P=0.030)
no
(P=0.012)
no
(P=0.036)
no
(P=0.044)
it could affect the binding properties of the protein, similar to what
has been described for other regions outside the HD (Liu et al.,
2008). Therefore, we tested whether the loss of rib-repressing
activity of the Hoxa10M1 and the Hoxa10ST>AA mutant proteins
could be related to changes in their DNA-binding properties. For
this, we used the Hox target site in the H1 enhancer of Myf5
(Buchberger et al., 2007), which is involved in the Hoxa10mediated rib-repression process (Vinagre et al., 2010). Hoxa10M1
bound its target within H1 with an affinity comparable to that of
wild-type Hoxa10 (Fig. 5), indicating that altered DNA-binding
properties cannot explain the inability of Hoxa10M1 to repress rib
formation. However, Hoxa10ST>AA bound less efficiently to this
target (Fig. 5), suggesting the possibility that reduced DNA-binding
activity could be at least part of the mechanism involved in the lack
of rib-repressing properties of this mutant protein.
It has been reported that phosphorylation of two tyrosine
residues within the Hoxa10 homeodomain (Y326 and Y343 in the
human protein, which correspond to Y332 and Y349 in the mouse
protein) reduces the binding of this protein to the CYBB and NCF2
enhancers, and that this is part of the mechanism regulating
Hoxa10 function during -interferon-induced differentiation of
myeloid cells (Eklund et al., 2000; Eklund et al., 2002). Because
Hoxa10ST>AA showed reduced DNA-binding properties, we wanted
to determine whether this could have resulted from
phosphorylation at Y332 and Y349. To test this possibility, we
mutated these residues to phenylalanines in the context of the
Hoxa10ST>AA protein (Hoxa10ST>AA/YY>FF). DNA-binding analyses
revealed that this protein bound DNA with affinity comparable to
that of the wild-type Hoxa10 protein (Fig. 5). The restoration of
DNA-binding affinities of Hoxa10ST>AA by mutating the two
conserved tyrosines to phenylalanines is consistent with the
likelihood that modifications in the conserved tyrosine residues
within the HD could represent the origin of the reduced binding
properties of Hoxa10ST>AA.
Increased DNA-binding capacity of Hoxa10ST>AA/YY>FF relative
to Hoxa10ST>AA was associated with a slight increase in ribrepressing activity because, contrary to Dll1-Hoxa10ST>AA
transgenics, some Dll1-Hoxa10ST>AA/YY>FF specimens presented
mild rib phenotypes (Fig. 6 and Table 1). However, the activity of
Hoxa10ST>AA/YY>FF was clearly far from complete as none of the
Dll1-Hoxa10ST>AA/YY>FF transgenic fetuses that we produced was
totally rib-less (Table 1). This indicates that decreased DNAbinding properties are not the main cause of the inability of
Hoxa10ST>AA to repress rib formation but that it can still account
for the slight difference in activity between Hoxa10ST>AA and
Hoxa10ST>AA/YY>FF. Altogether, these results suggest that the
phosphorylation sites in the M1 motif might have a dual regulatory
role. One of them would be connected to the activation of the ribrepressing program in a different part of the molecule. The other
might be associated with an additional regulatory process involving
modification of Hoxa10 affinity to its DNA targets through
modulated phosphorylation of Y332 and Y349 in the HD.
DEVELOPMENT
*The indicated cDNAs were expressed under the Dll1-msd enhancer.
‡Minimal rib phenotypes defined as unilateral or bilateral absence of no more than two ribs.
§
Full activity defined as presence of rib-less phenotypes. When rib-less phenotype was not detected, the P value for a significant absence of a rib-less phenotype on the
basis of the number of transgenics analyzed is indicated (one-tailed two-proportion z-test, significant at P<0.05).
¶These embryos had small ectopic ribs in the cervical area.
Fig. 4. Skeletal phenotypes of transgenic mice expressing
different mutant and chimeric versions of Hox proteins.
