California State University, Northridge
Characterization of Eleven Genes Putatively Associated with Akinete Development
in Nostoc punctiforme
A thesis submitted in partial fulfillment of the requirements
For the degree of Master of Science
in Biology
By
Sassan Tamaddoni
December 2013
The thesis of Sassan Tamaddoni is approved:
_______________________________
_____________________
Sean Murray, Ph.D.
Date
_______________________________
_____________________
Mary-Pat Stein, Ph.D.
Date
_______________________________
_____________________
Michael L. Summers, Ph.D., Chair
Date
California State University, Northridge
ii
ACKNOWLEDGMENTS
I’d like to sincerely thank Dr. Michael Summers not only for his guidance and support
throughout this project but also for giving me the opportunity to be a part of his team and
challenging my understanding of Science. And of course the free home-brew  His
continuous encouragement helped reinforce this endeavor through the many challenges
that paralleled this project.
It was an honor to have Drs. Sean Murray and Mary-Pat Stein as part of my defense
committee. Their counseling, guidance and above all friendship from the beginning of
this graduate venture have been very supportive. Thank you! It was pleasure knowing
you for so many years and I’m grateful you could be here for the finish.
To my colleagues, past and present, I’d like to express my gratitude for your
encouragement and support. The late nights in the lab will not be forgotten. A special
“thank you” goes to Wilber Escorcia, Ani Martirosian, Anantha Peramuna, Jenevieve
Polin, Alyssa Pisikayan, Jamie Lee, and Corina Calderon.
Recognition for support of this work includes Angelica Cardenas, Peter Holmquist,
Svetlana Rose, the Microbial Genetics (Bio512) Class of Fall 2007, and the Peter
Belinger and NIH grants.
Mom, Dad, “Chubs”, “Grandma-G”, “406”, the “3-Wise Men” and all of my friends…
Thank you for you teaching me to fight every challenge with,
Honesty
Enthusiasm
Rationale, and
Optimism
You are the true definition of a HERO.
Adventure On,
-
iii
Sassan “Sass” Tamaddoni
TABLE OF CONTENTS
Signature Page
ii
Acknowledgements
iii
List of Tables
vii
List of Figures
viii
Abstract
xiv
Introduction and Background
1
Cyanobacteria
1
Nostoc punctiforme ATCC29133 (PCC 73102)
1
Heterocysts
2
Akinetes
4
Hormogonia
5
The zwf mutant, UCD 466
6
Identification of akinete-expressed genes
6
Project Inception
7
Bacterial Two-Component Regulatory Systems
7
Materials and Methods
13
Bacterial Strains and Culture Conditions
13
Rapid Amplification of cDNA Ends (RACE) Mapping
13
Agarose Gel Electrophoresis
16
Green-Fluorescent Protein (GFP) Transcriptional Reporter Assay
16
Cloning and GFP Reporter Plasmid Construction
17
Transformant Colony PCR and DNA Extraction
20
Electroporation
20
GFP Reporter Strain Growth Conditions and Maintenance
21
Heterocyst Induction
22
Akinete Induction
22
iv
Epifluorescence Microscopy
22
Strategy for PCR Mediated In-frame Deletional Mutagenesis
23
PCR Mediated Deletional Gene Mutation
24
Triparental Conjugation
27
Results
31
NpF0020: Multi Sensor Signal Transduction Histidine Kinase
31
NpF0022: Response Regulator Receiver Sensor Transduction Histidine
41
NpF2868: Pad R-Like Transcriptional Regulator
50
NpF2889: Sensor Hybrid Histidine Kinase
60
NpF4131: Sensor Hybrid Histidine Kinase
75
NpR0438: ArsR Family Transcriptional Regulator
85
NpR1110: Histidine Kinase
97
NpR1449: Response Regulator Receiver Sensor Transduction Histidine
106
NpR3548: Multi Sensor Hybrid Histidine Kinase
115
NpR5425: RNA-binding S1 Domain- Containing Protein
124
NpR6228: Two Component Transcriptional Regulator
133
Discussion
143
NpF0020: Multi Sensor Signal Transduction Histidine Kinase
143
NpF0022: Response Regulator Receiver Sensor Transduction Histidine
145
NpF2868: Pad R-Like Transcriptional Regulator
146
NpF2889: Sensor Hybrid Histidine Kinase
148
NpF4131: Sensor Hybrid Histidine Kinase
151
NpR0438: ArsR Family Transcriptional Regulator
153
NpR1110: Histidine Kinase Hypothetical Protein
154
NpR1449: Response Regulator Receiver Sensor Transduction Histidine
156
NpR3548: Multi Sensor Hybrid Histidine Kinase
157
NpR5425: RNA-Binding S1 Domain- Containing Protein
159
v
NpR6228: Two Component Transcriptional Regulator
160
Conclusion
161
References
162
Appendices
168
vi
LIST OF TABLES
Table 1. List of Eleven Genes of Interest
7
Table 2. Conditions for Touchdown PCR Amplification
15
Table 3. PCR Conditions for Amplification of Promoter Regions
18
Table 4. PCR Conditions for Amplification of PCR1 and PCR 2
24
Table 5. PCR Conditions for Amplification of PCR3a
25
Table 6. PCR Conditions for Amplification of PCR3b
26
Table 7. PCR Cycle Parameters for Secondary Recombinant Screening
30
vii
LIST OF FIGURES
Figure 1. Nostoc punctiforme cell types
2
Figure 2. Schematic diagram of a typical two-component regulatory system
8
Figure 3. Prototypical Two-Component Regulatory System Schemes
10
Figure 4. Schematic Representation of the Three Different Mechanisms of
11
Stimulus Perception
Figure 5. Rapid Amplification of cDNA Ends (RACE) Mapping Schematic
14
Figure 6. Generic Diagram of PSUN119
18
Figure 7. PCR Mediated Gene Mutation (PCR1, PCR2, PCR3a)
25
Figure 8. PCR Mediated Gene Mutation (PCR3b)
26
Figure 9. Triparental Conjugation Schematic
28
Figure 10. NpF0020 zwf DNA Microarray Expression Data
31
Figure 11. NpF0020 Conserved Domains
32
Figure 12. NpF0020 10Kb Chromosomal Locus
32
Figure 13. NpF0020 RACE Sequencing Electropherogram
33
Figure 14. NpF0020 Nucleotide Sequence
33
Figure 15. NpF0020 Reporter Akinete Induction Day 0
35
Figure 16. NpF0020 Reporter Akinete Induction Day 1
36
Figure 17. NpF0020 Reporter Akinete Induction Day 6
37
Figure 18. NpF0020 Reporter Akinete Induction Day 14
38
Figure 19. NpF0020 Reporter Akinete Induction Day 20
39
Figure 20. NpF0020 Reporter Akinete Induction Day 23
40
Figure 21. NpF0022 zwf DNA Microarray Expression Data
41
Figure 22. NpF0022 Conserved Domains
42
Figure 23. NpF0022 10Kb Chromosomal Locus
42
Figure 24. NpF0022 Nucleotide Sequence
42
Figure 25. NpF0022 RACE Sequencing Electropherogram
43
Figure 26. NpF0022 Reporter Akinete Induction Day 0
44
viii
Figure 27. NpF0022 Reporter Akinete Induction Day 1
45
Figure 28. NpF0022 Reporter Akinete Induction Day 3
46
Figure 29. NpF0022 Reporter Akinete Induction Day 7
47
Figure 30. NpF0022 Reporter Akinete Induction Day 10
48
Figure 31. NpF0022 Reporter Akinete Induction Day 14
49
Figure 32. NpF2868 zwf DNA Microarray Expression Data
50
Figure 33. NpF2868 10Kb Chromosomal Locus
51
Figure 34. NpF2868 Conserved Domains
51
Figure 35. NpF2868 Nucleotide Sequence
51
Figure 36. NpF2868 RACE Sequencing Electropherogram
52
Figure 37. NpF2868 Reporter Akinete Induction Day 0
53
Figure 38. NpF2868 Reporter Akinete Induction Day 3
54
Figure 39. NpF2868 Reporter Akinete Induction Day 6
55
Figure 40. NpF2868 Reporter Akinete Induction Day 10
56
Figure 41. NpF2868 Reporter Akinete Induction Day 12
57
Figure 42. NpF2868 Reporter Akinete Induction Day 17
58
Figure 43. Colony PCR Gel Electrophoresis Image for ΔNpF2868
Secondary Recombinant Mutant Gel
59
Figure 44. NpF2889 zwf DNA Microarray Expression Data
60
Figure 45. NpF2889 Conserved Domains
61
Figure 46. NpF2889 10Kb Chromosomal Locus
61
Figure 47. NpF2889 Nucleotide Sequence
61
Figure 48. NpF2889 RACE Sequencing Electropherogram
62
Figure 49. NpF2889 Reporter Akinete Induction Day 0
64
Figure 50. NpF2889 Reporter Akinete Induction Day 3
65
Figure 51. NpF2889 Reporter Akinete Induction Day 7
66
Figure 52. NpF2889 Reporter Akinete Induction Day 10
67
Figure 53. NpF2889 Reporter Akinete Induction Day 17
68
ix
Figure 54. NpF2889 Reporter Akinete Induction Day 26
69
Figure 55. Colony PCR Gel Electrophoresis Image for ΔNpF2889
Secondary Recombinant Mutant Gel
70
Figure 56. ΔNpF2889 Heterocyst Induction Day 5
70
Figure 57. ΔNpF2889 Heterocyst Induction Day 6
71
Figure 58. ΔNpF2889 Heterocyst Induction Day 10
71
Figure 59. ΔNpF2889 Heterocyst Periodic acid–Schiff -Stain Day 5
72
Figure 60. Wild-type Heterocyst Periodic acid–Schiff -Stain Day 5
72
Figure 61. ΔNpF2889 Akinete Induction Day 3
73
Figure 62. ΔNpF2889 Akinete Induction Day 6
73
Figure 63. ΔNpF2889 Akinete Induction Day 10
74
Figure 64. ΔNpF2889 Akinete Induction Day 15
74
Figure 65. NpF4131 zwf DNA Microarray Expression Data
75
Figure 66. NpF4131 Conserved Domains
76
Figure 67. NpF4131 10Kb Chromosomal Locus
76
Figure 68. NpF4131 Nucleotide Sequence
76
Figure 69. NpF4131 RACE Sequencing Electropherogram
77
Figure 70. NpF4131 Reporter Akinete Induction Day 0
78
Figure 71. NpF4131 Reporter Akinete Induction Day 1
79
Figure 72. NpF4131 Reporter Akinete Induction Day 6
80
Figure 73. NpF4131 Reporter Akinete Induction Day 13
81
Figure 74. NpF4131 Reporter Akinete Induction Day 20
82
Figure 75. NpF4131 Reporter Akinete Induction Day 23
83
Figure 76. Colony PCR Gel Electrophoresis Image for ΔNpF4131
Secondary Recombinant Mutant Gel
84
Figure 77. NpR0438 zwf DNA Microarray Expression Data
85
Figure 78. NpR0438 Conserved Domains
86
Figure 79. NpR0438 10Kb Chromosomal Locus
86
x
Figure 80. NpR0438 Nucleotide Sequence
87
Figure 81. NpR0438 RACE Sequencing Electropherogram (A+1)
87
Figure 82. NpR0438 RACE Sequencing Electropherogram (C+1)
87
Figure 83. NpR0438 Reporter Akinete Induction Day 0
89
Figure 84. NpR0438 Reporter Akinete Induction Day 3
90
Figure 85. NpR0438 Reporter Akinete Induction Day 7
91
Figure 86. NpR0438 Reporter Akinete Induction Day 10
92
Figure 87. NpR0438 Reporter Akinete Induction Day 12
93
Figure 88. NpR0438 Reporter Akinete Induction Day 17
94
Figure 89. NpR0438 Reporter Akinete Induction Day 26
95
Figure 90. NpR0438 Reporter Akinete Induction Day 36
96
Figure 91. NpR1110 zwf DNA Microarray Expression Data
97
Figure 92. NpR1110 Conserved Domains
98
Figure 93. NpR1110 10Kb Chromosomal Locus
98
Figure 94. NpR1110 Nucleotide Sequence
98
Figure 95. NpR1110 RACE Sequencing Electropherogram
99
Figure 96. NpR1110 Reporter Akinete Induction Day 0
100
Figure 97. NpR1110 Reporter Akinete Induction Day 3
101
Figure 98. NpR1110 Reporter Akinete Induction Day 6
102
Figure 99. NpR1110 Reporter Akinete Induction Day 13
103
Figure 100. NpR1110 Reporter Akinete Induction Day 17
104
Figure 101. NpR1110 Reporter Akinete Induction Day 23
105
Figure 102. NpR1449 zwf DNA Microarray Expression Data
106
Figure 103. NpR1449 Conserved Domains
107
Figure 104. NpR1449 10Kb Chromosomal Locus
107
Figure 105. NpR1449 Nucleotide Sequence
107
Figure 106. NpR1449 RACE Sequencing Electropherogram
108
xi
Figure 107. NpR1449 Reporter Akinete Induction Day 0
109
Figure 108. NpR1449 Reporter Akinete Induction Day 1
110
Figure 109. NpR1449 Reporter Akinete Induction Day 6
111
Figure 110. NpR1449 Reporter Akinete Induction Day 13
112
Figure 111. NpR1449 Reporter Akinete Induction Day 20
113
Figure 112. NpR1449 Reporter Akinete Induction Day 23
114
Figure 113. NpR3548 zwf DNA Microarray Expression Data
115
Figure 114. NpR3548 Conserved Domains
116
Figure 115. NpR3548 10Kb Chromosomal Locus
116
Figure 116. NpR3548 Nucleotide Sequence
116
Figure 117. NpR3548 RACE Sequencing Electropherogram
117
Figure 118. NpR3548 Reporter Akinete Induction Day 0
118
Figure 119. NpR3548 Reporter Akinete Induction Day 1
119
Figure 120. NpR3548 Reporter Akinete Induction Day 6
120
Figure 121. NpR3548 Reporter Akinete Induction Day 13
121
Figure 122. NpR3548 Reporter Akinete Induction Day 20
122
Figure 123. NpR3548 Reporter Akinete Induction Day 23
123
Figure 124. NpR5425 zwf DNA Microarray Expression Data
124
Figure 125. NpR5425 Conserved Domains
125
Figure 126. NpR5425 10Kb Chromosomal Locus
125
Figure 127. NpR5425 Upstream Intergenic Sequence Alignment with all5249
126
Figure 128. NpR5425 Nucleotide Sequence
126
Figure 129. NpR5425 Reporter Akinete Induction Day 0
127
Figure 130. NpR5425 Reporter Akinete Induction Day 3
128
Figure 131. NpR5425 Reporter Akinete Induction Day 7
129
Figure 132. NpR5425 Reporter Akinete Induction Day 14
130
Figure 133. NpR5425 Reporter Akinete Induction Day 20
131
xii
Figure 134. NpR5425 Reporter Akinete Induction Day 22
132
Figure 135. NpR6228 zwf DNA Microarray Expression Data
133
Figure 136. NpR6228 Conserved Domains
134
Figure 137. NpR6228 10Kb Chromosomal Locus
134
Figure 138. NpR6228 Nucleotide Sequence
134
Figure 139. NpR6228 RACE Sequencing Electropherogram
134
Figure 140. NpR6228 Reporter Akinete Induction Day 0
136
Figure 141. NpR6228 Reporter Akinete Induction Day 3
137
Figure 142. NpR6228 Reporter Akinete Induction Day 7
138
Figure 143. NpR6228 Reporter Akinete Induction Day 10
139
Figure 144. NpR6228 Reporter Akinete Induction Day 12
140
Figure 145. NpR6228 Reporter Akinete Induction Day 15
141
Figure 146. NpR6228 Reporter Akinete Induction Day 19
142
xiii
ABSTRACT
Characterization of Eleven Genes Putatively Associated with Akinete Development
in Nostoc punctiforme
By
Sassan Tamaddoni
Masters of Science in Biology
The cyanobacterium, Nostoc punctiforme is capable of differentiating into various cell
types that allow adaptation and survival under various environmental threats. It has
proven to be a unique model system for investigating genetic regulation leading to
cyanobacterial cell differentiation. Heterocysts are a nitrogen fixing cells that form every
15-20 cells within a filament in response to a deficiency in combined nitrogen. Akinetes
are another morphologically distinct cell type that differentiate from vegetative cells
under low-light intensities and limiting phosphate or potassium. They enable survival of
environmental extremes such as cold or desiccation and are thought to allow persistence
of the species from season to season. A previous DNA microarray experiment identified
a set of eleven genes with homology to known transcriptional regulators that exhibited
1.5 to 2-fold increase in expression during akinete formation. The aim of this project was
to verify the microarray results using transcriptional reporter strains. The pSUN119
transcriptional GFP reporter plasmid was fused with promoters of each gene of interest
and electroporated into N. punctiforme. Under akinete inducing conditions, 8 out of 11
reporter strains showed GFP fluorescence under epifluorescence microscopy indicating
transcriptional up-regulation during akinesis. Of the remaining 3 genes, two showed
increased expression in heterocysts while the third had no upregulation in either cell
types. Additionally, three mutant strains were created by gene deletion. So far the
phenotype of one mutant has been identified; ΔNpF2889 is deficient in heterocyst
formation and is unable to fix N2.
xiv
Introduction and Background
Cyanobacteria
Early evolution of life on earth and the burgeoning of bio-diversity during the
Precambrian Era (~3 billion years ago) were profoundly influenced by a group of bluegreen microorganisms known as cyanobacteria. Exploiting the foundation of
photosynthesis, the system that converts atmospheric carbon dioxide with the help of
sunlight and water, into a reduced carbon energy source (such as glucose), cyanobacteria
became a significant contributor to primary production. Consequently this led to the
oxidation of Earth’s abounding carbon dioxide atmosphere and eventually heralded the
preparation for divergence of more complex eukaryotic organisms (Adams and Duggan,
1999). Although a majority of cyanobacteria behave photoautotrophically, some are also
able to use several saccharides in either light or dark conditions (Luque et al., 1994).
Preferentially these organisms use inorganic nitrogen such as nitrate or ammonia for
growth, but many species have adapted to perform nitrogen fixation to create combined
nitrogen for assimilation and growth (Luque et al., 1994). A direct consequence of this
adaptive feature positioned cyanobacteria to contribute to the nitrogen cycle, important
for the continuance of marine and terrestrial life (Herrero et al., 2008).
Over time with their collection of adaptive strengths, not limited to the features
mentioned above, cyanobacteria have colonized several ecological niches (Iteman et al.,
2000) and spread across aquatic and terrestrial environments including extreme habitats
such as hot springs, deserts and polar regions (Whitton et al., 2000). The cyanobacteria
group is monophyletic but demonstrate morphological diversity, and their morphological
distinctions have been used to categorize the group into five (I-V) subsections (Rippka et
al., 1979). These morphological features can include variations to cell shape, avenue of
fission, cell function or adaptation features. Nostoc punctiforme, the species of interest
for this study, belongs to group IV, the Nostocales order, which consist of filamentous
vegetative cells that have the adaptive potential to differentiate into heterocysts
specialized for nitrogen fixation, or akinetes, a dormant cell state allowing for survival
under environmental stresses, both discussed in further detail later. (Tomitani et al.,
2006). Although all cyanobacteria collectively deserve reverence from a biological
standpoint, N. puncitforme’s collection of adaptive features provide compelling
incentives to initiate further investigations using their developed molecular genetics
systems.
Nostoc punctiforme ATCC29133 (PCC 73102)
Unlike most heterotrophic organisms, cyanobacteria require a minimal nutrition,
which includes minerals such as phosphate, the presence of nitrogen compounds,
adequate light, and atmospheric carbon dioxide. In situations where light is limited, N.
punctiforme is among the few cyanobacteria that can grow by heterotrophic means, using
exogenous simple sugars such as glucose, sucrose or fructose as a reduced carbon source
in place of carbon dioxide (Campbell et al., 2007). At optimum levels of fixed nitrogen,
filaments assume a vegetative state where by cells grow and divide in a plane transverse
to the filament, propagating the vegetative-cell cycle to produce an un-branched filament
(Meeks, 2005). Under limiting nutrient conditions or environmental stress, N.
1
punctiforme has the capacity to differentiate from the vegetative cell (5-6ul in diameter)
state into accommodating states as one of three distinct cellular forms: the heterocyst, the
hormogonium and the akinete (see Figure 1), each with its own unique characteristics.
Heterocysts (6-10ul in diameter) are thick-walled and terminally differentiated cells
induced upon nitrate or ammonia limitation that can reduce atmospheric nitrogen and
share this with neighboring vegetative cells (Campbell et al., 2007). Hormogonia are
composed of smaller cells caused by rapid division of vegetative cells without an increase
in cell mass. The hormogonia exhibit gliding motility and are induced by any of a number
of stress conditions (Campbell et al., 2007). Hormogonia are thought to use this
movement to escape from non-optimal environmental conditions.
The third
differentiation potential is the akinete (10-20ul in diameter), a thick cell walled spore-like
cell developed under energy limitations that can withstand desiccation and cold
extremities (Adams et al., 1999).
Figure 1. N. punctiforme cell types. Under limiting nutrient conditions or stress that translates to
environmental signals, N. punctiforme has the capacity to differentiate from the vegetative cell (5-6ul in
diameter) state into three distinct cellular forms: heterocyst, hormogonia and akinetes.
Heterocysts
Nitrogen fixation in N. punctiforme provides a great survival advantage in
environments deficient in combined nitrogen. The differentiated heterocysts responsible
for fixing nitrogen make up about 5-10% of the cells along each filament (Meeks 2005),
where about every fifteenth cell differentiates (Yossef et al., 2011) when induced from
2
the vegetative state. After removal of combined nitrogen they become morphologically
distinguishable after about 8-9 hours and then fully functional after 20-24 hours (Kumar
et al., 2010). The enzyme accountable for catalyzing nitrogen fixation, nitrogenase, is
oxygen-sensitive and thus requires a micro-oxic environment in order to function
optimally (Yoessef et al., 2011). Consequently the morphological and metabolic changes
associated with heterocyst development aid to maintain a micro-oxic environment (Zhang
et al., 2005), a particularly important acclimatization since cyanobacteria produce oxygen
during photosynthetic activities.
Compared to vegetative cells, heterocysts that form are morphologically
distinguished by their larger size, different shape and diminished pigmentation that
results from a loss of phycobiliproteins, the water-soluble proteins present in
cyanobacteria that captures light energy for photosynthesis (Meeks, 2005). The inner
glycolipid layer poses a permeability barrier for gases such as oxygen; outside of this is
an outer polysaccharide envelope that protects the glycolipid layer from physical damage
(Meeks et al., 2005; Xu et al., 2008). In addition, the septa, which connect the cells
together in a filament, are narrower between the heterocyst and adjacent vegetative cells,
creating a neck-shaped end for the heterocyst (Walsby, 2007). It’s proposed that this
neck-like structure also has an acclimated function for maintaining a micro-oxic
environment by diminishing the surface of contact with the adjacent vegetative cells,
decreasing the amount of gas, mainly oxygen, from entering the heterocyst (Walsby,
2007). For heterocysts that form on terminal ends, the ‘neck’ is formed only at the side
adjacent to the vegetative cell (Flores and Herrero, 2009). A “plug” of cyanophycin is
present in the neck and may act as a physical barrier. Cyanophycin plugs appear
refractile under phase contrast microscopy and can be used as an identifying feature of
heterocysts.
From a metabolic standpoint, respiration rates increase to consume any oxygen
(Wolk et al., 1994) that leaks into the cell (Walsby, A.E, 2007) via the septa (‘neck’) and
to supply both ATP and reducing power to suuply nitrogen fixation and facilitate creation
of a micro-oxic environment (Meeks and Elhai, 2002). Due to the inhibitory effect of
oxygen on nitrogenase, heterocysts have a dismantled oxygen producing photosystem
PSII (Wolk et al., 1994), and do not have carboxysomes containing the CO2-fixing
enzyme ribulose-1,5-bisphosphate carboxylase oxygenase (Maldener and Muro-Pastor,
2010). Once the micro-oxic environment in the heterocyst has been established the genes
for nitrogenase subunits and cofactor biosynthesis are expressed, nitrogen fixation is
initiated (Wolk et al. 1994) and diazartrophic growth becomes active. The heterocysts
which are now unable to photosynthetically fix CO2, rely on the neighboring vegetative
cells for receiving fixed carbon (Wolk, 1968), probably transferred in the form of a sugar
such as sucrose (Curatti et al., 2002), while in return the heterocysts fund the vegetative
cells with fixed nitrogen compounds. The transfer of fixed carbon from the neighboring
vegetative cells allows the heterocysts, which have an increased respiration rate, to
maintain an adequate supply of ATP for conserving ATP-dependent processes involved
in nitrogen fixation that ultimately results in the amidation of glutamate, producing
glutamine (Wolk et al., 1994). It has been suggested that there is a glutamate-glutamine
exchange process between vegetative cells and heterocysts, resulting in a net export of
3
reduced nitrogen (glutamine) from the heterocysts (Wolk et al., 1976; Thomas et al.,
1977).
Heterocyst differentiation is a terminal event in that it cannot revert back a
vegetative state or become induced into any other morphological state specific to
cyanobacteria (Meeks and Campbell, 2002). Although the terminal differentiation event
is a basic form of programmed cell death, the physiological life span of the heterocyst is
still a mystery (Meeks, J.C., 2005) and may vary with different growth conditions
(Meeks, C. and Campbell, 2002).
Akinetes
Akinetes, the main focus of this study, are only found among select strains of
filamentous, heterocyst-forming cyanobacteria and are generally induced in N.
punctiforme by light limitations or phosphate starvation (Campbell et al., 2007).
Collectively, these inducing conditional suggest that a threat to an energy supply might
be the trigger for akinete induction. This observation is best demonstrated by a mutant
strain of N. punctiforme, zwf (described later), which lacks glucose-6-phosphate
dehydrogenase, the first enzyme of the oxidative pentose phosphate pathway needed for
carbon catabolism under dark heterotrophic growth conditions (Summers et al., 1995).
Under the presence of fructose and dark conditions, the zwf mutant formed akinetes
within 4 days whereas a wild-type strain continued to grow heterotrophically.
Until favorable conditions return, this transient stage protects the species from
other harsh environmental stresses and can endure darkness (Sutherland et al., 1979),
cold temperatures (4°C) and perennial desiccation; however, unlike endospores from
Gram-positive bacteria, they are not heat resistant (Adams and Duggan, 1999). Although
this stage is considered dormant (i.e. no further growth) mature akinetes are still
metabolically active (Thiel and Wolk, 1983) and contain comparable amounts of DNA,
RNA and protein as their vegetative counterparts (Sutherland et al., 1979). Consequently,
akinetes have been hypothesized to advance from the vegetative cell cycle after cell
division but before DNA replication (Meeks et al., 2002).
The akinetes can be anatomically distinguished in comparison to other cell types
by their larger size, granulation (as a result of high concentrations of glycogen and the
nitrogen storage polymer, cyanophycin) (Meeks et al., 2002), and like heterocysts have a
thickened envelope composed of polysaccharides and glycolipids (Argueta et al., 1999).
Unlike heterocysts, akinetes do not have polar ends, the narrow neck-like structures at the
opposite poles of the cell and do not completely loose their phycobilisomes (Thiel and
Wolk, 1983). Compared to vegetative cells, akinetes in some strains of cyanobacteria can
be up to tenfold larger in size (Adams and Duggan, 1999) although those in N.
punctiforme are only slightly larger. Usually the first akinete in a filament is produced
about 14 days (Argueta and Summers, 2005) in laboratory inductions that involve
phosphate starvation (Meeks et al., 2002). It is common for cultures that are in the
stationary phase of growth to develop akinetes, probably caused by limited nutrients or
light (Meeks et al., 2002).
4
As not all strains of cyanobacteria differentiate into akinetes, they are only seen in
heterocyst forming cyanobacterium (Castenholz and Waterbury, 1989), an attribute that
suggests that akinetes are evolutionary predecessors of heterocysts (Meeks et al., 2002).
At the onset of differentiation and depending on the species, akinetes either form
bordering a heterocyst cell (Adams and Duggan, 1999) or at a position along a strain of
vegetative cells that is central between two heterocyst cells (Meeks et al., 2002). N.
punctiforme displays the latter of these two heterocyst-influencing positions.
Subsequently, after the first akinete cell has formed, the vegetative cells differentiate in a
succeeding pattern beginning with the ones neighboring the first akinete cell (Meeks et
al., 2002). When heterocysts are present in a filament, it is therefore possible to predict
the location of new akinetes, a characteristic that will be used in this work to analyze
GFP transcriptional reporter strains following akinete induction.
A few genes support the belief that heterocysts and akinetes are associated
(Argueta and Summers, 2005); these genes are: hetR, which is required for heterocyst
formation, impedes granular formation of akinetes in N. punctiforme but without losing
its ability to resist cold conditions. (Argueta and Summers, 2005); devR, required for
heterocyst polysaccharide development, when overexpressed displayed a higher
manifestation of akinetes in N. punctiforme (Adams and Duggan, 1999); and hepA, also
essential for the polysaccharide development in heterocysts, was required for akinete
polysaccharide development as well (Adams and Duggan, 1999).
An interesting feature of akinetes is their ability to germinate into new filaments
during favorable conditions (Adams and Duggan, 1999); conditions that are optimal for
vegetative growth (Kaplan-Levy et al., 2010) The germination process involves release of
a short filament germling through a pole in the akinete envelope (Adam and Duggan,
1999).
Hormogonia
Hormogonia are a transient non-growing filaments that result as a consequence of
vegetative cells that divide without an increase of biomass or the absence of DNA
replication to form motile filaments (Meeks et al., 2001, Meeks et al., 2002). Generally,
hormogonia lack heterocysts and akinetes and are composed of cells that are both
smaller, have more area of cell-cell contact that make the cells appear more cylindrical
and the terminal cells in a hormogonium assume a shape with a pointed end (Meet et al.,
2002). Some hormogonia express gas vesicles that may allow their escape from the
sediments up to the photosphere (Tandeau de Marsac, 1994). Hormogonia differentiate in
response to a variety of environmental changes that maybe either positive or negative
(Meeks, 2005) and can exhibit chemotaxis, such as from chemical signals provided by
some plants typically colonized by cyanobacteria (Tandeau de Marsac, 1994; Meeks and
Elhai, 2002, Meeks et al., 2001). Hormogonia therefore act as infective units of
cyanobacterial symbiotic associations (Meeks, 1998; Meeks and Elhai, 2002).
Hormogonia maintain gliding activity for 48-72 hours (Campbell and Meeks, 1989), after
which they become sessile, begin to grow and differentiate back into vegetative cells.
Depending on the availability of fixed nitrogen, the newly formed vegetative filaments
may bear heterocysts (Flores and Herrero, 2010).
5
The zwf mutant, UCD 466
As mentioned above, akinete development is triggered in situations where there is
a reduction in energy supply. To effectively study the development of this process on a
global genetic level, a zwf, mutant model system was created that unveiled the identity of
genes required for differentiation. What made the zwf mutant unique was its lack of
glucose-6-phosphate dehydrogenase, the first enzyme of the oxidative pentose phosphate
pathway (OPP) (Argueta and Summers, 2005) and thus prevents the strain from being
able to obtain reductant power from the OPP pathway (Summers et al., 1995). Upon dark
incubation in the presence of fructose or glucose, the zwf strain ceased growth and
synchronously differentiated into akinete-like cells to avoid cell death, whereas the wildtype strain exhibited heterotrophic growth (Argueta and Summers, 2005). zwf akinetes
demonstrated similar periodic acid–Schiff staining characteristics to the wild-type,
indicating akinete development. Despite the fact that the zwf strain was placed in
heterotrophic environment or not, the presence of fructose and glucose corroborated the
strains inability to produce reducing power which led the to development of akinetes
within 4 days. In addition to the quick turnaround time for akinete development, the zwf
akinetes gained resistance to desiccation, cold and treatment with lysozyme relative to the
vegetative cells of both strains (Argueta and Summers, 2005). Also observed was an
increased transcription level of avaK, an akinete marker gene, confirmed by both a GFP
transcriptional reporter fusions and Northern blotting (Argueta and Summers, 2005).
The akinetes represented by the zwf model (UCD 466) provided evidence,
phenotypic and genetic, that illustrates unaffected functionality and near-synchronous
induction under dark conditions, which can provide a valuable tool for molecular genetic
studies of akinete development in N. punctiforme.
Identification of akinete-expressed genes
Synchronous akinete induction of the zwf mutant provides an advantage of
identifying akinete related genes using the tools of molecular genetics, unlike using the
wild-type strain that produced low numbers of asynchronous akinetes following
induction. Using this mutant model, a DNA microarray was performed for 6,893 N.
punctiforme genes to determine global transcription patterns during differentiation into its
three cellular states (Campbell et al., 2007). Compared to transcription patterns of
vegetative cells under growing conditions with ammonium, the zwf mutant showed 497
differentially expressed genes at day 3 after akinete induction, of which an equal number
were up- and down regulated (255 up-regulated). The down-regulated genes were mainly
comprised of core metabolic functions found similar to cultures entering a non-growth
state. Heterocyst containing cultures manifested 495 transcriptionally regulated genes, of
which 373 were up-regulated and 1827 differentially transcribed genes were found in
hormogonia with 944 gene up-regulated. As a result, this endeavor pursued by Campbell
provided collective data showing the genes up-regulated for each cellular state and
although each state share a few common genes, their difference largely involves distinct
up-regulated genes (Campbell et al., 2007). Researchers interested in examining genetic
regulation of the three developmental states of N. punctiforme now have a cache of
putative unassigned gene and associated proteins with putative adaptive functions and
6
features. For the purpose of this study, the putative up-regulated genes involved in
akinesis were further examined.
