CALIFORNIA STATE UNIVERSITY, NORTHRIDGE
MicroRNA AS A POTENTIAL REGULATOR OF BMP-MEDIATED
CHONDROGENESIS
A thesis submitted in partial fulfillment of the requirements
For the degree of Master of Science
in Biology
By
Joseph Michael Aldahl
May 2013
The thesis of Joseph Aldahl is approved:
_______________________________________
_________________
Cheryl Van Buskirk, Ph.D.
Date
_______________________________________
_________________
Mary-Pat Stein, Ph.D.
Date
_______________________________________
_________________
Cindy S. Malone, Ph.D., Chair
Date
California State Unversity, Northridge
ii
Dedication
This thesis is dedicated to Dr. Cindy Malone, who provided me with this
incomparable opportunity to further my education in ways I never thought possible, as
well as to Mary-Pat Stein and Cheryl Van Buskirk for their support and mentorship.
Finally, this thesis is dedicated to Michael Grizel, who has provided me with the tools
required for success during this process and beyond.
iii
Table of Contents
Signature Page
ii
Dedication
iii
List of Tables
vi
List of Figures
vii
Abstract
viii
Section 1: Introduction
1
1.1 - Overview
1
1.2 – Endochondral Ossification
2
1.3 – Bone Morphogenic Protein Signaling
4
1.4 – MicroRNA Overview
10
1.5 – MicroRNA Biogenesis
11
1.6 – SMAD-Mediated microRNA Maturation
14
Section 2: Methods
18
2.1 – Mouse Lines
18
2.2—DNA Isolation and Genotyping
19
2.3 – Chondrocyte Isolation and Cell Culture
20
2.4 – Adenovirus Infection
21
2.5 - RNA Isolation and Quantitative Real Time PCR (qRT-PCR)
21
2.6 – Primer Design
23
2.7 – MicroRNA Microarray
24
iv
Section 3: Results
25
3.1 -- Response of RNAi Pathway Effectors to Absence of SMAD4
25
3.2 -- SMAD4 is Required for Processing of a Subset of miRNAs
26
3.3—BMP Downregulates Argonaute1 Expression
28
3.4 –MicroRNA Expression Profiling
30
Section 4: Discussion
34
References
42
v
List of Tables
Table 1 –Putative candidate microRNAs identified from the literature
27
Table 2 –List of predicted targets of microRNAs of interest
33
vi
List of Figures
Figure 1 –Canonical BMP signaling pathway
5
Figure 2 –Structure of a phosphorylated R-SMAD protein
6
Figure 3 – Overview of BMP signaling through TAK1
8
Figure 4 – Differential effects of tissue-specific SMAD knockouts
9
Figure 5 – MicroRNA biogenesis
12
Figure 6 –SMAD-mediated regulation of microRNA expression
15
Figure 7 –Mouse lines used to generate SMAD4CKO
18
Figure 8-- Representative genotyping results
19
Figure 9-- RNAi pathway effector expression
25
Figure 10—Effects of BMP on mature miRNA expression is SMAD4 dependent 28
Figure 11—Argonaute1 expression is BMP-responsive
29
Figure 12—Heat map for microRNA microarray
30
Figure 13—Cluster diagram of microarray samples
31
Figure 14—Effect of SMAD4 and BMP on chondrocyte microRNA profiles
32
vii
Abstract
MicroRNA AS A POTENTIAL REGULATOR OF BMP-MEDIATED
CHONDROGENESIS
By
Joseph Aldahl
Master of Science in Biology
The TGFβ/BMP family of intercellular ligands has been shown to regulate several
biological processes, including cartilage development. Dysfunction in TGFβ/BMP
pathways in chondrocytes has been implicated in osteoarthritis, a debilitating disease
prevalent in humans. The SMAD family of proteins plays an integral role in the
intracellular transduction of canonical TGFβ/BMP signals. Both canonical and
noncanonical TGFβ/BMP signaling pathways with differential SMAD requirements have
gained notoriety as important in proper skeletal formation. Cartilage-specific knockout
of different SMADs gives rise to a range of phenotypes in mouse models, indicative of
the importance of noncanonical signaling in cartilage development. This project
examines the expression of microRNAs in response to BMP2 treatment in primary mouse
chondrocytes. We hypothesized that a noncanonical BMP signaling pathway involving
posttranscriptional microRNA regulation is integral to proper cartilage formation.
Herein, we determined that several proteins involved in microRNA maturation do not
viii
change expression levels significantly in SMAD4 cartilage-specific knockout mice. This
suggests that SMAD4 is not required for proper microRNA maturation. However, BMP
treatment significantly downregulated Argonaute1 expression independent of SMAD4.
Microarray analyses revealed several microRNAs that were also BMP responsive in
chondrocytes in a SMAD4-independent manner. Predicted microRNA targets include
proteins involved in proper skeletal formation. Taken together, these results indicate a
novel BMP signaling pathway in cartilage and lay the groundwork for future
investigations into the mechanisms of skeletal formation and degeneration.
ix
Section 1: Introduction
1.1 Overview
The processes governing skeletal formation have been the subject of intense study
for several decades. It has been conclusively determined that several different
biochemical pathways are at play in the development and maintenance of a healthy
skeleton (Kronenberg, 2003). However, the interplay between these pathways is the
subject of an ever-growing body of knowledge. These concepts are of the utmost
importance not only in the pursuit of knowledge, but also in the search for medical
treatments for skeletal dysplasias and degenerative skeletal diseases such as
osteoarthritis. Due to the high conservation of the processes known to govern skeletal
development across all vertebrates, animal models are a commonly used tool to study
developmental and regulatory mechanisms (van der Kraan, 2013).
An important signaling pathway in cartilage-mediated long bone formation is the
bone morphogenic protein (BMP) pathway (Yoon and Lyons, 2004). Long known to be
integral to proper skeletal formation, recent discoveries have uncovered novel pathways
through which BMP-mediated signals are transduced. In particular, BMP ligands have
been shown to modulate gene expression in different cell types via a microRNA
mechanism of regulation (e.g. Li et al., 2008). Moreover, microRNA-mediated BMP
regulation has been shown to operate through more than one mechanism (Davis et al.,
2008). The focus of this research project was to examine the mechanism through which a
subset of microRNAs is regulated by BMP in the development and maintenance of
cartilage.
1
1.2 Endochondral Ossification
Endochondral bone formation is the process through which the vast majority of
the mammalian skeleton is formed. Through a tightly regulated process, mesenchymal
cells condense and become chondrocytes, which serve as a template for bone. The
interplay between several different regulatory elements is responsible for proper
development (Yoon and Lyons, 2004). Under the guidance of these elements,
chondrocytes undergo a developmental regime in which they grow in size to become
hypertrophic. After secretion of a suitable and balanced extracellular matrix rich in
connective proteins such as collagens II and X, the hypertrophic chondrocytes apoptose,
leaving behind this matrix. Serving as a scaffold for the developing bone, the matrix is
invaded and filled by blood vessels and osteoblasts, and the primary spongiosa is laid
down (Lewis et al., 2011; Wilson et al., 2012).
In the cartilage stage of endochondral bone formation, there are several important
processes that take place to ensure the proper patterning and development of bone.
Through a series of tightly controlled feedback loops, the cartilage template (called the
growth plate) is laid down in an organized and directional fashion. Even after bone
formation, the growth plate remains an active site of chondrocyte-mediated growth in the
long bones (Mirtz et al., 2011). At one end of the growth plate, adjacent to series of
resting chondrocytes, a population of stem-like proliferating chondrocytes reproduce
themselves in a linear fashion. As the leading edge of cells moves farther from the end of
the bone, the combination of signals gradually changes, instructing the proliferating
chondrocytes to stop proliferating and become hypertrophic. These signals include
secreted hormones such as bone morphogenic proteins (BMPs), Indian hedgehog (IHH)
2
and parathyroid hormone-related protein (PTHrP), transcription factors including
RUNX2 and osterix, as well as microRNAs including miR-1 (Tu et al., 2012; Chen et al.,
2012; Oh et al., 2012; Sumiyoshi et al., 2010). As mentioned above, hypertrophic
chondrocytes secrete a characteristic matrix of collagen and aggrecan, and also signal for
the invasion of blood vessels. Additionally, perichondral cells near hypertrophic
chondrocytes become osteoblasts, thus forming the bone collar. Upon completion of this
program of chondrocytic hypertrophy, the chondrocytes apoptose, leaving behind a
matrix suitable for the invasion of osteoblasts and the subsequent formation of bone
(Kronenberg, 2003).