(A)Skeletal phenotype of the most affected Dll1-Hoxb9M1 transgenic at
E18.5 showing a lateral view of the whole specimen (left), the cervical,
thoracic and lumbar areas of the axial skeleton (middle), the sternum
with the attached cartilaginous part of the ribs (bottom right) and a
close up of the cervical region (top right). Asterisk indicates the position
of vertebra number 8. Arrow indicates the presence of ectopic cervical
ribs. (B)Close up of the cervical and upper thoracic area of a wild-type
skeleton. Asterisk indicates the position of the first thoracic vertebra
(the eighth vertebra). (C)Skeletal phenotype of a Dll1-Hoxa10S>A
transgenic at E18.5 showing a lateral view of the whole specimen
(right), the dissected axial skeleton (middle) and the sternum with the
collar bone (left). (D)Skeletal phenotype of a rib-less Dll1-Hoxa10T>A
transgenic at E18.5 showing a lateral view of the whole specimen (left),
the dissected axial skeleton (middle) and the sternum with the collar
bone (right). (E)Skeletal phenotype of an intermediately affected Dll1Hoxa10T>A transgenic at E18.5 showing a lateral view of the whole
specimen (right), the dissected axial skeleton (middle) and the sternum
with associated ribs, also including the collar bone (left). Arrows show
residual ribs. (F)Lateral view of the skeletal phenotype of a Dll1Hoxa10ST>AA transgenic at E18.5.
DISCUSSION
Hox genes of the paralog group 10 are able to block rib formation
and this function is essential for patterning of the lumbar area
(Wellik and Capecchi, 2003; Carapuço et al., 2005). Genetic
studies revealed that the three members of this paralog group are
redundant in this function (Wellik and Capecchi, 2003), suggesting
that group 10 proteins should share some sequence or structural
property relevant for setting up the program leading to the block of
rib formation. Sequence comparison revealed that, besides the HD,
Hox10 proteins share just a few conserved regions. Among them,
we identified two small motifs flanking the HD. These motifs show
strong phylogenetic conservation and seem to be group 10 specific,
suggesting that they might play a role in Hox10 functions. Our
analysis of the relevance of these motifs to rib development
revealed that one of them, here named M1, is involved in this
process. The motif located at the C-terminal end of Hox10 proteins
(M2) seems to be dispensable for the rib-repressing activity of
Hoxa10, although a fine regulatory role in this process cannot be
completely ruled out. Gene inactivation studies revealed that
Hox10 genes are also redundant in limb patterning, most
Development 139 (15)
Fig. 5. DNA-binding activity of different versions of the Hoxa10
protein. Electrophoretic mobility shift assay using a probe
corresponding to the H1 enhancer of the Myf5 gene and different
versions of the Hoxa10 protein expressed in 293T cells. Shown from left
to right are the patterns obtained with non-transfected extracts (N-Trf.),
Hoxa10, Hoxa10M1, Hoxa10ST>AA, Hoxa10ST>AA/YY>FF, Hoxa10T>A and
Hoxa10S>A. Shown below are the amounts of the respective Hoxa10
proteins in the extracts used for the EMSA, using western blotting
against the FLAG tag. Arrow indicates the complexes with Hoxa10.
Asterisk identifies the free probe, and the dots indicate the position of
non-specific bands.
particularly the proximal segment (stylopod) of the hindlimb
(Wellik and Capecchi, 2003). It remains to be determined whether
M2 is involved in this process.
Our studies indicate that M1 is required for the rib-repressing
activity of Hox10 proteins because removal of this motif rendered
Hoxa10 virtually inactive in our transgenic assay. However, our data
also indicates that M1 is not sufficient to confer rib-repressing
properties to Hox proteins, but requires the presence of other parts
of the Hox10 protein. The lack of abnormal rib phenotypes in Dll1Hoxa10M1 and Dll1-Hoxb9NT/a10CT transgenic fetuses indicates both
that the presence of the Hoxa10 HD is insufficient to bring M1 active
in rib-repression, and that the N-terminal part of Hoxb9 cannot
replace the equivalent area of Hoxa10, suggesting that the existence
of Hox group-10-specific element(s) is required to activate the ribrepressing program upon interaction with M1. Sequence
comparisons of Hox10 proteins revealed the presence of a few small
conserved regions scattered through the first half of their N-terminal
region, which are obvious candidates to be involved in the ribrepressing function of Hox10 proteins. Experiments are currently
under way in our laboratory to test whether or not they are relevant
to this common Hox10 function in the axial skeleton.
It is not clear what drives the functional connection between M1
and other areas of Hoxa10 to promote rib repression. As discussed
above, our data suggests that this should include direct or indirect
interactions between M1 and the N-terminal region of the protein.
One possibility is that M1 modulates an activity in the N-terminal
region that is eventually responsible for triggering the program that
blocks rib development. Specific modulation of N-terminal activity
by sequences adjacent to the homeodomain has been described for
DEVELOPMENT
2708 RESEARCH ARTICLE
Fig. 6. Skeletal phenotype of a Dll1-Hoxa10ST>AA/YY>FF transgenic
mouse. This is the specimen with the strongest skeletal phenotype.