Project Inception
The 11 up-regulated genes identified in the work of Campbell et al., (2007) were
chosen for further investigation in order to ascertain their involvement with akinesis and
if possible, their phenotypic function. The 11 genes were chosen as a group because they
showed protein sequence homology to members of two-component regulatory systems or
other transcriptional regulatory proteins. In the lab portion of Biology 561 at CSUN in
2007, one of the 11 genes was assigned to a student, including the author of this thesis, as
part of a semester research project. Each student’s involvement included but was not
limited to bioinformatics, RACE mapping, promoter cloning, primer design, and
engineering of GFP transcriptional reporters. Svetlana Rose constructed the mutagenesis
plasmids using the method described herein. The objective of this thesis was to analyze
GFP fluorescence during akinesis for all 11 genes and attempt to create mutational strains
for each gene of interest. All the genes of interest are represented in Table 1.
Gene No.
Gene No.
1
NpF0020
7
NpR1110
2
NpF0022
8
NpR1449
3
NpF2868
9
NpR3548
4
NpF2889
10
NpR5425
5
NpF4131
11
NpR6228
6
NpF0438
Table 1. Eleven genes identified in the work of Campbell and collaborators, chosen for further
investigation as a group because they showed protein sequence homology to transcriptional regulators and
to members of two-component regulatory systems.
Bacterial two-component regulatory systems
Two-component regulatory systems or two-component signal transduction
system, allow bacteria to sense, respond through changes in transcription, and thereby
adapt to various environments, stressors, and growth conditions (Laub and Goulin, 2007).
As the latter of two names mentioned above suggests, these system are involved in signal
transduction, using external stimuli to propel a cascade of intracellular events leading to a
metabolic or developmental change. Found in nearly every sequenced bacterial genome,
two-component regulatory systems bestow bacteria with the power to adapt to chaotic
environments (Mizuno et al., 1996). Not only are they commonly found in bacterial
species, but also many bacteria contain dozens or even hundreds of these systems (Laub
7
and Goulin, 2007). Some of the environmental parameters screened using two-component
regulatory systems include but are not limited to changes in osmolarity, quorum signals,
ionic strength, pH, temperature, nutrients, and harmful substances (Laub and Goulin,
2007; Mascher et al., 2006). In a prototypical sense, they are comprised of two families
(or components); a membrane-bound sensor histidine kinases and their cognate response
regulator that affects transcriptional changes (See Figure 2). Typically, the structural
genes for the histidine kinases and cognate response regulator are organized in operons
(Mascher et al., 2006).
Figure 2. Schematic diagram of a typical two-component regulatory system. TM = Transmembrane, His =
Histidine residue; P = Phosphate; Asp = Aspartic Acid residue; C = C-Terminus; N= N-Terminus. Adapted
from Gao et al.,2007 (Figure 1) and Mascher et al., 2006 (Figure 2).
The largest group of two-component regulatory systems have sensory histidine
kinases represent the classical model component of the system and are found bound to the
membrane and spanning over the periplasmic region, extending out of the cell (Mascher
et al., 2006). Its position in the cell commissions it with the responsibility of monitoring
and sensing specific extracellular stimuli from the environment, either by binding or
reacting with a signaling molecule or by interactions with a physical stimulus (Mascher et
8
al., 2006). The signal-input sensory domain of the component responsible for this
surveillance is located at the N-terminus of the protein, which extends into the periplasm
and typically has two transmembrane helices (Mascher et al., 2006). The variable-length
extra-cytoplasmic regions that physically detect specific stimuli, range between 50 to 300
amino acids and have no conserved regions (Gao et al., 2007; Mascher et al.,, 2006).
Subsequently the C-terminus end of the protein is regarded as the cytoplasmic transmitter
domain, containing two conserved domains; a conserved histidine residue domain for
autophosporhylation, that contains two α-helices that undergo dimerization upon call
followed by a catalytic ATP-kinase domain that catalyzes autophosphorylation (more
detail below) (Mascher et al., 2006).
Response regulators, the second component of these systems, are considered to be
part of a large family of signaling proteins (Gao et al., 2007) that function as
phosphorylation-activated switches that regulate output responses (West and Stock,
2001). They consist of a conserved N-terminal domain and a variable C-terminal domain,
where respectively, the N- and C- terminus are considered as the receiver that interacts
with a sensory histidine kinase gets phosphorylated, and an effector that catalyzes a
specific output response, typically through protein-protein interaction or protein-DNA
interaction (Gao et al., 2007; Mascher et al., 2006). The output response mediated by
response regulators, makes them a fundamental control elements of two-component
regulatory systems (Gao et al., 2007).
Signaling cascades that involve two-component regulatory systems rely on a
phosphoryl transfer between the two components (Mascher et al., 2006). After the
stimulation of the sensor histidine kinase from signaling molecules, autophosphorylation
of the conserved histidine residue follows, catalyzed by the dimerization of the
monomers of the dimeric kinase domain found in the transmitter domain (Laub and
Goulin, 2007; Gao et al., 2007). Successively, a second phosphoryl transfer is executed
from the now phosphorylated histidine residue to a conserved aspartic acid residue
located on the receiver domain of the response regulator (see Figure 3a). This transfer
ensues a conformational change of the response regulator, promoting the output response
of the effector domain, altering its ability to bind to a target DNA sequence (Mascher et
al., 2006; Bijlsma and Groisman, 2003). The response regulator does not stay active for
ever, and contains an auto-dephosphorylation function that sets it back to the prestimulated state. Removal of the phosphate from the response regulatory can in some
cases also be a result of a phosphatase action from the sensory histidine kinase (Mascher
et al., 2006). Either way, this consequently limits the lifetime of the response regulator in
a phosphorylated state and subsequently allows it to self-regulate its output response.
Half-lives of the response regulator in phosphorylated states can range from seconds to
hours. (Gao et al., 2007). The pathway detailed illustrates the central mechanism of a
prototypical two-component regulatory system, leaving a unique functionality for both
simple and elaborate systems that have variations specific to their mode of action or
physical form. (West and Stock, 2001).
More complex forms found in the bacterial world of two-component regulatory
systems consist of hybrid systems, where the histidine (His) and aspartic acid (Asp)
residue domains are combined in a single protein (West and Stock, 2001). The
9
phosphoryl transfer scheme inclusive to this group involves multiple phosphate transfers
steps known as phosphorelays, namely the His-Asp-His-Asp phosphorelay (see Figure
3b). The integration of an aspartic acid residue to the histidine domain of a sensory
histidine kinase at the C-terminal end, does not suggest that it interacts with a response
regulator that lacks an aspartic acid residue; in fact, the cognate response regulators
maintain their conformation but receive the phosphate from another molecular player.
This standalone molecule, a histidine-containing phosphotransfer protein essentially
grabs phosphoryl groups from the aspartic acid residue of the hybrid sensory kinase,
using its integral histidine residue, and transfers it to the aspartic acid residue of a
cytoplasmic response regulator. The availability of hybrid histidine kinases in twocomponent regulatory systems provides more versatility in signaling strategies and larger
numbers of potential sites for regulation (West and Stock, 2001). However, the
conformational attributes of the sensory histidine kinases in hybrid systems are not the
only source of variability. Evolution has also elicited added variability by augmenting
both the location and additional physical properties of the of the histidine kinase. The
periplasmic sensing histidine kinases that involve proteins with an extracellular sensory
domain, which are also inclusive to hybrid histidine kinases, make up the largest group of
two-component regulatory systems. Yet, two additional groups that also exist are 1)
histidine kinase with sensing mechanisms that are linked to the transmembrane region
and 2) soluble, cytoplasmic sensing histidine kinases (See Figure 4).
Figure 3. Prototypical two-component regulatory system schemes. (a) Stimulation of the sensor histidine
kinase from signaling molecules catalyzes the dimerization of the monomers of the dimeric kinase domain
found in the transmitter domain that leads to autophosphorylation (from ATP) of the conserved histidine
residue. Subsequently, a second phosphoryl transfer is conducted from the histidine residue to the a
conserved aspartic acid residue located on the receiver domain of the response regulator (b) Hybrid System
His-Asp-His-Asp phosphorelay uses more than two phosphoryl transfer using a sensor histidine kinase with
an aspartic acid residue and requires a histidine-containing phosphotransfer protein (HPt) to shuttle the
phosphate to the response regulator. (Taken from West and Stock, 2001)
10
In the first group, the transmembrane helices play a central role in stimulus
perception. The key attributes of sensing mechanisms integrated in the transmembrane
include the lack of extracellular input domains, replaced with the presence of 2 to 20
transmembrane regions composed of hydrophobic amino acid helices connected by short
intra- or extracellular linkers that instead collectively function to intercept the sensory
input. As a result of this shift from the prototypical schematic of two-component
regulatory systems, the stimuli sensed are either membrane associated or occur directly
within the membrane interface. Stimuli from the membrane may include mechanical
properties of the cell envelope, membrane bound compounds such as enzymes, ion or
electrochemical gradients, transport processes and compounds that impact the integrity of
cell envelope integrity (Mascher et al., 2006).
The second group is composed of cytoplasmic-sensing histidine kinases that
includes both membrane-anchored or soluble proteins with their input domains inside the
cytoplasm. Structural versions that are membrane-anchored have their sensor domains
located at the N-terminus before the first transmembrane or after the last transmembrane
segment before the C-terminal kinase domain (Cheung and Hendrickson, 2010).
Collectively, both versions of cytoplasmic sensing histidine kinases detect the presence of
cytoplasmic solutes or proteins responsible of signaling metabolic functions or
developmental stages of the cell (Mascher et al., 2006).
Figure 4. Schematic representation of the three different mechanisms of stimulus perception. (A)
Periplasmic-sensing HKs. (B) HKs with sensing mechanisms linked to the transmembrane regions (stimulus perception can occur either with the membrane-spanning helices alone or by combination of the
transmembrane regions and short extracellular loops). (C) Cytoplasmic-sensing HKs (either soluble or
membrane-anchored proteins). The stimulus is represented by a red arrow or red star. The parts of the
proteins involved in stimulus perception are highlighted in color. (Mascher et al., 2006)
11
Apparent from the variety of sensor domains, certain plasticity exists among the
structural interface of these system, but the histidine kinase and response regulator
together rigidly manifest as systemic components rather than standalone systems (Jung et
al., 2012). They can be considered as switches where the phosphorylation status of the
response regulator determines the “on” or “off” state (Msadek, 1999) or as rheostats,
where phosphorylation leads to gradual differences in expression of target genes (Russo
and Silhavy, 1993).
12
Materials and Methods
Bacterial Strains and Culture Conditions
N. punctiforme strains which includes wild-type, GFP transcriptional reporters
and deletion mutants were grown in Allen and Arnon (AA/4) liquid media supplemented
with 5 mM MOPS (3-[N-morpholino]-propanesulfonic acid) buffer (pH 7.8) with or
without 2.5 mM NH4Cl added as a combined nitrogen source. The phosphate component
of the medium was omitted in akinete induction studies. Liquid cultures were grown
photoautotrophically between 1-10 ug/mL in 50 ml of buffered AA/4 and were provided
10µg/ml of neomycin (Nm10) if needed for plasmid selection. Incubation parameters were
set at room temperature, between 23-25°C on a shaker with low light (8-12 PDF). Solid
medium was composed of a four-fold concentration of Allen and Arnon (AA) media with
1% Noble agar and similar buffers with optional nitrogen supplements and/or Nm10. As
with liquid cultures, the incubation parameters were the same with the exception of
shaking. For tri-parental conjugation experiments, plate media were supplemented with
either 5% sucrose or 0.5% Luria-Broth (LB) and plated cultures were incubated inside a
0.5% CO2 chamber.
DH5α and HB101 E. coli strains were used for this project. Both were grown at
37°C in either liquid or solid Luria-Broth (LB) media. The LB composition contains 1%
tryptone, 0.5% yeast extract, and 1% NaCl, with the exception of adding 1.5% BBL
granulated (Beckton Dickinson) agar for solid media. Kanamycin (30µg/ml) was
supplemented for pRL278 plasmid selection during the preparatory stages of deletional
gene mutation experiments.
Rapid Amplification of cDNA Ends (RACE) Mapping
RACE or RACE Mapping was used to amplify the ends of mRNA transcripts and
identifying the promoter region and transcriptional (+1) start site for all eleven putative
two-component regulatory system genes using reverse transcription and nested anti-sense
oligonucleotide primers. Using RNA templates isolated from a cell, the cDNA copies are
made by reverse transcription and then amplified by Polymerase Chain Reaction (PCR)
followed by sequencing. Refer to figure 5 for a visual interpretation of RACE Mapping.
The minimum information required for this technique is a single short stretch of
sequence within the mRNA (Frohman et al., 1988) so that a gene-specific primer can be
made and used to extend (using reverse transcription) a copy of the mRNA template until
the single cDNA strand terminates at the 5’-end of the mRNA. Subsequently, a known
single stranded oligomer “anchor” is ligated to the 5’-end of the cDNA and PCR is used
to amplify the cDNA using the gene-specific primer used during reverse transcription and
an additional primer that has a reverse complimentary sequence to the anchor sequence.
To insure that the cDNA corresponding to the gene of interest is amplified, and not
artifacts from PCR products produced by random priming, the PCR product is reamplified using a second nested primer primes within in the first cDNA PCR product.
To identify the +1 transcriptional start site of the gene of interest, the second
nested primer is used to sequence the second nested PCR product. Sequencing not only
13
all includes the nucleotide sequence of the cDNA extending upstream from the gene of
interest, but also the anchor sequence ligated previously. Using bioinformatics programs,
the sequence can be analyzed to map the anchor sequence and its adjacent nucleotide
base, which represents the +1 transcriptional start site present in the original mRNA.
(Argueta et al., 1999)
With knowledge of the +1 transcription start site, primers could then be designed
bearing restriction enzyme sites for promoter regions amplification and subsequent
cloning into a GFP transcriptional reporter plasmid.
Figure 5. Rapid Amplification of cDNA Ends (RACE) mapping schematic. Arrows indicate primer and
direction of polymerase activity. Primer names are labeled in the figure. Primer function can be found in
Appendix A.
cDNA Synthesis – At various time points after transferring cultures to fructose
media under dark conditions, RNA was isolated from both wild-type and zwf vegetative
cell strains. RNA extraction was not carried out as part of this work but was provided; for
protocol guidance see: Summers et al., 1995. Microarray data, also carried out outside the
documented work of this project, demonstrated that Day 3 manifested the most
significant change in gene expression levels from the preceding time point, Day 0.
Consequently RNA from Day 3 was used for reverse transcription reactions. Per each
gene, per strain, twenty microliter reactions were made containing 1µg of RNA; 1µl of
8µM gene-specific reverse transcription primer RACEp1 (Appendix A) 1µl of 10mM
dNTPs, and 4 µl of 5X First-Strand Buffer (Invitrogen). Each reaction mix was incubated
at 65°C for 10 minutes to unfold any conformational overlap of the RNA strands, and
then placed in 42°C for 5 minutes, prior to adding 2 µl of SuperScript II Reverse
14
Transcriptase (100 U/µl) to make the final reaction mixture of twenty microliters.
Incubation at 42°C continued for another 60 minutes and then the reaction was
terminated at 72°C for 15 minutes to inactivate the SuperScript II Reverse Transcriptase
under heat denaturation. The resulting post-reverse transcription reaction mixtures which
now contain single stranded cDNA products were stored at -20°C. Control reactions were
also done for both the wild type and zwf by omitting reverse transcriptase in the reaction
tube.
cDNA purification – To the post-reverse transcription reaction mixtures, 1µl of
0.5 M EDTA and 2.1 µl of 1 M NaOH were added, followed by a 10 minute incubation at
65°C to hydrolyze the RNA. HCl was added to neutralize the reaction to near neutral pH.
In accordance to the manufacturer’s instructions the cDNA was purified with a Zymo
DNA Clean and Concentrator Kit (Zymo Research) except that 1 ml of binding buffer
was used and two-8 l elutions were collected. Purified cDNA was stored at -20°C until
further use.
Anchor Ligation to cDNA – Single stranded cDNA for each gene, per strain, was
ligated to a 3’-blocked, 5’phosphorylated anchor oligonucleotide DT-88 (Appendix A).
The 40-µl ligation reaction mixture included 16 µl cDNA from the previous step, 4µl of
10X ligase buffer, 1µl of 6µM DT88, 20µl of 40% polyethylene glycol 8KD, 1µl of T4
RNA ligase (10U/µl) from Promega; all of which was incubated at 18°C for 18 hours.
Touchdown Polymerase Chain Reaction (PCR) Amplification – 1µl of anchor
DT88 ligated cDNA was used in a 50µl PCR reaction which included 5µl of 10X
TAKARA PCR Buffer, 4 µl of 2.5 M TAKARA dNTPs mix, 1.67 µl of 3µM DT89
forward primer (Appendix A), 1.67 µl of 3µM RACE p1 reverse primer (previously used
during reverse transcription), and 0.25 TAKARA Taq DNA Polymerase HS. The PCR
products were subject to a 500-fold dilution prior to using as a template for a second
round of PCR, using the same components as before with the exception of using 5µl of
DNA and 1.67µl of 3µM RACE p2 reverse primer (Appendix A) instead of RACE p1.
For both PCR reactions, touchdown parameters as detailed in Cunnac et al., (2004) were
used to reduce non-specific amplification (see PCR Conditions below/Table #2).
Step No.
1
2
Temperature
95°C
94°C
70°C
Time (min)
No. of Cycles
2
0.6
15x

0.5
55°C
(-1°C/cycle)
68°C
0.5
94°C
0.6
55°C
0.5
68°C
0.5
25x
68°C
7
4°C
∞
Table 2. Conditions for touchdown PCR amplification.
15
Sequencing - The post-RACE PCR products were visualized by agarose gel
electrophoresis and subjected to purification using the manufacturer’s instruction for the
Zymo DNA Clean and Concentrator Kit (Zymo Research). 20ng per 100bp of purified
DNA for each gene per strain was sequenced at the California State University of
Northridge Sequencing Facility, using 3µl of 3 µM RACE p2 in a 16µl reaction volume.
The sequences were analyzed and manipulated using DNA Strider (Marck, 1988).
Agarose Gel Electrophoresis
This technique was used to separate macromolecules such as DNA, RNA, and
proteins for analysis based on their fragment size. In the case of this work, it was used to
analyze DNA products generated from Polymerase Chain Reaction amplification
procedures performed in various aspects of this project, in addition to assessing DNA
molecule sizes post- restriction enzyme digestion. 1% and 2.5% agarose gels were made
for DNA molecules that varied in length, between 0.5-3.5Kb and 0.1-.05Kb, respectively.
The DNA ran through the agarose gel immersed in 1X tris-acetate-EDTA (TAE) buffer
(pH 8) contained in an electrophoresis system. When complete, gels were stained with
1X TAE solution mixed with 1µg/ml of ethidium bromide for 15 minutes. The ethidium
bromide (EtBr) intercalates into the DNA and fluoresces under ultraviolet light. Prior to
exposing the UV light with a transilluminator, excess EtBr is washed off with deionized
water. A digital camera captured all visualization of the fluorescence.
Green-Fluorescent Protein (GFP) Transcriptional Reporter Assay
GFP has become a well-established marker of gene expression or subcellular
localization for in vivo studies. It was first discovered as a companion protein to aequorin
a well-known chemiluminescent protein from the Aequorea jellyfish. Emitting a green
fluorescence at an emission peak of 508 nm, its major and minor excitation peaks are 395
nm and 475 nm, respectively (Tsien, 1998; Argueta et al., 1994) Due to this intrinsic
property, GFP fluorescence can be used as a reporter during epifluorescence microscopy
to determine the levels of gene expression by exciting with UV light (395nm), and
provides the advantage of not requiring a substrate (Argueta et al., 1994).
For this work, the novelty of GFP was used to determine transcriptional activity of
akinete-specific genes in N. punctiforme. A shuttle vector, pSUN119 features a
promoterless GFP gene preceded by a multiple cloning site intended for cloning
promoters of N. punctiforme genes. With such a tool in hand, pSUN119 was linked to
promoters of eleven genes that showed similar sequence homology to transcriptional
regulators or two-component regulatory systems. Under laboratory conditions set to
induce heterocysts and akinete development, green fluorescence was investigated with
epifluorescence microscopy to confirm gene expression suggested by DNA microarray
analysis. Transcription factors that influence the regulation of these eleven genes, in
particular up-regulation for all the chosen genes, would also associate with the promoter
cloned behind the GFP gene. Expression of GFP would then show vegetative, akinete or
heterocyst specific transcriptional expression.
16
Cloning and GFP Reporter Plasmid Construction
GFP reporter plasmids were constructed for each gene of interest, by cloning the
upstream intergenic region of each gene into pSUN119, which contains a Multiple
Cloning Site (MCS) adjacent (upstream) to a promoterless gfp gene, ORI sites for both N.
punctiforme and E. coli, and a neomycin antibiotic resistance cassette. Cloning the gene
specific intergenic regions into the MCS of pSUN119, integrates a functional promoter
for the gfp gene that can be used to confirm cell-type gene expression in comparison to
the micro-array analysis. All complete reporter plasmids were transformed into E. coli
DH5α for in-vivo replication, followed by purification and electroporation into wild-type
N. punctiforme using previously published methods (Summers et al., 1995).
Primer Design and PCR Amplification of Promoter Regions - Using the
bioinformatics programs DNA Strider and Amplify, primers were designed with 5’
flanking restriction enzyme (RE) sites. As a consequence, the resulting PCR products
have integrated RE sites incorporated adjacent to the amplified promoter region
providing the advantage of directional cloning into the MCS of PSUN119 when both
treated with the same restriction enzymes. It is prudent to design primers that will
amplify a product with an anti-sense strand that has the same polarity as GFP’s anti-sense
strand. PSUN119’s MCR has a KpnI RE site located right upstream of the GFP reporter
gene and a PstI RE site roughly 31 base pairs upstream the KpnI RE site; accordingly,
primers were designed with integrated KpnI and PstI RE site sequences. In addition, the
primers (ordered from IDT DNA, Inc.) have average lengths of 30 bp (20 bp hybridizing
region), are composed of about a 55% GC content, and have an average melting
temperature of 70°C.
17
Multiple Cloning
Site
Promoterless gfp
gene
NPT Cassete
(neomycin
resistance gene)
N.Punctiforme
Origin of
Replication (ORI)
E.Coli Origin of
Replication (ORI)
Figure 6. Generic diagram of PSUN119 highlighting the multiple cloning site, promoterless gfp gene,
E.coli oring of replication, N. punctiforme origin of replication and npt cassette. The graphic was created
by pDRAW32 DNA analysis software created by AcaClone Software.
PCR amplification reactions included 2µl of 10uM of each gene-specific primers,
PromP1 Forward and PromP2 Reverse, 100ng of genomic DNA, 5µl of 10X PCR buffer,
either 1.5 µl, 3 µl, 4.5µl, or 6 µl of 25 mM MgCl2 (depending on the best result), 5 µl of
2.5 mM dNTP mix, 3 µl of 1U/µl of Taq DNA Polymerase and were brought up to 50 µl.
The cycle sequence for PCR and the primers used are shown in table 3 and Appendix A,
respectively.
Step No.
1
2.1
Temperature
95°C
Time (min)
3
95°C
0.5
2.2
56°C
0.5
No. of Cycles
1x
30x
68°C
1
2.3
68°C
10
1x
3
1x
4
4°C
∞
Table 3. PCR conditions for amplification of promoter regions.
18
Visualization of PCR products was done with agarose gel electrophoresis and
DNA purification was performed according to the manufacturer’s instruction for the
Zymo DNA Clean and Concentrator Kit (Zymo Research). Purified samples of gene
specific pSUN 119 plasmids were stored at -20°C until further use.
Digestion and Ligation – Using 5 µl of 10X bovine serum albumin (BSA), 5 µl of
New England BioLabs Buffer, 16µl of 50 ng/µl of promoter DNA, 1 µl of 5 U/µl KpnI, 1
µl of 5 U/µl PstI, the restriction enzyme digest was conducted in a 50µl reaction mixture
at 37°C for one hour to digest the RE sites integrated into the PCR products for each gene
of interest. Additionally, the same digestion reaction was preformed but with 20µl of 100
ng/µl pSUN119 plasmid. All digestion reactions were inactivated after one hour by heat
inactivating the enzymes at 65°C for 5 minutes and then purified with the Zymo DNA
Clean and Concentrator Kit (Zymo Research). The resulting sticky ends produced in both
the PCR products and plasmid using the same restriction enzymes ensures directional
cloning.
Ligation involves energetically connecting the cut PCR product (insert) and cut
plasmid by means of chemical bonding. In order to increase the likelihood of ligation, a
1:3 molar ratio of cut plasmid (150ng maximum) to insert was used. In addition, 4 µl of
5X Rapid Ligation Buffer (Fermentas) and 1ul of 3 U/µl of T4 Ligase (Fermentas) were
used in a 20µl reaction, incubated at 25°C for 5 minutes.
Experimental controls were also conducted where the reaction mixes excluded the
digested PCR product (promoter insert) and were combined with and without T4 Ligase
to test for complete digestion and the plasmid’s ability to re-ligate (single digestion). All
Ligation products were stored at -20°C until further use.
Transformation – This process involved introducing free DNA from the
environment into bacteria (Trun and Trempy, 2004), which for this work includes
introducing recombinant plasmids into CaCl2 competent bacterial hosts. Typically the
recombinant plasmid contains a particular gene that can be manipulated for a selective
advantage when placed in a particular medium, such as antibiotic resistance;
consequently cells carrying the recombinant plasmid can be selected for and thus
identified as putative transformants. The putative nature of transformants reflects the
possibility of cell acquiring plasmid that have either undigested plasmids or
recircularized plasmids that are missing the genetic insert of interest. To determine the
validity of a true transformant, colony PCR was conducted using primer sets designed to
hybridize within the plasimd and amplify the entire multiple cloning site. True
transformants that produced PCR products were significantly larger than negative
transformants because of the inclusion of the genetic insert.
Final products of the ligation process were transformed into CaCl2 competent E.
coli DH5α cells for in vivo replication. E. coli CaCl2 competent cells which were made
prior to this work were stored in tubes of 100µl aliquots at -80°C. 4µl of ligation
products for each gene was added to in individual tube of E. coli CaCl2 competent cells
and gently mixed, followed by 20-minute ice incubation. Subsequently, each individual
transformation reaction was heat-shocked in a 42°C water bath for 90 seconds and
promptly placed back on ice. After placed on ice for at least 90 seconds, 900µl of super
19
optimal catabolite solution, also known as SOC media was added to each reaction tube.
SOC, a rich nutrient source which acts as a microbiological growth medium contains 2%
tryptone, 0.5% yeast extract, 10mM NaCl, 10mM MgSO4, and 10mM MgCl2. Once SOC
was added, each reaction tube was gently inverted a few times prior to placing in a
rotating incubator at 37°C for 1 hour. After the incubation, the transformation procedure
was complete, and 3 samples of various volumes are aliquoted and spread-plated on Luria
Broth (LB) agar plates containing neomycin antibiotics. The three sample volume were
25µl, 125µl and the residual volume but concentrated by removing a majority of the
supernatant after centrifugation. All plated cultures were incubated overnight at 37°C to
allow time for bacterial growth. Any immerging colonies were then subject to colony
PCR to screen for positive transformants.
Transformant Colony PCR and DNA Extraction
Successful transformation results were validated by amplifying the inserted region
from the transgenic PSUN119 vector that is now in Escherichia coli via colony PCR.
Using primers GFP forward and reverse (Appendix A) a segment of the plasmid that
includes GFP and the insert was amplified and run on a gel against a ladder to discern its
relative size. The GFP primer sequences can be found in Appendix A.
The correct size of the segment equated to the difference between the distances of
the KpnI/PstI RE sites and the GFP-Forward/GFP-Reverse primer sites from the plasmid,
added to the size of the insert. All positive transformants were then subject to DNA
isolation using Quiagen Plasmid Prep according to the manufacturers concentration.
Following DNA isolation of the plasmid, the concentration of isolate was determined
using a Nanodrop 1000 and stored at -20 until further use.
Electroporation
Electroporation was used for the transformation of cells and in the case of these
work bacteria. It subjects bacteria to a brief pulse of high voltage electricity (~1-5Kv),
which creates temporary pores in the cell’s membrane so macromolecules, including
large plasmid DNA, can enter (Trun and Trempy, 2004). Although the efficiency of
effectiveness is thought to be about ~10% (Trun and Trempy, 2004), according to
Sambrook et al., (1989), electroporation is very useful because it allows an efficient
means of transferring plasmids without any concern about size especially in
Cyanobacteria who tend to have large sized plasmids (Argueta et al., 2004).
N. punctiforme Preparation – Two to five days prior to electroporation, wild-type
culture was inoculated in AA/4 ammonium liquid media and grown on a shaking
incubator (26°C, 150 RPM, 500ml culture in 1 l flask). On the day of electroporation, the
culture was microscopically visualized to ensure it was filamentous and still in a
vegetative state. A Cholorophyl a (Chla) reading was also taken to determine the culture
was in an exponential stage of bacterial growth curve. Using the Chla reading, the culture
was concentrated to a volume of 3-5ml and then sonicated 4 times with 10-second bursts
at 50% duty. The sonicated culture was examined under the microscope to ensure the
20
filaments were 3-5 cells long and then placed in 50ml AA/4+MA for 4 hours at low light
to recover.
Following the recovery period and just prior to the electroporation procedure, the
cells were washed 3 times with 50ml of room temperature sterile double distilled water.
After the third washing step the cells were resuspended between to 50-100µg/ml Chla. 420µl of isolated plasmid DNA for each gene was aliquoted (100-200ng/µl) into a sterile
1.5ml microfuge tube, left on ice and mixed with 400µl of the concentrated and washed
N. punctiforme. Following the addition of N. punctiforme the mixture was homogenized
by pipetting up and down and then left out for 60 seconds to allow DNA absorption to the
cells. The mixture was transferred to a cooled 0.2cm cuvette and electroporated with a
Bio-Rad Pulse Controller using the following parameters; 600 Ohms, 1.6 kEV, 25 µF,
and 11-13 Msec (average time with ~1µg of DNA) or 9-10 Msec (average time with
>1µg of DNA).
Immediately following electroporation cells were transferred to an AA/4ammonia MOPS media containing 20 mM MgCl2 and incubated overnight at room
temperature with dim lighting and gentle shaking. The following day, overnight cultures
were concentrated and resuspended in 1ml of AA/4-ammonia MOPS and vortexed to
break up any clumps. Three 100µl aliquots of the resuspension were taken and plated on
solid media as 100µl, and 1:5 and 1:10 dilutions. The residual volume was placed in
liquid selection (AA+MA+Nm10) for backup. Plates and liquid were placed under low
light (8-12 PDF) at 25°C in the 0.5% carbon dioxide incubator until colony forming units
became visible, respectively.
Electroporant Colony PCR - Due to the neomycin selective pressure, it was
assumed that visible colonies have successfully acquired the recombinant pSUN119
plasmid. However as a precaution, in the event the previous methodical procedures
manifests false positives due to natural events or human error, electroporation results
were validated by amplifying the inserted region from the transgenic PSUN119 vector
that is now in N. punctiforme via colony PCR using GFP forward and reverse primers. A
segment of the plasmid that includes GFP and the insert was amplified and ran on a gel
against a ladder to discern its relative size. The correct size of the segment was the
difference between the distances of the KpnI/PstI RE sites and the GFP-Forward/GFPReverse primer sites from the plasmid, added to the size of the insert.
GFP Reporter Strain Growth Conditions and Maintenance
Once positive electroporant N. punctiforme cells were validated to contain the
recombinant pSUN119 plasmid, they were grown and maintained in liquid media
(AA/4+MA+Nm10) under low light (8-12 PDF) at 25°C, between 1-10µg/ml chla, with
weekly bottle changes. Bottle changes required inoculums at about 1 ug/mL chla to
prevent filament breakage due to high light stress responses at lower concentrations.
21
Heterocyst Induction
Although the focus of this project was to corroborate the transcriptional
upregulation of particular genes during akinete development, it was recommended to
differentiate akinetes from filaments with heterocysts. Localization of akinetes N.
punctiforme’s about halfway between two heterocysts within a filament provides
associative evidence when combined with cell morphology. After at least two bottle
changes from the point of electroporation, liquid cultures were grown under standard
growth conditions until mid to late log phase with 6-8µg/mL chla. Prior to induction, the
cultures were investigated microscopically to ensure they were all in the vegetative state
and were long filaments. As mentioned before heterocyst induction was initiated from
combined nitrogen starvation. To remove the combined nitrogen (ammonium or nitrate)
from the media, cultures were pelleted after centrifugation at ~3000 x g for >2 minutes.