This program of endochondral bone formation is tightly regulated by a variety of
factors both spatially and temporally, such that there are a number of places along the
way where the process can go awry. Through studies of aberrant signaling, several
factors have been shown to be necessary to ensure proper endochondral ossification
(Kronenberg, 2003). Animal studies utilizing specific-gene knockouts have
demonstrated abnormal skeleton formation (Monemdjou et al., 2012; Retting et al.,
2009). Mutations in a variety of receptors, as well as intracellular effector proteins, also
give rise to a wide variety of skeletal disorders. Ectopic expression of regulatory
elements can also create an observable phenotype. For example, over expression of
microRNA 1 (miR-1) in hypertrophic chondrocytes significantly represses the production
of aggrecan, an important proteoglycan component of the extracellular matrix (ECM) laid
down by chondrocytes (Sumiyoshi et al., 2010). Additionally, mutations in the genes for
ECM components (i.e. collagen genes) can be equally problematic, preventing
osteoblasts from successfully invading and populating the ECM (Wilson et al., 2012). A
3
variety of diseases are attributed to dysfunction in these processes, ranging from severe
skeletal dysplasias to degenerative diseases like osteoarthritis.
1.3 Bone Morphogenic Protein Signaling
A group of extracellular signaling molecules instrumental in the development of
cartilage and bone, as well several other tissue types, is the transforming growth factor-β
(TGFβ) family of ligands. A subgroup within this superfamily is the bone morphogenic
proteins (BMPs), of which more than twenty have been discovered in humans (Chen et
al., 2004). BMPs have been implicated in several processes ranging from developmental
patterning to cell cycle regulation and cancer. These extracellular ligands operate
through several distinct mechanisms, including a canonical, a TAK1-mediated, and a
microRNA-mediated pathway.
Canonical BMP signaling has been well studied, and there has been considerable
work done to elucidate the mechanism of the canonical pathway (Yoon and Lyons, 2004;
Shi and Massague, 2003; Sieber et al., 2009; Heldin and Moustakas, 2011). Briefly, an
extracellular BMP ligand binds to a type II BMP receptor dimer (BMPRII). BMPRII is a
serine/threonine kinase receptor (Chen et al., 2004). The type II receptors complex with
a pair of type I receptors and phosphorylate serine/threonine residues on the type I
receptors (Figure 1). An activated BMP receptor complex consists of four subunits, two
type II receptors and two type I receptors (Yoon and Lyons, 2004). Upon
phosphorylation of BMPRI, the type I receptors phosphorylate intracellular substrates,
known as receptor-regulated (R-) SMADs (Shi and Massague, 2003). In transduction of
the BMP signal, the R-SMADs include SMADs 1, 5, and 8 (Heldin and Moustakas,
4
Figure 1. Canonical BMP Signaling Pathway. Signaling through the BMP pathway operates through
R-Smad (green) and Co-Smad (pink) proteins in the canonical pathway of gene regulation. The
complexed Smads enter into the nucleus and regulate gene expression along with a suite of other
transcription factors.
2011). The R-SMADs 2 and 3 play a parallel role in the transduction of TGFβ signaling.
SMADs 6 and 7 are inhibitor (I-) SMADs, and play a regulatory role in the modulation of
both BMP and TGFβ signaling. (Yoon and Lyons, 2004) In the cytosol, a pair of
activated R-SMADs recruits the common-partner SMAD (co-SMAD), SMAD4. This
trimeric complex (R-SMAD 1,5,8/Co-SMAD4) translocates into the nucleus. In concert
with a variety of additional transcription factors, the BMP-induced SMAD complex can
activate or repress target genes in a pattern that is specific to different cell types due to
the activity of co-activators and cis elements (Deckers et al., 2006). Additionally, in
some cases SMAD proteins bind directly to a conserved DNA sequence (5’-CAGAC-3’)
known as the SMAD-binding element (SBE), and thereby serve to modulate gene
5
transcription via direct DNA binding (Davis et al., 2010). The structural and mechanistic
characteristics of BMP signaling are highly conserved across a variety of species (Morita
et al., 1999).
SMAD proteins are the downstream effectors in the canonical mediation of TGFβ
superfamily signaling (Sieber et al., 2009). The name SMAD is a portmanteau of two
names given to orthologues found in Drosophila and C. elegans. Decapentaplegic (DPP)
is a homolog of BMP2 in
found in Drosophila
(Nellen et al., 1994). A
novel protein downstream
of DPP was characterized
in 1995. Mutations in the
novel protein recapitulated
the activity of mutated DPP
(Sekelsky et al., 1995).
Figure 2: Structure of a phosphorylated R-Smad Protein. The
DNA-binding MH1 domain is shown in blue, and is connected to
the protein-binding MH2 domain (green) via the linker sequence.
Modified from Shi and Massague, 2003
Mutations were also shown
to be maternally inherited. As such, the proteins were designated Mothers against
decapentaplegic (MAD) (Sekelsky et al., 1995). In C. elegans, mutation in SMAD
homologs gave rise to a shortened, or small, body length (Morita et al., 1999). As such,
the class of proteins was termed the SMA proteins. Taken together, these names gave
rise to SMAD.
The SMAD family of proteins is made up of eight members in vertebrates.
Structural similarity is shared among the R-SMADs and the Co-SMAD, while the I6
SMADs are structurally and functionally distinct (Shi and Massague, 2003). The RSMADs and Co-SMAD are made up of two distinct domains which are connected by a
linker region (Figure 2). The N-terminal domain is termed the MH1 (Mad Homology 1)
domain, and the carboxyl-terminus domain is the MH2 domain. The amino acid
sequences are similar among the various SMADs, but the linker region between these two
domains can vary significantly between SMAD family members (Xu, 2006). The MH1
domain contains DNA-binding capabilities, along with the ability to bind other proteins.
In addition, the MH1domain encodes the nuclear localization signal (NLS) for the RSMADs and Co-SMAD. The NLS binds an importin which brings the SMADs to the
nuclear pore complex (NPC) (Shi and Massague, 2003). The C-terminal domain has the
capability to bind with other proteins, including the other SMADs in order to form the
complex required to transduce canonical signaling (Heldin and Moustakas, 2011). It is
also the MH2 domain that interacts and is phosphorylated by the type I BMP receptor.
Furthermore, the MH2 domain is responsible for directly contacting the nuclear pore
complex (NPC) and thus the shuttling of SMADs in and out of the nucleus. The linker
sequence has several phosphorylation sites, and is thus instrumental in crosstalk with
other signaling pathways. The linker regions also interact with regulatory elements
including the SMURF proteins and I-SMADs (Shi and Massague, 2003).
Over the past several years, noncanonical mechanisms of BMP signaling have
gained notoriety. Among these is the TGFβ-activated kinase 1 (TAK1)-mediated MAPK
pathway (Figure 3) (Moustakas et al., 2005). Similar to the canonical SMAD-mediated
BMP pathway, this TAK1 mechanism has been shown to modulate gene expression at the
transcriptional level (Greenblatt et al., 2010). Originally shown to be SMAD7
independent, these
pathways involve
TAK1 activation of
the p38 mitogenactivated kinase
(MAPK) pathway as
well as TAK1
regulation of the NFκB pathway
(Moriguchi et al.
Figure 3: Overview of BMP signaling through TAK1. BMP ligand
binding to receptors can activate TAK1-mediated pathways including
p38, JNK, ERK, and crosstalk with SMADs.
1996). More recent
work has shown several examples of interaction, overlap, and crosstalk between TAK1mediated pathways and SMAD proteins in a variety of situations. Physical interactions
between SMAD proteins and TAK1, as well as functional redundancy of p38 and
SMAD4 in development have also been demonstrated (Hoffmann et al., 2005, Xu et al.,
2008).
In addition to the BMP-responsive TAK1 pathways, recent studies have shown a
subset of microRNAs to be regulated by BMP through a SMAD-mediated pathway,
which will be discussed in detail below. Briefly, a fraction of primary microRNA
transcripts generated have been identified as containing a SBE in a region accessible by a
SMAD complex. Upon signaling, SMAD proteins are recruited a nuclear microRNA
processing complex and facilitate the maturation process of these microRNAs.
Expression of microRNAs enhances a cell’s ability to regulate stability of target mRNA
8
transcripts (Davis et al., 2010).
In work done in vitro as well as in vivo in mouse models, it has been shown that a
range of phenotypes exists in tissue-specific knockouts of different BMP pathway
effectors (Chu et al., 2004; Heldin and Moustakas, 2011; Retting et al., 2009). These
phenotypes vary not only in specific presentation but also in severity. A SMADdependent BMP
mechanism
regulates the
retinoic acid
induced
differentiation of
embryonic stem
cells (Chen et al.,
2012). Based on
the dogmatic
canonical BMP
pathway, knockout
Figure 4. Differential effects of tissue-specific SMAD knockouts. Skeletal
preps of P0 wildtype (left) and SMAD1/5CKO (center) mice. SMAD4
knockout mice are smaller than littermates at 32 days (right top). Hindlimbs
at P10 (right middle) and P32 (right bottom) reflect the less developed bone
in SMAD4CKO cartilage. Bone is stained in red, cartilage in blue.