(A)Lateral view of the skeleton at E18.5. (B)Dorsal view of the
dissected axial skeleton with the ossified part of the ribs. The asterisk
indicates the vertebra number 8. (C)Close-up of the cervical-to-thoracic
transition to show the absent connection of the first rib to the sternum
(arrow). (D)Cartilaginous part of the rib cage attached to the sternum
showing the presence of six, instead of seven, sternal ribs.
other Hox proteins (Merabet et al., 2003; Joshi et al., 2010). This
modulation could be mediated through specific M1-dependent
post-translational modifications in the N-terminal region that would
eventually trigger the rib-repressing program. Our comparison of
the in vivo and in vitro behavior of Hoxa10ST>AA and
Hoxa10ST>AA/YY>FF indicates that M1 could indeed be involved in
the phosphorylation of tyrosine residues in the HD. However,
understanding whether M1 activates rib-repressing properties in the
N-terminal region of Hoxa10 through specific post-translational
modifications will require a direct analysis of proteins with active
and inactive M1 motifs. Another possibility is that M1 is necessary
to recruit co-factors that interact with the N-terminal part of the
protein to repress rib formation. The first obvious candidates for
such factors are Pbx proteins, because of their ability to bind most
Hox proteins (Moens and Selleri, 2006). Indeed, the M1 equivalent
in HOXA9 has been shown to interact with Pbx proteins
(LaRonde-LeBlanc and Wolberger, 2003), suggesting that the M1
motif of Hox10 proteins could also interact with Pbx. However,
even if such interaction occurs, it is not very probable that Pbx
proteins mediate interactions between M1 and N-terminal region
in the rib-repressing process. Genetic data supports this conclusion
as inactivating mutations in Pbx genes are associated with deficient
rib development (Capellini et al., 2008), which is the opposite to
what would be expected for a Hox10 co-factor. Our analysis of
Hoxa10ST>AA also argues against an involvement of Pbx proteins
in Hoxa10 rib-repressing activity. In particular, the mutant M1
motif in Hoxa10ST>AA contains the tryptophan residue thought to
be critical for Pbx-Hox interactions (LaRonde-LeBlanc and
Wolberger, 2003) and it is thus expected that the mutant M1 is still
able to bind Pbx proteins. However, Hoxa10ST>AA (or
Hoxa10ST>AA/YY>FF) lacks rib-repressing properties, thus
suggesting that this activity is independent of Pbx. In addition,
experiments performed in our laboratory, aimed at identifying
Hoxa10-Pbx1 interactions in the context of the H1 enhancer, did
not provide any evidence for such interactions (supplementary
material Fig. S1). In conclusion, although we cannot formally rule
out an involvement of Pbx proteins in the Hoxa10-mediated ribrepressing process, all evidence seems to go against Pbx proteins
as Hox10 co-factors in this process. Considering that M1 can be
RESEARCH ARTICLE 2709
somehow regarded as a functional equivalent of the hexapeptide
present in Hox1-8 proteins, other factors that could mediate M1
activity are proteins related to Bip2, as this protein, a member of
the TFIID complex involved in transcription initiation, has been
shown to bind the hexapeptide of Antp (Prince et al., 2008).
Whether Bip2 or related proteins are indeed involved in the
functional interactions of M1 remains to be determined. Clearly,
identification of bona fide M1-binding partners will require a
systematic experimental approach.
Our data is compatible with phosphorylation within M1 being
essential to promote and/or regulate its function in the rib-repression
process. M1 contains conserved Thr and Ser residues, which are
essential for its function as their mutation to Ala completely removes
rib-repressing activity from the Hoxa10 protein. According to our
data, the presence of either the Thr or Ser is enough to keep Hoxa10
activity in rib development, as individual Hoxa10S>A and Hoxa10T>A
mutants conserved rib-repressing properties. Although both residues
seem to be sufficient to promote Hoxa10 rib-repressing activity, the
small phenotypic differences between Dll1-Hoxa10S>A and Dll1Hoxa10T>A transgenics suggest that, physiologically, the relative
weight of the Thr (actually the most Hox10 specific) in this process
is slightly higher than that of the Ser.