The supernatant was removed and the pelleted culture was resuspended in 50 ml of
A&A/4 +Pi +MOPS, followed by gentle inversion. This procedure was repeated 3 times
and after the last wash step, the cultures were resuspended in 50 ml A&A/4 +Pi +MOPS
under the same growth conditions. Between the next 24-48 hours heterocyst began to
develop and were examined under the epifluorescent microscope for identification and
investigation any influence on GFP emission due to cross talk with the promoter of
interest.
Akinete Induction
Once heterocysts were identified and investigated, any hormogonia, if present,
was removed by first transferring all of the liquid culture into a 50 ml falcon tube and
allowing it to settle on the bench top for 15-20 minutes. During the settlement, the top
layer that contained hormogonia was removed with a pipette while the bottom layer that
contained filaments with heterocysts was used for the next wash procedure to remove any
phosphates. The heterocyst culture was washed similarly to the vegetative cell when
induced for heterocysts, but with A&A/4 -Pi +MOPS instead. After the third wash, the
culture was resuspended in 50 ml of A&A/4 -Pi +MOPS with 80 µl of 0.01x filter
sterilized +Pi and incubated at room temp 22°C, 3-8 PFD, with low shaking. Akinete
development typically occured in the wild-type strain at about 14 days and each GFP
reporter strain was monitored with epifluorescent microscope for up to three weeks from
the day zero
Epifluorescence Microscopy
Epifluorescence microscopy consists of a fluorescence microscope that directs
excitatory light from a source in the apparatus, through the objective and onto a
specimen. The fluorescence of the specimen, in this case N. punctiforme, emanates light
towards a detector, focused by the same objective that is used for excitation. To filter out
the excitation light from fluorescent light a filter is placed between the objective and the
detector. To obtain GFP fluorescence a filter set composed of a long-pass blue filter
(395nm) and a green band pass filter (509nm) from Omega Optical was used.
Additionally, a Texas Red filter set, also by Omega Optical, was used to filter and
captured the auto-fluorescence of the phycobilisomes found non-heterocyst N.
punctiforme. Consequently, heterocysts, which have disintegrated phycobilisomes, can be
22
distinguished by the fluorescent activity of other cell types; under Texas red filter sets,
heterocysts are not visible. All visualizations were viewed with the 100X objective lens
and captured with a DVC 1321 digital camera.
Strategy for PCR Mediated In-frame Deletional Mutagenesis
For further examination of genetic involvement during akinete development, each
gene was subject to in-frame deletional mutagenesis using PCR methodology placed into
N. punctiforme via tri-parental conjugation, and selected/screened for recombinants
leading to a non-functional version of the gene into the genome.
Deletion of each gene was made by PCR amplification of the flanking regions,
upstream and downstream of the gene intended for deletion using cross-priming primers.
The primer just inside the downstream end of the gene was designed with a nonhybridizing 5’-end that was complementary to the downstream primer used to amplify the
PCR product upstream the gene. The amplicons for both PCR reactions, upstream and
downstream, are then mixed and homologous sequences at one end of each PCR
fragment hybridize and extend on each other using the cross-priming regions, combing
the two pairs of PCR fragments into one long fragment. A third round of PCR extends
each linked pair, creating a length of the gene that is missing its integral functional
domain. Primers can be designed such that only a small truncated version of the gene
remains in the final PCR product, containing an in-frame start codon and stop codon of
the gene, along with a few codons within the ORF. The use of in-frame deletions is
desirable to eliminate artifacts caused by insertional gene inactivation such as polar
effects on transcription of downstream genes or due to effects on downstream gene
translation caused by disruption of translational coupling. Using another set of primers
that bear restriction enzyme sites, the PCR products bearing the mutational gene are reamplified, cloned into the multiple cloning site (MCS) of pRL278 (a suicide plasmid
integrated with a sacB gene and only an E.coli ORI site) and finally transformed into an
E.coli strain (DH5α) for in-vivo amplification.
Completed plasmids are then introduced into N. puncitforme via two conjugal
transfers with the help of self-mobilizable plasmids found in the E. coli strain HB101.
The tri-parental conjugation begins with HB101 transferring its mobilizable plasmid to
the DH5α strain that contains the completed pRL278 plasmid designed for the specific
gene of interest, followed by a conjugal transfer from DH5α to N. punctiforme using the
conjugation genes of the self-mobilizable plasmids to facilitate the transfer. Once
introduced into N. puncitforme, the subsequent step involves the random event of the
plasmid naturally integrating into the wild-type genome by homologous recombination.
These primary recombinants are screened for neomycin resistance due to the
neomycin cassette present in pRL278. Subsequently, positive primary recombinants are
plated on solid medium containing 5% sucrose, a lethal condition for cells bearing the
sacB gene (sacB is part of the pRL278 construct). Any surviving colonies on the sucrose
have become sucrose resistant as a result of a secondary recombination event where the
sacB pRL278 plasmid is removed. Approximately 50% of these secondary recombinants
may have their wild-type genomic gene replaced with the mutant version during the
23
secondary recombination event, which can be further screened for by using colony PCR
(Cai and Wolk, 1990).
PCR Mediated Deletional Gene Mutation
For further examination of genetic involvement during akinete development, each
gene was subject to in-frame deletional mutagenesis using PCR methodology and cross
recombinant methods to incorporate a non-functional version of the gene into the
genome. The advantage of maintaining an in-frame deletion avoids confounding effects
of antibiotic resistances cassettes on transcription or translation of surrounding genes. A
mutational version of each gene was created by cross-priming PCR products generated by
only PCR amplifying the upstream and downstream regions of the coding domain. The
final product, which was composed of a shortened version of the wild-type sequence was
cloned into a plasmid and used to recombine with the genomic DNA.
PCR 1 and 2 - PCR amplification of the upstream and downstream regions
neighboring the coding region was conducted separately, designated as PCR 1(upstream)
and PCR2 (downstream). Both reactions were 50µl in volume and utilized 5µl of 10X
PCR buffer, 5 µl of 25 mM MgCl2, 5µl of 2.5 mM dNTP blend, 2 µl of 10µM for each
gene-specific forward and reverse primers (See Figure 7 and Appendix B), 2 µl of
100ng/µl N. punctiforme genomic DNA and 3µl of 1U/µl Taq DNA Polymerase. The
cycle sequence for PCR1 and PCR2 is shown in Table 4.
Step No.
Temperature
Time
No. of Cycles
1
95°C
5 min
1x
2.1
95°C
30 sec
2.2
54°C
30 sec
30x
2.3
72°C
30 sec
3
72°C
10
1x
4
4°C
1x
∞
Table 4. PCR conditions for amplification of the upstream (PCR1) and downstream (PCR2) portions of the
gene.
Final PCR products were run on a gel to confirm a successful PCR reaction and
the expected DNA fragment size. Once confirmed, the products were purified with a
Zymo DNA Clean and Concentrator Kit (Zymo Research) according to the
manufacturer’s instructions and stored at -20°C until further use.
PCR 3a - Subsequently, a third PCR amplification, PCR3a, was conducted using
the PCR products from both PCR1 and PCR2. The forward primer (P3) used in PCR 2
was designed to not only contain a sequence that would prime with the downstream
sequence but also include a linker sequence region at its 5’-end that is reverse
complementary with the Primer-P2 sequence. Consequently the PCR2 products had
additional bases that hybridized to the Primer-P2 sequence, which is was incorporated in
the products of PCR1. Hence the two PCR products can were ligated via PCR using the
linker, and extended to create a PCR3a product that includes only the upstream and
downstream regions of the gene of interest. Since the two products were amalgamated,
24
they acted as a template and primer for each other and therefore required no additional
primers.
The amplification was conducted in a 50µl volume, containing 5µl of 10X PCR
buffer, 5 µl of 25 mM MgCl2, 5µl of 2.5 mM (each) dNTP mix, 3µl of 1U/µl Taq DNA
Polymerase, and equal molar ratio with at ~80 ng of each PCR1 and PCR2 products. The
cycle sequence for PCR 3 is shown in Table 5. Final PCR products were run on a gel to
confirm a successful PCR reaction and the expected DNA fragment size. Once
confirmed, the products were stored at -20°C until further use.
Step No.
Temperature
Time
No. of Cycles
1
95°C
5 sec
2.1
95°C
30 sec
1x
2.2
54°C
30 sec
15x
2.3
3
72°C
72°C
30 sec
10
1x
4
4°C
1x
∞
Table 5. PCR3a conditions for ligation of PCR1 and PCR2 products, followed by sequence extension and
amplification.
Figure 7. PCR mediated gene mutation (PCR1,2,3a). Each gene is inactivated in-frame* by first
performing a PCR mediated ligation involving only amplicons from the upstream and downstream of each
gene. Both PCR reactions are mixed and homologous sequences at one end of each PCR fragment align,
due to the use of a linker primer, combing the two pairs of PCR fragments. A third round of PCR extends
each linked pair, creating a length of the gene that is missing an integral part of its sequence
25
PCR 3b – The final PCR product from PCR3a included only the upstream and
downstream regions of the gene of interest. However to complete the goal of cloning it
into a plasmid vector, it required incorporation of restriction enzyme sites for cloning by
re-PCRing with nested primers containing the necessary restriction enzyme sites (Figure
8).
Using the reaction tube for PCR3a, 5µl of 10X PCR buffer, 5 µl of 25 mM
MgCl2, 5µl of 2.5 mM dNTP blend, 1 µl of 10µM for each gene-specific forward and
reverse primers (P5, P6,), and 3µl of 1U/µl Taq DNA Polymerase. The reaction volume
was made up to 50µl and the PCR cycle sequence is shown in Table 6.
Step No.
Temperature
Time
1
95°C
2.1
95°C
2.2
54°C
2.3
72°C
3
72°C
4
4°C
Table 6. PCR conditions for PCR3b.
No. of Cycles
5 min
30 sec
30 sec
30 sec
10
∞
1x
27x
1x
1x
Figure 8. PCR mediated gene mutation (PCR3b). Using another set of primers that bear restriction enzyme
sites, the PCR products are re-amplified.
26
Final PCR products were run on a gel to confirm a successful PCR reaction and
the expected DNA fragment size. Once confirmed, the PCR products were in accordance
to the manufacturer’s instructions purified with a Zymo DNA Clean and Concentrator Kit
(Zymo Research) and stored at -20°C until further use.
Digestion and Ligation - Using 5 µl of 10X bovine serum albumin (BSA), 5 µl of
New England BioLabs Buffer, 16µl of 100 ng/µl of PCR3b product DNA, 1 µl of each
restriction enzyme at 5 U/µl, the restriction enzyme digest was conducted in a 50µl
reaction mixture at 37°C for one hour to digest the RE sites integrated into the PCR
products for each gene of interest. Additionally, the same digestion reaction was
preformed but with 20µl of 100 ng/µl pRL278 plasmid DNA. All digestion reactions
were inactivated after one hour by heat inactivating the enzymes at 65°C for 5 minutes
and then purified with the Zymo DNA Clean and Concentrator Kit (Zymo Research).
Ligations contained a 1:3 molar ratio of cut plasmid (150ng maximum) to insert as well
as 4 µl of 5X Rapid Ligation Buffer (Fermentas) and 1ul of 3 U/µl of T4 Ligase
(Fermentas) were used in a 20µl reaction, incubated at 25°C for 5 minutes.
Transformation – Final products of the ligation process were transformed into
CaCl2 competent E. coli DH5α cells for in vivo replication. E. coli CaCl2 competent cells
which were made prior to this work were stored in tubes of 100µl aliquots at -80°C. 4µl
of ligation products for each gene was added to in individual tube of E. coli CaCl2
competent cells and gently mixed, followed by 20-minute ice incubation. Subsequently,
each individual transformation reaction was heat-shocked in a 42°C water bat for 90
seconds and promptly placed back on ice. After placed on ice for at least 90 seconds,
900µl of super optimal catabolite solution, also known as SOC solution was added to
each reaction tube. SOC, a rich nutrient source which acts as a microbiological growth
medium contains 2% tryptone, 0.5% yeast extract, 10mM NaCl, 10mM MgSO4, and
10mM MgCl2. Once SOC is added, each reaction tube is gently inverted a few times prior
to placing in a rotating incubator at 37°C for 1 hour. After the incubation, the
transformation procedure was completed, and 3 samples of various volumes were
aliquoted and spread-plated on Luria Broth (LB) agar plates containing kanamycin
25ng/µl antibiotic. The three sample volume are 25µl, 125µl and the residual volume but
concentrated by removing a majority of the supernatant after centrifugation. All plated
cultures were incubated overnight at 37°C to allow time for bacterial growth. Any
immerging colonies were then subject to colony PCR to screen for positive
transformants. Successful transformants were be validated by amplifying the inserted
region from the transgenic pRL278 vector by colony PCR using pRL278 forward and
reverse primers (Appendix B) as previously described. Following colony PCR, the E. coli
strains were grown in liquid LB and kanamycin 25ng/µl and cryogenically stored at 80°C until further use.
Triparental Conjugation
The objective of following was procedure to transfer recombinant pRL278
plasmids that contained a deleted version of the gene of interest into N. punctiforme. This
particular form of transfer required the assistance one bacterial strain’s mobilizer plasmid
to help transfer another plasmid from a second strain into a third strain (Fig. 9).
27
The E. coli strain HB101, employed as the donor for this process, has a self-mobilizable
plasmid designated pRK2013. It’s ability to donate/mobilize its plasmid comes from an
intrinsic gene, which codes for a sex pilus required for conjugation with a neighboring
bacterium known as the recipient. The bacteria employed as the recipient are the DH5α
strains that contain the recombinant pRL278 plasmids. During the first conjugation
process the various DH5α strains acquire the HB101 mobilizable plasmid and as a result
develop the ability to induce conjugation on its own accord as a donor. Consequently, the
DH5α strain in turn conjugates with N. punctiforme and transfers either pRK2013 or the
recombinant pRL278 suicide plasmids containing the deleted gene constructs. Once
introduced into N. puncitforme, the subsequent step involved a random event of the
plasmid naturally integrating into the wild-type genome by homologous recombination.
Primary recombinants were selected with neomycin (10ng/µl) resistance because of a
neomycin resistance gene included in pRL278, which was integrated in the N.
punctiforme genome. Subsequently, primary recombinants were grown under selective
pressure in the presence of sucrose, which is lethal due to the sacB gene product, levan
sucrase enzyme. Ideally, selection was prompted by a secondary recombination event to
possibly remove the lethal sacB gene in conjunction with the pRL278 plasmid out of the
genome while replacing the wild-type gene from the chromosome with the mutated
version.
Figure 9. Triparental Conjugation Schematic.
28
Conjugation prep - Wash Millapore HATF nirocellulose filters in deionized water
and place between Watman #1 filters. Autoclave in a glass petri dish dry cycle (20-20
min).
N. punctiforme prep - Wild-type culture was in 500ml of AA/4 liquid media and
grown on a shaking incubator (26°C, 250RPM, 1 l flask). The day of conjugation, the
culture was microscopically visualized to ensure it was filamentous and still in a
vegetative state. A Cholorophyl a (Chla) reading was also taken to determine the culture
was in an exponential stage of bacterial growth curve. Using the Chla reading, the culture
was concentrated to a volume of 3-5ml and then sonicated 4 times with 10-second bursts
at 50% duty. The sonicated culture was examined under the microscope to ensure the
filaments were 3-5 cells long and then placed in 50ml AA/4+MA for 4-6 hours at low
light to recover. Prior to conjugation a Chla reading was taken to adjust the concentration
to 100 ug Chla/ml.
E.coli (DH5α and HB101) prep- Each DH5α strain containing recombinant
pRL278 plasmid with an integrated mutated gene and the HB101 strain were inoculated
over night in liquid LB with kanamycin (25ng/µl), the day before conjugation. The day of
conjugation, 1/40th of each culture was re-inoculated in liquid LB without any selection
and grown until an OD600 reading with a spectrophotometer was near 1 (arbitrary units).
Each strain was centrifuged at 2000 x g for 10 minutes and resuspended to an OD600
reading of 10 (arbitrary units).
Conjugation - Millapore HATF nitrocellulose filters were placed on top of
AA+MA+0.5%LB plates. Using a 1.5ml microfuge tube, each DH5α strain was mixed
HB101 in a 1:1 volume ratio, total volume 500µl, and washed twice by adding liquid LB
and centrifuging to remove the supernatant. Afterwards, 500µl of N. punctiforme was to
each blend of DH5α/HB101 and briefly centrifuged. A portion of the supernatant was
removed, leaving ~200-300µl to resuspend the pellet with a pipette. The mixture of the
three strains for each deletional gene experiment was removed from the 1.5ml microfuge
tube and spread over a Millapore HATF nitrocellulose filter embedded on a
AA+MA+0.5%LB plate. Each triparental conjugation mating plate was placed in a 1%
CO2 incubator under low light. The following day the filters were transferred to AA +
MA plates and left to recover back in the 1% CO2 incubator under low light for about a
week. When the cells appeared to look healthy, the filters were transferred onto AA +
MA+Nm10 plates and placed under the same incubation parameters. Every week the
filters were transferred to a new plate with fresh neomycin until the E.coli background
reduced and putative neomycin resistant primary conjugants grew into visible colonies
that could be isolated and cultured in liquid media (AA/4 + MA+Nm10). If not
detrimental to the vitality of strain because an incurred mutation, the cultures were
washed and grown in MOPs buffer without any nitrogen sources to help exterminate any
contaminating E.coli cells as they can’t produce their own nitrates to survive. Liquid
cultures were grown on LB plates with Nm10 to evaluate any remaining contaminants.
Secondary Recombinant Screening – Once it was determined that the cultures
were axenic the putative primary recombinants were spread plated onto AA + MA+ 5%
29
sucrose solid media plates to prompt a secondary recombination event. Any rising
colonies were designated as putative secondary recombinants and subject for screening
via colony PCR. When the recombinant pRL278 plasmid was excised out of the genome,
there was a 50% chance the wild-type gene was replaced by the mutated version,
depending on the orientation of the recombination event. Selective pressure with
antibiotics was not used in this situation since the plasmid’s antibiotic cassette was no
longer in the genome, nor was it available in the cell, as the plasmid could not replicate in
N. punctiforme (no ORI site). Consequently, colony PCR was required to verify the
chromosomal integration of the mutated gene. Table 9 shows the PCR cycle parameters
and Appendix C provides the Colony PCR parameters for Mut-P1/Mut-P8 and MutP4/Mut-P7 primer pairs.
Step No.
Temperature
Time (min)
No. of Cycles
1
95°C
5
1x
2.1
95°C
2
2.2
Annealing Temp*
2
27x
2.3
72°C
Elongation Time**
3
72°C
10
1x
4
6°C
1x
∞
Table 7. PCR cycle parameters for secondary recombinant screening. *Annealing Temperature specific to
primer pairs can be found in Appendix C. **Elongation Time specific to primer pairs can be found in
Appendix C.
30
Results
NpF0020 – Multi Sensor Signal Transduction Histidine Kinase
Change In Expression Relative to Time
0
NpF0020
3
2.5
2
1.5
1
0.5
0
0
1
2
3
Time (Day)
4
5
6
Figure 10. zwf DNA microarray expression data for gene NpF0020 showing relative expression to an uninduced zwf control. Time 0 is inferred.
According to the DNA microarray data, the expression pattern for NpF0020
indicates up-regulation during akinesis in the zwf strain (Fig. 10). NpF0020 resides as a
2304 base pair open reading frame (ORF) within the genome that overlaps within the first
~100 bases of the downstream gene, NpF0021, and has an upstream intergenic region
that spans about ~300 base pairs. According to Cyanobase, NpF0020 expresses a multisensor signal transduction histidine kinase (Fig. 12) and a protein-BLAST illustrates that
it shares conserved domains that belong to histidine kinases, which include
phosphorylation sites, ATP binding sites and a dimer interface (Fig 11). Figure 12 also
shows the two consecutive genes downstream are response regulators constituents, a
receiver protein (NpF0021) and a sensor signal (NpF0022), suggesting an operonic
architecture of the three genes, and that these might be interacting partners in a twocomponent regulatory pathway with NpF0020.
The STRING database was used in an attempt to find additional interacting
partners and or occurrences in related family members of cyanobacteria. The operonic
sequence of NpF0020, NpF0021 and NpF0022 was found to co-occur in closely related
filamentous cyanobacteria (Nostoc sp PC7120 or Anabaena variabilis) and in distantly
related cyanobacteria (Microsystis aeruginosa). The operonic sequence of NpF0020 and
NpF0021 was found to co-occur in distantly related filamentous cyanobacteria, namely,
Synechocystis sp. 6803 and Cyanothece sp. 51142. The NpF0020 and NpF0021 gene
orthologs in Synechocystis PCC 6803 are slr0473 and slr0474, respectively. The slr0473
gene has been identified as Cph1, a light responsive two-component sensor that has been
31
shown to interact with Slr0474 (named Rcp1) in the CheY subfamily of proteins. In the
filamentous cyanobacterium Nostoc PCC 7120, the NpF0020 ortholog has been named
AphA (phytochrome A).
The BLAST results indicated both GAF and PHY superfamily domains, which
are typically found in photoreceptors that microorganisms use to help them adapt
physiologically and developmentally to ambient light environments. The phytochrome
(PHY) superfamily is the most influential photoreceptors that act as reversible switches in
various photosensory cascades. Phylogenetic studies determined that individual PHYs are
composed of a series of combined and defined structural domains that are instruct distinct
attributes to the photoreceptors. One such structural domain is the cGMP
phosphodiesterase/adenylcyclase/FhlA (GAF) superfamily domain, which in combination
with a Per/Arndt/Sim (PAS) domain make up the photosensing portion of a photorepector
(Cornilescu G, Ulijasz A, et al., 2008).
Race mapping, followed by DNA sequencing identified the transcriptional start
site (+1) 164 bases upstream of the annotated translational start codon (ATG), indicated
by the base G and hence the leader sequence (Fig. 13 and 14) Further analysis of the
leader sequence elucidated an annotated Shine-Dalgarno box sequence (AGGAGG) 6
bases before the translational start site (Fig. 14).
Figure 11. Graphic map of putative conserved domains within NpF0020 showing location of the
phosphorylation site, ATP binding site and dimer interface found in the protein sequence. The graphic was
created using the BLAST program on NCBI.
Figure 12. The 10 kb chromosomal locus containing NpF0020. Taken from CyanoBase: The Genome
Database for Cyanobacteria.
32
Figure 13. NpR0020 RACE sequencing electropherogram. Highlighted sequence identified DT89 adjacent
to the transcriptional start site (+1) “G”. Result was identified from RNA isolated 3 days after fructosegrown wild type strain of N. punctiforme were switched to darkness.
NpF0020 Sequence
GCATCATCTGGATTCCTCACCTTCAGCTAGATAAAACTTATGGATTTATTGCAGTACATCAGCA
AATTTTGAAATTTCACTTGCATTTAGGTGGTAATAGTTCGGATGTACATCCTTATTGTGCTGCT
TGGTACAAATGGCCTTTGATGATTCGACCAATGGCATATTATTATCAAACGGCTGAAAGTATT
ACCGAACCATTACCTGTCATGGGGCCACCTTTACCTGCTGGTGCTGGACAAGTTATTTATGAT
GTCCATGCAATGGGCAATCCCTTTTTGTGGTGGTTTGGTGTTGCTGCTATGTTGTTTTTAGTAG
GGATGCTGATATCACAAGCCGTAATTCCTTGGGTGAAAGAAAAGCGTTTTTTAGTACCTGCAA
CTCTTAGTATTGATACTTGGATTGGTTTGTATTTAGTTATAAATTATGCTGCTAATTTAGCACCT
TGGATAAAAGTGACGAGGTGTGTTTTCATATACCATTATATGTGTGCAGTCGTATTTGTATTTT
TAGCGATCGCTTGGTTTGTCGATCAGTGTCTTCGCAGCTATTATCAACAACTCCGGACGTTAGG
TGTCACCATTACTTTTATTATTCTGGCTGCTTTTATTTTCTGGATGCCCATTTATTTGGGTTTAC
CCCTCTCCCCTGACGGTTATAAATTGCGGATGTGGTTTAACTCTTGGATTTGAttaaaaggggtcttggta
agaataatggctcctaaactcatttctaaagttaacatagctacacatatacatgattgtttaatcacatggttttcacatttcttatccctatgtaagtttactggctg
ctagacttttcaaaG+1tgtaagcagatgagagtaagcctgcaaaacgcaacatcagggcatgggaaattagatactaagtaaaaatgctgagtgtaaagtt
atttgttttacattcatcattattcagttattctagatattctagttttgatgctcccggacaacagaggaggatcttcATG
Figure 14. Nucleotide sequence of NpF0020, with highlighted annotated (putative) regions of interest;
putative Shine-Delgarno in pink, ATG in blue, the transcription start site “+1” in red. Upstream gene
NpF0019 is denoted by capital letters and the intergenic region is denoted in lower case letters.
Raw fluorescence data from the time-course array for NpF0020 zero time point
was 666, indicating low-to-moderate level of transcription expression. This expression
correlates with the GFP fluorescence seen in the early time points of the GFP reporter
strain.
Observations of the GFP transcriptional reporter for NpF0020 under
epifluorescence microscopy after phosphate deprivation are shown below from figure 15
to figure 20. From a general standpoint, the GFP fluorescence activity was significantly
high in comparison to negative control studies, demonstrating transcriptional activity for
the Npun0020 reporter plasmid, indicating GFP fluorescence at high basal levels in
vegetative cells. Fluorescence at low levels was also observed in some heterocysts early
in the experiment, but less so in older cultures. Similar to the expression profile seen in
the zwf microarray data (Fig. 10), the overall intensity of fluorescence seemed to fluctuate
between high and low levels, with the highest levels at day 0 (Fig. 15) and day 13
(Fig.18). Within a filament, the highest concentration of fluorescence was observed in
33
regions between two heterocysts where proto- or mature akinetes typically appear.
Although mature akinetes did show fluorescent activity (day 23; Fig.20) it was not as
high as disjointed neighboring cell clusters during akinesis and vegetative cells prior to
the development of akinetes.
34
A
Figure 15. NpF0020 transcriptional
reporter strain during akinete induction:
Day 0
Hollow arrows indicate heterocysts.
(A)
Brightfield
micrograph,
(B)
epifluorescence
micrograph
showing
autofluorescence, (C) epifluorescence
micrograph showing GFP fluorescence.
All images were visualized using a 100X
objective.
B
C
35
A
Figure 16. NpF0020 transcriptional
reporter strain during akinete induction:
Day 1
Hollow arrows indicate heterocysts.
(A)
Brightfield
micrograph,
(B)
epifluorescence micrograph showing
autofluorescence, (C) epifluorescence
micrograph showing GFP fluorescence.
All images were visualized using a 100X
objective.
B
C
36
A
Figure 17. NpF0020 transcriptional reporter
strain during akinete induction: Day 6
Hallow arrows
indicate
heterocysts.
(A)
Brightfield
micrograph,
(B)
epifluorescence
micrograph
showing
autofluorescence,
(C)
epifluorescence
micrograph showing GFP fluorescence. All
images were visualized using a 100X
objective.
B
C
37
A
Figure 18. NpF0020 transcriptional reporter
strain during akinete induction: Day 14
Hallow arrows indicate heterocysts. (A)
Brightfield micrograph, (B) epifluorescence
micrograph showing autofluorescence, (C)
epifluorescence micrograph showing GFP
fluorescence. All images were visualized
using a 100X objective.
B
C
38
A
Figure 19. NpF0020 transcriptional reporter
strain during akinete induction: Day 20
Hallow arrows indicate heterocysts. (A)
Brightfield
micrograph,
(B)
epifluorescence
micrograph
showing
autofluorescence, (C) epifluorescence
micrograph showing GFP fluorescence. All
images were visualized using a 100X
objective.
B
C
39
A
Figure 20. NpF0020 transcriptional reporter
strain during akinete induction: Day 23
Hallow arrows indicate heterocysts. Filled
arrows indicate akinetes. (A) Brightfield
micrograph,
(B)
epifluorescence
micrograph showing autofluorescence, (C)
epifluorescence micrograph showing GFP
fluorescence. All images were visualized
using a 100X objective.
B
C
40
NpF0022 – Response Regulator Receiver Sensor Signal Transduction Histidine
Change In Expression Relative to Time 0
NpF0022
2.5
2
1.5
1
0.5
0
0
1
2
3
Time (Day)
4
5
6
Figure 21. zwf time-course DNA microarray expression data for gene NpF0022 showing relative expression
to an un-induced zwf control. Time 0 is inferred.
According to the time-course DNA microarray data, the expression pattern for
NpF0022 indicates up-regulation during akinesis in the zwf strain (Fig. 21). NpF0022, a
response regulator receiver sensor signal resides as an 1161 base open reading frame
within the genome, 131 bp downstream of NpF0021, a response regulator receiver that
has a 56 bp overlap with its upstream gene NpF0020 presented above. The arrangement
of these three genes indicates a potential operonic architecture. According to a proteinBLAST, NpF0022 shares homology to histidine kinases, which include phosphorylation
sites, ATP binding sites and a dimer interface (Fig 22). The STRING database confirmed
the operonic sequence of the three genes and identified co-occurrences in closely related
filamentous cyanobacteria (Nostoc sp PC7120 and Anabaena variabilis). Paralogs were
also identified across different loci in Nostoc Punctiforme and across genomes that
belong to closely and distantly related filamentous cyanobacteria.
Race mapping, followed by DNA sequencing identified a potential transcriptional
start site (+1) 96 bases upstream of the annotated translational start codon (ATG),
indicated by the base A and hence the leader sequence (Fig. 24). Using the transcriptional
start site, further analysis of the intergenic region identified 33 bases from the
transcriptional start a putative 3 base core sequence of a -35 (TTGCAA) region. No
Shince-Dalgarno box was identified upstream of the translational start site.
41
Figure 22. Graphic map of putative conserved domains in NpF0022. The graphic was created using the
BLAST program on NCBI.
Figure 23. The 10 kb chromosomal locus containing NpF0022. Taken from CyanoBase: The Genome
Database for Cyanobacteria.
NpF0022 Sequence
TTGAGCGTAGAAACGGGAGAAAAACACAAAACCATCTTTTTGGTCGAGGACAATAAAGCTGA
CATTCGCTTAATCCAAGAAGCGTTAAAAAATAGTTCAGTGCCCTACCAAGTGGTAACGGTCAG
GGATGGTATAGATGCTATGGCTTATTTACGCCAAGAAGGTGAATATGCTGATGCACCTCGCCC
TGACCTTATTCTGCTGGATTTGAATTTGCCTAAAAAAGATGGTCGAGAAGTGCTGGCGGAAAT
AAAAGCCGACCCACTACTAAAACGTATTCCAGTTGTTGTGTTAACAACCTCAAAAAATGAGGA
TGACATTTTTCACAGCTACGATTTACATGTGAATTGCTATATCACTAAATCTCGCAACCTGAAC
CAATTATTTCAAATCGTCAAGAGTATCGAAGATTTTTGGCTCTCTACTGTGACGCTACCATCAG
AGTGAggcagggggtaggggaggcaggggagacaaggggA+!caaagggacaaggtgacaaatgacaaatgactaatgacaaatgacaaataa
ctaatgacaagatagaggagcaatagggggtgaaacccgaagattATG
Figure 24. Nucleotide sequence upstream of NpF0022, with highlighted annotated (putative) regions of
interest: ATG start codon in blue, transcription start site “+1” in red, and -35 in yellow. Upstream gene
NpF0021 is denoted by capital letters and the intergenic region in small case letters. Overlapping region
with upstream gene NpF0020 is underlined.
42
Figure 25. NpR0022 RACE sequencing electropherogram. Highlighted sequence identified DT89 adjacent
to the transcriptional start site (+1) “A”. Result was identified from RNA isolated 3 days after fructosegrown wild type strain of N. punctiforme were switched to darkness.
Raw fluorescence data from the time-course array for NpF0022 zero time point
was 87, indicating low expression. This low expression was still visible in the GFP
reporter strain. Observations of the transcriptional reporter for Npun0022 under
epifluorescence microscopy after phosphate deprivation are shown below from figure 26
to figure 31. The images indicate GFP fluorescence consistently at a low level throughout
the all cell types in filament, with the exception of a few outlying observations in single
cells. The fluorescence levels were equal throughout, with no concentrating areas such as
mid-way between heterocysts. The NpF0022 reporter showed similar fluorescence as the
negative control indicating this predicted promoter was not active under these conditions.
43
A
Figure 26. NpF0022 transcriptional reporter
strain during akinete induction: Day 0
Hollow arrows indicate heterocysts. (A)
Brightfield micrograph, (B) epifluorescence
micrograph showing autofluorescence, (C)
epifluorescence micrograph showing GFP
fluorescence. All images were visualized
using a 100X objective.
B
C
44
A
Figure 27. NpF0022 transcriptional
reporter strain during akinete
induction: Day 1
Hallow arrows indicate heterocysts. (A)
Brightfield
micrograph,
(B)
epifluorescence micrograph showing
autofluorescence, (C) epifluorescence
micrograph showing GFP fluorescence.
All images were visualized using a 100X
objective.
B
C
45
A
Figure 28. NpF0022 transcriptional reporter
strain during akinete induction: Day 3
Hallow arrows indicate heterocysts. (A)
Brightfield micrograph, (B) epifluorescence
micrograph showing autofluorescence, (C)
epifluorescence micrograph showing GFP
fluorescence. All images were visualized
using a 100X objective.