Modified from Retting et al. 2009 and Zheng et al. 2005
of SMAD4 should provide a phenotype comparable to the knockout of the functionally
related SMADs 1 and 5. In order for the pair of R-SMADs to be shuttled into the nucleus
to regulate transcription, it has long been though that they must be in complex with
SMAD4. Indeed, global knockout of either SMAD4 or SMAD1/5 results in severe
effects on early developmental processes including gastrulation as well as developmental
patterning (Sirard et al., 1998). However, tissue-specific ablation of SMAD4 or
9
SMAD1/5 often gives rise to a range of phenotypes (Zheng et al, 2005; Retting et al,
2009).
Of specific interest to this study, differential phenotypes are seen in cartilagespecific knockouts of SMAD4 and SMAD1/5 (Figure 4). In cartilage-specific knockout
of SMAD4 driven by a Collagen II promoter via a Cre-lox system (SMAD4CKO), mutant
mice exhibit a disorganized growth plate as well as retardation of long bone growth
(Figure 4). Knockout of SMAD1/5 with a similar system (SMAD1/5CKO), meanwhile,
gave rise to a severe chondrodysplasia and no viable mice (Retting et al., 2009). The
only bone that forms in SMAD1/5CKO mice results from intramembranous ossificaction, a
process devoid of a cartilage intermediate. Though developmental timing of knockout in
in vivo experiments does lend a considerable amount of variation in the phenotypes seen,
it remains prudent to state that conditional knockout of SMAD1/5 generally presents with
a much more severe phenotype than does knockout of SMAD4, regardless of the
promoter used for the knockout.
1.4 MicroRNA Overview
MicroRNAs are small, endogenous noncoding RNA molecules (Davis and Hata,
2009). Evolutionarily conserved, microRNAs are thought to be present in all eukaryotic
cells, and microRNA involvement has been demonstrated in several biological processes
including development, cell cycle regulation, differentiation and cellular metabolism
(Bushati and Cohen, 2007). Mature microRNAs (miRNAs) are generally 18 to 25
nucleotide single stranded RNA molecules that complimentarily base pair with specific
mRNAs in a posttranscriptional regulatory mechanism. The seed sequence, nucleotides 2-
10
7 at the 5’ end of the mature microRNA, is thought to be the main indicator of
miRNA/mRNA complementarity, as a perfect complementary match results in the
predictable targeting of specific mRNAs. However, recent studies suggest that
alternative mechanisms in which the sequence of the 3’ end of the miRNA has a high
complementarity to the target mRNA (Nicolas et al., 2008).
The RNA-induced silencing complex (RISC) consists of a mature microRNA and
Argonaute proteins, and the RISC complex is the functional machinery bringing
microRNAs to their corresponding mRNA molecule(s). Depending on the level of
complementarity, these miRNAs can either (1) repress the expression of the
corresponding mRNA by blocking the translational machinery, or (2) or tag the target
mRNA for degradation (Davis and Hata 2009). As a general rule, the amount of effect a
microRNA has on its target is directly related to its complementarity to the target. In
most known cases, the miRNA binding sites lie in the 3’ untranslated region (UTR) of
target mRNAs (Bushati and Cohen, 2007). In addition, recent research has led to the
conclusion that there is not a one-to-one relationship between miRNAs and target mRNA
molecules (Selbach et al., 2008). A specific miRNA in a given cell type can target and
thereby regulate several different mRNAs, and a single mRNA transcript can be
regulated by several different miRNAs.
1.5 MicroRNA Biogenesis
MicroRNAs are endogenously encoded in the genome and are initially transcribed
as primary (pri-) miRNA transcripts (Figure 5). These pri-miRNAs can be hundreds to
thousands of nucleotides in length, and may encode the precursors of multiple mature
11
miRNAs (Ambros et al., 2003). miRNA coding sequences are found throughout the
genome. Some miRNAs are transcribed similar to standalone genes with independent
promoter regions, while others lie within intronic regions of genes, thereby allowing for
transcription along with the host gene (Rodriguez et al., 2004). Similar to other RNA
transcripts, most miRNAs are initially capped on their 5’ end with a modified
methylguanosine residue and polyadenylated. A characteristic “stem-loop” structure
results from base pairing within the miRNA molecule, and is an important physical
attribute in the further processing of the molecule (Davis and Hata, 2009).
While still in the nucleus, the pri-miRNA is processed into a precursor miRNA
(pre-miRNA) by a microprocessor complex centered on an RNaseIII known as Drosha.
The Drosha complex
involves various
other cofactors
including DiGeorge
critical region 8
(DGCR8), which is
responsible for
mediating the
physical binding
between Drosha and
the pri-miRNA
(Winter et al., 2009).
Figure 5. microRNA biogenesis. After being transcribed as a primary
miRNA transcript (pri-miRNA), the Drosha complex processes the
transcript to a pre-miRNA. This precursor is transported to the cytoplasm
where it is further processed by a Dicer complex. The resulting duplex is
incorporated into the RNA-induced silencing complex (RISC), where its
complementarity to target mRNAs dictates the regulatory activity. The
RISC complex transports target mRNAs to cytoplasmic P-bodies where
they are degraded.
12
RNA helicases p68 and p72, as well as SMAD proteins have been reported to have an
impact on the processing of pri-miRNA to pre-miRNA in certain cases. Upon
recruitment of the pri-miRNA to the processing complex, Drosha cleaves the RNA
molecule on both the 5’ and 3’ end, giving rise to the ~80 nucleotide pre-miRNA (Davis
et al., 2008; Winter et al., 2009).
Following nuclear processing by the Drosha complex, the pre-miRNA is shuttled
to the cytoplasm. This move is mediated by the karyopherin Exportin-5 protein.
Complexed with Ran-GTP, Exportin-5 transports the pre-miRNA through a nuclear pore
out to the cytoplasm (Bohnsack et al., 2004). Once in the cytoplasm, the processing of
the pre-miRNA continues. The RISC loading complex (RLC) is made up of several
proteins including Dicer and Argonaute proteis. Similar to Drosha, Dicer is an RNaseIII
responsible for cleavage of the microRNA precursor. Dicer cleaves the pre-miRNA at
the base of the terminal loop structure, creating a double stranded miRNA molecule
approximately 22 nucleotides in length (Davis and Hata, 2009). The two strands are
referred to as the mature miRNA guide strand and the passenger strand, designated as
miRNA* (Figure 5) (Hata and Davis, 2010). The RLC proceeds to separate the two RNA
strands, and through an uncharacterized mechanism, selects the guide strand for loading
onto the RISC complex and usually directs the degradation of the passenger strand.
Recent work has demonstrated instances in which both the miRNA and the miRNA*
strands of a given pre-miRNA are incorporated into RISC complexes and facilitate
mRNA modulation (Sakurai et al., 2011). The catalytic components of the RISC
complex are members of the Argonaute (AGO) family RNase proteins. While it has been
shown that there is some functional redundancy among Argonaute family members,
13
studies suggest they usually perform distinct functions in translational repression (Meyer
et al., 2006). In the destabilization of target mRNAs, AGO1 degrades the poly-A tail,
while AGO2 blocks translational initiation factors from binding (Michon et al., 2010).
Using the complexed microRNA as a template, Argonautes and associated proteins seek
out the target mRNA to be regulated (Winter et al., 2009).
1.6 SMAD-Mediated microRNA Maturation
A definitive connection between the maturation process of a subset of microRNA
molecules and SMAD proteins has been described (Davis et al, 2010). For example,
miR-21 operates in a BMP-responsive manner in vascular smooth muscle cells (VSMCs)
(Davis et al., 2008). In these cells, a BMP-induced contractile phenotype was mediated
by miR-21 downregulation of programmed cell death 4 (PDCD4), an inhibitor of
contractile differentiation. In this case, the mechanism of microRNA regulation was
posttranscriptional (Figure 6). Upon stimulation by BMP, the R-SMADs1/5 are
phosphorylated and enter the nucleus. The R-SMADs bind to specific primary
microRNA transcripts based on the presence of a sequence known as the SMAD-binding
element (SBE). This sequence, 5’-CAGAC-3’, or a close variation thereof is generally
present in the stem region of the primary miRNA transcripts processed by SMADs
(Davis et al., 2010).
The posttranscriptional SMAD-mediated mechanism of microRNA maturation to
occurs in a SMAD4 independent manner (Davis et al., 2010). In general terms, SMAD4
is required for other BMP-induced pathways that operate through R-SMADs (Heldin and
Moustakas, 2011). However, as described above, grossly different phenotypes are seen
in mouse models with cartilage specific knockouts of SMAD4 and SMAD1/5 (Figure 4).