Comparison of the phenotypes of Dll1-Hoxa10M1, Dll1Hoxa10ST>AA and Dll1-Hoxa10ST>AA/YY>FF transgenic fetuses,
suggests that modification of the Thr or Ser is required for
productive interactions between M1 and the N-terminal region,
leading to activation of the rib-repressing program. Interestingly,
our data indicates that M1 might also be implicated in an additional
type of regulatory process involving interactions between M1 and
the HD, ultimately controlling the phosphorylation state of two
conserved tyrosine residues within the HD (Y332 and Y349),
which influences the DNA-binding properties of the molecule. Our
data is compatible with phosphorylation of Y332 and Y349 being
the origin of the small differences in activity that we detected for
Hoxa10ST>AA, compared with that of Hoxa10M1 and
Hoxa10ST>AA/YY>FF, suggesting that this mechanism might also be
part of the physiological control of Hox10 activity during rib
development. Such a mechanism resembles that described to
modulate Hoxa10 activity during -interferon-induced
differentiation of myeloid cells (Eklund et al., 2000; Eklund et al.,
2002). In myeloid cells, it has been shown that this regulation
requires the activity of Shp1 (Ptpn6 – Mouse Genome Informatics)
(Eklund et al., 2002). Involvement of this factor in the control of
rib development is not probable, however, as SHP1 has been
described to be hematopoietic-specific (Plutzky et al., 1992) and
Shp1 null mutant mice appear to have no rib problems (Kozlowski
et al., 1993). It remains to be determined whether the factors that
mediate M1 interactions with the N-terminal region and HD are the
same or different. It is clear that identification of molecules
interacting with M1 and analysis of how modifications in M1 affect
those interactions and/or their functional output will be essential to
understand how Hox10 proteins control rib development.
Acknowledgements
We thank members of the Mallo lab for helpful comments throughout the
course of this work. We are grateful to Ines Domingues, Arnon Jurberg, Ana
Santos and Aybuke Isik for their comments on different drafts; Jennifer
Rowland for checking the English language of the manuscript; and Daniel
Damineli for helping with the statistical evaluation of the transgenic
phenotypes.
Funding
This work was supported by Fundação para a Ciência e a Tecnologia
[PTDC/SAU-BID/110640/2009 to M.M.].
DEVELOPMENT
Regulation of Hox10 function
Competing interests statement
The authors declare no competing financial interests.
Supplementary material
Supplementary material available online at
http://dev.biologists.org/lookup/suppl/doi:10.1242/dev.081448/-/DC1
References
Beckers, J., Caron, A., Hrabe de Angelis, M., Hans, S., Campos-Ortega, J. A.
and Gossler, A. (2000). Distinct regulatory elements direct delta1 expression in
the nervous system and paraxial mesoderm of transgenic mice. Mech. Dev. 95,
23-34.
Benson, G. V., Nguyen, T. H. and Maas, R. L. (1995). The expression pattern of
the murine Hoxa-10 gene and the sequence recognition of its homeodomain
reveal specific properties of Abdominal B-like genes. Mol. Cell. Biol. 15, 15911601.
Berry, M. and Gehring, W. (2000). Phosphorylation status of the SCR
homeodomain determines its functional activity: essential role for protein
phosphatase 2A,B’. EMBO J. 19, 2946-2957.
Buchberger, A., Freitag, D. and Arnold, H. H. (2007). A homeo-paired domainbinding motif directs Myf5 expression in progenitor cells of limb muscle.
Development 134, 1171-1180.
Capellini, T. D., Di Giacomo, G., Salsi, V., Brendolan, A., Ferretti, E.,
Srivastava, D., Zappavigna, V. and Selleri, L. (2006). Pbx1/Pbx2 requirement
for distal limb patterning is mediated by the hierarchical control of Hox gene
spatial distribution and Shh expression. Development 133, 2263-2273.
Capellini, T. D., Zewdu, R., Di Giacomo, G., Asciutti, S., Kugler, J. E., Di
Gregorio, A. and Selleri, L. (2008). Pbx1/Pbx2 govern axial skeletal
development by controlling Polycomb and Hox in mesoderm and Pax1/Pax9 in
sclerotome. Dev. Biol. 321, 500-514.
Carapuço, M., Nóvoa, A., Bobola, N. and Mallo, M. (2005). Hox genes specify
vertebral types in the presomitic mesoderm. Genes Dev. 19, 2116-2121.
Chan, S. K. and Mann, R. S. (1993). The segment identity functions of
Ultrabithorax are contained within its homeo domain and carboxy-terminal
sequences. Genes Dev. 7, 796-811.