B
C
46
A
Figure 29. NpF0022 transcriptional reporter
strain during akinete induction: Day 7
Hallow arrows indicate heterocysts. (A)
Brightfield micrograph, (B) epifluorescence
micrograph showing autofluorescence, (C)
epifluorescence micrograph showing GFP
fluorescence. All images were visualized
using a 100X objective.
B
C
47
A
Figure 30. NpF0022 transcriptional reporter
strain during akinete induction: Day 10
Hallow arrows indicate heterocysts. (A)
Brightfield micrograph, (B) epifluorescence
micrograph showing autofluorescence, (C)
epifluorescence micrograph showing GFP
fluorescence. All images were visualized
using a 100X objective.
B
C
48
A
Figure 31. NpF0022 transcriptional
reporter
strain
during
akinete
induction: Day 14
Hallow arrows indicate heterocysts. Filled
arrows indicate akinetes.
(A) Brightfield
micrograph, (B) epifluorescence micrograph
showing
autofluorescence,
(C)
epifluorescence micrograph showing GFP
fluorescence. All images were visualized
using a 100X objective.
B
C
49
NpF2868 – Pad R-like Transcriptional Regulator
Change In Expression Relative to Time
0
NpF2868
2
1.5
1
0.5
0
0
1
2
3
Time (Days)
4
5
6
Figure 32. zwf DNA microarray expression data for gene NpF2889 showing relative expression to an uninduced zwf control. Time 0 is inferred.
According to the DNA microarray data, the expression pattern for NpF2868
indicates 1.2- to 1.8-fold upregulation during akinesis in zwf strains (Fig. 32). NpF2868
resides as a 564 base pair open reading frame within the genome. Cyanobase details the
NpF2868 protein as a Pad R-like Transcriptional Regulator that typically acts as a
repressor. A protein-BLAST did not indicate common domains of two-component
regulatory systems, with the exception of helix-turn-helix domain within the N-terminal
PadR domain found in some response regulators that bind DNA (Fig. 34). PadR-like
transcriptional regulators form a structurally related family of proteins that control the
expression of genes associated with detoxification, virulence and multi-drug resistance in
bacteria (Fibriansah et al., 2012).
The downstream gene (NpN2869) encoding a potential carotenoid oxygenase is
closely associated with NpF2868, with its start site next to the stop codon of NpF2868,
with no intervening sequence. Close association with homologs of this gene is also
observed in another cyanobacterium (Acaryochloris marina) but the gene AM1_1272 is
a) divergently transcribed and is dictated as a putative retinal pigment epithelial
membrane protein. Additionally, two members of the Actinobacteria class of bacteria
also show close association with this set of homologs. (STRING database). This
represents weak evidence throughout the cyanobacteria taxa that the NpF2869 and
NpF2828 proteins may interact in a 2-component pathway.
RACE Mapping, followed by DNA sequencing identified the transcriptional start
site (+1) in the upstream 427 bp-long intergenic region that was 68 bases upstream from
the translation start codon (ATG) indicated by the base T (Fig. 35 and 36). Using the
50
location of the transcriptional start site, further analysis identified 10 bases upstream an
putative -10 box (TATATT) only a base substitution off from a perfect sigma 70
consensus sequence (TATAAT) and a partial (TTG) core sequence of a -35 box
(TTGACA) region, 34 bases from the transcriptional start site.
Figure 33. The 10 kb chromosomal locus containing NpF2868. Taken from CyanoBase: The Genome
Database for Cyanobacteria.
Figure 34. Graphic mapping out putative conserved domains of NpF2868. The graphic was created using
the BLAST program on NCBI.
NpF2868 Sequence
CTGTAAACTAAATAAtattagtgtagggagattgcattgcaacctccctactcgcgtcaaatctttgttatctagcatctagcgatcgcaaagctc
gttattctgatactagtggattttaccccaagtcttgccctgtcgaagtgacagggaaagacttaaactttagacgtgagaaaccttgatatttccgcatgtgcca
acacagcagatggttcgcgctggagagcattgtaatactttctctcaaaagtattacctgtctctaacggtacaatcagggtgcggacatcagcaatcaactttt
caaaatcttccaaagatatcggttcatctgcttcgagcatttcatcaacttgcacaaccacctcagaaatgcgatgtagccaggcaaattgttcatgagcgataa
ctagctgaagtaattctccgcttgatactcgtccactaacctgttcataggcaatgcgttctgtttccaacaacattttatgaaggtggagtaatttatttcgtaaatc
acgcagatattgatgttgacgtattctttgtgaaagtgtgttagaagtcaatgttactcatcctctcgttacaatagccttcaatggcttaaataattgctgcgtcagt
atcgatacgcgaatagactgtagcgaacaactggcttgttgagtgataccgtagcgatgcgtagacgcttgcttgccgctccaactttatcttcacgacactct
atctagtaagattcccatctggttacaggctcgacactcaacatacatcgccacttttgcaccgtcttgtgcaaacagcaccattaaccatctgcccaatctcag
ttcatatattcggtttccttgttaagagcgtgaaaatcaacatatctttttataacggttgtatcttatattggattaatcatatattagcaT+1aaacttataagaagta
gatagttatagaacctagtgagaaaatgtcaattatgggaaaacagccttaATG
Figure 35. Nucleotide sequence of NpF2868 intergenic region, with highlighted annotated (putative)
regions of interest; ATG in blue, transcription start site “+1” in red, partial core sequence of the -35 in
yellow, and Pribnow -10 box in green. Upstream gene NpF2866 is denoted by capital letters and the
intergenic region is denoted in lower case letters.
51
Figure 36. NpF2868 RACE sequencing electropherogram. Highlighted sequence identified DT89 adjacent
to the transcriptional start site (+1) “T”. Result was identified from RNA isolated 3 days after fructosegrown wild type strain of N. punctiforme were switched to darkness.
Raw fluorescence data from the time-course array for NpF2868 zero time point
was 68, indicating low expression. This low expression was visible in the GFP reporter
strain during the early days of the study. Observations of the transcriptional reporter for
NpF2868 under epifluorescence microscopy after phosphate deprivation are shown below
from figure 37 to figure 42. Relatively higher GFP emissions were detected at every time
point in comparison to negative control studies indicating a low basal level of
transcription in vegetative cells. The images indicate increased GFP fluorescence specific
to proto- or mature akinetes. Heterocysts however showed no fluorescent activity. Based
on visual observations, the time points with the highest GFP emissions were day 0, 6, and
10 (Figures 37, 39, and 40, respectively) . Through time, the localization of GFP tends to
shift from throughout the filament to a more targeted region, mid point between two
heterocysts where akinetes typically region develop. On day 12 (Fig.41) the only cell
types that showed any significant GFP emission were the akinetes, although it was not
the highest emission intensity compared to previous time points. Day 12 as well showed
GFP intensities in vegetative cells similar to the negative control. From a general
standpoint, the GFP fluorescence activity was relatively higher in comparison to negative
control studies, apart from day 12.
The ΔNpF2868 mutant was determined after a series of attempted triparental
conjugation events. Once primary colonies were identified after a triparental conjugation
event they were grown in liquid culture with under selective pressure with antibiotics to
maintain survival of the strains that have acquired the plasmid (pRL278) that contains a
neomycin resistance cassette. Surviving strains were subjected to secondary selection by
plating on media that contained 5% sucrose and any surviving colonies were subjected to
colony PCR to determine if a secondary recombination event took place removing the
integral portion of the gene NpF2868 was removed. The expected amplicons sizes
amplified using the putative ΔNpF2868 DNA for primer sets P1/P8 and P4/P7 is 1195bp
and 1200bp respectively. The expected amplicons sizes amplified using the wild-type
DNA for primer sets P1/P8 and P4/P7 is 1709bp and 1714bp respectively. Figure 43 is a
photograph of the gel that illustrates the amplicons sizes of colony PCR reactions that
verified the chromosomal integration of the mutated gene. No putative phenotype was for
the mutant was determined.
52
A
Figure 37. NpF2868 transcriptional reporter
strain during akinete induction: Day 0
Hollow arrows indicate heterocysts. (A)
Brightfield micrograph, (B) epifluorescence
micrograph showing autofluorescence, (C)
epifluorescence micrograph showing GFP
fluorescence. All images were visualized
using a 100X objective.
B
C
53
A
Figure 38. NpF2868 transcriptional reporter
strain during akinete induction: Day 3
Hallow arrows indicate heterocysts. (A)
Brightfield micrograph, (B) epifluorescence
micrograph showing autofluorescence, (C)
epifluorescence micrograph showing GFP
fluorescence. All images were visualized
using a 100X objective.
B
C
54
A
Figure 39. NpF2868 transcriptional
reporter strain during akinete induction:
Day 6
Hallow arrows indicate heterocysts. (A)
Brightfield
micrograph,
(B)
epifluorescence
micrograph
showing
autofluorescence, (C) epifluorescence
micrograph showing GFP fluorescence.
All images were visualized using a 100X
objective.
B
C
55
A
Figure 40. NpF2868 transcriptional
reporter strain during akinete induction:
Day 10
Hallow arrows indicate heterocysts. (A)
Brightfield
micrograph,
(B)
epifluorescence
micrograph
showing
autofluorescence, (C) epifluorescence
micrograph showing GFP fluorescence. All
images were visualized using a 100X
objective.
B
C
56
A
Figure 41. NpF2868 transcriptional
reporter strain during akinete induction:
Day 12
Hallow arrows indicate heterocysts. (A)
Brightfield
micrograph,
(B)
epifluorescence
micrograph
showing
autofluorescence, (C) epifluorescence
micrograph showing GFP fluorescence.
All images were visualized using a 100X
objective.
B
C
57
A
Figure 42. NpF2868 transcriptional
reporter strain during akinete induction:
Day 17
Hallow arrows indicate heterocysts. Filled
arrows indicate akinetes. (A) Brightfield
micrograph,
(B)
epifluorescence
micrograph showing autofluorescence, (C)
epifluorescence micrograph showing GFP
fluorescence. All images were visualized
using a 100X objective.
B
C
N
58
~1200 bp
~1200 bp
~1714 bp
~1200 bp
Wild
Type
Cont
rol
P1 &
P8
ΔNpF
2868
P1
and
P8
B
WildType
Contr
ol P4
& P7
1Kb DNA Ladder
ΔNpF
2868
P4
and
P7
~1200 bp
ΔNpF
2868
P4
and
P7
A
~1709 bp
1500 bp
1500 bp
~1195 bp
Figure 43. Colony PCR Gel Electrophoresis Image for ΔNpF2889 Secondary Recombinant Mutant.
A. Primer Set 4/7 B. Primer Set 1/8
59
NpF2889 – CBS Sensor Hybrid Histidine Kinase
Change In Expression Relative to Time 0
NpF2889
2.5
2
1.5
1
0.5
0
0
1
2
3
Time (Days)
4
5
6
Figure 44. zwf DNA microarray expression data for gene NpF2889 showing relative expression to an uninduced zwf control. Time 0 is inferred.
According to the DNA microarray data, the expression pattern for NpF2889
indicates up-regulation during akinesis in the zwf strain (Fig. 44). NpF2889 resides as an
3354 base pair open reading frame within the genome. According to Cyanobase,
NpF2889 expresses a multi-sensor signal transduction histidine kinase (Fig. 46) and
protein-BLAST illustrates that it shares conserved domains that belong to histidine
kinases, which include phosphorylation sites, ATP binding sites and a dimer interface
(Fig. 45).
Since NpF2889 is a member of a 2-component signaling pathway, STRING was
used in an attempt to find potential interacting partners. NpF2889 did not co-evolve in
the genome with other genes found in closely related filamentous cyanobacteria (Nostoc
or Anabaena), however it was found to co-occur with two genes in more distantly related
cyanobacteria. In Prochlorococcus marina, a homolog of NpR3548 lies upstream from
its NpF2889 homolog, in Microcystis aeruginosa, an NpF5527 homolog lies at a similar
position, and in Gloeobacter violaceus the NpF2889 homolog is fused to NpF2557 and
NpR3548 lies downstream. NpF5527 encodes a 2-component response regulator and
NpR3548 encodes a 2-hybrid hybrid sensor and regulator, making them good candidates
for potential interacting partners with NpF2889.
Race mapping, followed by DNA sequencing identified the transcriptional start
site (+1) 173 bases upstream of the translational start codon (ATG), indicated by the base
A and hence the leader sequence; see figures 47 and 48. Using the location of the
transcriptional start site, further analysis of the intergenic region annotated the following
60
features (Fig. 48): a putative core sequence of a Shine-Delgarno box sequence (~AGAG)
8 bases before the translational start site; a putative Pribnow -10 box (~ATAAT) spaced 6
bases upstream of the transcriptional start site and a disrupted core sequence of a -35 box
region.
Figure 45. Graphic mapping out putative conserved domains and location of the phosphorylation site, ATP
binding site and dimer interface found in the protein sequence. The graphic was created using the BLAST
program on NCBI.
Figure 46. The 10 kb chromosomal locus containing NpF2889. Taken from CyanoBase: The Genome
Database for Cyanobacteria.
NpF2889 Sequence
taatctaatttaagctgtcttaataatccttgcctttcggctggattcatctcgttaaaatgctgttggcttttttgcatctggctagcaaatacatagacgtacttgcta
gtgtatgccttacttggattttgttgcggccaatttggtaaatagtttattgttgcagaggtcgttgcagtaacaggtaaatagcaaaattgggcgacgatcgcat
caataaatttccacacccaagaaatccaacctttttgcttggctaagtcaactagattatctaaacatttgttaacatcaggtcgcagaatcaatattggtaataac
atttactctttaatctatctccttgatcgctttgaccaagaaacgtgggctgataagtttggctaacgcttctaggggaatacttcttgatgtccagaaaactagtga
ctttaccccaaaataacgctctgtgttaacagatagtgcaagaaggcagttcttgctggaggtggtaagtaataaagcttatgcactaaagttaagcttttagctt
ttttcaactggatatttatttatgcatgcttatgctagcgactcaacagcttaatgcagcaactgagtgttaagacttagtaaatctttgatgatgaggtatatgtcgc
cataacgagacacagtagctaatttattgtttgcgtatctgtaatctatgtctataaatagatatattttttaattttgctccttgataagatacttaaacgaacttaaag
gattgtcgcattctaaatcattataattcctcaaggttctaaagcgaatctttggggccataattgttgtA+1gccgtcgctatcgatcgggagtttaaataccagt
aagacgctggggaggctagttgctataaattggaaacgtcgcctcttggaaaaatgcacttgtccacaagcaagtgtccgtgaggggaaatcccattcttttat
ttaatggcgttgaaataaccagagttgcttatATG
Figure 47. Nucleotide sequence of NpF2889, with highlighted annotated (putative) regions of interest;
partial core sequence of the Shine-Dalgarno in pink, ATG in blue, the transcription start site “+1” in red,
and Pribnow -10 box in green. Upstream gene NpF2881 is not included in the sequence and the intergenic
region is denoted in lower case letters.
61
Figure 48. NpF2889 RACE sequencing electropherogram. Highlighted sequence identified DT89 adjacent
to the transcriptional start site (+1) “A”. Result was identified from RNA isolated 3 days after fructosegrown wild type strain of N. punctiforme were switched to darkness.
Raw fluorescence data from the time-course array for NpF2889 zero time point
was 61, indicating low expression. This low expression was still visible in the GFP
reporter strain, which was noticeably more fluorescent than the plasmid-only control
strain.
Observations of the transcriptional reporter for NpF2889 under epifluorescence
microscopy after phosphate deprivation are shown below from figure 49 to figure 54. The
images indicate GFP fluorescence is not specific to either proto- or mature akinetes but is
also found among vegetative cells. However, through out the time course in relation to
other cell types, heterocysts showed a increased expression, while akinetes at day 26 (Fig.
54) showed a relatively low intensity. Another observation in regards to heterocysts, the
highest fluorescent intensity was exhibited on certain days through out the time course in
particular day 3, 17 and 26 (Figures 50, 53, and 54, respectively). From a global
perspective, GFP fluorescence is emitted through out the filament, with its highest peak
based on subjective evidence on day 0 and 3, from which the level of intensity seems to
drop, with the exception of select heterocysts.
The ΔNpF2889 mutant was determined after a series of attempted triparental
conjugation events. Once primary colonies were identified after a triparental conjugation
event they were grown in liquid culture with under selective pressure with antibiotics to
maintain survival of the strains that have acquired the plasmid (pRL278) that contains a
neomycin resistance cassette. Surviving strains were subjected to secondary selection by
plating on media that contained 5% sucrose and any surviving colonies were subjected to
colony PCR to determine if a secondary recombination event took place removing the
integral portion of the gene NpF2889 was removed. The expected amplicons sizes
amplified using the putative ΔNpF2889 DNA for primer sets P1/P8 and P4/P7 is 1837bp
and 1836bp respectively. The expected amplicons sizes amplified using the wild-type
DNA for primer sets P1/P8 and P4/P7 is 5121bp and 5122bp respectively. Figure 55 is a
photograph of the gel that illustrates the amplicons sizes of colony PCR reactions that
verified the chromosomal integration of the mutated gene.
62
During the mutational experiment it was observed that the putative ΔNpF2889
primary recombinant could not grow in media deficient in combined nitrogen sources
(MOPS). The same observation was made with the confirmed ΔNpF2889 mutant,
suggesting the mutational event of the NpF2889 removed a necessary phenotype used in
some manner to assimilate nitrogen from the atmosphere into a combined source. Figure
58 shows a picture of the ΔNpF2889 mutant culture in an unviable state demonstrated by
the yellow color indicating cell death as apposed to a green color indicating vitality.
Consequently the ΔNpF2889 mutant was maintained in liquid media that contained a
combined nitrogen source (MOPS/NH4).
Further investigation took place to decipher the phenotype affected as a result of
mutating NpF2889. Figure 56 shows images of the ΔNpF2889 mutant moved from media
containing combined nitrogen to media containing no combined nitrogen to see if the
mutant was capable of developing heterocysts, the cell responsible for fixing nitrogen.
Although under common laboratory practice heterocysts can develop under 48 hours, the
only observations made of putative heterocysts were seen on day 5. These putative
heterocysts were identified not because they were fully developed but because of their
shape resembled heterocysts undergoing development and their lack of fluorescent under
a Texas Red Filter. No mature heterocysts we observed
Figure 59 and figure 60 shows both a ΔNpF2889 mutant and a wild-type strain
stained with Periodic acid–Schiff -stain to identify the presence of polysaccharides. Under
this experiment it is expected only for the heterocysts if present to be stained violet;
vegetative cell do not permeate with the stain, as they do not contain a polysaccharide
layer. Unfortunately, the wild-type control showed staining in both heterocysts and
vegetative cells and the ΔNpF2889 mutant showed no staining on either cell type.
However, the wild type exhibited an interesting halo of stain surrounding the heterocysts
that was not witnessed with the ΔNpF2889 mutant. Although based on this observations
it can be viewed that the ΔNpF2889 mutant does not contain a polysaccharide layer
further optimization of the protocol is necessary to rule this out.
Figure 61 to figure 64 shows the ΔNpF2889 mutant under akinete inducing
conditions where the media is deficient in phosphates. Unlike previous akinete induction
experiments the media for this particular experiment contained a combined nitrogen
source since the mutant has demonstrated unfavorable outcomes in media with out a
nitrogen source. Although the ΔNpF2889 mutant can develop akinetes as seen in figure
64, observations of filaments with disjointed cells was not observed as would be expected
under wild-type conditions.
63
A
Figure 49. NpF2889 transcriptional reporter
strain during akinete induction: Day 0
Hollow arrows indicate heterocysts. (A)
Brightfield micrograph, (B) epifluorescence
micrograph showing autofluorescence, (C)
epifluorescence micrograph showing GFP
fluorescence. All images were visualized
using a 100X objective.
B
C
64
A
Figure 50. NpF2889 transcriptional reporter
strain during akinete induction: Day 3
Hollow arrows indicate heterocysts. (A)
Brightfield micrograph, (B) epifluorescence
micrograph showing autofluorescence, (C)
epifluorescence micrograph showing GFP
fluorescence. All images were visualized using
a 100X objective.
B
C
65
A
Figure 51. NpF2889 transcriptional reporter
strain during akinete induction: Day 7
Hollow arrows indicate heterocysts. (A)
Brightfield micrograph, (B) epifluorescence
micrograph showing autofluorescence, (C)
epifluorescence micrograph showing GFP
fluorescence. All images were visualized
using a 100X objective.
B
C
66
A
Figure 52. NpF2889 transcriptional reporter
strain during akinete induction: Day10
Hollow arrows indicate heterocysts. (A)
Brightfield micrograph, (B) epifluorescence
micrograph showing autofluorescence, (C)
epifluorescence micrograph showing GFP
fluorescence. All images were visualized
using a 100X objective.
B
C
67
A
Figure 53. NpF2889 transcriptional reporter
strain during akinete induction: Day 17
Hollow arrows indicate heterocysts. (A)
Brightfield micrograph, (B) epifluorescence
micrograph showing autofluorescence, (C)
epifluorescence micrograph showing GFP
fluorescence. All images were visualized
using a 100X objective.
B
C
68
A
Figure 54. NpF2889 transcriptional reporter
strain during akinete induction: Day 26
Hollow arrows indicate heterocysts. Filled
arrows indicate akinetes. (A) Brightfield
micrograph,
(B)
epifluorescence
micrograph showing autofluorescence, (C)
epifluorescence micrograph showing GFP
fluorescence. All images were visualized
using a 100X objective.
B
C
69
1Kb DNA Ladder
ΔNpF2889
P1 and P8
~1837 bp
~1836 bp
Wild-Type Control
P4 & P7
ΔNpF2889
P4 and P7
1Kb DNA Ladder
ΔNpF2889
P1 and P8
Wild-Type Control
P1 & P8
2000 bp
ΔNpF2889
P4 and P7
1Kb DNA Ladder
5000 bp
~5122 bp
~5121 bp
~1837 bp
~1836 bp
Figure 55. Colony PCR for ΔNpF2889 Secondary Recombinant Mutant.
A
B
Figure 56. ΔNpF2889 Secondary Recombinant Mutant Heterocyst Induction: Day 5, MOPS media. Hollow
arrows indicate putative proto-heterocysts identified due lack of fluorescence under Texas Red Filter.
(A)Brightfield micrograph (B) Epifluorescent micrograph using Texas Red filter. All images were viewed
under a 100X objective.
70
A
B
Figure 57. ΔNpF2889 Secondary Recombinant Mutant Heterocyst Induction: Day 6, MOPS media.
(A)Brightfield micrograph (B) Epifluorescent micrograph using Texas Red filter. All images were viewed
under a 100X objective.
Figure 58. ΔNpF2889 Secondary Recombinant Mutant Heterocyst Induction Day 10, MOPS media. Liquid
culture of ΔNpF2889 Secondary Recombinant Mutant exhibiting a yellow property, indicating cease of
growth.
71
Figure 59. Periodic acid–Schiff -Stain of ΔNpF2889 Secondary Recombinant Mutant; Heterocyst Induction:
Day 2. Filament with putative developing proto- heterocyst showing no polysaccharide staining. Hollow
arrow indicates putative developing heterocysts.
Figure 60. Periodic acid–Schiff -Stain Wild-Type strain; Heterocyst Induction: Day 2. Filament with
developed heterocyst showing polysaccharide staining. Hollow arrows indicates developed heterocysts.
72
Figure 61. ΔNpF2889
Secondary Recombinant Mutant
during akinete induction: Day 3;
MOPS/NH4, -phosphates;
Brightfield micrograph at 100X.
Figure 62. ΔNpF2889 Secondary
Recombinant Mutant during
akinete induction: Day 6;
MOPS/NH4, -phosphates;
Brightfield micrograph at 100X.
73
Figure 63. ΔNpF2889
Secondary Recombinant
Mutant during akinete
induction: Day 10;
MOPS/NH4, -phosphates;
Brightfield micrograph at
100X.
Figure 64. ΔNpF2889
Secondary Recombinant
Mutant during akinete
induction: Day 15;
MOPS/NH4, -phosphates;
Filled arrows indicate akinetes.
Brightfield micrograph at
100X.
74
Change In Expression Relative to Time
0
NpF4131 – Sensor Hybrid Histidine Kinase
NpF4131
3
2.5
2
1.5
1
0.5
0
0
1
2
3
Time (Days)
4
5
6
Figure 65. zwf DNA microarray expression data for gene NpF4131 showing relative expression to an uninduced zwf control. Time 0 is inferred.
NpF4131 resides as a 1671 base pair open reading frame within the genome.
According to the DNA microarray data, the expression pattern implies a spike in
upregulation during the beginning of akinesis followed by a gradual drop in the zwf
mutant (Fig. 65). Cyanobase lists the NpF4131 protein as a GAF Sensor Hybrid Histidine
Kinase (Fig. 67) and protein-BLAST illustrates that it shares conserved domains that
belong to two-component regulatory systems, which include histidine kinases, response
regulators, phosphorylation sites, ATP binding sites and dimer interfaces (Fig 66).
Use of the STRING database resource to find potential interacting partners for
this 2-component regulator was rewarding. In all other cyanobacteria, the NpF4131
protein was adjacent to an ortholog of NpF1185 encoding a two component response
regulator, indicating that its potential interacting partner in a 2-component regulatory
system has moved relatively recently in the genome of N. punctiforme.
Race mapping, followed by DNA sequencing identified the transcriptional start
site (+1) 82 bases upstream of the translational start codon (ATG), indicated by the base
A (Fig. 68 and 69). Using the location of the transcriptional start site, further analysis of
the intergenic region showed the following features (Fig. 68); and a disrupted core ShineDelgarno box sequence (~AGGAGG) 10 bases before the translational start site, and a
disrupted core Pribnow -10 sequene located 7 base pairs from the transcriptional start site.
75
Figure 66. Graphic mapping out putative conserved domains and location of the phosphorylation site, ATP
binding site and dimer interface found in the protein sequence. The graphic was created using the BLAST
program on NCBI.
Figure 67. The 10 kb chromosomal locus containing NpF4131. Taken from CyanoBase: The Genome
Database for Cyanobacteria.
NpF4131 Sequence
ATCGCGATCGTCACTCAAGTAGATCGGCTGCGTCCCATCCGCGAATGGCAACCGCCTTATGAT
TGGGAATGGGGCGATCGCCCAAAAGAAATTGCCATTCGAGAAGCTACTGAGTATCGCGCCAA
ATTGCTGGGAAAATTCTGTAATCTAGTTCTACCCCTGGTTACAGGTGACAGCAAAACAGGTCG
AGTTGCCTGGGGAGTGGATACGCTTTCACTGGGATTAGTAGATGCGATCGCACCTACCAAGCA
ACTCCGTCTCGCCCGATTTTTGCGTAACCTTGAAGCCCGTACCGTCGCTGCTGCCAAAATCATC
GACCACTACACCTTCCAGATGGCGACAACTCAAGGACTAACGGCATTGCTCAAAAGTCCCGTC
CTCCAGTTTGTTTCTACGCTCTCAACCGGATCTCCAGCGCTAGCATATATGCTGGCAGAACAA
ATTCCCGTGGAACAGTTACCGATTGTGATTGGCAAACTCCAAATGGGATATGAGCTTTTCTCG
CTTTTGAATATAGCTAACCCTAACCCGCTCAACTTTGAATTGCTATCCCTCTGGCCGCTACTGC
TAGAAAATTCCACTTCACCCGATCGCAATGCCTGGGCATTTGGTCACGCCCTAGTGGAGTACT
GGACTCAGAATCTAACGGTTGAACAACTCCGGGAGCGATTTGAGTATTATCTGTCAATTGCCA
AATAAtttgtctgtgttgaggaattaatgcccgcattttccattctggtacgcctcaatagcgattttactagccacgttcccccagtcttattaaacaccaca
agttgcattagctcctttggtcaactaagcatatttgcttaatggagtatatttatacctgtaaaaaacagaacgcaaaatacggcgatatctcgtactattgacat
caaagttaagattA+1CGATTAAGAGTAGGTGTCTGTTGAAACCTACCCGCTTTACCTGAGTGTTTATCC
AGACATCCCTTTTGTTCGGAGTTATTTATG
Figure 68. Nucleotide sequence of NpF4131, with highlighted annotated (putative) regions of interest; a
partial core sequence of the Shine Delgarno in pink, ATG in blue, a disrupted core sequence of the Pribnow
box (-10 region) in yellow, and transcriptional start site in red. Upstream gene NpF4130 is denoted by
capital letters and the intergenic region is denoted in lower case letters.
76
Figure 69. NpF4131 RACE sequencing electropherogram. Highlighted sequence identified DT89 adjacent
to the transcriptional start site (+1) “A”. Result was identified from RNA isolated 3 days after fructosegrown wild type strain of N. punctiforme were switched to darkness.
A raw fluorescence value of 158 was found for the time zero sample indicating a
low level of gene expression that is supported by the GFP reporter results. Observations
of the transcriptional reporter for NpF4131 under epifluorescence microscopy after
phosphate deprivation are shown below from figure 70 to figure 75. GFP emission was
detected at every time point, and in comparison to a negative control, were slightly higher
based on visual observation. The images indicate GFP fluorescence is not specific to just
proto- or mature akinetes but also found among vegetative cells. Heterocysts, however,
showed no fluorescent activity. Based on visual observations, there was an increase in
GFP intensity between day 0 (Fig. 70) and 1 (Fig 71), followed by a constant level from
day 6 (Fig.72) to day 20 (Fig.74). Day 23 (Fig 75) showed more expression in mature
akinetes within the filament compared to the akinete and proto-akinetes at day 20. GFP
localization was also observed mainly in segments of the filaments between two
heterocysts.
The ΔNpF4131 mutant was determined after a series of attempted triparental
conjugation events. Once primary colonies were identified after a triparental conjugation
event they were grown in liquid culture with under selective pressure with antibiotics to
maintain survival of the strains that have acquired the plasmid (pRL278) that contains a
neomycin resistance cassette. Surviving strains were subjected to secondary selection by
plating on media that contained 5% sucrose and any surviving colonies were subjected to
colony PCR to determine if a secondary recombination event took place removing the
integral portion of the gene NpF4131 was removed. The expected amplicons sizes
amplified using the putative ΔNpF4131 DNA for primer sets P1/P8 and P4/P7 is 1989bp
and 1116bp respectively. The expected amplicons sizes amplified using the wild-type
DNA for primer sets P1/P8 and P4/P7 is 3585bp and 2712bp respectively. Figure 76 is a
photograph of the gel that illustrates the amplicons sizes of colony PCR reactions that
verified the chromosomal integration of the mutated gene.
77
A
Figure 70. NpF4131 transcriptional reporter
strain during akinete induction: Day 0
Hollow arrows indicate heterocysts. (A)
Brightfield micrograph, (B) epifluorescence
micrograph showing autofluorescence, (C)
epifluorescence micrograph showing GFP
fluorescence. All images were visualized
using a 100X objective.
B
C
78
A
Figure 71. NpF4131 transcriptional reporter
strain during akinete induction: Day 1
Hallow arrows indicate heterocysts. (A)
Brightfield micrograph, (B) epifluorescence
micrograph showing autofluorescence, (C)
epifluorescence micrograph showing GFP
fluorescence. All images were visualized
using a 100X objective.
B
C
79
A
Figure 72. NpF4131 transcriptional
reporter strain during akinete induction:
Day 6
Hallow arrows indicate heterocysts. (A)
Brightfield
micrograph,
(B)
epifluorescence
micrograph
showing
autofluorescence, (C) epifluorescence
micrograph showing GFP fluorescence. All
images were visualized using a 100X
objective.
B
C
80
A
Figure 73. NpF4131 transcriptional
reporter strain during akinete induction:
Day 13
Hallow arrows indicate heterocysts. (A)
Brightfield
micrograph,
(B)
epifluorescence micrograph showing
autofluorescence, (C) epifluorescence
micrograph showing GFP fluorescence.
All images were visualized using a 100X
objective.
B
C
81
A
Figure 74. NpF4131 transcriptional reporter
strain during akinete induction: Day 20
Hallow arrows indicate heterocysts. Filled
arrows indicate akinetes.
(A) Brightfield
micrograph, (B) epifluorescence micrograph
showing
autofluorescence,
(C)
epifluorescence micrograph showing GFP
fluorescence. All images were visualized
using a 100X objective.
B
C
82
A
Figure 75. NpF4131 transcriptional reporter
strain during akinete induction: Day 23
Hallow arrows indicate heterocysts. Filled
arrows indicate akinetes.
(A) Brightfield
micrograph,
(B)
epifluorescence
micrograph showing autofluorescence, (C)
epifluorescence micrograph showing GFP
fluorescence. All images were visualized
using a 100X objective.
B
C
83
1Kb DNA Ladder
1500 bp
~1989 bp
Wild-Type Control
P1 & P8
~1116 bp
ΔNpF
4131
P1
and
P8
1500 bp
1Kb DNA Ladder
Wild-Type Control
P4 & P7
ΔNpF
4131
P4
and
P7
1Kb DNA Ladder
~2712 bp
~3585 bp
1500 bp
Figure 76. Colony PCR Gel Electrophoresis Image for ΔNpF4131 Secondary Recombinant Mutant
.