14
These differential phenotypes likely indicate that novel mechanisms are at play, relying
on SMAD1/5 for proper function, yet operating entirely or partially independent of
SMAD4. Recent studies have shown that microRNAs are required for the maintenance
differentiation of chondrocytes (Martinez-Sanchez et al., 2012, Miyaki et al., 2010).
We hypothesize that there is a BMP-responsive, SMAD1/5-dependent processing of
a subset of microRNAs occurring in chondrocytes that operates in a SMAD4
independent manner.
Figure 6. Smad-mediated regulation of microRNA expression. Upon stimulation by a BMP or TGFβ
ligand, Smad proteins can regulate microRNAs through the canonical pathway of BMP-mediated
transcriptional regulation (left) or the non-canonical posttranscriptional pathway by binding to a primary
microRNA transcript and facilitating the processing to a pre-microRNA (right). The Co-Smad (Smad4)
is generally required for transcriptional regulation, while posttranscriptional microRNA processing
occurs independent of Smad4.
15
While there is a growing body of work concerning the involvement of SMAD
proteins in Drosha mediated microRNA maturation, there is a dearth of data on this
process in chondrocytes. BMP has been shown to induce miR-21 maturation in vascular
smooth muscle cells (VSMCs) via a SMAD-controlled posttranscriptional step (Davis et
al., 2008). Moreover, SMAD proteins bind directly to the SMAD binding element
present in a subset of pri-miRNAs in a similar cell type, pulmonary artery smooth muscle
cells (PASMCs) (Davis et al, 2010). There has also been a considerable amount of work
recently attempting to characterize the microRNA profile of chondrocytes over the course
of their development (Kobayashi et al., 2008; Gradus et al., 2011). In a mesenchymal
cell line (C2C12), the changing microRNA profile upon BMP-induced osteogenesis has
been reported (Li et al., 2008). Though the microRNA profiles of chondrocytes and
osteocytes are thought to be somewhat similar, it is likely that subtle variations in the
microRNA profiles may play a part in the differential phenotypes observed in the two cell
types (Kobayashi et al., 2008).
A small number of microRNAs in chondrocytes have been identified that meet
the criteria to be regulated posttranscriptionally via a SMAD-mediated mechanism. One
potential target is mouse microRNA 27a (mmu-miR-27a). miR-27a is shown to be
upregulated upon BMP stimulation in C2C12 cells as well as PASMCs and is predicted
to act in a negative feedback fashion, down regulating the effects of BMP signaling
through the repression of growth signals (Li et al., 2008; Drake et al., 2011).
Additionally, miR-27a is present in chondrocytes, making this miRNA an attractive
target for therapeutic purposes (Kobayashi et al., 2008; Tardif et al., 2009).
miR-140 may also be posttranscriptionally regulated by SMADs in chondrocytes.
16
miR-140 has been shown to be present in cartilage at high levels, with little to no
expression elsewhere (Tuddenham et al., 2006). As is the case with miR-27a, miR-140
activity appears abnormal in osteoarthritic cartilage (Tardif et al., 2009). A proposed
mechanism for the role of miR-140 in osteoarthritis involves one of its confirmed targets,
ADAMTS5, an aggrecanase. ADAMTS5 breaks down extracellular matrix in cartilage
and without proper regulation (i.e. by miR-140), ADAMTS5 activity can promote the
progression of osteoarthritis (Miyaki et al., 2010). Though the level to which miR-140 is
BMP responsive is unknown, it has been shown to modulate BMP signaling in cartilage,
with complete loss causing skeletal defects (Nakamura et al., 2011).
miR-199a is yet another microRNA whose maturation may be controlled by
SMADs in cartilage. Expressed in chondrocytes, miRNA-199a is BMP-responsive
(Suomi et al, 2008; Davis et al., 2010). Similar to miR-27a, a consensus binding
sequence of 5’-CAGAC-3’ is also present (Drake et al., 2011). miR-199a also appears to
be involved in a negative feedback loop with BMP signaling, targeting SMAD1 in order
to modulate the process of chondrogenesis (Lin et al., 2009).
By examining the differential expressions of these BMP-responsive miRNAs in
the presence/absence of SMAD4, we can discover (1) the mechanism through which
these miRNAs are regulated by BMP and (2) alternative intracellular mechanisms
through which BMP-mediated signals are transduced in cartilage development. This
information may be applicable in many other aspects of developmental biology.
Furthermore, these studies can provide therapeutic targets for treatment for skeletal
diseases like osteoarthritis.
17
Section 2:Methods
2.1 Mouse Lines
In order to create the mice needed to perform many of these experiments, two
different mice lines were used. The first is a Cre recombinase expressing mouse. Cre is
driven by a Col2a1 promoter, giving spatial and temporal expression of Cre recombinase,
relegated to cells destined to a cartilage fate, beginning at embryonic day 9.5
(Ovchinnikov et al., 2000). This line of C57BL/6 mice carries the designation of Col2Cre transgenic mice. The second line of mice used in this project is another line of
C57BL/6 mice which carries a floxed SMAD4 allele (SMAD4fx/fx). LoxP sites flank the
first coding exon of the SMAD4 gene (Chu et al., 2004). In order to generate the mutant
mice used in these experiments, two generations of crosses were performed (Figure 7).
The parental (P) generation
consisted of one of each of
the above described lines.
The subsequent generation
(F1) resulted from a cross
of SMAD4fx/fx and a Col2Cre mouse. Potential F1
genotypes include mice
that do not express Cre and
have one floxed SMAD4
gene [Col2-Cre(-):
Figure 7: Mouse lines used to generate our SMAD4CKO.
In order to generate our SMAD4CKO mice, two generations
of crosses were required. The first was between a Col2Creexpressing mouse and a Smad4fxfx mouse. The resulting
Smad4fx/+; Col2Cre+ progeny is back crossed to a Smad4fxfx
mouse, thereby generating our Smad4fx/fx; Col2Cre
genotype.
18
SMAD4fx/+], as well as mice that do express Cre and have one floxed SMAD4 allele
[Col2-Cre:SMAD4fx/+]. Subsequently, a cross between a mouse of the genotype Col2Cre:SMAD4fx/+ and another SMAD4fx/fx mouse generates, among other things (F2), a
Col2-Cre:SMAD4fx/fx at a predicted ratio of 1/8. This is the genotype hereafter referred
to as SMAD4 cartilage-specific knockout (SMAD4CKO). Phenotypically, Col2Cre:SMAD4fx/+, Col2-Cre:SMAD4+/+, and SMAD4fx/fx littermates showed no
developmental difference
from wildtype mice and
A
were used as controls.
B
2.2 DNA Isolation and
Genotyping
Mice were
genotyped for Col2-Cre
expression and the
Figure 8: Representative genotyping results. Genotype
shown for a litter of 8 newborn pups born from a cross of
fx/fx
fx/+
Smad4 with Smad4 , Cre+. (A) Smad4 genotyping:
Upper bands represent the Smad4 conditional allele
fx/fx
(Smad4 ) at 675 bp, the lower band represents the wildtype
Smad4 allele (625 bp). (B) Cre expression genotyping: A
band indicates Cre presence, no band indicates absence. Pups
fx/fx
in lanes 5 & 6 are mutant (Smad4 , Cre+).
presence of the modified
SMAD4 conditional allele (Figure 8). DNA was isolated by digesting tail tissue
overnight in 500 µl tail lysis buffer with 10 µl proteinase K at 55°C. 10 µl of this
overnight lysate was combined with 100 µl 6% TritonX in H2O with AEBSF. Primers
used for genotyping were the following: Cre F:5’-TGCTCTGTCCGTTTGCCG-3’; and
R:5’-ACTGTGTCCAGACCAGGC-3’. SMAD4 genotyping primers were previously
reported, and are as follows: F, 5′-AAAATGGGAAAACCAACGAG-3-′; and R:5′TACAAGTGCTATGTCTTCAGCG-3′ (Chu et al., 2004). The SMAD4 F and R primers
19
amplify two different bands, depending on whether the SMAD4 allele is floxed. A
wildtype SMAD4 allele gives a band at 625 bp. A floxed conditional allele gives a
fragment at 675 bp in size (Chu et al. 2004).
2.3 Chondrocyte Isolation and Cell Culture
Primary mouse sternal chondrocytes were isolated from mice at postnatal day 0-1
similar to methods previously described (Lefebvre et al., 1994 (via Retting et al. 2009)).
Newborn mouse pups were sacrificed via isofluorane inhalation and decapitation. The
cartilaginous portion of the rib growth plates were then removed for in vitro cell culture.