Chan, S. K. and Mann, R. S. (1996). A structural model for a homeotic proteinextra-denticle-DNA complex accounts for the choice of HOX protein in the
heterodimer. Proc. Natl. Acad. Sci. USA 93, 5223-5228.
Duboule, D. (2007). The rise and fall of Hox gene clusters. Development 134,
2549-2560.
Ekker, S. C., Jackson, D. G., von Kessler, D. P., Sun, B. I., Young, K. E. and
Beachy. P. A. (1994). The degree of variation in DNA sequence recognition
among four Drosophila homeotic proteins. EMBO J. 13, 3551-3560.
Eklund, E. A., Jalava, A. and Kakar, R. (2000). Tyrosine phosphorylation of
HoxA10 decreases DNA binding and transcriptional repression during interferon
gamma-induced differentiation of myeloid leukemia cell lines. J. Biol. Chem.
275, 20117-20126.
Eklund, E. A., Goldenberg, I., Lu, Y., Andrejic, J. and Kakar, R. (2002). SHP1
protein-tyrosine phosphatase regulates HoxA10 DNA binding and transcriptional
repression activity in undifferentiated myeloid cells. J. Biol. Chem. 277, 3687836888.
Galant, R. and Carroll, S. B. (2002). Evolution of a transcriptional repression
domain in an insect Hox protein. Nature 415, 910-913.
Hogan, B., Beddington, R., Constantini, F. and Lacy, E. (1994). Manipulating
The Mouse Embryo: A Laboratory Manual. Cold Spring Harbor: Cold Spring
Harbor Laboratory Press.
Jaffe, L., Ryoo, H. D. and Mann, R. S. (1997). A role for phosphorylation by
casein kinase II in modulating Antennapedia activity in Drosophila. Genes Dev.
11, 1327-1340.
Joshi, R., Passner, J. M., Rohs, R., Jain, R., Sosinsky, A., Crickmore, M. A.,
Jacob, V., Aggarwal, A. K., Honig, B. and Mann, R. S. (2007). Functional
specificity of a Hox protein mediated by the recognition of minor groove
structure. Cell 131, 530-543.
Joshi, R., Sun, L. and Mann, R. (2010). Dissecting the functional specificities of
two Hox proteins. Genes Dev. 24, 1533-1545.
Kozlowski, M., Mlinaric-Rascan, I., Feng, G. S., Shen, R., Pawson, T. and
Siminovitch, K. A. (1993). Expression and catalytic activity of the tyrosine
phosphatase PTP1C is severely impaired in motheaten and viable motheaten
mice. J. Exp. Med. 178, 2157-2163.
Krumlauf, R. (1994). Hox genes in vertebrate development. Cell 78, 191-201.
Development 139 (15)
LaRonde-LeBlanc, N. A. and Wolberger, C. (2003). Structure of HoxA9 and
Pbx1 bound to DNA: Hox hexapeptide and DNA recognition anterior to
posterior. Genes Dev. 17, 2060-2072.
Liu, Y., Matthews, K. S. and Bondos, S. E. (2008). Multiple intrinsically
disordered sequences alter DNA binding by the homeodomain of the Drosophila
hox protein ultrabithorax. J. Biol. Chem. 283, 20874-20887.
Mallo, M. and Brändlin, I. (1997). Segmental identity can change independently
in the hindbrain and rhombencephalic neural crest. Dev. Dyn. 210, 146-156.
Mallo, M., Wellik, D. M. and Deschamps, J. (2010). Hox genes and regional
patterning of the vertebrate body plan. Dev. Biol. 344, 7-15.
Mann, R. S., Lelli, K. M. and Joshi, R. (2009). Hox specificity: unique roles for
cofactors and collaborators. Curr. Top. Dev. Biol. 88, 63-101.
McIntyre, D. C., Rakshit, S., Yallowitz, A. R., Loken, L., Jeannotte, L.,
Capecchi, M. R. and Wellik, D. M. (2007). Hox patterning of the vertebrate rib
cage. Development 134, 2981-2989.
Merabet, S., Kambris, Z., Capovilla, M., Bérenger, H., Pradel, J. and Graba, Y.
(2003). The hexapeptide and linker regions of the AbdA Hox protein regulate its
activating and repressive functions. Dev. Cell. 4, 761-768.
Merabet, S., Saadaoui, M., Sambrani, N., Hudry, B., Pradel, J., Affolter, M.
and Graba, Y. (2007). A unique Extradenticle recruitment mode in the
Drosophila Hox protein Ultrabithorax. Proc. Natl. Acad. Sci. USA 104, 1694616951.