84
Change In Expression Relative to Time 0
NpR0438 – ArsR Family Transcriptional Regulator
NpR0438
3
2.5
2
1.5
1
0.5
0
0
1
2
3
Time (Days)
4
5
6
Figure 77. zwf DNA microarray expression data for gene NpR0438 showing relative expression to an uninduced zwf control. Time 0 is inferred.
According to the zwf microarray data, the expression pattern for NpR0438 indicates an
almost 3-fold up-regulated activity during akineses followed by a sharp decline to a level
half of it peak level (Fig. 77). NpR0438 resides as a 345 base pair open reading frame
within the genome. According to Cyanobase, NpR0438 expresses an ArsR family
transcriptional regulator (Fig. 79) and a protein-BLAST illustrates that it has homology to
the Arsenic Response Repressor; a homo-dimeric protein that represses the expression of
operons linked to stress- inducing concentrations of di- and multivalent heavy metal ions.
These proteins that contain a helix-turn-helix domain (Fig. 78), typically a winged helix
topology and it is the direct binding of inducing metal ions that allows for a change in the
regulatory function of the metal sensor protein allowing it to dissociate from DNA.
The STRING database shows homologs of NpR0438 to occur twice across the
Nostoc punctiforme genome both of which co-localize with other genes. NpR0438 colocalizes with NpR0439 an acetyl-CoA carboxylase, biotin carboxyl carrier protein and
NpR0440, a translation elongation factor P. The other homolog, NpF6484 co-localizes
with NpF6485, an arsenical resistance protein and Npun_F6486, protein tyrosine
phosphatase. The association of NpR0438 with NpR0439 and NpR0440 is also found
co-localize in closely related filamentous cyanobacteria (Nostoc sp. PCC7120 or
Anabaena variabilis). Other homologs of NpR0438 are found to co-occur in distantly
related filamentous cyanobacteria as well, namely, Gloeobacter violaceus, Synechocystis
sp. 6803, and Microcystis aeruginosa.
RACE Mapping, followed by DNA sequencing identified two transcriptional start
sites (+1), one 44 bases upstream from the translation start site (ATG) and one in the
85
coding region, 3 bases downstream from the translational start site, indicated by the base
A and C, respectively (Fig. 81 and 82). Using the transcriptional start sites to identify the
promoter region, no consensus sigma-70 -10 region (TATAAT) was detected upstream
from the transcriptional start site, although an “TAAT” motif was conserved between the
two putative promoters, but spaced 9 or 10 bases from the transcriptional start site. No
Shine Dalgarno site was identified upstream from the start codon, although a G-C rich
region was present close to the translational start site rather than having a typical spacing
of ~7 nucleotides upstream from the ATG start codon.
Figure 78. Graphic mapping out putative conserved domains and location of the phosphorylation site, ATP
binding site and dimer interface found in the protein sequence. The graphic was created using the BLAST
program on NCBI.
Figure 79. The 10 kb chromosomal locus containing NpR0438. Taken from CyanoBase: The Genome
Database for Cyanobacteria.
86
NpR0438 Sequence
TCGCGTCAAATACCTGAAGGAAGGTATGGAAGCTGAAGTTATTAAGTGGGGCGATCAGGTGC
TGGGAGTAGAATTGCCTAAATCTGTGGTTCTGGAAATTGTACAAACAGATCCAGGTTTAAAAG
GTGACACTGCCACAGGTGGCTCAAAACCCGCAACTTTGGAAACTGGTGCAATTGTGATGGTTC
CTTTGTTTATTTCCCAAGGAGAACGCATCAAAGTTGATACCCAGGAAGATAAATATATCAGCA
GGGAATAACtttcatctctacggagacgcaagtcccgcttgaaatccctacatagggatttaatccctgccacacttaagatgctaatttacggttaggt
cgaggtaataaaaactgtgccattggactttaatgaaatccgccaactattggcaactatcgcacaaacagatattgcagaagtcacgctcaaaagcgatgat
tttgaactaacagtccgtaaggctgtgagcgtcagcaatcagatgttgtcggtaggtcaagcgaccttcggcggtgtggtaggttctggcctgacatcgggtt
catctgggggaaaccaggtgaacgcgagtcaggtaacggaggtgtccacatctcgcgtgtttgagaatactggtactagcacacaattgcagttgtcagtaa
atcctccctcaatcatcgatcagagattagtagaagtgccttccccaatggtgggaacgttttatcgcgctcctgcgcccggagaagcggcatttgtggaagtt
ggcgatcgcgtccgcaagggtcaaacagtctgtatcattgaagccatgaagctgatgaatgaaatcgaagccgaagtctctggacaggtgatggaaattctt
ctccaaaatggtgacgctgtagaatatggtcaacctttgatgcgaattaaccctgattaagtattaatctatatatcaaatgagtcatctA+1aaatgagtcatcgt
taaaacttcagtccttgcgggttaatcctgATGAAAC+1AAACGTTGCCTTTACCGCCAGAAGTGGTGCAACAAGT
AGCTGAATACTTCAGCCTGTTAAGTGAGCCGATGCGCTTGCGGCTGCTCCACTTATTACGGGA
TGAAGAAAAATGCGTGCAAGAGTTGGTAGAGGCAACACAGACTTCTCAGGCAAATGTGTCAA
AACACCTGAAGGTAATG
Figure 80. Nucleotide sequence of NpF2889, with highlighted annotated (putative) regions of interest; ATG
in blue, transcription start sites “+1” in red, and a partial core sequence of the Pribnow box (-10 box) in
green. Upstream gene NpR4130 is denoted by capital letters and the intergenic region is denoted in lower
case letters.
Figure 81. NpR0438 RACE sequencing electropherogram. Highlighted sequence identified DT89 adjacent
to the transcriptional start site (+1) “A”. Result was identified from RNA isolated 3 days after fructosegrown wild type strain of N. punctiforme were switched to darkness.
Figure 82. NpR0438 RACE sequencing electropherogram. Highlighted sequence identified DT89 adjacent
to the transcriptional start site (+1) “C”. Result was identified from RNA isolated 3 days after fructosegrown wild type strain of N. punctiforme were switched to darkness.
87
Observations of the transcriptional reporter for NpR0438 under epifluorescence
microscopy after phosphate deprivation are shown below from figure 83 to figure 90. The
images indicate initial uniform GFP fluorescence throughout filaments initially that was
higher than that observed in the negative control strain. The 213 raw fluorescence value
of the time 0 spots from the time-course array for this gene indicates low expression that
is reflected in the low level GFP fluorescence observed. Later during akinete induction,
GFP fluorescence was not specific to proto- or mature akinetes. A few cell within the
filaments demonstrated high GFP fluorescence in comparison to surrounding cells,
however these cells under bright field showed abnormal morphologies not descriptive to
any cell type specific to N. punctiforme, and were not viewed as indicators for akinete
expression.
Expression in heterocysts was virtually absent relative to that observed in
vegetative cells. Similar to the transient expression pattern shown in the zwf microarray
data, the intensity of fluorescence increased to its peak level after the initiation of
akinesis and then dropped to low levels after akinete formation. The highest GFP
emission was observed on day 12 and found throughout the filament. Akinetes on day 26
(Fig.89) and day 36 (Fig. 90) shows GFP fluorescence with relatively higher intensity on
day 26.
88
A
Figure 83. NpR0438 transcriptional reporter
strain during akinete induction: Day 0
Hollow arrows indicate heterocysts. (A)
Brightfield micrograph, (B) epifluorescence
micrograph showing autofluorescence, (C)
epifluorescence micrograph showing GFP
fluorescence. All images were visualized using
a 100X objective.
B
C
89
A
Figure 84. NpR0438 transcriptional reporter
strain during akinete induction: Day 3
Hallow arrows indicate heterocysts. (A)
Brightfield micrograph, (B) epifluorescence
micrograph showing autofluorescence, (C)
epifluorescence micrograph showing GFP
fluorescence. All images were visualized
using a 100X objective.
B
C
90
A
Figure 85. NpR0438 transcriptional reporter
strain during akinete induction: Day 7
Hallow arrows indicate heterocysts. (A)
Brightfield micrograph, (B) epifluorescence
micrograph showing autofluorescence, (C)
epifluorescence micrograph showing GFP
fluorescence. All images were visualized
using a 100X objective.
B
C
91
A
Figure 86. NpR0438 transcriptional reporter
strain during akinete induction: Day 10
Hallow arrows indicate heterocysts. (A)
Brightfield micrograph, (B) epifluorescence
micrograph showing autofluorescence, (C)
epifluorescence micrograph showing GFP
fluorescence. All images were visualized
using a 100X objective.
B
C
92
A
Figure 87. NpR0438 transcriptional reporter
strain during akinete induction: Day 12
Hallow arrows indicate heterocysts. (A)
Brightfield micrograph, (B) epifluorescence
micrograph showing autofluorescence, (C)
epifluorescence micrograph showing GFP
fluorescence. All images were visualized
using a 100X objective.
B
C
93
A
Figure 88. NpR0438 transcriptional reporter
strain during akinete induction: Day 17
Hallow arrows indicate heterocysts. (A)
Brightfield micrograph, (B) epifluorescence
micrograph showing autofluorescence, (C)
epifluorescence micrograph showing GFP
fluorescence. All images were visualized
using a 100X objective.
B
C
94
A
Figure 89.
NpR0438 transcriptional
reporter strain during akinete induction:
Day 26
Hallow arrows indicate heterocysts. Filled
arrows indicate akinetes. (A) Brightfield
micrograph,
(B)
epifluorescence
micrograph showing autofluorescence, (C)
epifluorescence micrograph showing GFP
fluorescence. All images were visualized
using a 100X objective.
B
C
95
A
Figure 90. NpR0438 transcriptional reporter
strain during akinete induction: Day 36
Hallow arrows indicate heterocysts. Filled
arrows indicate akinetes.
(A) Brightfield
micrograph, (B) epifluorescence micrograph
showing
autofluorescence,
(C)
epifluorescence micrograph showing GFP
fluorescence. All images were visualized
using a 100X objective.
B
C
96
NpR1110 – Histidine Kinase Hypothetical Protein
NpR1110
Change In Expression Relative to Time 0
2.5
2
1.5
1
0.5
0
0
1
2
3
Time (Days)
4
5
6
Figure 91. zwf DNA microarray expression data for gene NpR1110 showing relative expression to an uninduced zwf control. Time 0 is inferred.
According to the DNA microarray data, the expression pattern for NpR1110
implicates a spike in upregulation at day 1 following induction and then a gradual decline
during akinesis in the zwf strain (Fig. 91). NpR1110 resides as a 1,122 base open reading
frame within the genome separated by only 54 bases from the downstream gene,
NpR1109. According to Cyanobase, NpR1110 encodes a histidine kinase (Fig. 93) and a
protein-BLAST illustrates that it has shared conserved domains common among histidine
kinases, which includes an ATP binding sites (Fig. 92). Motifs in the N-terminal end
typically associated with sensing were not identified. The downstream gene, NpR1109,
encodes for a 2-component LuxR family transcriptional regulator and due its close
spacing, indicates a potential operonic architecture with NpR1110.
The downstream location of a LuxR family transcriptional regulator is conserved
only in one closely related cyanobacterium, Anabaena variabilis, and one distantly
related cyanobacterium, Acarycholris marina - giving weak evidence that the NpR1109
and NpR1110 proteins may interact in a 2-component pathway.
Race mapping, followed by DNA sequencing identified the transcriptional start
site (+1) 99 bases upstream of the translational start codon (ATG), indicated by the base
A (Fig. 94 and 95). Using the location of the transcriptional start site, further analysis of
the intergenic region elucidated the potential 10- sequence tattaat, however it is spaced ~3
nucleotides further upstream from the typical -10 region. The NpR1110 ORF is preceded
by a potential Shine Dalgarno sequence AGCGAG spaced 7 nucleotides upstream of the
ATG start codon.
97
Figure 92. Graphic map of putative conserved domains and location of the ATP binding site found in the
protein sequence. The graphic was created using the BLAST program on NCBI.
Figure 93. The 10 kb chromosomal locus containing NpR1110. Taken from CyanoBase: The Genome
Database for Cyanobacteria.
NpR1110 Sequence
gtggctcgaaggggattgtaactgtcaaatataaggctgaacgcaatggcacattgagagcgctccataaagagccaatttcaattggcggctctagggca
actgtcatgttcaaattaccatagccccgtaattcaggaaccaaaaactcctcttccaaggtgcgatggcgcaacagcacagccaacgcctcactgataaag
tgatgctcccctaaagctgttctatcccaggctgttaatagcagtgaaacatcaaaccaagcgggtgcccaatttacagtggcaggttgtagagcgcgtgtta
gcttgcgttcaacttgcctaccagaatgttgtacctgcttactctcacgtatatcaaaaatgtataaattgagagtcgggcctgctccctcttcccttcgattacca
ggatggctaaagtcaatttgctctgtactggtaagtgaggttcctccagctagaatttcggctaaagtttgaagaacgaagataagcatgaaggtgttctgctg
gtagctaatccagatgcatctacagtatatgtatcagccttctaaagttaattagacttttgtcgatattttttcaattggtcattggtcatttgtcatttgtcattgggta
ctggttattaattctttcccccctgctcccctgccccctgctccccatttgagtgggctggaagatattaaattttcaaaaatccgaaaagcagtaacttcagtttgt
agattagtctggagcagttcttaataggagtggcgagatgaccacaccacaaaatttatttcgatgtaacaaataattttccttacgtacctatatatacttagaaa
aaggataagcatatataaacataaacttaataattctttgtattaattatctaacaA+1gataacttaataaaaaaataaacattactaagactgcataaatttatact
ggtcagcagaagaataaaaacatttggttgcaaaaagcgagtgaagctATG
Figure 94. Nucleotide sequence of NpR1110, with highlighted annotated (putative) regions of interest;
Shine-Delgarno in pink, ATG in blue, Pribnow box in green, and transcription start site “+1” in red.
Upstream gene NpR1110 is not included in the sequence and the intergenic region is denoted in lower case
letters.
98
Figure 95. NpR1110 RACE sequencing electropherogram. Highlighted sequence identified DT89 adjacent
to the transcriptional start site (+1) “A”. Result was identified from RNA isolated 3 days after fructosegrown wild type strain of N. punctiforme were switched to darkness.
Observations of the transcriptional reporter for NpR1110 under epifluorescence
microscopy after phosphate deprivation are shown below from figure 96 to figure 101.
The images indicate initial GFP fluorescence prior to the formation of akinetes is not
discriminatory to any cell type, although heterocysts only show low GFP fluorescence up
until day 3 (Fig. 97), and then diminishes thereafter. On a global perspective, the images
do not indicate any localization of transcriptional until about day 13 (Fig. 99) whereupon
neighboring cells to a heterocyst show very little intensity, and the mid-filament portion
between two heterocysts has the highest concentration of transcriptional activity. From
day 0 onwards the intensity of GFP increases, peaking between day 13 and 17 (Fig. 100)
and then dropping at day 23. Although the peak of the transcriptional levels of the zwf
microarray data and transcriptional reporters are dissimilar (one is a fast developing
model system whereas the wild-type system typically takes two weeks before akinetes are
observed), they both suggest an eventual decline towards the end of akinete development.
From a general standpoint these various level of GFP fluorescence are higher in
comparison to the negative control studies, with the exception of day 23 (Fig. 101) where
the intensity levels appear to match the negative control. The average raw fluorescence
of this gene in the time 0 time-course microarray was 53, indicating low basal
transcription of this gene. This correlates with the low level of GFP fluorescence seen in
the early time points in the GFP reporter strain.
99
A
Figure 96.
NpR1110 transcriptional
reporter strain during akinete induction:
Day 0
Hollow arrows indicate heterocysts. (A)
Brightfield micrograph, (B) epifluorescence
micrograph showing autofluorescence, (C)
epifluorescence micrograph showing GFP
fluorescence. All images were visualized
using a 100X objective.
B
C
100
A
Figure 97. NpR1110 transcriptional reporter
strain during akinete induction: Day 3
Hallow arrows indicate heterocysts. (A)
Brightfield micrograph, (B) epifluorescence
micrograph showing autofluorescence, (C)
epifluorescence micrograph showing GFP
fluorescence. All images were visualized
using a 100X objective.
B
C
101
A
Figure 98.
NpR1110 transcriptional
reporter strain during akinete induction:
Day 6
Hallow arrows indicate heterocysts. (A)
Brightfield micrograph, (B) epifluorescence
micrograph showing autofluorescence, (C)
epifluorescence micrograph showing GFP
fluorescence. All images were visualized
using a 100X objective.
B
C
102
A
Figure 99. NpR1110 transcriptional reporter
strain during akinete induction: Day 13
Hallow arrows indicate heterocysts. (A)
Brightfield micrograph, (B) epifluorescence
micrograph showing autofluorescence, (C)
epifluorescence micrograph showing GFP
fluorescence. All images were visualized
using a 100X objective.
B
C
103
A
Figure 100.
NpR1110 transcriptional
reporter strain during akinete induction:
Day 17
Hallow arrows indicate heterocysts. (A)
Brightfield micrograph, (B) epifluorescence
micrograph showing autofluorescence, (C)
epifluorescence micrograph showing GFP
fluorescence. All images were visualized
using a 100X objective.
B
C
104
A
Figure 101.
NpR1110 transcriptional
reporter strain during akinete induction:
Day 23
Hallow arrows indicate heterocysts. Filled
arrows indicate akinetes. (A) Brightfield
micrograph,
(B)
epifluorescence
micrograph showing autofluorescence, (C)
epifluorescence micrograph showing GFP
fluorescence. All images were visualized
using a 100X objective.
B
Not Available
C
105
NpR1449 – Response Regulator Receiver Sensor Signal Transduction Histidine
Change In Expression Relative to Time 0
NpR1449
2.5
2
1.5
1
0.5
0
0
1
2
3
Time (Days)
4
5
6
Figure 102. zwf DNA microarray expression data for gene NpR1449 showing relative expression to an uninduced zwf control. Time 0 is inferred.
According to the DNA microarray data, the expression pattern for NpR1449
implicates up-regulation during akinesis in the zwf strain (Fig. 102). NpR1449, a
Response Regulator Receiver Sensor Signal Transduction Histidine resides as a 1332
base open reading frame within the genome, upstream of NpR1448, another response
regulator receiver sensor signal transduction histidine kinase (Fig. 104). According to a
protein-BLAST, NpR1449 shares homology to histidine kinases, which include
phosphorylation sites, ATP binding sites and a dimer interface (Fig. 103).
According to the STRING Database, multiple homologs of NpR1449 are found
across the genome of Nostoc punctiforme but also across the genomes of closely and
distantly related filamentous cyanobacteria. Closely related cyanobacteria include Nostoc
sp. PCC7120 and Anabaena variabilis. Distantly related filamentous cyanobacteria
include Cyanothece sp. 51142, Thermosynechococcus elongates, Microcystis aeruginosa,
Synechocystis sp. 6803, Prochlorococcus marinus MIT9313, Acarychloris marina,
Trichodesmim erythraeum IM101, and Gloebacter violaceus. All of the homologs of
NpR1449 co-localize with one or two other proteins, which may or may not be fused with
those associated proteins. The multiple finding of NpR1449 homologs shows at the very
least a universal application for the protein function as a response regulator receiver
sensor signal transduction histidine kinase in cyanobacteria.
Race mapping, followed by DNA sequencing identified the transcriptional start
site (+1) 96 bases upstream of the translational start codon (ATG), indicated by the base
A and hence the leader sequence; see figures 105 and 106. Using the location of the
transcriptional start site, further analysis of the intergenic region identified the last three
106
bases of a consensus sigma70 -10 sequence (~TATAAT) spaced ~3 bp upstream from the
normal spacing. A putative -35 region was not observed. A potential Shine-Dalgarno
sequence (AGCAGG) starting 7 bases from the translational start site that closely
matched the consensus (AGGAGG) was also observed. (Fig. 105).
Figure 103. Graphic map of putative conserved domains and location of the phosphorylation site, ATP
binding site and dimer interface found in the protein sequence. The graphic was created using the BLAST
program on NCBI.
Figure 104. The 10 kb chromosomal locus containing NpR1449. Taken from CyanoBase: The Genome
Database for Cyanobacteria.
NpR1449 Sequence
TTAATGCCAAAAGGCTTAGAAGGGCTTGGTATTCTTCCTAAAGTTTGCCAGGAGGTCTTGGTA
ATTTTCCAAACTGTGAAAGTTTGCGATTGTTAAgaaaattgttgaaattctagaaggtaggaatacttgtgttcacaaataggt
ataggaagtactttcttatttacctggtctaaccaaatcaatggttaaaactgctcaagcttatggtacaggataatgttatgcaactctcaccaatggctgacga
cggtcacttgatcgctcatttacaattggtttaagcttagtaaagtattttattttactttatatcagttctgtctgttgtgtctagagcagtaggtttcgattttttaattgc
tagttttttgaaagccattggtagtttgctagaagtttaatttcaatagtctgtcaaattaatcatattaaggatacaacagactaaatttaatgcaagtaaatgccat
aaagactgattaacacactactagtggaggacaacgaagttgatttgatgaatgtcttacaggcattaaagaaagttaatattattgaccgtattcaccttactag
ttatgggctacaggcactaataatgttgtgtggcaatgacagacagcctccgaaagttactgccgagtaacatttgcttttcctagatttgaatatgccaaaggt
aagtggcagcgaattatcccaataattagctttaagagcaactcctgtaattgtaatgataacctcaaatcaagatcgacaccgagtgaaagctgacagcttaa
atctagccggatatatcctcaagcctttcaccttgcctaatgtcaagatgacggcaacgctaaacaagtattggatattatgctaaatgccttagtcaatcaagtt
acagattttagatgcccgaaaatcttatattttttttaattggataatctcaaaagagaaatgttatacatcA+1ACCTATGTTTGGCGGCAAAA
ATAAAAAACGATGGAAGAGACGCTGAAAATTTTGGTTGTAGAAAATGACGAAGTAGACAGGA
TGGTAGTCCGTCAAGCCCTGACGATAGCAGGTATTCAGATG
Figure 105. Nucleotide sequence of NpR1449, with highlighted annotated (putative) regions of interest;
Shine-Delgarno in pink, ATG in blue, the transcription start site “+1” in red, Pribnow box in green, and -35
box region in yellow. Upstream gene NpR1452 is denoted by capital letters and the intergenic region is
denoted in lower case letters.
107
Figure 106. NpR1449 RACE sequencing electropherogram. Highlighted sequence identified DT89 adjacent
to the transcriptional start site (+1) “A”. Result was identified from RNA isolated 3 days after fructosegrown wild type strain of N. punctiforme were switched to darkness.
Observations of the transcriptional reporter for NpR1449 under epifluorescence
microscopy after phosphate deprivation are shown below from figure 107 to figure 112.
Throughout the induction period, the GFP fluorescence intensity was at relatively low
level, but markedly higher than the negative control. As akinete induction progressed so
did GFP intensity with the exception of day 6 (Fig. 109) were the intensity dipped to
close to null, but continued to increase as is apparent from day 13 (Figures 110 – 112)
onwards. The same fluctuating pattern was exhibited with the microarray data (Fig. 102).
The raw fluorescence value of 192 for the time-zero DNA microarray spots for this gene
indicates a low level of basal transcription that is reflected in the low GFP fluorescence
observed in the reporter strain.
The images indicate GFP fluorescence is not specific to proto- or mature akinetes,
and is instead induced in heterocysts. Strong fluorescence was only observed in relatively
young (day 0 and 1; Fig 107 and 108, respectively) heterocysts that had been induced 48
hours prior to removal of phosphate for the akinete induction. During phosphate
starvation growth does not occur and new heterocysts do not form. As the existing
heterocysts age, they slowly lost fluorescence after day 0 and 1 until they completely lost
expression at day 20 (Fig. 111).
108
A
Figure 107.
NpR1449 transcriptional
reporter strain during akinete induction:
Day 0
Hollow arrows indicate heterocysts. (A)
Brightfield micrograph, (B) epifluorescence
micrograph showing autofluorescence, (C)
epifluorescence micrograph showing GFP
fluorescence. All images were visualized
using a 100X objective.
B
C
109
A
Figure 108.
NpR1449 transcriptional
reporter strain during akinete induction: Day
1
Hallow arrows indicate heterocysts. (A)
Brightfield micrograph, (B) epifluorescence
micrograph showing autofluorescence, (C)
epifluorescence micrograph showing GFP
fluorescence. All images were visualized
using a 100X objective.
B
C
110
A
Figure 109.
NpR1449 transcriptional
reporter strain during akinete induction:
Day 6
Hallow arrows indicate heterocysts. (A)
Brightfield micrograph, (B) epifluorescence
micrograph showing autofluorescence, (C)
epifluorescence micrograph showing GFP
fluorescence. All images were visualized
using a 100X objective.
B
C
111
A
Figure 110.
NpR1449 transcriptional
reporter strain during akinete induction: Day
13
Hallow arrows indicate heterocysts. (A)
Brightfield micrograph, (B) epifluorescence
micrograph showing autofluorescence, (C)
epifluorescence micrograph showing GFP
fluorescence. All images were visualized
using a 100X objective.
B
C
112
A
Figure 111.
NpR1449 transcriptional
reporter strain during akinete induction: Day
20
Hallow arrows indicate heterocysts. (A)
Brightfield micrograph, (B) epifluorescence
micrograph showing autofluorescence, (C)
epifluorescence micrograph showing GFP
fluorescence. All images were visualized
using a 100X objective.
B
C
113
A
Figure 112.
NpR1449 transcriptional
reporter strain during akinete induction: Day
23
Hallow arrows indicate heterocysts. Filled
arrows indicate akinetes.
(A) Brightfield
micrograph, (B) epifluorescence micrograph
showing
autofluorescence,
(C)
epifluorescence micrograph showing GFP
fluorescence. All images were visualized
using a 100X objective.
B
C
114
NpF3538 – Multi Sensor Hybrid Histidine Kinase
Change In Expression Relative to Time 0
NpR3548
2.5
2
1.5
1
0.5
0
0
1
2
3
Time (Days)
4
5
6
Figure 113. zwf DNA microarray expression data for gene NpR3548 showing relative expression to an uninduced zwf control. Time 0 is inferred.
According to the time course DNA microarray data, the expression pattern for
NpR3548 indicates an initial spike in upregulation and then a plateau during akinesis in
the zwf strain (Fig. 113). NpR3548 resides as a 4398 base pair open reading frame within
the genome that encodes a putative multi-sensor histidine kinase protein. A proteinBLAST illustrates shared conserved domains that are common to histidine kinases, which
include phosphorylation sites, ATP binding sites and a dimer interface (Fig. 114).
NpR3548 is transcribed in parallel with a upstream hypothetical protein (Fig. 115)
overlapped by 2 base pairs (Fig. 116), and is convergently transcribed with a downstream
gene involved in photosynthesis (Fig. 115).
According to the STRING database NpF3548 does not co-localize with any
known interacting protein in Nostoc punctiforme. Only one NpR3548 ortholog that is
described as a Multi Sensor Hybrid Histidine Kinase is found in a closely related
cyanobacterium, Anabaena variabilis.
RACE mapping, followed by DNA sequencing identified the transcriptional start
site (+1) 271 bases upstream of the translational start codon (ATG), indicated by the base
A (Fig. 116 and 117). Based upon the location of the transcriptional start site, a typical
cyanobacterial -10 sequence TAnnnT was not observed (Fig. 116), however, a -35 box
sequence (~TTGACA) found 43 bases upstream from the transcriptional start site. A
potential Shine-Dalgarno sequence (AGAGAA) found 12 bases before the translational
start site was also identified.
115
Figure 114. Graphic map of putative conserved domains within NpR3548 showing location of the
phosphorylation site, ATP binding site and dimer interface found in the protein sequence. The graphic was
created using the BLAST program on NCBI.
Figure 115. The 10 kb chromosomal locus containing NpR3548. Taken from CyanoBase: The Genome
Database for Cyanobacteria.
NpR3548 Sequence
ATGGAACGTGGTCTTTTGTGGTTGCCGCTATTAGTAATGTTTTTCTGGTTGGCTTGGCAAGGCTC
GAAGGAGTATCAAAAAGTTGAAGCCTATCGCGCTTGGGCAGAACAGTTTGAACGGGCTAAGTA
CGATATTTATGCTGTATTAGGTCAAAAAGACAATAATTTGACTTGGGGAAAACCCACGCCTCA
AGGACCTATTAAGCTAGAAACATTCTCTTTGCTTGATATTAAGCAAATTAACTTTCTAGTAGAT
GAGAAATCAGTAGATTTTGATAATATACCGCAGAAAGGTCGTTCTATAGAGCTAGAATTTCTCT
TTTCCGAATCTAATAAATCGGTGCGTGTTCCATTTACCGAAATCCCTTTGGCGGCAGAATGGGG
TAAGTTTTTGCAAGGGCTATTACAAGACTTGCGAACAGAATCAAACAAGTA+1gttatattgaagctacaag
ttctcgattatacggctgtttacgatcggaaagttagatcgggtaaacgacatagcctgcaattctgaaatcctcacaaaggtggttttttgcattattaattcttact
ctaaattgttcaataaaaaatatgcttctgggtagatgaaaagtaagtcaaggggtagcataaaatacaaaggcatagatgattaaaccgtaaggaatacggca
ctttactacgctagatagatgcggttagagaacaccaaATG
Figure 116. Nucleotide sequence of NpR3548, with highlighted annotated (putative) regions of interest;
putative Shine-Delgarno in pink, ATG start codon in blue, the transcription start site “+1” in red, and
potential -35 region in yellow. Upstream gene NpR3549 is denoted by capital letters and the intergenic
region is denoted in lower case letters. The overlapping sequence between NpR3549 and NpR3548 is
underlined.
116
Figure 117. NpR3548 RACE sequencing electropherogram. Highlighted sequence identified DT89 adjacent
to the transcriptional start site (+1) “A”. Result was identified from RNA isolated 3 days after a fructosegrown wild type strain of N. punctiforme was switched to darkness.
Observations of the transcriptional reporter for NpR3548 under epifluorescence
microscopy after phosphate deprivation are shown below from figure 118 to figure 123.
The images indicate GFP fluorescence expressed in proto-akinetes, with even stronger
expression in mature akinetes. However the GFP expression time course study illuminates
a slow pick up in GFP emission for the first 13 days based on the low GFP intensity
observed. The average raw fluorescence of this gene in the time 0 time-course microarray
was 84, indicating low basal transcription of this gene, correlating with the low level of
GFP fluorescence seen in the early time points in the GFP reporter strain.
By about day 20 (Fig. 122), the intensity levels increase specifically around cells
that show a disjointed structure (the area of akinesis), proto-akinetes and akinetes
themselves. Based on visual evidence, the mature akinetes showed the highest level of
GFP intensity, in particular day 23 (Fig. 123). In comparison to the negative control
lacking a promoter, day 23 intensity levels were significantly higher. No GFP
fluorescence was observed in heterocysts.
117
A
Figure 118.
NpR3548 transcriptional
reporter strain during akinete induction:
Day 0
Hollow arrows indicate heterocysts. (A)
Brightfield micrograph, (B) epifluorescence
micrograph showing autofluorescence, (C)
epifluorescence micrograph showing GFP
fluorescence. All images were visualized
using a 100X objective.
B
C
118
A
Figure 119.
NpR3548 transcriptional
reporter strain during akinete induction:
Day 1
Hallow arrows indicate heterocysts. (A)
Brightfield micrograph, (B) epifluorescence
micrograph showing autofluorescence, (C)
epifluorescence micrograph showing GFP
fluorescence. All images were visualized
using a 100X objective.
B
C
119
A
Figure 120.
NpR3548 transcriptional
reporter strain during akinete induction:
Day 6
Hallow arrows indicate heterocysts. (A)
Brightfield micrograph, (B) epifluorescence
micrograph showing autofluorescence, (C)
epifluorescence micrograph showing GFP
fluorescence. All images were visualized
using a 100X objective.
B
C
120
A
Figure 121.
NpR3548 transcriptional
reporter strain during akinete induction:
Day 13
Hallow arrows indicate heterocysts. (A)
Brightfield micrograph, (B) epifluorescence
micrograph showing autofluorescence, (C)
epifluorescence micrograph showing GFP
fluorescence. All images were visualized
using a 100X objective.
B
C
121
A
Figure 122.
NpR3548 transcriptional
reporter strain during akinete induction:
Day 20
Hallow arrows indicate heterocysts. (A)
Brightfield micrograph, (B) epifluorescence
micrograph showing autofluorescence, (C)
epifluorescence micrograph showing GFP
fluorescence. All images were visualized
using a 100X objective.
B
C
122
A
Figure 123.
NpR3548 transcriptional
reporter strain during akinete induction:
Day 23
Hallow arrows indicate heterocysts. Filled
arrows indicate akinetes.
(A) Brightfield
micrograph,
(B)
epifluorescence
micrograph showing autofluorescence, (C)
epifluorescence micrograph showing GFP
fluorescence. All images were visualized
using a 100X objective.
B
C
123
NpR5425 – RNA-Binding S1 Domain-Containing Protein
Change In Expression Relative to Time
0
NpR5425
2
1.5
1
0.5
0
0
1
2
3
Time (Days)
4
5
6
Figure 124. zwf DNA microarray expression data for gene NpR5425 showing relative expression to an uninduced zwf control. Time 0 is inferred. Thin black line indicates general trend of the data.