The cartilaginous tissue was first washed in PBS and then subjected to digestion with 2
mg/ml pronase in PBS at 37°C for fifteen minutes, and then digested with 3 mg/ml
collagenase II in DMEM at 37°C for fifteen minutes. Samples were then digested
overnight in 0.3 mg/ml collagenase in DMEM at 37°C. The next day, chondrocytes were
strained through a 70 µm cell strainer and collected by centrifugation. The cells were
centrtifuged at 1000 rpm for five minutes and resuspended in fresh complete media. This
was repeated three times. Chondrocytes were then resuspended in chondrogenic media
consisting of DMEM with 10% FBS and 1% antibiotic/antimycotic with 50µg/ml
ascorbic acid. Normal culture conditions employed 1x103 cells/well in 12-well plates in
complete media, which consisted of DMEM with 10% FBS and 1%
antibiotic/antimycotic.
20
2.4 Adenovirus Infection and BMP2 Treatment
AdenoCre infection was performed on SMAD4fx/fx chondrocytes using AdenoCre
obtained from the University of Iowa Gene Transfer Vector Core. Infection was
performed in complete media for 48 hours using an estimated multiplicity of infection
(MOI) of 300. AdenoCont, an empty adenoviral vector, was used as a control. Gene
knockdown was quantified using qRT-PCR.
BMP2 treatment was performed in serum-free media following an 8-12 hour
serum starvation. Serum free media included DMEM with 1% antibiotic/antimycotic.
Cells were treated with purified recombinant human BMP2 (R&D Systems) at 100ng/ml
in serum free media for 2 hours, unless otherwise noted. Vehicle treatment was used as
control. Vehicle consisted of serum free media without BMP2. In vehicle-treated
controls, media contents were changed in concert with the BMP-treated samples, with the
only difference being the absence of BMP2.
2.5 RNA Isolation and Quantitative Real Time PCR (qRT-PCR)
For examination of expression of RNAi pathway effectors and other nonmicroRNAs, total RNA was isolated from cultured sternal chondrocytes using the
RNeasy Kit (Qiagen). DNase treatment was performed as described by protocol
(Ambion). Briefly, 3 µl of reaction buffer and 1µl DNase1 are added to a 26µl solution
containing 2000ng of total RNA in DEPC water. This mixture is incubated at 37°C for
thirty minutes. The reaction is terminated by adding 2 µl of DNase Inhibitor Reagent at
room temperature for two minutes. Each sample is centrifuged at 10000g for 90 seconds,
and the supernatant is saved. RNA concentration was determined using a Nanodrop 2000
spectrophotometer. For each reverse transcription, 2 µg RNA was reverse transcribed
21
into cDNA using the RevertAid M-MuLV reverse transcriptase system (Fermentas).
RNA was combined with 1 µl random hexamer primer, 4 µl 5x reaction buffer, 1 µl
RNase iinhibitor, 2 µl 10mM dNTPs, and 1 µl reverse transcriptase. cDNA synthesis
was performed by heating the above mixture to 42°C for 60 minutes, then terminating the
reaction by heating to 70°C for 5 minutes. Quantitative PCR was performed using a
Mx3005P thermal cycler (Stratagene) and detected using Sybr green master mix (Applied
Biosystems). For each reaction, 2 ng of total cDNA were combined with 7.5 µl Sybr
green master mix, 10 µM each of specific forward and reverse primers, and ddH20 to a
final volume of 15 µl. After an initial denaturation at 95°C for ten minutes, the
temperature was held at 95°C for 30 seconds, dropped to 56°C for 60 seconds, followed
by 60 seconds at 72°C. These three steps were repeated 40 times. The samples are then
heated to 95°C for 60 seconds, followed by 45 seconds at 56°C, and finally heated to
95°C for 30 additional seconds. Signals were normalized to β actin, and expression was
calculated using the comparative Ct method (Schmittgen and Livak, 2008). All
experiments included three technical replicates.
Total microRNA was isolated via acid-phenol:chloroform extracting from
cultured cells using mirVana miRNA isolation kit (Ambion). RNA was quantified using
a Nanodrop 2000 spectrophotometer, and treated with DNase as described above
(Ambion). Individual microRNAs were reverse transcribed using the RevertAid MMuLV system (Fermentas) and specific primers (Applied Biosystems). qPCR was
performed with specific primers using the TaqMan microRNA assay kit (Applied
Biosystems). To standardize miRNA expression levels, the stably-expressed small
nucleolar RNA, snoRNA202, was used as an endogenous control (Brattelid et al., 2010).
22
2.6 Primer Design
Primers for quantitative real time RT-PCR measurement of RNAi pathway
effectors were previously described (Michon et al., 2010). The primers used were as
follows: Drosha-F: GGACCATCACGAAGGACACTTG, Drosha-R:
GATGTACAGCGCTGCGATAA. Ago1-F: GAAGACGCCAGTGTATGCTGAA,
Ago1-R: ATCTTGAGGCAGAGGTTGGACA. Ago2-F:
GCCGTCCTTCCCACTACCAC, Ago2-R: GGTATTGACACAGAGCGTGTGC. Ago3F: GATAGTGTGAAGGACGGCTGGT, Ago3-R: TTGGAAGAAGCGGCAACATC.
Ago4-F: GACTGCCTTCCGCACTGTCA, Ago4-R: ACACGCTCCGTCTCCATTCC.
Staufen1-F: TAGGGGAAGGAGAAGGGAAA, Staufen1-R:
TTCATCCCTTGGCCATAATC. Staufen2-F: ACAAGCTGCCAGACACAATG.
Staufen2-R: TTCAGCGCAATCTCAAACAC. GW182-F:
AGCCTTCTACTCCAGCCACA, GW182-R: GGCCCAGATTTGCTTAATGA. Dicer
mRNA primers were designed using NCBI’s PrimerBlast tool
(http://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi) and were as follows: Dicer-F:
GGTGGTCTGGCAGGTGTACT. Dicer-R: CCTGAGGCTGGTTAGCTTTG.
Additionally, primers were designed in order to distinguish the amount of wildtype
SMAD4 from the floxed transcript variant, as one of the primers anneals to the region
that was excised out via the cre-lox method mentioned above. SMAD4-F:
ACACCAACAAGTAACGATGCC; SMAD4-R: AGCCACCTGAAGTCGTCCA. To
ensure BMP stimulation of the cells, Noggin levels were monitored as well. Noggin-F:
TGGTGTGTAAGCCATCCAAG; Noggin-R: AGCAGGAACACTTACACTCG.
mRNA levels of each of these proteins were normalized to the expression of β-actin,
23
using the following primers: Actin-F: CAGAAGGAGATTACTGCTCTGGCT, Actin-R:
TACTCCTGCTTGCTGATCCACATC.
2.7 MicroRNA Microarray
Microarray profiling of microRNA was performed in the UCLA Clinical
Microarray Core using the miRCURY LNA microRNA microarray, 7th generation. Four
treatments groups were examined: Smad4CKO +BMP2; Smad4CKO-BMP; wildtype +BMP;
and wildtype-BMP. Each treatment group contained three biological replicates. Target
prediction for differentially expressed microRNAs was performed using miRDB
(www.miRDB.org) and DIANA.microT software (www.diana.cslab.ece.ntua.gr/microCDS/?r=search).
24
Results
3.1 Response of RNAi Pathway Effectors to Absence of SMAD4
Proteins that are involved in microRNA maturation were monitored. Potentially,
there is differential protein expression in our SMAD4CKO mice compared to wildtype
mice. We accounted for other factors that play a role in microRNA biogenesis that could
have led to false conclusions. Most importantly, it was imperative that we took into
account the levels of RNAi pathway effectors across our treatments. For example if
knockdown of SMAD4 led to a subsequent downregulation of Drosha, a key RNAi
pathway effector, it may have led us to draw false conclusions regarding the action of
Figure 9: No difference in the expression levels of a variety of RNAi pathway effectors
observed in SMAD4CKO mice. mRNA from wildtype (gray) and SMAD4-knock down (red)
chondrocytes was examined for relative expression of protein associated with microRNA
maturation by qRT-PCR. All values are normalized to β-actin. mRNA expression levels were
calculated via ΔCt method. Error bars represent standard deviation. n=3 for all values except
for Staufen1 and Staufen2, where n=2. Ago=Argonaute; Stau=Staufen.
25
BMP regulation of microRNA maturation. With this in mind, we examined via qPCR the
mRNA levels of several key RNAi pathway effectors; proteins with valuable roles in the
biogenesis and processing of microRNA.
As depicted in Figure 9, no RNAi pathway effectors studied in response to
SMAD4 knockdown varied in expression. Though Argonaute1 appears significantly
downregulated, statistical analysis revealed this was not the case (t=0.8404, p=0.4624;
n=3). We found no significant change in RNAi pathway effector levels in SMAD4
knockout vs. wildtype cartilage cells. The functional redundancy of Argonaute proteins
could nullify the effects of any individual variable family member. Conversely, if we
concluded that there was an effect of SMAD4 absence on the levels of some of these
effectors, it would need to be considered in the analysis and interpretation of microRNA
levels.