Moens, C. B. and Selleri, L. (2006). Hox cofactors in vertebrate development.
Dev. Biol. 291, 193-206.
Noyes, M. B., Christensen, R. G., Wakabayashi, A., Stormo, G. D., Brodsky,
M. H. and Wolfe, S. A. (2008). Analysis of homeodomain specificities allows
the family-wide prediction of preferred recognition sites. Cell 133, 1277-1289.
Papadopoulos, D. K., Vukojevic, V., Adachi, Y., Terenius, L., Rigler, R. and
Gehring, W. J. (2010). Function and specificity of synthetic Hox transcription
factors in vivo. Proc. Natl. Acad. Sci. USA 107, 4087-4092.
Pearson, J. C., Lemons, D. and McGinnis, W. (2005). Modulating Hox gene
functions during animal body patterning. Nat. Rev. Genet. 6, 893-904.
Phelan, M. L., Rambaldi, I. and Featherstone, M. S. (1995). Cooperative
interactions between HOX and PBX proteins mediated by a conserved peptide
motif. Mol. Cell. Biol. 15, 3989-3997.
Plutzky, J., Neel, B. G. and Rosenberg. R. D. (1992). Isolation of a src homology
2-containing tyrosine phosphatase. Proc. Natl. Acad. Sci. USA 89, 1123-1127.
Prince, F., Katsuyama, T., Oshima, Y., Plaza, S., Resendez-Perez, D., Berry, M.,
Kurata, S. and Gehring, W. J. (2008). The YPWM motif links Antennapedia to
the basal transcriptional machinery. Development 135, 1669-1679.
Ronshaugen, M., McGinnis, N. and McGinnis, W. (2002). Hox protein mutation
and macroevolution of the insect body plan. Nature 415, 914-917.
Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989). Molecular Cloning: A
Laboratory Manual. Cold Spring Harbor: Cold Spring Harbor Laboratory Press.
Slattery, M., Riley, T., Liu, P., Abe, N., Gomez-Alcala, P., Dror, I., Zhou, T.,
Rohs, R., Honig, B., Bussemaker, H. J. and Mann, R. S. (2011). Cofactor
binding evokes latent differences in DNA binding specificity between Hox
proteins. Cell 147, 1270-1282.
Taghli-Lamallem, O., Hsia, C., Ronshaugen, M. and McGinnis, W. (2008).
Context-dependent regulation of Hox protein functions by CK2 phosphorylation
sites. Dev. Genes Evol. 218, 321-332.
Vinagre, T., Moncaut, N., Carapuço, M., Nóvoa, A., Bom, J. and Mallo, M.
(2010). Evidence for a myotomal Hox/Myf cascade governing non-autonomous
control of rib specification within global vertebral domains. Dev. Cell 18, 655661.
Wadman, I. A., Osada, H., Grütz, G. G., Agulnick, A. D., Westphal, H.,
Forster, A. and Rabbitts, T. H. (1997). The LIM-only protein Lmo2 is a bridging
molecule assembling an erythroid, DNA-binding complex which includes the
TAL1, E47, GATA-1 and Ldb1/NLI proteins. EMBO J. 16, 3145-3157.
Wellik, D. M. and Capecchi, M. R. (2003). Hox10 and Hox11 genes are required
to globally pattern the mammalian skeleton. Science 301, 363-367.
Yallowitz, A. R., Gong, K. Q., Swinehart, I. T., Nelson, L. T. and Wellik, D. M.
(2009). Non-homeodomain regions of Hox proteins mediate activation versus
repression of Six2 via a single enhancer site in vivo. Dev. Biol. 335, 156-165.
Young, T., Rowland, J. E., van de Ven, C.,Bialecka, M., Novoa, A., Carapuco,
M., van Nes, J., de Graaff, W., Duluc, I., Freund, J. N., Beck, F., Mallo, M.
and Deschamps, J. (2009). Hox and Cdx genes differentially regulate posterior
axial growth in mammalian embryos. Dev. Cell 17, 516-526.
Zhao, Y. and Potter, S. S. (2001). Functional specificity of the Hoxa13 homeobox.
Development 128, 3197-3207.
Zhao, Y. and Potter, S. S. (2002). Functional comparison of the Hoxa4, Hoxa10,
and Hoxa11 homeoboxes. Dev. Biol. 244, 21-36.
DEVELOPMENT
2710 RESEARCH ARTICLE