According to the time-course DNA microarray data, the expression pattern for
NpR5425 indicates up-regulation during akinesis in the zwf strain that peaks at day 4
following induction (Fig. 124). NpR5425 resides as a 2157 base pair open reading frame
within the genome. The NpR5425 gene is divergently transcribed from an upstream
hypothetical protein and transcribed in parallel with the downstream gene encoding for
ferridoxin (Fig. 126)
Since NpR5425 is a member of a transcriptional accessory proteins, STRING was
used in an attempt to find potential interacting partners. NpR5425 was found to colocalize in the genome with a ferredoxin gene (NpR5424) found in closely related
filamentous cyanobacteria, Nostoc PCC 7120 and Anabaena viriablis. In addition it was
also found to co-localize and co-occur in more distantly related cyanobacteria,
Acaryochloris and Thermosynechococcus.
The protein-BLAST (Fig.125) indicates that it does not share conserved domains
that belong to response regulators or two component regulatory systems like many
included in this study, but instead has homology to a YqgFc domain that likely acts as a
ribonuclease with an Rnase H fold, and both the TexN C-terminus domain and S1 RNAbinding N-terminal domains both which are commonly found in members of the Tex a
family of prokaryotic transcriptional accessory proteins (NCBI). YqgFc proteins are
likely to function as an alternative to RuvC in most bacteria, and could be the principal
holliday junction resolvases in low-GC Gram-positive bacteria (NCBI). Very similar to
the structure of cold shock protein (CSP), the S1 domain implies to be derived from an
ancient nucleic acid-binding protein (Bycroft et al. 1997). Bordetella pertussis, a Tex
124
carrier, has been observed using CSP, hinting at the disparate nature of each protein the
domain manifests itself in (Stubs et al. 2005). A number of unrelated proteins with an S1
domain have displayed a common interaction with nucleic acids (Stickney et al. 2005). It
has been suggested that these proteins with S1 domains melt different nucleic acid
secondary structures; in particular, removing secondary structure elements in mRNA
transcripts ready for translation (Draper et al. 1977). Whatever the function maybe for
each protein with an S1 RNA-binding domain, like ribosomes, these domains show
consistent homology throughout different species, emphasizing that their existence is
anything but trivial (Draper et al. 1977).
Figure 125. Graphic mapping out putative conserved domains and location of the phosphorylation site,
ATP binding site and dimer interface found in the protein sequence. The graphic was created using the
BLAST program on NCBI
Figure 126. The 10 kb chromosomal locus containing NpR5425. Taken from CyanoBase: The Genome
Database for Cyanobacteria.
RACE mapping efforts were inconclusive in identifying the location of the
transcriptional start site. As an alternative, the -10 region (TAAAGTA) was identified in
the intergenic sequence of the NpR5425 ortholog alr5429 from Anabaena PCC 7120 (Fig.
127) using published deep sequencing of the Anabaena 7120 transcriptome (Mitschke et
al. 2011). Following alignment with the in the intergenic sequence upstream from
NpR5425 (Fig. 127), a similar -10 sequence was identified (TAAATTA). The
transcriptional start site for NpR5425 was thereby inferred to be 83 bases from the
translational start site with the base “A” used as the transcriptional start.
125
NpR5425
alr5249
NpR5425
alr5249
TGGAATAATTATTGCGACAGATGAAGCAACCAAAAGCTTGGCGAATAACTCTTCCATTTG
-------------GAGGGGAACCAAAAAAACATGGGCATTTTTACTTACCTTCCCACAT*.*. ..* **..**.**:..**:*
*.*:** * *** :*
TGGTAGATACTGCGTGTAACAACAAGCTTTCAAAGTGGGGGTATAAGGCACTATGTGTAA
------------------------------------------------------------
NpR5425
alr5249
CAAGATTAAAGTATATGCTTATACGGATATCACAGTGATACTTGTTCTAATGCTCTCCCG
--------AAATGTAAACTTTTACT-AAAGCGAAGTGAGAGCTATTTTTGT--------A
**.*.**:.***:*** *:* *..***** * *.** *:.*
.
NpR5425
alr5249
ACTCAGGATAGCTGCGCTATGCTATACAAACTCTCCTTCATCTACGCGGATTAATAGGGT
TATCGGG-------------------TAATCTCTTATTTTAGCAAGCGGAGTTACAGTAT
:.**.**
**:**** .** :: *.***** *:* ** .*
NpR5425
alr5249
TCAAAACTTACTTGCGTAGGTGGGTTTTGTCTACTTCGCTTGTACTCTTGTGAGCAATCA
TCTACTTAAAATTAC------------------CGTATTTTTCTCAATGTTACGTAATCA
**:*.: ::*.**.*
* *. ** :*:.* *..* *****
NpR5425
alr5249
TCTGGTAAATTAGCTTAAAACTTTGGCTTTGCGCCAGGATAAGGATCTAGCATACTACCT
TTTGGTAAAGTAACTTAATACTTGCCGCTAATGCTAGAACAAGCATCTAGCATAGTACCT
* ******* **.*****:****
*:. ** **.* *** ********** *****
NpR5425
alr5249
TTAGAAGTAGCATTTTCATTTTTTTCATTTTAGACACCTA
TTATTCATAG-------ATATCTGACATTAATTACCCA-*** :..***
**:* * :****::: **.*.
Figure 127. Sequence alignment between the upstream intergenic regions of NpR5425 and alr5249. Sigma
factor binding for alr5429 is highlighted in green (Mitschke et al. 2011).
NpR5425 Sequence
aaaaaacaaagtttaccattattaagaaataatacagtctcaagaagcggtcaaaattatacacacacctaagaatttcctatcaacaagttaccaacttttgttttt
aaggacattactgggttagctgtcttatgatttttagctgtttaaagttgagaaaaaaatagtttgtcgtggttgatattatttaatttctctaggttgttttcctgtggttt
cagtttgtttgaactcatttttctgcaaaagtctgttcgtaatgattaagacagtgattaacaatccaaattgaatctgccagggtgccaatactaaacttaaaatca
agctaatagctgcaaatacacctgcaagatatgcaatttcatcattactctttttaaataagtagcccgtgactaaagcagtacatagtggtatcaagaaaaaca
aaggcatcttagcaaacctctgaacgaaaagttattgtgcttaataaaacaaattgttttggtaattgtggtcaattttacatccaataagcttttaggcacaacagt
cgaatgaaataaatattatagaaaatcaagattacgcaagattgtatcttacaccaattggaataattattgcgacagatgaagcaaccaaaagcttggcgaat
aactcttccatttgtggtagatactgcgtgtaacaacaagctttcaaagtgggggtataaggcactatgtgtaacaagattaaagtatatgcttatacggatatca
cagtgatacttgttctaatgctctcccgactcaggatagctgcgctatgctatacaaactctccttcatctacgcggattaatagggttcaaaacttacttgcgtag
gtgggttttgtctacttcgcttgtactcttgtgagcaatcatctggtaaattagcttaA+1aactttggctttgcgccaggataaggatctagcatactacctttaga
agtagcattttcatttttttcattttagacacctaatg
Figure 128. Nucleotide sequence upstream from NpR5425, with highlighted annotated (putative) regions of
interest; potential Shine-Delgarno in pink, ATG start codon in blue, the predicted transcription start site “+1”
in red, and the -10 sigma factor binding site in green. Upstream gene NpR5433 is not included in the
sequence and the intergenic region is denoted in lower case letters.
Observations of the transcriptional reporter for Npr5425 under epifluorescence
microscopy at various times after phosphate starvation are shown below from figure 129
to figure 134. The images indicate GFP fluorescence is expressed at low levels in
vegetative cells and not in heterocysts. Larger cells spaced midway between heterocysts
showed increased, but still low-levels of GFP expression (Fig. 133). Mature akinetes at
late time points, specifically day 22 (Fig. 134), did not show significant GFP fluorescent
intensity through visual observations. From a global perspective, GFP fluorescence is
emitted through out the filaments increased through time with its highest peak based on
subjective evidence on day 10 from which the level of intensity seemed to drop.
126
A
Figure 129.
NpR5425 transcriptional
reporter strain during akinete induction:
Day 0
Hollow arrows indicate heterocysts. (A)
Brightfield micrograph, (B) epifluorescence
micrograph showing autofluorescence, (C)
epifluorescence micrograph showing GFP
fluorescence. All images were visualized
using a 100X objective.
B
C
127
A
Figure 130.
NpR5425 transcriptional
reporter strain during akinete induction:
Day 3
Hallow arrows indicate heterocysts. (A)
Brightfield micrograph, (B) epifluorescence
micrograph showing autofluorescence, (C)
epifluorescence micrograph showing GFP
fluorescence. All images were visualized
using a 100X objective.
B
C
128
A
Figure 131.
NpR5425 transcriptional
reporter strain during akinete induction:
Day 7
Hallow arrows indicate heterocysts. (A)
Brightfield micrograph, (B) epifluorescence
micrograph showing autofluorescence, (C)
epifluorescence micrograph showing GFP
fluorescence. All images were visualized
using a 100X objective.
B
C
129
A
Figure 132.
NpR5425 transcriptional
reporter strain during akinete induction:
Day 14
Hallow arrows indicate heterocysts. (A)
Brightfield micrograph, (B) epifluorescence
micrograph showing autofluorescence, (C)
epifluorescence micrograph showing GFP
fluorescence. All images were visualized
using a 100X objective.
B
C
130
A
Figure 133.
NpR5425 transcriptional
reporter strain during akinete induction:
Day 20
Hallow arrows indicate heterocysts. (A)
Brightfield micrograph, (B) epifluorescence
micrograph showing autofluorescence, (C)
epifluorescence micrograph showing GFP
fluorescence. All images were visualized
using a 100X objective.
B
C
131
A
Figure 134.
NpR5425 transcriptional
reporter strain during akinete induction:
Day 22
Hallow arrows indicate heterocysts. (A)
Brightfield micrograph, (B) epifluorescence
micrograph showing autofluorescence, (C)
epifluorescence micrograph showing GFP
fluorescence. All images were visualized
using a 100X objective.
B
C
132
NpR6228 – Two Component Transcriptional Regulator
Change In Expression Relative to Time
0
NpR6228
2
1.5
1
0.5
0
0
1
2
3
Time (Days)
4
5
6
Figure 135. zwf DNA microarray expression data for gene NpR6228 showing relative expression to an uninduced zwf control. Time 0 is inferred.
According to the DNA microarray data, the expression pattern for NpR6228
implicates upregulation during akinesis in zwf strains (Fig. 135). NpR6228, a two
component transcriptional regulator, resides as a 708 base pair open reading frame within
the genome that sits upstream of NpR6227, an integral membrane sensor signal
transduction histidine kinase and downstream of NpR6229, a hypothetical protein. The
close proximity of all three genes may suggest they are all part of one operon. BLAST
analysis (Fig. 136) illustrates that NpR6228 shares conserved domains that belong to
response regulators, which include, phosphorylation sites and dimerization interfaces.
STRING analysis illustrates that co-localization of NpR2667, NpR6228 and
NpR6229 in closely related cyanobacteria, Nostoc sp PCC7120 suggesting a weak
evidence that they are interacting proteins although their putative function suggests a
combined relationship as a two-component regulatory system.
RACE mapping, followed by DNA sequencing identified the 4 possible
transcriptional start site (+1) 58, 104, 269, and 443 bases upstream of the translational
start codon (ATG), indicated by the base T, A, A and T, respectively; see figure 138 and
139. Also annotated are the putative Shine-Delgarno sequence, TATA box and Prinbrow
Box (Fig. 138).
133
Figure 136. Graphic mapping out putative conserved domains and location of the phosphorylation site, ATP binding
site and dimer interface found in the protein sequence. The graphic was created using the BLAST program on NCBI.
Figure 137. The 10 kb chromosomal locus containing NpR6228. Taken from CyanoBase: The
Genome Database for Cyanobacteria.
NpR6228 Sequence
AGCTTTACAACTGGGCATCGAAATTGACTACGTTAAATTGCTTTGTCATTTAACCAATGGTTCA
AGACTGTTGCGGGCTTTCTTTTATACTGGGGTTGATAACAGCAATGAAAAGCAACAGGGTTTT
CTGTTATGGATGCGTCGTAATGGCTATCGTGTAGTAGCTAAAGATATCATGCAACCAGCAGAA
AATTTCAAAAAATCAAATCTGAACGTAGAAATTGCTGTAGATATGAT+1ACTCTAGCTCCTTAT
TATGATACTGCGGTCTTAGTCAGTGGCGATGGAGACTTAGCTTATGCGGTGAACGCTGTCAGC
AGAATGGGAGTTCGGGTGGAAGTGGTGAGTCTACAAACTACTACTAGTGAAAGCTTGATTGA
TGTTGCTGACTGCTTCATTGACCTCGATAGTA+1TTAAAGCACACATTCAAAAAGATTCTAATCT
TGGCTATAGTTATCGCACACCGTCAAATTCAAACCTTTAATCCACTCTGGCGGAAGTTTATCTA
TTTTGTAACAAGGGGATTTTACCCCTTGTCTGCTCCCAGTTTTGTGATTAATTATTAAATATTTT
AA+1TAGTTGAAGATGAGCCAGAAATTGCTCATTTAATCCAATTATCT+1TTAGAAAAAGAAGG
ATTTTTTTGTCGCATCAGTCGTGATGGGATAAATGCTTTACGAATGTTTCAGGAGCAACCACCT
GATTTAATCATTCTAGATTTAATGATTCCTGGTTTGGATGGGTTGGAAGTTTGC
Figure 138. Nucleotide sequence of NpR6229, with highlighted annotated (putative) regions of interest;
transcription start site “+1” in red, ATG in blue, a Pribnow -10 box in green, and the -35 in yellow.
No Chromatogram
Figure 139. NpR6228 RACE Electropherogram. Highlighted sequence identified DT89 adjacent to the
transcriptional start site (+1) “G”.
134
Observations of the transcriptional reporter for NpR6228 under epifluorescence
microscopy are shown below from figure 140 to figure 148. The images indicate GFP
fluorescence is not specific to just proto- or mature akinetes but also found among
vegetative cells, with the exception of heterocysts. Through the time course, the intensity
of GFP fluorescence increases, and the highest level was observed visually at day 19 with
the appearance of the first akinete. The low intensity levels were comparable to negative
control studies. No localization of fluorescence of observed with sections of the filament.
From a general standpoint, the GFP fluorescence activity was relatively higher in
comparison to negative control studies only once the filament was close to developing
mature akinetes.
135
A
Figure 140. NpR6228 transcriptional
reporter strain during akinete induction:
Day 0
Hollow arrows indicate heterocysts. (A)
Brightfield micrograph, (B) epifluorescence
micrograph showing autofluorescence, (C)
epifluorescence micrograph showing GFP
fluorescence. All images were visualized
using a 100X objective.
B
C
136
A
Figure 141. NpR6228 transcriptional
reporter strain during akinete induction:
Day 3
Hallow arrows indicate heterocysts. (A)
Brightfield micrograph, (B) epifluorescence
micrograph showing autofluorescence, (C)
epifluorescence micrograph showing GFP
fluorescence. All images were visualized
using a 100X objective.
B
C
137
A
Figure 142. NpR6228 transcriptional
reporter strain during akinete induction:
Day 7
Hallow arrows indicate heterocysts. (A)
Brightfield micrograph, (B) epifluorescence
micrograph showing autofluorescence, (C)
epifluorescence micrograph showing GFP
fluorescence. All images were visualized
using a 100X objective.
B
C
138
A
Figure 143 NpR6228 transcriptional
reporter strain during akinete induction:
Day 10
Hallow arrows indicate heterocysts. (A)
Brightfield micrograph, (B) epifluorescence
micrograph showing autofluorescence, (C)
epifluorescence micrograph showing GFP
fluorescence. All images were visualized
using a 100X objective.
B
C
139
A
Figure 144. NpR6228 transcriptional
reporter strain during akinete induction:
Day 12
Hallow arrows indicate heterocysts. (A)
Brightfield micrograph, (B) epifluorescence
micrograph showing autofluorescence, (C)
epifluorescence micrograph showing GFP
fluorescence. All images were visualized
using a 100X objective.
B
C
140
A
Figure 145. NpR6228 transcriptional
reporter strain during akinete induction:
Day 15
Hallow arrows indicate heterocysts. (A)
Brightfield micrograph, (B) epifluorescence
micrograph showing autofluorescence, (C)
epifluorescence micrograph showing GFP
fluorescence. All images were visualized
using a 100X objective.
B
C
141
A
Figure 146. NpR6228 transcriptional
reporter strain during akinete induction:
Day 19
Hallow arrows indicate heterocysts. Filled
arrows indicate akinetes.
(A)
Brightfield micrograph, (B) epifluorescence
micrograph showing autofluorescence, (C)
epifluorescence micrograph showing GFP
fluorescence. All images were visualized
using a 100X objective.
B
Not Available
C
142
Discussion
NpF0020 – Multi Sensor Signal Transduction Histidine Kinase
Based on the initial zwf time-course microarray data it was hypothesized that
NpF0020 would show a significant degree of transcriptional activity during akinete
development (Figure 10). Expression relative to a time 0 control exhibited a positive
trend over the 6-day time course, with peak expression at day 1 and 6 following induction.
Previous work has shown that zwf akinetes start to mature around day 3 under these
conditions as indicated by increased resistance to lysozyme, desiccation, and cold
(Argueta and Summers, 2005). Using these parameters, the time-course expression data
indicates an overall increase in transcriptional activity, with increased expression both
early and late in akinete formation.
In comparison to a negative control, observations of the epifluorescence
microscopy results show moderate overall levels of GFP intensity compared to the
negative control. Fluorescent activity was found throughout the filaments, demonstrating
transcriptional activity of NpF0020 in vegetative cells. This correlates well with the
observed raw fluorescence of 666 at time zero in the DNA microarray data, characteristic
of low-to moderate basal expression. At time 0 (Figure 15), the culture is only deprived
of combined nitrogen, and GFP fluorescence indicates potential transcription may be due
to nitrogen deficiency, and may not be specific to just phosphate-poor adaptation.
Although the heterocysts demonstrated little to no fluorescence activity it cannot be
negated that the transcriptional response has no specificity within a vegetative cell in
poor combined nitrogen environments.
From day 1 (Figure 16) of akinete induction and onwards, fluctuations in GFP
intensity were visually observed along filaments, suggesting transcriptional activity
during akinete development. For each time point, the highest intensity or concentration of
cells emitting fluorescence was localized in an area of the filament midway between two
heterocysts (Fig. 15). The same pattern may be extrapolated from samples that only have
one heterocyst; for example, day 20 (Figure 19) shows a decreasing intensity of GFP
from the cells adjacent to the proto-akinete down to the closest heterocyst. This pattern
of localization suggests increased transcriptional activity to accommodate akinete
development in that region.
It is also possible that NpF0020 is involved in some sort of signaling pathway that
regulates cell functions not related to akinete development. The annotated designation
given to the NpF0020 protein is “Multi Sensor Signal Transduction Histidine Kinase”
which may insinuate that multiple stimulants, not limited to deficiency in phosphates or
compound nitrogen sources induces its stimulation, both which are environmental
stresses. Also its annotation as a “multi sensor” may provide insight as to why its so
highly up-regulated, provided that a certain quota of transcript and hence protein must be
maintained to detect multiple stimulants. Transcriptional activity continues even after the
development of the first mature akinete at day 20 (Figure 19) and based on all the GFP
expression data, indicating that NpF0020 maintains a level of transcription during akinete
development. Alternately proteases that normally degrade the GFP protein may be
absent in maturing akinetes.
143
The conservation of the two different variations in the operon sequence
(NpF0020/NpF0021 and NpF0020/NpF0021/NpF0022) demonstrate the importance of
NpF0020, in addition to the multiple paralogs found within the genome of Nostoc
punctiforme and in other filamentous cyanobacteria, demonstrates not only the
importance of NpF0020 but endorses its description as a “Multi-Sensor Signal
Transduction Histidine Kinase”. The references to homologs of NpF0020 in addition to
the GAF and PHY domains found (Figure 11), suggest that it may be involved in some
sort of adaptation function to ambient light environment. The akinete and heterocyst
studies of the GFP reporter strains included the presence of light during the procedure
and were never observed under dark conditions. In addition, vegetative cells were never
observed under dark conditions. Consequently NpF0020’s putative influence under
different light parameters was never investigated to suggest the gene’s function as a
photoreceptor either in vegetative, heterocyst or akinete conditions. Based on this
information, it’s interesting to note that the heterocysts compared to akinetes and
vegetative cells showed lower fluorescence levels suggesting down regulation of
NpF0020 under light conditions. Heterocyst development and function as mentioned
before is known to shut down its photosystems for photosynthesis to prevent the build up
of oxygen that is detrimental to the integrity of nitrogenase. According to Cornilescu et
al., (2008) PHY super family domains act as reversible switches in photosensory
cascades that regulate photosynthetic processes. Down regulation of such a protein in
heterocysts may further corroborate NpF0020 as a photosensory protein, refute its
involvement in akinete development and explain it upregulation in akinetes as a result of
the light environment. However the question that still lingers is why NpF0020 was
upregulated in the zwf studies where the experimental parameters included darkness.
144
NpF0022 – Response Regulator Receiver Sensor Signal Transduction Histidine
Based on the initial zwf time-course microarray data it was hypothesized that
NpF0022 would show a significant degree of transcriptional activity during akinete
development, as shown by the graphical expression data (Figure 21). Expression relative
to a time 0 control exhibited an initial increase from day 0 to day 1 that remains at an
approximately two-fold high level from day 2 onward. Previous work has shown that zwf
akinetes start to mature around day 3 under these conditions as indicated by increased
resistance to lysozyme, desiccation, and cold (Argueta and Summers, 2005). Using these
parameters, the time-course expression data indicates an early increase during akinete
formulation.
Observations of the epifluorescence microscopy results shows low overall levels
of GFP intensity associated with transcriptional activity of NpF0022 throughout all cell
types, with even lower expression in heterocysts which showed no activity. Due to the
null activity levels in heterocysts from day 0 (Figure 26) and onwards, it can be inferred
that the NpF0022 transcriptional response is not influenced by a deficiency in compound
nitrogen sources in heterocysts. GFP fluorescence throughout the time course shows a
similar emission intensity compared to the negative control, suggesting a extremely low
or absence of transcription. However, towards the end of the time course the intensity at
day 10 (Figure 30) and day 14 (Figure 31) after phosphate deprivation was slightly higher
than previous time points. Based on the images from day 12 (Figure 30) and day 14
(Figure 31), one can infer that there is some minor induction of NpF0022 during akinete
development from this promoter.
After reviewing NpF0022’s position within the chromosome (Figure 23), it is
possible that it is part of an operon in conjunction with NpF0020 and NpF0021. NpF0020
expresses the multi-sensor signal histidine kinase, NpF0021 expresses a response
regulator receiver protein and NpF0022 express the response regulator receiver sensor
signal transduction histidine; most likely these three genetic units together express a
hybrid version of two-component regulatory systems. If the operonic architecture of all
three genes holds to be true, it maybe suggested that the low levels of transcriptional
activity of NpF0022 demonstrated by the GFP transcriptional reporters conveys an
inaccurate interpretation. Operons that contain a cluster of genes are controlled by a
single regulatory element, one that is furthest upstream from all the genes in order to
transcribe all genes in sequence. Therefore the transcriptional increase of NpF0020,
which is the first gene within the proposed operon should hypothetically influence
NpF0022’s transcriptional rate in the same manner. It is therefore likely that the putative
transcriptional start site identified by RACE is actually an mRNA processing site, and not
a true transcriptional start site. This is supported by 1) the overlapping ORFs of
NpF0020 and 0021, 2) the similar transcription levels of NpF0020 and 0022 from the
microarray study, and 3) the lack of transcription observed for NpF0022 based on a GFP
reporter plasmid. GFP transcriptional reporters were designed only to evaluate the
potential transcriptional rate of a gene by using its promoter to initiate a GFP transcript; it
does not directly measure the level of mRNA transcript found in a cell.
145
NpF2868 – Pad R-Like Transcriptional Regulator
Based on the initial zwf time-course microarray data it was hypothesized that
NpF2868 demonstrates an approximate 2-fold increase in transcriptional activity during
akinete development, as shown by the graphical expression data (Figure 32). Previous
work has shown that zwf akinetes start to mature around day 3 under these conditions as
indicated by increased resistance to lysozyme, desiccation, and cold (Argueta and
Summers, 2005). Using these parameters, the time-course expression data indicates an
overall increase in transcriptional activity, with increased expression early and continuing
late into akinete formation.
In comparison to the negative control, visual observations of the epifluorescence
microscopy results show significantly low overall levels of GFP fluorescent intensity
associated with the transcriptional activity of NpF2868. The raw fluorescence data from
the time-course DNA microarray was 64 for the time zero and the induction was slightly
less than 2-fold throughout the time course (Figure 32). This approximately 2-fold
increase from a low-level of expression is supported by observations of low-level but
inducible expression of GFP in the reporter strain.
The fluorescence activity was observed to be higher than that of the negative
control, indicating the promoter was active in the plasmid. The absence of fluorescence
emitted from heterocysts implies that the upregulation of NpF2868 is not influenced by
deprivation of combined nitrogen sources in the heterocyst cell alone. However, there lies
the possibility that NpF2868 is upregulated in vegetative cells as a result of combined
nitrogen deprivation. Under limited phosphate environments, during the development of
akinetes, the fluorescence emitted increases between day 3 (Figure 38) and day 6 (Figure
39) after phosphate deprivation, maintains a constant level among the cells of a filament.
The first akinete witnessed at day 17 (Figure 42) after phosphate deprivation shows the
highest concentration and intensity of GFP fluorescence, implying upregulation of
NpF2868 during akinete development. Although the low levels of GFP fluorescence
intensity made it hard to determine localized expression in the filament, on day 12 after
phosphate deprivation one cell found midway between the heterocysts had showed the
highest intensity level in comparison to the other cells (Figure 41).
The observed association with the downstream carotenoid oxygenase gene was
conserved in only one other distantly related cyanobacterium, and in only two members
of the Actinobacteria class of bacteria, according to STRING analysis. Since this
association is not very conserved, the hypothesis that the NpR2868 protein regulates this
downstream gene is not supported. CyanoBase analysis (Figure 33) describes NpR2868
as a Pad R-like Transcriptional Regulator and according to Agustiandari et al., they are
involved in the regulation of expression of the phenolic acid decarboxylase (pad) genes,
which are required for the detoxification and metabolism of phenolic acid compounds
and are also related to transcriptional regulators of multiple antibiotic resistance. In
Lactococcus lactis, an unrelated microorganism to cyanobacteria has a Pad R-like
Transcriptional Regulator (LmrR) represses LmrCD, a major multidrug ABC transporter
protein; however the presence of antibiotics directly interacts with LmrR inducing
LmrCD expression (Madoori P, Agustiandari H, et al., 2009) The notion of the
146
relationship between LmrR and antibiotic resistance provide insight on the experimental
conditions used when studying NpF2868; zwf and NpF2868 GFP reporter studies used
ampicillin (Argueta and Summers, 2005) and neomycin, respectively, and each antibiotic
may have a different interaction the NpF2868 transcriptional regulator.
Since the both the GFP reporter studies showed evidence of transcriptional
activity and the zwf microarray studies did, future investigations to further characterize
NpF2868 include a comparative with microarray of the zwf or GFP reporter experiments
under different antibiotic conditions.
147
NpF2889 – CBS Sensor Hybrid Histidine Kinase
Based on the initial zwf time-course microarray data it was hypothesized that
NpF2889 demonstrates a significant degree of transcriptional activity during akinete
development, as shown by the graphical expression data (Figure 44). Expression relative
to a time 0 control exhibited a positive gradient between day 0 and day 1 that flat lines to
a neutral gradient moving forward from day 2 as can be seen with Figure 44. Previous
work has shown that zwf akinetes start to mature around day 3 under these conditions as
indicated by increased resistance to lysozyme, desiccation, and cold (Argueta and
Summers, 2005). Using these parameters, the time-course expression data indicates an
overall increase in transcriptional activity, with increased expression early and late in
akinete formation.
In comparison to the negative control, observations of the epifluorescence
microscopy results showed visible levels of GFP intensity associated with transcriptional
activity of NpF2889 throughout all cell types; however heterocysts cells emitted a
significantly high overall fluorescent intensity as can be visually witnessed from each
time point. Although the images highly suggest that NpF2889 is involved for heterocysts
development and activity under deprived combined nitrogen environments, it cannot be
negated that it is not involved with akinetes or vegetative function as suggested by
witnessed GFP intensity in these cell types that – although akinetes were inducted as a
result of phosphate deprivation, the cultures were also maintained in media deprived of
combined nitrogen to maintain heterocyst vitality and prevent fragmentation.
During akinesis as a result of phosphate removal, intensity levels of the nonheterocysts cells reached a peak point on day 3 (Figure 50) that leveled out the days
following and eventually dropped to almost null on day 26 (Figure 54). Only the
vegetative cells showed any fluctuations in GFP fluorescent intensity, but filaments that
had a disjointed morphology with inclusive proto-akinetes or akinetes as such on day 26
(Figure 54), showed almost no GFP fluorescence indicating that NpF2889 was no longer
involved during akinete development if required for akinesis or is no longer required if
used for vegetative metabolic functions. Toward the end of akinesis at day 26 (Figure 54),
the heterocysts still attached to the filament continued to expresses GFP at high levels,
suggesting that the terminally differentiated cell-type had not reached metabolic
inactivity and was not affected by akinete development yet. Based on GFP transcriptional
reporter it can be determined that NpF2889 is expressed during akinesis and it can also be
postulated if not concluded that it is involved in heterocyst functionality.
Further experimental initiatives mutagenized NpF2889 in the wild type genome of
N. punctiforme, with the motive of observing cell survival in both heterocysts and akinete
inducing environments. Successful mutagenesis was proven with PCR amplification
(Figure 55) that identified a curtailed PCR product compared to a wild type strain. The
mutant strain demonstrated that under combined nitrogen deficiency, it was unable to
survive, implying that the cell was unable to fix atmospheric nitrogen. Figure 58 shows
an image of liquid cell cultures ten days after removal of combined nitrogen, exhibiting a
yellow color, indicating cell death and cease of growth. Based on the observation it can
be concluded that NpF2889 is required for heterocyst function and cell survival in
conditions lacking combined nitrogen sources.
148
Microscopic observations under combined nitrogen deficiency provided insight
on the physical nature of the mutant; the filaments were much shorter in length compared
to strains (mutant or wild type) growing in optimal conditions and the vegetative cells
were not as well defined with an emaciated appearance (Figure 56). Eventually filaments
were hardly recognizable and the majority of the culture was observed as clumps of
single cells (Figure 57; day 6). Fully developed heterocysts were not identifiable based on
the physical criteria that represent the cell-type: larger, round, and thick walled. However
certain cells were speculated to be proto-heterocysts based on their round nature and
inability to capture auto-fluorescence with Texas-Red filters (Figure 56). These
speculated proto-heterocysts lacked the thickness and size one would expect to find in
developed heterocysts. Based on the observations it can be considered that NpF2889 may
have some role in the physical development of heterocysts rather than metabolic function,
although it cannot be confirmed which role it plays.
In pursuit of identifying if NpF2889 has a role in the physical development of
heterocysts, a literature search was conducted. An ortholog survey found a similar gene
in Anabaena sp. Strain PCC 7120, all2883, and based on the paper by Lechno-Yossef et
al., (2006), a mutated version of the hepK (all4496) gene down regulated the transcription
of all2883 gene and resulted in a heterocyst with no polysaccharide under combined
nitrogen deficiency. The same paper also indicated that the mutation of hepk also
increased the expression of the HepK protein suggesting that it auto-regulates its
transcription. HepK, according to Zhou and Wolf (2003) is a two-component regulatory
system like NpF2889/all2883 and is found to be involved in biosynthesis of the
polysaccharide layer during heterocysts differentiation; a characteristic sourced by many
publications. Additionally, it has been suggested that the hepK gene may play a role in
sensing the oxygen differential within a cell during heterocysts development (Zhu et al.,
1998) and is expressed mainly in proto-heterocysts (Zhou R, Wolk CP., 2003). The
relationship between hepK and all2883 just described brought to question the impact of
polysaccharide development in mutant strains of NpF2889.
Depletion of oxygen from the heterocyst is absolutely necessary to prevent
degradation of nitrogenase, the enzyme responsible for converting atmospheric nitrogen
into a combined nitrogen source. The glycolipid layer development is essential to
maintain a micro-oxic environment in the cell and the polysaccharide layer is best
required to protect the glycolipid layer from damage. Although studies have determined
that heterocysts without polysaccharides can survive and the mutant NpF2889 cannot
sustain heterocyst survival, staining procedures were conducted to evaluate the presence
of polysaccharides and determine if NpF2889 had any association to polysaccharide
development. The follow up investigation, searching for polysaccharides however posed
the difficulty of identifying developing heterocysts in the NpF2889 mutant strain.
Nevertheless the search was pursued with a Periodic acid-Schiff-Stain procedure.