3.2 SMAD4 is Required for Processing of a Subset of miRNAs
Prior to performing microarray analyses of microRNA expression profiles of the
+/- SMAD4 and +/-BMP chondrocytes, preliminary studies were performed in order to
examine the expression of specific microRNAs. An exhaustive literature search led to
the identification of a pool of candidate microRNAs for study (Table 1). Five miRNAs
were chosen based on their potential expression in cartilage as well as their BMPresponsiveness. Of these candidates, miRNAs 509-3p and 465c-5p were not present in
cartilage at levels detectable by qRT-PCR (Data not shown). The expression of the
remaining three was measured at 0, 2, 4, and 8-hours post-BMP treatment (Figure 10).
Expression levels for all time points were lower in SMAD4 knockout cells.
26
MmumiR
IS expression
(cartilage)
BMP relationship
Function
Reagnts available
199a*
“early
chondrogenic
differentiation”
-mesenchyme
Likely, deletion
causes skeletal
defects
Regulated
**
Cell death, cancer
**inhibits chondrogenesis
Mir199a* and antimir199a* expression
plasmids (Lin et al 2009)
Posttranscriptionally (at
pri-level), binds
SMAD1/5
Post-transcriptional
(keratinocytes)
Enhances myocardial
differentiation, role in skeletal
growth and patterning
Expression plasmid (Wang
et al)
Targets tumor suppressors…
Davis and Hata have them
all
Upregulated in
CH310T1/2
Inhibits skeletal muscle
differentiation , may target Alk4
(24-wiki)
Looks like it, in
eurexpress
Inhibits
osteogenesis in
C2C12, not
visible in
Eurexpress
In MC3T3-E1
preosteoblasts
(Itoh et al)
Upregulated in
CH310T1/2
Yes*targets
BMPR1A
Characterized as tumor
suppressor
Same as above, except possibly
targets BMPR1A and 2, SMAD5
Transforming growth
factor-β-regulated miR-24
promotes skeletal muscle
differentiation by Qiang
Sun
?
“Significantly
downregulated by
BMP”
Modulate pre-osteoblast
differentiation by regulating Dlx5
200a
Same as above
Same as above
Same as above
199a5p
Skeletal (199a5p)
“R-SMADregulated”** Has an
SBE in hsa-mir
421
Yes. Eurexpress
509-3p
Present(eurexpr
ess)
Present(eurexpr
ess)
Absolutely
? N-Myc responsive,
“TGFβ/BMP
regulated”
“TGFβ/BMP
regulated”
***
*x-linked
Likely Sox9
regulated
1792
21
24-1
31
135
141
465c5p
140
27a
Well
documented
miR, but no
info on cartilage
?
Appears present
(eurexpress)
check with
Karen
SMAD8-dependent
in PASMCs, so
likely BMP
regulated
qPCR primer seqs
Hyo Won Ahn
miRNA designed and
transfected with
lipofection, lots of
luciferase reporters
designed
Same as above
Login: K Sakuri et al,
2011; Optimization of a
microRNA expression
vector for function analysis
of microRNA
DPC/SMAD4 repression in
pancreatic cancer, cell cycle
checkpoint regulator
?
Inhibits p21-activated kinase 1
(Pak1)-implicated in oncogenesis
*well defined: MicroRNA-140
plays dual roles in both cartilage
development and homeostasis by
Shigeru Miyaki et al
Enhances Wnt signaling,
promotes osteogenesis
Primers Ahn et al
Luciferase 140, siR140,
LNA-antimiR-140 (Nicolas
et al, 2008)
Table 1: Putative candidate microRNAs identified from the literature. Several microRNAs that
preliminarily met our criteria of BMP-responsiveness and cartilage expression are listed. Follow up
studies were performed on those highlighted in color.
27
Figure 10. Effects of BMP
treatment on mature
miRNA expression levels is
SMAD4-dependent in
chondrocytes. Expression
of microRNAs was measured
via qPCR in isolated sternal
chondrocytes from P0 mice
over an 8-hour time course in
control vs. BMP-treated
cells. Mature microRNA
levels for miR-140 (top
panel), miR-27a (middle
panel), and miR-199a-5p
(bottom panel) are shown.
Values shown are relative
expression levels normalized
to the wildtype control (red)
at time zero. All microRNA
expression values were
normalized to sn202. n=2
for each treatment. Error
bars represent standard
deviation.
3.3 BMP Downregulates Argonaute1 Expression
Argonaute1 is an RNaseIII protein that often plays an integral role in microRNA
biogenesis. The Argonaute family of proteins is highly conserved, and may exhibit
functional redundancy. Several members can potentially serve as the catalytic
component of the RNA-induced silencing complex (RISC) (Carmell et al., 2002).
28
Stimulation of sternal chondrocytes with BMP2 downregulated the mRNA level
expression of Argonaute1 (Figure 11). While vehicle-treated cells displayed a relatively
robust endogenous
Argonaute1 level, a two hour
treatment with BMP2 resulted
in a decrease in Argonaute1
mRNA to a level of
approximately one-eighth of
the untreated control. In order
to confirm the stimulation of
the BMP signaling pathway in
these cells, we also measured
the levels of Noggin, a BMP
inhibitor. It is well
documented that Noggin is
upregulated by BMP in order
Figure 11: Argonaute1 expression is BMP-responsive.
Argonaute1(top panel) and Noggin(bottom panel) mRNA
expression levels were measured in mouse cartilage cells
after either two hour treatment with BMP2 or vehicle.
Noggin was used as a control to confirm success of BMP
treatment. Error bars shown are SD. n=3 (two wildtype,
one Smad4 mutant).
to modulate the level of
signaling, and Noggin
expression is therefore often
used as a method to confirm
effective BMP treatment. The results demonstrated an average noggin mRNA expression
levels over 5 times higher in the samples treated with BMP (Figure 11).
29
3.4 MicroRNA Expression Profiling
A miRNA microarray was performed on four test groups (SMAD4CKO +BMP;
SMAD4CKO-BMP; WT+BMP; WT-BMP).A heat map representation of the raw data
from the microRNA microarray is presented (Figure 12). Hierarchical clustering is based
on the microRNA expression profiles when compared between the 12 samples. The
yellow tiles represent probes targeting microRNAs that were expressed at a relatively
high level, while the red tiles are indicative of lower expression. Further clustering
Figure 12: Heat map
for microRNA
microarray.
Unmodified data
demonstrates the
microRNA expression
profile for each of the
12 samples measured.
Color key and
histogram indicate the
level of expression
from low (red) to
yellow (high).
Mut=Smad4CKO
mutant; WT=wildtype;
BMP=BMP-treated
sample; Ctrl=vehicletreated.
30
analysis was performed based on the microRNA expression profiles of our samples. A
dendrogram representing this cluster analysis is presented (Figure 13). Each sample
group did not successfully cluster together, so the raw data was modified via linear
regression. In performing this linear regression, we essentially designated the groups to
which each sample was to be assigned. This was performed in order to minimize the
amount of variance between biological replicates within one treatment (i.e. wildtype
+BMP), while maximizing variance between different study groups. The modified data
provided a more direct microRNA expression pattern for each of our study groups
(Figure 14). However a result of the linear regression provided us with less statistical
power.
Figure 13: Cluster diagram of microarray samples. microRNA expression profiles were
used in order to cluster the 12 samples investigated. The height of the line is indicative of
similarity. Mut=mutant; WT=wildtype; Ctrl=vehicle treated; BMP=BMP-treated.
31
Figure 14: Effect of
Smad4 and BMP on
microRNA profiles of
mouse chondrocytes.
Wildtype and
Smad4CKO cells were
treated with either
BMP2 or vehicle for
two hours prior to total
RNA isolation. Color
key reveals color
scheme reflecting
expression levels from
low (blue) to high
(red). Linear
regression was
performed in order to
better group the
different treatments.
n=3 for each group.
Target prediction analysis was performed on differentially expressed microRNAs.
We examined microRNAs that responded to BMP treatment with at least a 1.5 fold
change. In addition, we limited our target prediction studies to microRNAs that showed a
similar BMP-responsive expression pattern in the wildtype as well as the Smad4CKO
samples. Several of these differentially expressed microRNAs appear in Table 2. In
32
addition the identity of the microRNA, the table includes any sequence contained in the
pre-microRNA that is similar to the Smad-binding consensus sequence (CAGAC), as
well as predicted targets of interest in skeletal tissue. Mmu-miR-5109, mmu-miR-30e5p, hsa-miR-5100, mmu-miR-27a-3p and mmu-miR-491-3p were all upregulated upon
treatment with BMP2. Hsa-miR-2964a-5p was downregulated upon treatment with
BMP2. Each of these miRNAs targets proteins that play a role in chondrogenesis and/or
skeletal maintenance. In particular, hsa-miR-2964a-5p and mmu-miR-27a-3p are
predicted to target proteins involved in BMP signaling (type II BMP receptor and
SMAD8, respectively).
miRNA
Smad-binding seq.
Predicted targets of interest
mmu-5109
CAGGC
-WNT3-integral in several processes
-LRRC39 (Myomasp)-stretch sensing
mmu-30e-5p
CAGUC
-MOX2-craniofacial/skeletal dev.
-COL4A5-primarily basal lamina
-STAUFEN1-dsRNA-binding protein
hsa-5100
CAGAU
-UBASH3B-EGF/PDGF signaling
hsa-2964a-5p
CAGCC
-BMPRII-Type II BMP receptor
mmu-27a-3p
n/a
-p53 (validated)-TAK1/miRNA crosstalk
-TAB3-TGFβ-responsive; NFκB signaling
-SMAD8-BMP-responsive R-SMAD
mmu-491-3p
CAGUC
-USP33-peptidase
-CACYBP- calcium-induced ubiquitination
Table 2: List of predicted targets of microRNAs of interest. Target prediction analysis was
carried out on microRNAs that were differentially expressed in Smad4CKO cells upon BMP
stimulation. Predicted targets from mirDB and DIANA-MICROT.
33
Discussion
The formation and maintenance of a healthy skeleton is essential for proper
growth and development of vertebrates. Improper developmental formation as well as
degradation leads to myriad diseases. We hypothesized that a noncanonical bone
morphogenic protein signaling pathway involving a subset of microRNAs is essential for
skeletal formation and maintenance.
A subset of microRNAs has been shown to be regulated in a BMP-responsive
manner. Furthermore, a posttranscriptional mechanism of microRNA processing can act
independently of SMAD4 upon BMP stimulation. In this mechanism, R-SMAD1/5 bind
to the Drosha complex responsible for cleaving pri-miRNAs to pre-miRNAs. This only
occurs with a certain population of miRNAs, and the binding of the R-SMAD serves to
enhance the processing of these miRNAs. We hypothesized that this mechanism plays a
significant role in the formation and maintenance of a healthy skeleton. We showed that
a cartilage-specific knockdown of SMAD4 in newborn mice does not significantly
change the levels of key proteins in the RNAi pathway. However, we found that one of
these proteins, Argonaute1, is downregulated upon stimulation of chondrocytes with
BMP. Finally, we were able to identify several microRNAs that we think play a role in
the development and maintenance of cartilage in a BMP-responsive fashion. A portion of
these miRNAs respond in a SMAD4-independent fashion, and may be of great
consequence in the maintenance of healthy cartilage.
Prior to delving directly into the role of SMAD4 in the maturation of a specific
subset of BMP-responsive miRNAs, we set out to eliminate possible variables in the
34
process. In order to control for global changes in microRNA maturation, we first
examined the effect of SMAD4 knockdown on key elements in the maturation process of
miRNAs. For example, we know that chondrocyte-specific knockdown of Dicer is
catastrophic for cell proliferation and differentiation (Kobayashi et al., 2008). We
determined that our model does not inhibit basic RNAi pathway functions, as there are no
significant differences in effectors of miRNA biogenesis when attempting to distinguish
between a SMAD4CKO and wildtype set of mice (Figure 9). Therefore, differentially
expressed miRNAs found on the array can be attributed to the SMAD4-independent
BMP-mediated mechanism of concern.
Interestingly, we found some differential expression of RNAi pathway effectors
based on treatment with BMP2. Namely, we found Argonaute1, the most common
catalytic component of RISC, to be downregulated nearly eight-fold upon treatment of
cells with BMP2 (Figure 11). Due to the fact that Argonaute1 is downregulated by BMP
in both our wildtype and SMAD4CKO chondrocytes, this regulation may operate through a
noncanonical BMP mechanism. While a small amount of wildtype SMAD4 is still
present in our mutant mice (~85% knockdown), we believe the residual activity is not
responsible for any patterns seen in the SMAD4CKO samples. To confirm our findings,
the protein-level expression of Argonaute1 should be examined. Additionally, an
examination of the Argonaute1 promoter region for the established SMAD-binding
element (5’-CAGAC-3’) would provide evidence of the regulatory mechanism.
Preliminary studies were undertaken in order to justify proceeding with the
investigation into miRNAs that are responsive to BMP in a SMAD4-independent fashion.
As mentioned above, several candidate miRNAs were identified from the literature as
35
potentially meeting our desired criteria (Table 1). Based on the preliminary data
generated from these candidate miRNAs, we can see that BMP treatment affects the
expression levels of some microRNAs (Figure 10). While more statistical tests must be
performed prior to any further functional investigation, we showed that microRNA-27a
was downregulated by BMP2 in a SMAD4-dependent manner. This could signify a
responsiveness that follows the canonical BMP pathway, which requires SMAD4 to be
effective. Preliminary analysis of microRNA-199a-5p revealed that it may be regulated
via the same mechanism, however it was upregulated by BMP treatment. The opposite
responses of these two microRNAs to BMP treatment may indicate opposing functional
roles in development and maintenance of cartilage. Or, it may represent a different
temporal or spatial expression pattern between the two. Regardless, it appears that each
miRNA displayed in Figure 10 seems to have some level of SMAD4-dependence. The
fluctuation patterns over the time course are consistent between the WT and the SMAD4
knockdown chondrocytes, yet it is consistently the case that the SMAD4 knockdown
chondrocytes gave rise to lower overall levels of mature miRNAs-27a, -140, and -199a5p. The apparent SMAD4-dependence of these miRNAs may signify a transcriptional
level of BMP influence, which leads us to believe these particular miRNAs are not likely
responsible for the differential phenotypes seen (Davis et al., 2010; Nakamura et al.,
2011).
Upon confident conclusion that our SMAD4CKO mouse model was sufficient for
monitoring the microRNA expression levels in chondrocytes, we proceeded to perform a
microRNA microarray. Though a relatively nascent technology, miRNA arrays have
grown popular over the last half-decade, and the array we used (Exiqon miRCURY 7th
36
generation) contains over 3100 probes from mouse, rat, and human. This array contains
all published miRNA sequences from version 19.0 of the database miRBase. Due to the
relatively high conservation of miRNAs across species, these arrays have the potential to
provide much information, including identification of novel miRNAs in a species that
may contain an orthologue in another. Compelling patterns were uncovered, suggesting
putative microRNAs that may be important in skeletal homeostasis.
Analysis of the data gleaned from the microarray revealed some unexpected
patterns. Interestingly, miR-140 is shown to be higher in SMAD4CKO chondrocytes,
regardless of BMP stimulation. These results stand in contrast to our preliminary data
that showed a lower level of mmu-miR-140 in SMAD4CKO chondrocytes (Figure 10). It
is imperative that more work must be performed to determine the relationship between
BMP and miR-140, as this particular microRNA is known to be present in very high
levels in chondrocytes (Nicolas et al, 2008). Moreover, it has been conclusively
implicated in the onset and progression of osteoarthritis (OA), as its targets include the
collagen-degrading matrix metalloprotease 13 (MMP-13) (Tardif et al., 2009). The
BMP-mediated upregulation of miR-140 in both WT and SMAD4CKO samples show that
the maturation of this particular microRNA is suitable for further characterization.
Together with the fact that it is expressed at high levels, the mechanism of miR-140 may
be of great consequence in cartilage development and homeostasis. In addition to the
well-characterized miR-140, our microarray revealed less-explored miRNAs of interest
as well. For example, mmu-miR-491-3p responds to BMP at the apparent same levels
with and without SMAD4. The SMAD4-independent mechanism that may be
responsible for this differential BMP regulation could hypothetically contribute to
37
phenotypic differences in our skeletal knockouts. To our knowledge, targeting assays
have yet to be published for miR-491-3p. Based on data from miRBase
(www.mirbase.org) as well as the miR Database (www.mirdb.org), it has several
predicted targets including Calcyclin-binding protein (CACYBP). CACYBP has been
implicated in ubiquitin-mediated protein degradation of several proteins, including the
WNT signal-transducing beta catenin (Matsuzawa and Reed, 2001). Also upregulated by
BMP stimulation was mmu-miR-27a-3p. Predicted mRNA targets included SMAD8.
The activity of miR-27a-3p may thus reflect a negative feedback loop modulating BMP
signaling. However, it has been shown that SMAD8 is largely dispensable in skeletal
formation, as it is functionally redundant of SMADs1/5 (Retting et al.,2009).
Conversely, the miRNA hsa-miR-2964a-5p, predicted to target the type II BMP receptor
(BMPRII), is downregulated by 1.5 fold upon BMP stimulation. This may reflect a
positive feedback mechanism, wherein BMP stimulation results in the functional ability
to increase BMP signaling by having available more BMP receptors. Taken together,
these results illustrate the multiple roles for BMP-responsive microRNAs in
chondrocytes, as well as the complex regulatory mechanisms in which microRNAs
participate.