Identifying proto-heterocyst could not be confirmed by epifluorescent microscopy with a
Texas Red filter because of pigmentation disruptions with the Periodic acid-Schiff-Stain
reagents and were subject to physical properties for possible identification. Regardless,
staining was not observed in the samples collected (Figure 59) and despite the results it
cannot be confirmed or refuted that NpF2889 has any association with polysaccharide
149
development. Although it may show an inverse relationship with hepK, the information
available does directly edify its involvement in polysaccharide development.
It should be noted that there was difficulty performing the Periodic acid-SchiffStain as wild type vegetative cells, which should not have any polysaccharide layers were
picking up the stain, in addition to the heterocysts. Attempts to optimize the procedure
unveiled the same results. However, whenever a wild type culture was examined after
polysaccharide staining, a ring of staining was found haloing around the heterocyst as
depicted in Figure 60. This observation was used as a control for comparison with the
NpF2889 mutant.
Akinetes, like heterocysts also produce polysaccharide layers around the body of
the cell. A final experiment was conducted with the mutant strain of NpF2889, inducing
akinetes. Fully developed akinete were observed on Day 15, (Figure 64), suggesting that
NpF2889
is
essential
for
heterocyst
development,
not
akinetes.
150
NpF4131 – Sensor Hybrid Histidine Kinase
Based on the initial zwf time-course microarray data it was hypothesized that
NpF4131 demonstrates a significant degree of transcriptional activity during akinete
development, as shown by the graphical expression data (Figure 65). Previous work has
shown that zwf akinetes start to mature around day 3 under these conditions as indicated
by increased resistance to lysozyme, desiccation, and cold (Argueta and Summers, 2005).
Using these parameters, the time-course expression data indicates an overall increase in
transcriptional activity, with increased expression early and late in akinete formation.
In comparison to the negative control, observations of the epifluorescence
microscopy results show low overall levels of GFP fluorescent intensity associated with
transcriptional activity of NpF41313 throughout all cell types with the exception of
heterocysts. Throughout the time course heterocysts exhibited no GFP fluorescence and
demonstrates that NpF4131 is not affected by deprived combined nitrogen sources within
the cell type itself is, even in conditions that included both phosphate and combined
nitrogen deprivation during akinete induction. This information however does not negate
the possibility that NpF4131 is not affected by deprivation of combined nitrogen in the
vegetative and akinetes cells as suggested by witnessed GFP intensity in these cell types.
The vegetative cell that continued to demonstrate low levels of GFP may inadvertently be
a result of upregulation of NpF4131 as a results heterocyst formation and function.
Of all the time points studied, day 0 (Figure 70), where the culture was cultivated
without any combined nitrogen, the cells demonstrated the lowest GFP fluorescence
intensity. From day 1 (Figure 71), after phosphates were removed from the media and
onwards, the GFP intensity increased through time among the vegetative and akinete
cells. The difference in intensity levels of cells between day zero (low level; Figure 70)
and day 23 (high level; Figure 75) can easily be discernable by visual observations to
suggest that NpF4131 is upregulated during akinete development.
Although the levels of GFP fluorescent intensity were low it was possible to
evaluate the localization of GFP expression in the filament. In particular, between days 6
and 23, GFP expression was found in cells that were positioned midway between two
heterocysts. This area being considered where the first akinetes develop within filaments
with heterocysts, the localization of GFP expression may indicate the relevance of
NpF4131 for akinesis. Also, akinete cells on day 23 (Figure 75) demonstrated GFP
expression suggesting the possible role of NpF4131 in akinete function.
Another element to consider is that the microarray expression data (Figure 65)
suggest a different story, where the expression level of NpF4131 falls as akinetes develop.
However, it maybe explained that the half life of the mRNA transcripts are short and thus
require increasing upregulation to maintain a certain quota for akinete development;
although this is only speculation.
NCBI identifies NpF4131 as GAF sensor hybrid histidine kinase despite although
there was no identification of a GAF domain during the BLAST analysis (Figure 66).
GAF domains are known superfamily domains typically found in combination with PHY
domains in photoreceptors that microorganisms use to help them adapt physiologically
151
and developmentally to ambient light environments. The akinete and heterocyst studies of
the GFP reporter strains included the presence of light during the procedure and were
never observed under dark conditions. In addition, vegetative cells were never observed
under dark conditions. Consequently NpF4131’s putative influence under different light
parameters was never investigated to suggest the gene’s function as a photoreceptor
either in vegetative, heterocyst or akinete conditions. Based on this information, it’s
interesting to note that the heterocysts compared to akinetes and vegetative cells showed
no fluorescent activity, suggesting down regulation of NpF4131 under light conditions.
Vegetative and akinete cells however showed almost null level of GFP intensity at the
beginning of the time course and increased throughout akinesis. If NpF4131 is truly a
photoreceptor, lack of its expression in heterocysts may be explained as a reason to shut
down its photosystems for photosynthesis to prevent the build up of oxygen that is
detrimental to the integrity of nitrogenase. However the explanation as to why its
expression increases in vegetative cells and akinetes during akinesis in response to light
raises questions. Studies under different light conditions are suggested to elaborate the
putative function of this gene as a photoreceptor.
On another note, the BLAST analysis (Figure 66) identified a BaeS domain
integral to sensor histidine kinase protein structure. The BaeS protein is an innermembrane-bound sensor histidine kinase (HK) that controls regulation of one of six
envelope stress responses in Escherichia coli (LeBlanc et al., 2011). According to
LeBlanc et al. (2011) the types of envelope stresses include changes in temperature, pH,
and osmolarity; exposure to toxic compounds; and oxidative stress. One of the stresses
that induce BaeS is spheroplasting and by definition, spheroplast is a bacterium or yeast
cell that is modified (as by enzymatic action) so that there is partial loss of the cell wall
and increased osmotic sensitivity (Merriam-Webster, 2013). The development of the
polysaccharide and glycolipid layers in addition to the acquired spherical shape formed
during akinesis may be attributing factors that is similar to “spheroplasting” as caused
BaeS induction. The GFP reporter studies do suggest an increase of GFP fluorescent
during akinete development suggesting a possible involvement of NpF4131 with BaeS
induction-like behavior. Although this shows some association, it cannot be determined
from this study, whether NpF4131 induction is a direct result of akinesis or a collateral
effect resulting from crosstalk.
152
NpR0438 – ArsR Family Transcriptional Regulator
Based on the initial zwf time-course microarray data it was hypothesized that
NpR0438 would exhibit a significant degree of transcriptional activity during akinete
development, as shown by the graphical expression data (Figure 77). Expression relative
to a time 0 control exhibited a increased expression between day 0 to day 3, followed by
a continuous decline at an almost constant rate. Previous work has shown that zwf
akinetes start to mature around day 3 under these conditions as indicated by increased
resistance to lysozyme, desiccation, and cold (Argueta and Summers, 2005). Using these
parameters, the time-course expression data indicates an overall increase in
transcriptional activity, with increased expression preceding akinete formation.
In comparison to negative controls, observations of the epifluorescence
microscopy results show a low to moderate overall level of GFP intensity associated with
transcriptional activity of NpR0438 throughout all cell types with the exception of
heterocysts. Throughout the time course heterocysts exhibited no GFP fluorescence
demonstrating that NpR0438 is not transcribed in heterocysts, even in conditions that
included both phosphate and combined nitrogen deprivation during akinete induction.
Based on visual observations, the intensity of GFP fluorescence increases to a
peak point at day 12 (all cells show upregulation; Figure 87), suggesting increasing
upregulation of NpR0438. Following day 12 , the expression intensity drops
progressively (Figure 88 -90). The filaments that show evidence of akinete development
(i.e have disjointed cells; Figure 26), have either proto-akinetes or fully mature akinetes
have very low fluorescence intensity.
Interestingly, the overall expression pattern suggested by the GFP observations is
similar to pattern manifested by the microarray day implying that there is an increase in
transcriptional activity followed by a decline. Although the two sets of data cannot be
compared as equals due to their nature, they do however suggest the same indication that
NpR0438 is upregulated in filaments during the development of akinetes, but not
specifically in akinetes themselves.
The STRING database identifies the NpR0438 gene as part of a 3-gene conserved
unit that occurs also in the closely related filamentous cyanobacteria Nostoc PCC 7120
and Anabaena variabilis.
These upstream genes include Acetyl-CoA carboxylase
(NpR0439) and a protein elongation factor P-like protein (NpR0440) (Figure 79).
Elsewhere in the N. punctiforme genome two proteins similar to NpR0438 exist,
NpF1680 (49% identical, 69% similar), and NpF6484 (40% identical, 66% similar).
NpF6484 co-localizes with genes encoding for arsenical resistance. This suggests that
the NpR0438 gene product may not be involved in heavy metal resistance, but may
perhaps regulate the three-gene unit of unknown function in which it lies.
153
NpR1110 – Histidine Kinase Hypothetical Protein
Based on the initial zwf time-course microarray data it was hypothesized that
NpR110 demonstrates a significant degree of transcriptional activity during akinete
development as shown by the graphical expression data (Figure 91). Expression relative to
a time 0 control exhibited a positive gradient between day 0 and day 1 that declines
moving forward from day 2. Previous work has shown that zwf akinetes start to mature
around day 3 under these conditions as indicated by increased resistance to lysozyme,
desiccation, and cold (Argueta and Summers, 2005). Using these parameters, the timecourse expression data indicates an overall increase in transcriptional activity, with
increased expression early and late in akinete formation.
In comparison to the negative control, observations of the epifluorescence
microscopy results shows significant low overall levels of GFP intensity associated with
transcriptional activity of NpR1110 throughout the filaments. Nonetheless, based on
visual observation, the fluorescent activity was relatively higher than that observed by the
negative control. All cell types, including heterocysts showed some level of GFP activity.
Heterocysts however, showed the lowest intensity of GFP fluorescence intensity
throughout the time course study in both con. It cannot be ruled out that NpR1110 is
involved or uninvolved with heterocysts development or maintenance. The existence of
GFP within the heterocysts cells may be limited to two reasons if not more; 1) NpR1110
protein is required for heterocysts or 2) there maybe some cross-talk expression as a result
of non-specific stimulation of its promoter region. NpR1110 upregulation in vegetative
cells during heterocyst induction may also as a result of combined nitrogen deprivation
and also cannot rule out NpR1110 as having no involvement in heterocyst development or
maintenance.
During akinesis as a result of phosphate removal, cells with the highest GFP
fluorescence intensity within the filament were found between day 0 (Figure 96) and day
6 (Figure 98). Day 3 (Figure 97) and day 6 (Figure 98) demonstrated more concentration
of GFP expression in the mid-ridge portion of the filament between two heterocysts.
Although the day 6’s image only shows one heterocysts, this localization pattern can be
extrapolated based on the increasing intensity of GFP from the heterocysts onwards. This
observation suggests upregulation activity in a region of a filament where one would
expect akinetes to first appear. Day 13 (Figure 99) filaments show a more disjointed
structure accompanied with increasing GFP fluorescent intensity, compared to the
previous time-points. However as the filaments continue in a disjointed state the GFP
intensity drops from 17 (Figure 100-101) onwards, suggesting down-regulated expression
of NpR1110. Unfortunately, images of mature akinetes were not recorded to determine if
it also follows the same pattern.
Interestingly, the expression pattern suggested by the GFP observations is similar
to pattern manifested by the microarray day implying that there is an increase in
transcriptional activity followed by a decline. Although the two sets of data cannot be
compared as equals due to their nature, they do however suggest the same indication that
NpR1110 is upregulated during the development of akinetes.
154
The co-localization of NpR1110 and NpR1109 (LuxR family transcriptional
regulator) suggest they are co-expressed as an operon (Figure 93). LuxR is known for
having a role in quorum sensing, coordinating expression of a variety of genes, mobility,
nodulation and more (Chen and Xie, 2011). The roles of LuxR do not suggest any
influence on akinete induction. Nevertheless, the weak conservation of co-localization of
LuxR with NpR1110 across different relative of cyanobacteria signifies that the two
proteins may not have any interaction as a two-component regulatory system.
Consequently, the evidence of upregulation from the GFP reporters suggests that
NpR1110 has a role in akinete development but in conjunction with another gene.
155
NpR1449 – Response Regulator Receiver Sensor Signal Transduction Histidine
Based on the initial zwf time-course microarray data it was hypothesized that
NpR1449 demonstrates a significant degree of transcriptional activity during akinete
development, as shown by the graphical expression data (Figure 102). Expression relative
to a time 0 control exhibited a positive gradient between day 1 to day 6 as can be
exhibited with Figure 102. Previous work has shown that zwf akinetes start to mature
around day 3 under these conditions as indicated by increased resistance to lysozyme,
desiccation, and cold (Argueta and Summers, 2005). Using these parameters, the timecourse expression data indicates an overall increase in transcriptional activity, with
increased expression early and late in akinete formation.
Observations of the epifluorescence microscopy results show GFP expression
associated with transcriptional activity of NpR1449 throughout all cell types. In
conditions lacking combined nitrogen sources, the heterocysts show a higher overall level
of GFP fluorescence intensity than the vegetative cells in the same filament. Expression
of GFP in vegetative cells may imply one of three reasons if not more, 1) NpR1449 is
required for metabolic functions in the vegetative state, 2) during heterocyst development,
there maybe some cross-talk expression as a result of non-specific stimulation of its
promoter region, or 3) more NpR1449 protein is needed in heterocysts.
Interestingly, based on visual observation, when akinete development is induced,
by removing phosphates from the media, the GFP fluorescent intensity in heterocysts
progressively decreases throughout the time course. The vegetative cells however show
the opposite pattern, showing a gentle increase in fluorescent intensity. Although the GFP
fluorescence found in akinetes and vegetative cells during akinete development are not
significantly high they are relatively higher than the negative control specimen. Based on
that evidence it can be suggested that NpR1449 is found up-regulated at some level
during akinete development, in addition to heterocyst development.
The domains identified by BLAST (Figure 103) revealed a REC super family
domain, which according NCBI is known as a receiver domain found in bacteria which in
NpR1449’s it has sequence homology to a CheY-like multi-domain. According to
Mascher et al. (2006), CheY is a response regulator whose cognate histidine kinase
(CheA) is a soluble sensor protein, where there combined efforts help with chemotaxis.
The position of CheY in NpR1449 is at the N-terminus of the response regulator, located
upstream of the output domain which in the case of NpR1449 is a protein histidine kinase
that can be used to phosphorylate a intracellular response regulator propelling some sort
of signal transduction avenue.
According to the STRING database, the downstream location of Npun_R1448,
another response regulator receiver signal transduction histidine kinase is conserved only
in a closely related cyanobacterium Anabaena variabilis - giving weak evidence that the
NpR1449 and NpR1448 proteins may interact in a 2-component pathway. All other
distant and close relatives of Nostoc punctiforme have homologous pairs of
Npun_R1449/Npun_R1448 that make up either two-component regulatory systems or
two-component hybrid sensor and receivers.
156
NpF3538 – Multi Sensor Hybrid Histidine Kinase
Based on the initial zwf time-course microarray data it was hypothesized that
NpF3548 demonstrates a significant degree of transcriptional activity during akinete
development as shown by the graphical expression data (Figure 113). Expression relative
to a time 0 control exhibited a positive gradient between day 0 and day 1 that fluctuates
between the low the high points of level of the mRNA transcripts produced from day 2
onwards. Previous work has shown that zwf akinetes start to mature around day 3 under
these conditions as indicated by increased resistance to lysozyme, desiccation, and cold
(Argueta and Summers, 2005). Using these parameters, the time-course expression data
indicates an overall increase in transcriptional activity, with increased expression early
and late in akinete formation.
In comparison to the negative control, observations of the epifluorescence
microscopy results during the initial days of the time course shows significant low overall
levels of GFP intensity associated with transcriptional activity of NpF3548 throughout all
cell types, with the exception of heterocysts that showed no activity. Due to the null
activity levels in heterocysts from day 0 (Figures 118-123) and onwards, it can be
inferred that the NpF3548 transcriptional response is not influenced by a deficiency in
compound nitrogen sources in heterocysts alone. However, it cannot be refuted that low
levels of GFP found in vegetative cell are not a result of NpF3548 activity as
consequence of deprived combined nitrogen. Akinetes are also under the supposition
because although the cultures are deprived of phosphates for akinete induction, they are
deprived of combined nitrogen to maintain heterocyst vitality and prevent fragmentation.
Thus akinete cell that show GFP results maybe a combined consequence of both
phosphate and combined nitrogen deprivation if influenced by NpF3548.
Based on visual observations, the GFP fluorescent intensity levels slightly drop
between the different media condition from day 0 to day 1, going from deficiency in
compound nitrogen sources to a combination of deficiency in compound nitrogen and
phosphate sources. Day 1 specimen includes atypical cell types that cannot be recognized
as heterocysts, vegetative, hormogonia or akinetes. They appear to be mutated, based on
its morphology, that somehow overexpress certain genes including NpF3548 evident by
the high GFP expression levels. As a result theses atypical cell types should be ignored.
From day 6 onwards (Figures 120 - 123) the GFP fluorescence levels not only
increases but also appears to be localize in the mid-ridge portion of the filaments between
heterocyst, implying an association of NpF3548 transcriptional regulation with akinete
development. The first akinete is observed at day 23 (Figure 23) and also shows GFP
fluorescent suggesting a direct influence on the upregulation of NpF3548 during akinete
development.
BLAST (Figure 114) results shows that NpR3548 has a sensory input domain that
in tandem links GAF and PAS domains. According to Michel et al. (2009) Synechocystis
sp. PCC 6803 has a histidine hybrid kinase (Slr1759) with a similar pattern and
presumably it is part of an operon with Slr1760 (response regulator) that together
represent a two-component regulatory system encoded by linked genes. The closest gene
that co-localizes with NpR3548 is NpR3549 that is dictated as a hypothetical protein with
157
no known function. STRING analysis did not find any orthologs of Slr1760 in Nostoc
punctiforme that is associated with NpR3548, suggesting that NpR3549 has no known
interacting patterns in the same locus. Regardless of the interacting protein function, its
has been noted in the literature that there is a significant correlation between the number
of PAS domains and the number of proteins participating in electron transport reactions
(Zhulin and Taylor, 1998). The findings by Michel et al. (2009) demonstrated that
Slr1759 is the first cyanobacterial histidine kinase for which an association with flavin
co-factor, FAD, which is known as a redox cofactor (electron carrier). Hence, Slr1759
may be involved in sensing the energy status or changes in the redox poise within the cell
via FAD and coordinate photosynthetic and respiratory activity (Michel et al., 2009).
Mutant studies of Slr1759 pointed to an enhanced respiratory activity and a slightly
reduced photosynthetic activity.
Based on this information, the notable increase in expression of NpR3548 in the
micro array study and the expression GFP in akinete cells may be influenced by the
change energy potential during akinesis by removal of phosphates from the media.
158
NpR5425 – RNA-Binding S1 Domain-Containing Protein
Based on the initial zwf time-course microarray data it was hypothesized that
NpR5425 would show a significant degree of transcriptional activity during akinete
development (Figure 124). Expression relative to a time 0 control exhibited a positive
trend over the 6-day time course, with peak expression at day 4 following induction.
Previous work has shown that zwf akinetes start to mature around day 3 under these
conditions as indicated by increased resistance to lysozyme, desiccation, and cold
(Argueta and Summers, 2005). Using these parameters, the time-course expression data
indicates an overall increase in transcriptional activity, with increased expression both
early and late in akinete formation.
Raw fluorescence data from the time-course array for NpR5425 zero time point
was 117, indicating low levels of transcription expression. This expression correlates
with the GFP fluorescence seen with the GFP reporter strain. Observations of the
epifluorescent microscopy results show low visible levels of GFP intensity associated
with transcriptional activity of NpR5425 throughout all cell types with the exception of
heterocysts, which showed no activity. Due to the null activity levels in heterocysts from
day 0 and onwards (Figures 129-134), it can be inferred that the NpF5425 transcriptional
response is not influenced by a deficiency in compound nitrogen sources. However, it
cannot be negated that the NpR5425 transcriptional response is not influenced by a
deficiency in compound nitrogen within vegetative cells. The transcriptional activity at
day zero, a time point before akinete induction, indicates that transcriptional regulation of
NpR5425 may not specifically respond to just cellular adjustments as a result of
phosphate-poor adaptation.
From day 0 of akinete induction and onwards (Figures 129-134), GFP
fluorescence intensity demonstrated by visual observation consistent low levels with the
exception of Day 20 (Figure 133) which showed a significantly higher level of
fluroescence. Day 20 (Figure 133) demonstrated this uplift in intensity in both vegetative
and akinete cells. By Day 22 (Figure 134), the intensity turned back down to levels
similar to what would be expected from the negative control, suggesting a cease in
transcriptional activity for NpR5425. No localization patterns could be identified.
Although week, the presence of GFP fluorescence and certainly the intensity
increase on day 20 (Figure 133) endorses the transcriptional activity for NpR5425 during
the akinete development process. Although its function is to act as a transcriptional
binding protein, its efforts a regulator is still unknown and its role in akinete development
is unconvincing with the data present.
159
NpR6228 – Two Component Transcriptional Regulator
Based on the initial zwf time-course microarray data it was hypothesized that
NpF0020 would show a significant degree of transcriptional activity during akinete
development (Figure 135). The data points measured infer a positive gradient between
day 0 and day 2 that flat lines to an average neutral gradient moving forward from day 3.
Previous work has shown that zwf akinetes start to mature around day 3 under these
conditions as indicated by increased resistance to lysozyme, desiccation, and cold
(Argueta and Summers, 2005). Using these parameters, the time-course expression data
indicates an overall increase in transcriptional activity, with increased expression both
early and late in akinete formation.
In comparison to the negative control, observation of the epifluorescent
microscopy results shows significant low levels of GFP intensity associated with
transcriptional activity of NpR6228 throughout all cell types, with the exception of
heterocysts, which showed no activity. Although only non-heterocysts cells showed GFP
emission activity, the intensity was close to null in media with only a deficiency in
combined nitrogen, suggesting that transcriptional activity of NpR6228 in vegetative
cells are not influenced by this condition.
Throughout the rest of the time course, GFP intensity maintained low levels,
almost null, until about day 12 where at the first sign of disjointed cells found within
filaments developing akinetes, increased GFP intensity was observed. Although the
disjointed property in filaments can be associated with akinete development, GFP
fluorescence cannot be attributed to the disjointed physicality. Moving forward, GFP
fluorescence was still observable even in akinete cells as shown in day 19, implying the
necessity of NpR6228 transcriptional up-regulation in the later development stages of
akinetes.
After reviewing NpR6228’s position within the chromosome, it is apparent that it
may be part of an operon in conjunction with the downstream gene NpR6227 that codes
an integral membrane sensor signal transduction histidine kinase and the upstream
NpR6229 gene appears to code a hypothetical protein with an unknown function.
However the co-localization of these three genes is not found to be highly conserved in
distantly and closely related cyanobacteria suggesting no associated relationship. Further
genetic characterization studies should be conducted to determine the phenotype and
relationship of NpR6228 and its co-localizing genes.
160
CONCLUSION
Employment of the molecular applications used to verify the DNA microarray
data of the eleven genes thus far have provided significant evidence of transcriptional
upregulation during akinesis with the exception NpF2889, NpR1449 and NpR1110. Due
the nature of akinesis in Nostoc punctiforme, which exhibits an asynchronous
development of the akinete cells within a filament, it maybe challenging to objectively
determine the transcriptional pattern of a gene via GFP fluorescence when looking at a
series of different cell types with various fluorescent intensities in the filament.
Consequently it was necessary to establish examining guidelines that helped the
investigator truly define their objective interpretation of the results.
For the case of this study, at the early time points where the cultures were placed
in akinete inducing media, the over all filament(s) were observed in addition to any
fluorescence activity that may have been presented in the heterocyst cells. As the time
course moved along, observations were honed in on the center of the filaments (between
two heterocysts) where one would expect the first akinete cells to appear. Typically,
akinetes cells presented in a filament were measured via observation against neighboring
vegetative cells for differences in GFP fluorescence to determine if there was
upregulation of the gene in the akinete developing cell alone. In situations where akinete
cells did not show significant fluorescence compared to the neighboring vegetative cells,
the entire filament was observed for GFP from early time points to later time points to
determine characteristic of gene regulation via GFP fluorescence.
Although these genes were examined under the scope of understanding their role
in akinetes, heterocysts in some reporter strains also showed GFP fluorescence. The
original DNA microarray study never included heterocyst induction and so it may seem
peculiar that a gene such as NpF2889 shows expression predominantly in heterocyst cells
by means of GFP expression. As discussed earlier, akinetes only form in cyanobacteria
strains that can produce heterocysts, suggesting that akinetes once evolved from the
heterocyst cell. Additionally, both cell types share common phenotypic characteristics
such as a polysaccharide and glycolipid layer, in addition to common genes. Although
with NpF2889 we see a predominant GFP expression pattern with heterocysts compared
to akinetes, it does not discredit the data from the DNA microarray data because the
microarray measurements obtained show relative changes in RNA levels that cannot be
directly correlated with GFP fluorescence, which only infers transcription.
As GFP reporters only infer transcription, they cannot be used to provide
definitive results about gene expression. Although they may infer transcription, posttranscriptional regulatory system maybe involved that prevent protein expression. It is
imperative to pursue mutational and gene rescue experiments to investigate functionality
and expressed phenotypes of the genes under akinete or heterocysts induction.
161
REFERENCES
1. Argueta C., & Summers M.L. (2005) Characterization of a model system for the
study of Nostoc punctiforme akinetes. Archives of Microbiology. 183(5):338-46
2. Argueta C., Yuksek K., & Summers M.L. (2004) Construction and use of GFP
reporter vectors for analysis of cell-type-specific gene expression in Nostoc
punctiforme. Journal of Microbiology Methods. 59(2):181-8
3. Argueta C., Yuksek K., et al. (2006) Identification of Nostoc punctiforme akineteexpressed genes using differential display. Molecular Microbiology. 61(3):74857.
4. Agustiandri H., Lubelski J., et al. (2008) LmrR Is a Transcriptional Repressor of
Expression of the Multidrug ABC Transporter LmrCD in Lactococcus lactis.
Journal of Bacteriology. 190(2): 759-763.
5. Bijlisma J.J.E., & Groisman E.A. (2003) Making informed decisions: regulatory
interactions between two-component systems. Trends in Microbiology. 11(8):
359-366
6. Bryant D.A. Editor. (2004) The molecular biology of cyanobacteria (Advances in
Photosynthesis and Respiration). Kluwer Academic Publishers, Dordecht, The
Netherlands.
7. Bycroft M., Hubbard T.J., et al. (1997) The Solution structure of the S1 RNA
Binding Domain: A member of an Ancient Nucleic Acid-Binding Fold. Cell.
24;88(2):235-42
8. Cai Y.P., & Wolk C.P. (1990) Use of conditional lethal gene in Anabaena sp.
Strain PCC 7120 to select for double recombinants and to entrap insertion
sequences. Journal of Bacteriology. 172(6): 3138–3145.
9. Campbell E.L., and Meeks J.C. (1989) Characteristics of hormogonia formation
by symbiotic Nostoc ssp in response to the presence of Anthoceros punctatus or
its extracellular products. Applied Environmental Microbiology. 55(1): 125–131.
10. Campbell E.L., Summers M.L., et al. (2007) Global gene expression
patterns of Nostoc punctiforme in steady-state dinitrogen-grown heterocystcontaining cultures and at single time points during
the differentiation of akinetes and hormogonia. Journal of Bacteriology.
189(14):5247-56.
11. Chen J., & Xie J. (2011) Role and regulation of bacterial LuxR-like regulators.
Journal of Cellular Biochemistry. 112(10):2694-702.
162
12. Cheung J., & Hendrickson W.A., (2010) Sensor domains of two-component
regulatory system. Current Opinion in Microbiology. 13(2):116-23.
13. Cornilescu G., Ulijasz A.T., et al. (2008) Solution Structure of a Cyanobacterial
Phytochrome GAF domain in red-light-absorbing ground state. The Journal of
Molecular Biology. 383(2):403-13
14. Cunnac C., Boucher C., & Genin S. (2004) Characterization of the cis-acting
regulatory element controlling HrpB-mediated activation of the type III secretion
system and effector genes in Ralstonia solacacearum. Journal of Bacteriology.
186(8):2309-18
15. Curatti L., Flores E., & Salerno G. (2002) Sucrose is involved in the diazotrophic
metabolism of the heterocystforming cyanbacterium Anabaena sp. FEBS Letters.
27;513(2-3):175-8.
16. David G. Adams, D., & Duggan S, P. (1999) Tansely Review No. 107.
Heterocyst and Akinete Differentiation in Cyanobacteria. New
Phytologist. 144: 3–33.
17. Draper D.E., Pratt C.W., von Hippel P.H. (1977) Escherichia coli ribosomal
protein S1 has two polynucleotide binding sites. Proceedings of the National
Academy of Science in the United States of America. 74(11):4786-90
18. Fibrainsah G., Kovacs A.T., et al. (2012) Crystal Structures of Two
Transcriptional Regulators from Bacillus cereus Define the Conserved Structural
Features of a PadR Subfamily. PLoS One. e48015. doi:
10.1371/journal.pone.0048015.
19. Flores E., & Herrero A. (2010) Compartmentalized function through cell
differentiation in filamentous cyanobacteria. Nature Reviews Microbiology.
8(1):39-50
20. Forham M.A., Dush M.K., & Martin G.R. (1988). Rapid production of full-length
cDNAs from rare transcripts: amplification using a single gene-specific
oligonucleotide primer. Proceedings of the National Academy of Science in the
United States of America. 85(23):8998-9002.
21. Gao R., Mack T.R. & Stock A.M. (2007) Bacterial response regulators: versatile
regulatory strategies from common domains. Trends in Biochemistry Sciences.
32(5):225-34.
22. He X., Thomton J. et al. (2006) Tex, a putative transcriptional accessory factor, is
involved in pathogen fitness in Streptococcus pneumonia. Microbial
Pathogenesis. 41(6):199-206.
163
23. Herrero, A;, and Flores, E. Editors. (2008) The Cyanobacteria: Molecular
Biology, Genomics and Evolution. Pp 1-15. Caister Academix Press, Norfolk UK
24. Jung K., Fried L., et al. (2012) Histidine kinases and respons regulators in
networks. Current Opinion in Microbiology. 15(2):118-24.
25. Kazusa DNA Research Institute. (2001) Cyanobase: The Genome Database for
Cyanobacteria. (http://genome.microbedb.jp/cyanobase/).
26. Kumar K., Mella-Herrera R.A., & Golden J.W. (2010) Cyanobacterial heterocyst.
Cold Spring Harbor Perspectives in Biology. 2(4)
27. Iteman, I., Rippka, R., et al. (2000) Comparison of conserved structural and
regulatory domains within divergent 16S rRNA-23S rRNA spacer sequences
of cyanobacteria. Microbiology. (Pt 6):1275-86.
28. Laub M.T., & Goulian M. (2007) Specificity in Two-Component Signal
Transduction Pathway. Annual Review of Genetics. 41(1):121-45.
29. Leblanc S.K., Oates C.W., & Raivio T.L. (2011) Characterization of the induction
and cellular role of the BaeSR two-component envelope stress response of
Escherichia coli. Journal of Bacteriology. 193(13):3367-75
30. Lechno-Yossef S., Fan O., et al. (2011) Identification of Ten Anabaena sp. Genes
That under aerobic conditions are required for growth on dinitrogen but not for
growth on fixed nitrogen. Journal of Bacteriology. 193(14):3482-9
31. Lechno-Yossef S., Fan Q., et al. (2006) Mutations in Four Regulatory Genes
Have Interrelated Effects on Heterocyst Maturation in Anabaena sp. Strain PCC
7120. Journal of Bacteriology. 188(21):7387-95.
32. Lechno-Yossef S., Fan Q., et al. (2011) The Unique cyanobacterial protein OpcA
is an allosteric effector of glucose-6-phosphate dehydrogenase in Nostoc
punctiforme ATCC 29133. Journal of Bacteriology.193(14): 3482–3489.
33. Luque I, Flores E, Herrero A. (1994) Molecular Mechanism for
the operation of nitrogen control in cyanobacteria. EMBO Journal. 13(12): 2862–
2869.
34. Madoori P.K., Agustianderi H., et al. (2008) Structure of the transcriptional
regulator LmrR and its mechanism of multidrug recognition. The EMBO Journal.
28(2):156-66.
35. Maldener I., Muro-Pastor A.M. (2010) Cyanobacterial heterocyst. In:
Encyclopedia of life sciences. John Wiley & Sons, Ltd
164
36. Mascher T, Helmann J.D., & Unden G. (2006) Stimulus Perception in Bacterial
Signal Transducing Histidine Kinases. Microbial Molecular Biology Review.
70(4):910-38.
37. Meeks J.C., Campbell E.L., et al. (2002) Cellular differentiation in the
cyanobacterium Nostoc punctiforme. Archives of Microbiology. 178(6):395-403
38. Meeks J.C. (2005) The Genome of the Filamentous Cyanobacterium Nostoc
punctiforme. Pp 27-70. Springer Netherlands
39. Meeks J.C., Elhai J, et al. (2001) An overview of the genome of nostoc
punctiforme, a multicellular symbiotic cyanobacterium. Photosynthesis Research.
70(1):85-106.
40. Meeks J.C., & Elhai J. (2002) Regulation of cellular differentia- tion in
filamentous cyanobacteria in free-living and plant-associated symbiotic growth
states. Microbial Molecular Biology. 66 (1) 194-121.
41. Memorial University Research. The Epifluorescence Microscope. June 2011
Retrieved December 2012, from (http://www.mun.ca/research/resources/creait/)
42. Merriam- Webster Online. An Encyclopedia Britannica Company.
(www.Merriam-Webster.com) copyright ©2013 by Merriam-Webster,
Incorporated.
43. Mizuno T., Kenako T., & Tabata S. (1996) Compilation of all Genes Encoding
Bacterial Two-Component Signal Transducers in the Genome of the
Cyanobacterium, Synechocystis sp. Strain PCC 6803. DNA Research. 3(6):407414.
44. Mitschke J., Vioque A., et al. (2011) Dynamics of transcriptional start site
selection during nitrogen stress-induced cell differentiation in Anabaena sp.
PCC7120. Proceedings of the National Academy of Science in the United States
of America. 108(50); 20130-20135
45. Msadek T. (1999) When the going get tough, survival strategies and
environmental signalling networks in Bacillus subtilis. Trends in Microbiology.
7(5):201-7.
46. NCBI BLAST (Basic Local Alignment Search Tool). BLAST is a registered
trademark of the National Library of Medicine. Retrieved June 2013
(http://blast.ncbi.nlm.nih.gov/Blast.cgi)
47. Rippka R, Deruelles J, et al. (1979) Generic Assignments, Strain Histories and
Properties of Pure Cultures of Cyanobacteria. Microbiology. 111:1-61
165
48. Russo F.D., & Silhavy T.J. (1993) The essential tension: opposed reactions in
bacterial two-component regulatory systems. Trends in Microbiology. 1(8): 306–
310
49. Sambrook, J., Fritsch E. F., & T. Maniatis. (1989) Molecular cloning: a laboratory
manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.
50. Sidler W.A. (2004) Phycobilisome and Phycobiliprotein Structures. The
Molecular Biology of Cyanobacteria (Advances in Photosynthesis and
Respiration. 1(1): 139-216
51. Simone R.D. (1987) Inclusion bodies in cyanobacteria: cyanophycin,
polyphosphate and polyhedral bodies. In: Fay P, Van Baalen C, eds. The
cyanobacteria. Amsterdam, The Netherlands: Elsevier, 199–225.
52. Stubs D., Fuchs T.M., et al. (2005) Identification and regulation of cold-inducible
factors of Bordetella bronchiseptica. Microbiology. 151(Pt 6):1895-909.
53. Stickney L.M., Hankins J.S., et al. (2005) Function of Conserved S1 and KH
Domains in Polynucleotide Phosphorylase. Journal of Bacteriolgy. 187(21):721421.
54. STRING v 9.05 (Search Tool for the Retrieval of Interacting Genes/Proteins) Known and Predicted Protein-Protein Interactions. Retrieved June 2013
(http://stringdb.org/newstring_cgi/show_input_page.pl?UserId=ERHXcJtwGChj
&sessionId=sAfGoUkzyPr5)
55. Summers M.L., Wallis J.G., et al. (1995) Genetic evidence of a major role for
glucose-6-phosphate dehydrogenase in nitrogen fixation and dark growth of the
cyanobacterium Nostoc sp. strain ATCC 29133. Journal of Bacteriology. 177(21):
6184–6194.
56. Sutherland J.M., Herdman M., & Stewart W.D.P. (1979) Akinetes of the
Cyanobacterium Nostoc PCC 7524: Macromolecular Composition, Structure and
Control of Differentiation. Microbiology. 115(2): 273-287.
57. Thiel T., & Wolk C.P. (1983) Metabolic activities of isolated akinetes of the
cyanobacterium spongiaeforme. Journal of Bacteriology. 156(1):369-74.
58. Thomas J., Meeks J.C., et al. (1977) Formation of glutamine from ammonia ,
dinitrogen, and glutamate by heterocystis isolate from anabaena cylindrical.
Journal of Bacteriology. 129(3):1545-55.
59. Tomitani A, Knoll A. H., et al. (2006). The evolutionary diversification of
cyanobacteria: molecular-phylogenetic and paleontological perspectives.
166
Proceedings of the National Academy of Sciences of the United States of America.
103(14):5442-7
60. Trun N.J., & Trempy J.E. (2003) Fundamental Bacterial Genetics.
Australia:Wiley-Blackwell.
61. Walsby A,E. (2007) Cyanobacterial heterocyst: terminal pores proposed as sites
of gas exchange. Trends in Microbiology. Aug;15(8):340-9
62. Whitton B.A and Potts, M. Editors. (2000) The Ecology of Cyanobacteria - Their
Diversity in Time and Space Book. Kluwer Academic Publishers, Dordecht, The
Netherlands.
63. Wolk C.P., Ernst, A., Elhai J., (1994) Heterocyst metabolism and development.
In: The molecular biology of cyanobacteria. In: Bryant DA. Editor. The
molecular biology of cyanobacteria. Dordrecht, The Netherlands: Kluwer
Academic. Pp. 769-823. Kluwer, Boston. USA.
64. Wolk C.P. (1968) Movement of carbon from vegetative cells to heterocysts in
Anaaena cylindrica. Journal of Bacteriology. 96(6): 2138–2143.
65. Wolk C.P., Thomas J., et al. (1976) Pathway of Nitrogen metabolism after
fixation of N labeled gas by the cyanobacterium Anabaeena cylindrical. Journal
of Biological Chemistry. 251(16):5027-34.
66. West A.H. & Stock A.M. (2001) Histidine kinases and response regulator proteins
in two-component signaling systems. Trends in Biochemistry Sciences; 26(6):36976.
67. Zhang C., Laurent S., et al. (2006) Heterocyst differentiation and pattern
formation in cyanobacteria: a chorus of signals. Molecular Microbiology. 59(2):
367-375.
68. Zhou R. & Wolk C.P. (2003) A two-co ponent system mediates developmental
regulation of biosynthesis of a heterocyst polysaccharide. The Journal of
Biological Chemistry. 278(22):19939-46
69. Zhu J., et al. (1998) Regulation of hepA of Anabaena sp. strain PCC 7120 by
elements 5’ from the gene and by hepK. The Journal of Bacteriology. 180(16):
4233-42.
167
APPENDIX A
Oligonucleotide
Sequence
Function
DT88
*GAAGAGAAGGTGGAAATGGCGTTTTGG
DT89
GCGCATTTCCACCTTCTCTTC
Anchor Sequence (*note: 5’-end blocked to avoid oligimerization during
RACE ligation)
Forward Primer used for cDNA RACE PCR
NpF0022 RACEp1
ACTTGGTGCTTGACCAATCA
Reverse Primer used for reverse transcription and cDNA RACE PCR
NpF0022 RACEp2
GAGGAGGTAGAGATGACAAT
Reverse Nested Primer used for cDNA RACE PCR
NpF0020 RACEp1
TATAGAGGCTCTAGCCAGAT
Reverse Primer used for reverse transcription and cDNA RACE PCR
NpF0020 RACEP2
CCCAGATAGCCCTGTTTTA
Reverse Nested Primer used for cDNA RACE PCR
NpF0021 RACEp1
CAGCACTTCTCGACCATCTT
Reverse Primer used for reverse transcription and cDNA RACE PCR
NpF0021 RACEp2
GCGAGGTGCATCAGCATATT
Reverse Nested Primer used for cDNA RACE PCR
NpF2889 RACEp1
GGCAGAATACAGCAATCCGA
Reverse Primer used for reverse transcription and cDNA RACE PCR
NpF2889 RACEp2
CAAGCGATCGCACTGCTCTT
Reverse Nested Primer used for cDNA RACE PCR
NpR1110 RACEp1
AAGCAGGCGGAAAATCTGTA
Reverse Primer used for reverse transcription and cDNA RACE PCR
NpR1110 RACEp2
AGCCATGCTTCAGAGCACAA
Reverse Nested Primer used for cDNA RACE PCR
NpR0438 RACEp1
GGGCTTGCTCCTCTAACCTT
Reverse Primer used for reverse transcription and cDNA RACE PCR
NpR0438 RACEp2
ATCGCAAACCCGATTACACA
Reverse Nested Primer used for cDNA RACE PCR
NpR1798 RACEp1
GTTCACCATATTCTGACCCA
Reverse Primer used for reverse transcription and cDNA RACE PCR
NpR1798 RACEp2
GAGGCGTTTCAACATATACCT
Reverse Nested Primer used for cDNA RACE PCR
NpF4131 RACEp1
ACCGGAGATGCAAGATTTGA
Reverse Primer used for reverse transcription and cDNA RACE PCR
NpF4131 RACEp2
ACATTCACCATCCCGCAGTA
Reverse Nested Primer used for cDNA RACE PCR
NpR6228 RACEp1
ATGCCCGCACCCTAGCTATC
Reverse Primer used for reverse transcription and cDNA RACE PCR
NpR6228 RACEp2
GTACCCGGTTTCTGGCGAAT
Reverse Nested Primer used for cDNA RACE PCR
NpR1449 RACEp2
TCCTTGACCAGTCAAGACTAC
Reverse Primer used for reverse transcription and cDNA RACE PCR
NpR1449 RACEp1
AGTCTGTAGCACCAGCTTTGA
Reverse Nested Primer used for cDNA RACE PCR
NpR3548 RACEp1
GTGGTGACAGCTATTGCACA
Reverse Primer used for reverse transcription and cDNA RACE PCR
168
NpR3548 RACEp2
ACTTTCATCGTGGCAAGACT
Reverse Nested Primer used for cDNA RACE PCR
NpF2868 RACEp1
TAACGGCTGATGAGTCCCAA
Reverse Primer used for reverse transcription and cDNA RACE PCR
NpF2868 RACEp2
TCAGCTTTCCCTAGCTCCGT
Reverse Nested Primer used for cDNA RACE PCR
NpR5425 RACEp1
CCTTGTTGGGCGATCGCACT
Reverse Primer used for reverse transcription and cDNA RACE PCR
NpR5425 RACEp2
TGGGCGATCGCACTTACAAT
Reverse Nested Primer used for cDNA RACE PCR
NpF0022
PROMp1Forward
NpF0022
PROMp2Reverse
NpF0020
PROMp1Forward
NpF0020
PROMp2Reverse
NpF2889
PROMp1Forward
NpF2889
PROMp2Reverse
NpR1110
PROMp1Forward
NpR1110
PROMp2Reverse
NpR0438
PROMp1Forward
NpR0438
PROMp2Reverse
NpR1798
PROMp1Forward
NpR1798
PROMp2Reverse
NpF4131
PROMp1Forward
NpF4131
PROMp2Reverse
GGACGCGAACTTGAGCGTAGAAACGGG
AGA
TTCCCCCAATCGCGTCACATGAACCAGA
GT
TATAAATTGCGGATGTGGTTTAACTCTTG
GA
TATTTTTAGCTCAGGCTCCTCCAAAACTA
AC
AGCTCTGCAGATAATCCTTGCCTTTCGG
CT
ATCTGGTACCGCCAACTGTTGATGGTCT
TT
CTGCTCCCTCTTCCCTTCGATTACCAGG
A
ATTTGTGCTCTGAAGCATGG
Forward Primer with PstI restriction enzyme
construct
Reverse Primer with KpnI restriction enzyme
construct
Forward Primer with PstI restriction enzyme
construct Primer used for cDNA RACE PCR
Reverse Primer with KpnI restriction enzyme
construct Primer used for cDNA RACE PCR
Forward Primer with PstI restriction enzyme
construct Primer used for cDNA RACE PCR
Reverse Primer with KpnI restriction enzyme
construct Primer used for cDNA RACE PCR
Forward Primer with PstI restriction enzyme
construct Primer used for cDNA RACE PCR
Reverse Primer with KpnI restriction enzyme
construct Primer used for cDNA RACE PCR
Forward Primer with PstI restriction enzyme
construct Primer used for cDNA RACE PCR
Reverse Primer with KpnI restriction enzyme
construct Primer used for cDNA RACE PCR
Forward Primer with PstI restriction enzyme
construct Primer used for cDNA RACE PCR
Reverse Primer with KpnI restriction enzyme
construct Primer used for cDNA RACE PCR
Forward Primer with PstI restriction enzyme
construct Primer used for cDNA RACE PCR
Reverse Primer with KpnI restriction enzyme
construct Primer used for cDNA RACE PCR
ATGACTGCAGAGCCGAAGTCTCTGGAC
AGG
CACCGGTACCTAGGCGCAAGTTCCTTCA
CT
TATTCTGCAGTATCCGTTTAGCTACTTAA
GTC
ACCCGGTACCCCCTACGGCTAGAGAAA
TTTG
ATCGCTGCAGCTGGGCATTTGGTCACG
CCC
CCGAGGTACCGACGAAATGCTATAGCTC
TGA
169
used for GFP reporter
used for GFP reporter
used for GFP reporter
used for GFP reporter
used for GFP reporter
used for GFP reporter
used for GFP reporter
used for GFP reporter
used for GFP reporter
used for GFP reporter
used for GFP reporter
used for GFP reporter
used for GFP reporter
used for GFP reporter
NpR6228
PROMp1Forward
NpR6228
PROMp2Reverse
NpR1449
PROMp1Forward
NpR1449
PROMp2Reverse
NpR3548
PROMp1Forward
NpR3548
PROMp2Reverse
NpF2868
PROMp1Forward
NpF2868
PROMp2Reverse
NpR5425
PROMp1Forward
NpR5425
PROMp2Reverse
GFP Forward
TTTACTGCAGGGGTTGATAACAGCAATG
AA
GCAAGGTACCAACCCATCCAAACCAGG
AAT
TCAACTGCAGCACCTTGCCTAATGTCAA
GA
CTGCGGTACCCAGAAAACGCAT
GTAACTGCAGGCAAGGGCTATTACAAGA
CT
CTTCGGTACCAAGCCACCAGCCAATTAG
CA
GATTCTGCAGCAACCTCCCTACTCGCGT
CA
CGTCGGTACCTGCTGCTGAAGAAGGCC
TAGA
AAAACTGCAGGCATCTTAGCAAACCTCT
GA
GCGCGGTACCCACCTGATGAGGTTTGA
GGT
TATAGCGCTAGAGTCGACCT
GFP Reverse
GAGTCTCCAGTTTGTTTCAGT
PRL2 Forward
GTTGCTACGCCTGAATAAGT
PRL2 Reverse
GTTGCCGGGAAGCTAGAGTA
Forward Primer with PstI restriction enzyme
construct Primer used for cDNA RACE PCR
Reverse Primer with KpnI restriction enzyme
construct Primer used for cDNA RACE PCR
Forward Primer with PstI restriction enzyme
construct Primer used for cDNA RACE PCR
Reverse Primer with KpnI restriction enzyme
construct Primer used for cDNA RACE PCR
Forward Primer with PstI restriction enzyme
construct Primer used for cDNA RACE PCR
Reverse Primer with KpnI restriction enzyme
construct Primer used for cDNA RACE PCR
Forward Primer with PstI restriction enzyme
construct Primer used for cDNA RACE PCR
Reverse Primer with KpnI restriction enzyme
construct Primer used for cDNA RACE PCR
Forward Primer with PstI restriction enzyme
construct Primer used for cDNA RACE PCR
Reverse Primer with KpnI restriction enzyme
construct Primer used for cDNA RACE PCR
used for GFP reporter
used for GFP reporter
used for GFP reporter
used for GFP reporter
used for GFP reporter
used for GFP reporter
used for GFP reporter
used for GFP reporter
used for GFP reporter
used for GFP reporter
Forward Primer for Colony PCR of GFP reporter transformants
Reverse Primer for Colony PCR of GFP reporter transformants
Forward primer for Colony PCR of transformants with transgenic
pRL278 vector
Reverse primer for Colony PCR of transformants with transgenic
pRL278 vector
Table 8. Oligonucleotides used for RACE Mapping, cloning GFP reporter plasmid pSUN119, Colony PCR of GFP reporters and transgenic
pRL278 vectors. Gene Number is referenced in the oligonucleotide name (e.g NpF1110), except for DT88 DT89, GFP Forward, GFP Reverse,
PRL2 Forward and PRL Reverse, which are universal primers. Restriction Enzyme site sequences are highlight in in yellow and blue for PstI and
KpnI, respectively.
170
APPENDIX B
Oligonucleotide
NpF0020 Mut-P1
NpF0020 Mut-P2
NpF0020 Mut-P3
NpF0020 Mut-P4
NpF0020 Mut-P5
NpF0020 Mut-P6
NpF0020 Mut-P7
NpF0020 Mut-P8
NpF0021 Mut-P1
NpF0021 Mut-P2
NpF0021 Mut-P3
NpF0021 Mut-P4
NpF0021 Mut-P5
NpF0021 Mut-P6
NpF0021 Mut-P7
Sequence
CTGGATTCCTCACCTTCA
GC
GAATTGGTGCCTCTTTC
AAGC
GCTTGAAAGAGGCACCA
ATTCAACTTGAGCGTAG
AAACGGGA
TTCTAAAACCTGCTTGC
GCT
CCTTACTAGTCTGCTTGG
TACAAATGGCCT
TGCCGCATGCCCTCAAT
TGCCAGTTCTTCA
TTTGTGGTGGTTTGGTGT
TG
CGGCTTAGTTCCTGAAT
TGC
GTCGCTAGCGGTTTGTT
AGC
TTCTCCCGTTTCTACGCT
CAA
TTGAGCGTAGAAACGGG
AGAATCTACTGTGACGC
TACCATCA
CATCCCATAATGCCTCG
TCT
GATCACTAGTAGGCGTT
TGAAGTTAGCCAG
TGCCGCATGCTGGCAAA
CACCAAAGTCAGA
Function
Restriction
Enzymes
N/A
NE Buffer
N/A
N/A
Forward primer with linker sequence for amplifying
upstream flanking region
N/A
N/A
Reverse primer for amplifying downstream flanking region;
Colony PCR
Forward primer for PCR 3b
N/A
N/A
SpeI
NEB #2
Reverse primer for PCR 3b
SphI
NEB #2
Colony PCR
N/A
N/A
Colony PCR
N/A
N/A
Forward primer for amplifying upstream flanking region;
Colony PCR
Reverse primer for amplifying downstream flanking region
N/A
N/A
N/A
N/A
Forward primer with linker sequence for amplifying
upstream flanking region
N/A
N/A
Reverse primer for amplifying downstream flanking region;
Colony PCR
Forward primer for PCR 3b
N/A
N/A
SpeI
NEB #2
Reverse primer for PCR 3b
SphI
NEB #2
Colony PCR
N/A
N/A
Forward primer for amplifying upstream flanking region;
Colony PCR
Reverse primer for amplifying downstream flanking region
171
N/A
NpF0021 Mut-P8
NpF0022 Mut-P1
NpF0022 Mut-P2
NpF0022 Mut-P3
NpF0022 Mut-P4
NpF0022 Mut-P5
NpF0022 Mut-P6
NpF0022 Mut-P7
NpF0022 Mut-P8
NpR0438 Mut-P1
NpR0438 Mut-P2
NpR0438 Mut-P3
NpR0438 Mut-P4
NpR0438 Mut-P5
NpR0438 Mut-P6
NpR0438 Mut-P7
NpR0438 Mut-P8
ACGACCCCTTACCAACA
GTG
TACTGAGTAGCTCACAA
CCAT
ATGGTTGTGAGCTACTC
AGTACAAGTTGAAGTAG
GTACAACC
ATCGCACACACCACAGG
ATA
TAACACTAGTAAATTCC
ACAGTGACCAGCC
GCTAGCATGCATCAAAC
ACCAGCAAGTCCC
AATCTCGCAACCTGAAC
CAA
AATCTCGCAACCTGAAC
CAA
TATTAAGTGGGGCGATC
AGG
TTCTGGCGGTAAAGGCA
ACGT
ACGTTGCCTTTACCGCC
AGAACGTGTATTAAATA
GCAAACGT
TTGTGTTCCTCTGCGTTT
TC
GGCGACTAGTTGCTGGG
AGTAGAATTGCCT
CCAGGCATGCGCAAGCC
GCAAAAACATCTA
TTGGCAACTATCGCACA
AAC
AATCCTCCCACACCATC
AAA
Colony PCR
N/A
N/A
Forward primer for amplifying upstream flanking region;
Colony PCR
Reverse primer for amplifying downstream flanking region
N/A
N/A
N/A
N/A
Forward primer with linker sequence for amplifying
upstream flanking region
N/A
N/A
Reverse primer for amplifying downstream flanking region;
Colony PCR
Forward primer for PCR 3b
N/A
N/A
SpeI
NEB #2
Reverse primer for PCR 3b
SphI
NEB #2
Colony PCR
N/A
N/A
Colony PCR
N/A
N/A
Forward primer for amplifying upstream flanking region;
Colony PCR
Reverse primer for amplifying downstream flanking region
N/A
N/A
N/A
N/A
Forward primer with linker sequence for amplifying
upstream flanking region
N/A
N/A
Reverse primer for amplifying downstream flanking region;
Colony PCR
Forward primer for PCR 3b
N/A
N/A
SpeI
NEB #2
Reverse primer for PCR 3b
SphI
NEB #2
Colony PCR
N/A
N/A
Colony PCR
N/A
N/A
172
NpR1110 Mut-P1
NpR1110 Mut-P2
NpR1110 Mut-P3
NpR1110 Mut-P4
NpR1110 Mut-P5
NpR1110 Mut-P6
NpR1110 Mut-P7
NpR1110 Mut-P8
NpR1449 Mut-P1
NpR1449 Mut-P2
NpR1449 Mut-P3
NpR1449 Mut-P4
NpR1449 Mut-P5
NpR1449 Mut-P6
NpR1449 Mut-P7
NpR1449 Mut-P8
NpR1798 Mut-P1
AATTTCAATTGGCGGCT
CTA
TAATTCGAGCCATTCTC
CAGT
ACTGGAGAATGGCTCGA
ATTAAGGAAGTATCTGG
GCACAAGC
TGTGGTAAAGTCGCTGG
AAA
TTACCTCGAGCCCGTAA
TTCAGGAACCAAA
GGAGGCATGCACGAGCA
GGGGTATTCTTGA
CGAGATGACCACACCA
CAA
TGCTCCACAGAATCTGC
ATC
AAAGGCTTAGAAGGGCT
TGG
CCATCCTGTCTACTTCGT
CAT
ATGACGAAGTAGACAGG
ATGGGACAAGCACCAAT
AGGATATC
TGATGTTTCAAAAATGC
GGA
TGCCAGGAGGTCTTGGT
AAT
AATTGTTTAGCACTCGC
CGT
GCCTTTCACCTTGCCTA
ATG
CAGTCGGTTCAAGTCCA
GGT
CGTATCCTTGCTCGGTA
AGC
Forward primer for amplifying upstream flanking region;
Colony PCR
Reverse primer for amplifying downstream flanking region
N/A
N/A
N/A
N/A
Forward primer with linker sequence for amplifying
upstream flanking region
N/A
N/A
Reverse primer for amplifying downstream flanking region;
Colony PCR
Forward primer for PCR 3b
N/A
N/A
XheI
NEB #2
Reverse primer for PCR 3b
SphI
NEB #2
Colony PCR
N/A
N/A
Colony PCR
N/A
N/A
Forward primer for amplifying upstream flanking region;
Colony PCR
Reverse primer for amplifying downstream flanking region
N/A
N/A
N/A
N/A
Forward primer with linker sequence for amplifying
upstream flanking region
N/A
N/A
Reverse primer for amplifying downstream flanking region;
Colony PCR
Forward primer for PCR 3b
N/A
N/A
SacI
NEB #1
Reverse primer for PCR 3b
SphI
NEB #2
Colony PCR
N/A
N/A
Colony PCR
N/A
N/A
Forward primer for amplifying upstream flanking region;
Colony PCR
N/A
N/A
173
NpR1798 Mut-P2
NpR1798 Mut-P3
NpR1798 Mut-P4
NpR1798 Mut-P5
NpR1798 Mut-P6
NpR1798 Mut-P7
NpR1798 Mut-P8
NpF2868 Mut-P1
NpF2868 Mut-P2
NpF2868 Mut-P3
NpF2868 Mut-P4
NpF2868 Mut-P5
NpF2868 Mut-P6
NpF2868 Mut-P7
NpF2868 Mut-P8
NpF2889 Mut-P1
NpF2889 Mut-P2
AGAATGTGGCGCAACTG
CACA
TGTGCAGTTGCGCCACA
TTCTACTAACCAATCTC
GTAGACTG
CCCCATTAGTTCGCTTG
AAA
TTGCACTAGTAGCATTG
CTGATAAAAGGCG
TAACGCATGCGCGGAAA
GTTTTACTAACTCGC
AGCTAGGCAGTGTGCC
AGAG
TTGTTTGCACCCAGATG
GTA
CTCCCTACTCGCGTCAA
ATC
AATTACGTATGCTAGGG
ACAT
ATGTCCCTAGCATACGT
AATTAAGCCATATCCAT
CACATTAC
AAATCGCCAGCGATACA
AAC
GTTACTCGAGATCTAGC
GATCGCAAAGCTC
TAGTGCATGCCATACGA
CAGGCGATAAGCA
AACCATCTGCCCAATCT
CAG
CCATCACCATCAAACCA
GTG
ATAATCCTTGCCTTTCGG
CT
GCCATATCCTCTAAGAA
GACT
Reverse primer for amplifying downstream flanking region
N/A
N/A
Forward primer with linker sequence for amplifying
upstream flanking region
N/A
N/A
Reverse primer for amplifying downstream flanking region;
Colony PCR
Forward primer for PCR 3b
N/A
N/A
SpeI
NEB #2
Reverse primer for PCR 3b
SphI
NEB #2
Colony PCR
N/A
N/A
Colony PCR
N/A
N/A
Forward primer for amplifying upstream flanking region;
Colony PCR
Reverse primer for amplifying downstream flanking region
N/A
N/A
N/A
N/A
Forward primer with linker sequence for amplifying
upstream flanking region
N/A
N/A
Reverse primer for amplifying downstream flanking region;
Colony PCR
Forward primer for PCR 3b
N/A
N/A
XhoI
NEB #2
Reverse primer for PCR 3b
SphI
NEB #2
Colony PCR
N/A
N/A
Colony PCR
N/A
N/A
Forward primer for amplifying upstream flanking region;
Colony PCR
Reverse primer for amplifying downstream flanking region
N/A
N/A
N/A
N/A
174
NpR3548 Mut-P7
AGTCTTCTTAGAGGATA
Forward primer with linker sequence for amplifying
TGGCCAGATCAATCAAG upstream flanking region
CCTTAGCT
GCGCCATACTCCGTGTA
Reverse primer for amplifying downstream flanking region;
TTT
Colony PCR
TTGGCTCGAGTGCATCT
Forward primer for PCR 3b
GGCTAGCAAATAC
GTTTCTTAAGGTTTGGTT Reverse primer for PCR 3b
TATTCGCCTGGA
CCACACCCAAGAAATC
Colony PCR
CAACC
GCGCCATACTCCGTGTA
Colony PCR
TTT
TGCACCACATCTGATGG Forward primer for amplifying upstream flanking region;
AAT
Colony PCR
TTGCAGCCGCAAGCGGT Reverse primer for amplifying downstream flanking region
TAAC
GTTAACCGCTTGCGGCT
Forward primer with linker sequence for amplifying
GCAAGTAGTCGCTAGCC upstream flanking region
TTGTTGGA
CCAGCTAATTGTAGCAG Reverse primer for amplifying downstream flanking region;
GAG
Colony PCR
ACTGCTTAAGCCTGGAA Forward primer for PCR 3b
ATTCAGGAAACCA
AGACGCATGCAGATGTT Reverse primer for PCR 3b
GCTGGTAGTCGCA
Primers not made – Plasmid was missing
NpR3548 Mut-P8
Primers not made – Plasmid was missing
NpR4131 Mut-P1
CGCGATCGTCACTCAA
GTAG
TTCTTGAGAAATGGAG
ATGTC
GACATCTCCATTTCTCA
AGAACTTACAGCAGAA
ATTGATCGA
NpF2889 Mut-P3
NpF2889 Mut-P4
NpF2889 Mut-P5
NpF2889 Mut-P6
NpF2889 Mut-P7
NpF2889 Mut-P8
NpR3548 Mut-P1
NpR3548 Mut-P2
NpR3548 Mut-P3
NpR3548 Mut-P4
NpR3548 Mut-P5
NpR3548 Mut-P6
NpR4131 Mut-P2
NpR4131 Mut-P3
Forward primer for amplifying upstream flanking region;
Colony PCR
Reverse primer for amplifying downstream flanking region
Forward primer with linker sequence for amplifying
upstream flanking region
175
N/A
N/A
N/A
N/A
XhoI
NEB #2
AfiII
NEB #2
N/A
N/A
N/A
N/A
N/A
N/A
N/A
N/A
N/A
N/A
N/A
N/A
AfiII
NEB #2
SphI
NEB #2
NpR4131 Mut-P5
Reverse primer for amplifying downstream flanking region;
Colony PCR
Forward primer for PCR 3b
SpeI
NEB #2
NpR4131 Mut-P6
Reverse primer for PCR 3b
SphI
NEB #2
N/A
N/A
N/A
N/A
N/A
N/A
N/A
N/A
SpeI
NEB #2
SphI
NEB #2
N/A
N/A
N/A
N/A
NpR4131 Mut-P4
GGAACAGCGCGAAAGA
ATAG
TGAAACCTACCCGCTTT Colony PCR
ACC
ATCGTTCGACTGAGCG
Colony PCR
NpR4131 Mut-P8
ACTT
CAGTCTCAAGAAGCGG
Forward primer for amplifying upstream flanking region;
NpR5425 Mut-P1
TCAA
Colony PCR
TTCAGTTGCCAGTAGTT Reverse primer for amplifying downstream flanking region
NpR5425 Mut-P2
GAGG
CCTCAACTACTGGCAA
Forward primer with linker sequence for amplifying
NpR5425 Mut-P3
CTGAAAAGCGGATTAG upstream flanking region
TTTGTCGATG
ATCAGCACTGCCGGTT
Reverse primer for amplifying downstream flanking region;
NpR5425 Mut-P4
AAAA
Colony PCR
TTGTACTAGTGGACATT Forward primer for PCR 3b
NpR5425 Mut-P5
ACTGGGTTAGCTG
TTGAGCATGCGCGAAA
Reverse primer for PCR 3b
NpR5425 Mut-P6
ATGCTCCAAATGAT
GCCAGGGTGCCAATAC
Colony PCR
NpR5425 Mut-P7
TAAA
TTGTTTGCACCCAGATG Colony PCR
NpR5425 Mut-P8
GTA
Table 9. Oligonucleotide Primers for PCR mediated deletional gene mutagenesis and Colony PCR.
NpR4131 Mut-P7
176
APPENDIX C
Gene Primer
NpF0020 Mut-P4/Mut-P7
NpF0020 Mut-P1/Mut-P8
NpF0022 Mut-P4/ Mut-P7
NpF0022 Mut-P1/Mut-P8
NpF2868 Mut-P4/ Mut-P7
NpF2868 Mut-P1/Mut-P8
NpF2889 Mut-P4/ Mut-P7
NpF2889 Mut-P1/Mut-P8
NpR0438 Mut-P4/ Mut-P7
NpR0438 Mut-P1/Mut-P8
NpR1110 Mut-P4/ Mut-P7
NpR1110 Mut-P1/Mut-P8
NpR1449 Mut-P4/ Mut-P7
NpR1449 Mut-P1/Mut-P8
NpR1798 Mut-P4/ Mut-P7
NpR1798 Mut-P1/Mut-P8
NpR5425 Mut-P4/ Mut-P7
NpR5425 Mut-P1/Mut-P8
NpR6228 Mut-P4/ Mut-P7
NpR6228 Mut-P1/Mut-P8
NpF4131 Mut-P4/ Mut-P7
NpF4131 Mut-P1/Mut-P8
MgCl2 Volume
Reaction-1
3 ul
3 ul
3 ul
3 ul
3 ul
3 ul
4.5 ul
3 ul
3 ul
3 ul
4.5 ul
4.5ul
4.5 ul
3 ul
3 ul
3 ul
3 ul
3 ul
6 ul
3 ul
4.5 ul
6 ul
Annealing
Temp
54 C°
54 C°
52 C°
54 C°
54 C°
54 C°
55 C°
50 C°
57 C°
60 C°
52 C°
50 C°
48 C°
54 C°
52 C°
52 C°
53 C°
59 C°
47 C°
52 C°
52 C°
63 C°
Extension
Time
4 min
4 min
3 min
3 min
3 min
3 min
5.3 min
5.3 min
2 min
3 min
3 min
3 min
3 min
3 min
3 min
3 min
4 min
4 min
2 min
2 min
3 min
3 min
Expected Amplicon Length
Wild-type/Mutant (bp)
3950/1763
3846/1659
2297/1208
2831/1742
1714/1200
1709/1195
5122/1837
5121/1836
1915/1621
1874/1580
2272/1279
2493/1500
2443/1200
2763/508
4791/1641
4441/814
3271/1187
3607/1519
1980/1326
1829/1170
2712/1116
2854/1989
Comments
Table 10. Colony PCR parameters for Mut-P1/Mut-P8 and Mut-P4/Mut-P7 primer pairs
177