A disconcerting issue with our microarray data was the lack of statistical
significance in microRNAs level changes upon treatment with BMP. We initially set our
p-value for significance at p=0.01. This is a very conservative critical value, and
anything that is significantly changed at this level would very possibly yield some
biological significance between samples. However, our experimental results yielded no
miRNAs that were changed over two-fold at this p-value. Published microRNA
38
microarrays performed in human osteoarthritic chondrocytes as well as other tissues
reveal several microRNAs that are changed greater than two-fold upon growth factor
stimulation (Davis et al., 2010; Akhtar et al., 2010).
An explanation for this may lie in the cluster diagram of the samples which was
performed in order to analyze the consistency of microRNA expression among biological
replicates (Figure 13). We anticipated to see each biological replicate of a treatment
cluster with the other replicates of the same treatment (i.e. wildtype controls with
wildtype controls). This would indicate that the microRNA expression profiles could be
clearly distinguished between our treatments of interest. However, some of our samples
did not cluster as we had hoped. In the middle of the tree, the three wildtype samples
treated with BMP cluster together, as do the three wildtype samples that were not treated
with the growth factor. However, the cluster diagram based on miRNA expression
profiles from our array reveals a pattern of clustering we did not anticipate. While two of
the three BMP-treated SMAD4CKO samples clustered correctly, as did two of the three
non-BMP-treated SMAD4CKO samples. However, at the top of the tree, one of each
SMAD4CKO (Mut3BMP and Mut3Ctrl in Fig. 13) cluster away from their SMAD4
knockout counterparts thus diluting the expression differences between our treatment
groups. As mentioned above, we proceeded to perform a linear regression on our raw
data in order to maximize the “between groups” variance, while minimizing the “within
groups” variance. Performing this regression effectively “forced” our samples to be
grouped as we wished. That is, we grouped the SMAD4CKO+BMP samples together, and
so on. While this allows for a clearer division between treatment groups and enables
39
analysis of biologically relevant miRNAs, we lost a considerable amount of statistical
power in performing the regression.
Another possible explanation lies in the design of the SMAD4CKO mouse line. As
mentioned above in the methods section, it relied on a cre-lox mechanism of DNA
excision. The first coding exon of the SMAD4 gene (containing the ATG sequence) was
flanked with loxP sites, and was thus excised by Cre recombinase. It is well established
that the cre-lox method is not 100% effective. While a significant amount of previous
work has been successfully performed using this specific mouse line, it is entirely
possible that the small level of residual SMAD4 activity (~15% of the wildtype) could be
confounding our results. To our knowledge, this is the first time that this mouse model
was used for microRNA analysis. Seeing as we are studying a relatively novel and
unique aspect of chondrogenesis, it is entirely plausible that the mechanisms at play are
indeed affected by even low levels of functional SMAD4. Therefore, the residual activity
of SMAD4 in these mice is should be monitored in future studies.
Taken together, these results provide a promising glimpse into a novel field of
study with regard to the role for BMP in chondrogenesis. While there is likely a suite of
mechanisms at play which combine to give rise to the differential SMAD phenotypes we
have witnessed, this work lends credence to the idea that microRNA regulation is indeed
a factor in BMP-responsive chondrogenesis.
It follows from the demonstrated developmental role for BMP-responsive
microRNAs that there is likely a role for these miRNAs in the homeostatic maintenance
of cartilage, and thus in cartilage degeneration as well. Though relatively uncommon,
40
dramatic phenotypic skeletal dysplasias including dwarfism and osteogenesis imperfecta
(brittle bone disease) hold the potential to lend great insight into the mechanisms at play
in bone formation and maintenance. The much more common but less dramatic
manifestations of the degenerative skeletal diseases such as osteoarthritis are likely
subject to regulation by similar mechanisms. Osteoarthritis is proving to be a growing
epidemic, as it is predicted that upwards of 80% of Americans alive will show
radiographic evidence of osteoarthritis by the age of 65 (American Academy of
Orthopaedic Surgeons, 2008). With these dramatic numbers in mind, the importance of
understanding the mechanisms of skeletal generation and maintenance is apparent. Since
the mechanisms of osteoarthritis action are variable between cases, further investigation
may possibly lead to the identification of some universal factors that are at play in the
majority of cases of osteoarthritis. These factors can then potentially become therapeutic
targets for osteoarthritis, leading to a much more widely effective treatment regimen.
Characterizing a mechanism that gives rise to such a skeletal phenotype would surely
prove instrumental in therapeutic developments. The enhanced processing of this subset
of microRNAs by a noncanonical BMP pathway can lend great insight into the complex
nature of cartilage formation, and thus cartilage degeneration. While the phenotypic
characteristics as well as the organismal-level causes of OA are quite general and clear,
there is a dearth of knowledge as to the mechanistic biochemical forces that give rise to
this disease. Given the debilitating nature of osteoarthritis at advanced age, a more
effective treatment would undoubtedly lead to increased quality of life for innumerable
people in the future.
41
References
Akhtar, N., Rasheed, Z., Ramamurthy, S., Anbazhagan, A. N., Voss, F. R., and Haqqi, T.
M. (2010). MicroRNA-27b regulates the expression of Matrix Metalloprotease 13 in
human osteoarthritis chondrocytes. Arthr. Rheum 62, 1361-1371.
Ambros, V., Bartel, B., Bartel, D. P., Burge, C. B., Carrington, J.C., Chen, X., Dreyfuss,
G., Eddy, S. R., Griffiths-Jones, S., Marshall, M., et al. (2003). A uniform system for
microRNA annotation. RNA 9, 277-279.
Blahna, M.T., and Hata, A. (2012). SMAD-mediated regulation of microRNA
biosynthesis. FEBS Lett. 586, 1906-1912.
Bohnsack, M. T., Czaplinski, K., and Gorlich, D. (2004). Exportin 5 is a RanGTPdependent ds-RNA-binding protein that mediates nuclear export of pre-miRNAs. RNA
10, 185-191.
Brattelid, T., Aarnes, E., Helgeland, E., Guvag, S., Eichele, H., and Jonassen, A.K.
(2010). Normalization strategy is critical for the outcome of miRNA expression analyses
in the rat heart. Physiol. Genomics 43, 604-610.
Bushati, N., and Cohen, S.M. (2007). MicroRNA functions. Annu. Rev. Cell. Dev. Biol.
23, 175-205.
Carmell, M. A., Xuan, Z., Zhang, M. Q. (2002). The Argonaute family: tentacles that
reach into RNAi, developmental control, stem cell maintenance, and tumorigenesis.
Genes Dev. 16, 2733-2742.
Chen, D., Zhao, M., and Mundy, G. (2004). Bone morphogenic proteins. Growth Factors
22, 233-241.
Chen, G., Deng, C., and Li, Y.P. (2012). TGF-β and BMP signaling in osteoblast
differentiation and bone formation. Int. J. Biol. Sci. 8, 272-288.
Chen, W., Jia, W., Wang, K., Zhou, Q., Leng, Y., Duan, T., and Kang, J. (2012). Retinoic
acid regulates germ cell differentiation in mouse embryonic stem cells through a SMADmediated pathway. Biochem. Bioph. Res. Co. 418, 571-577.
Chu, G., Dunn, N. R., Anderson, D., Oxburgh, L., and Robertson, E. J. (2004).
Differential requirements for SMAD4 in TGFβ-dependent patterning of the early mouse
embryo. Devel. 131, 3501-3512.
Davis, B. N., Hilyard, A. C., Lagna, G., and Hata, A. (2008). SMAD proteins control
Drosha-mediated microRNA maturation. Nature 454, 56-61.
Davis, B. N., and Hata, A. (2009). Regulation of microRNA biogenesis: a miRiad of
mechanisms. Cell Commun. Sig. 7.
Davis, B. N., Hilyard, A. C., Nguyen, P.H., Lagna, G., and Hata, A. (2010). SMAD
proteins bind a conserved RNA sequence to promote microRNA maturation by Drosha.
42
Mol. Cell 39, 373-384.
Deckers, M., van Dinther, M., Buijs, J., Que, I., Lowik, C., van der Pluijm, G., and ten
Dijke, P. (2006). The tumor suppressor SMAD4 is required for transforming growth
factor β-induced epithelial to mesenchymal transition and bone metastasis of breast
cancer cells. Cancer Res. 66, 2202-2209.
Drake, K.M., Zygmunt, D., Mavrakis, L., Harbor, P., Wang, L., Comhair, S.A., Erzurum,
S.C. and Aldred, M.A. (2011). Altered microRNA processing in heritable pulmonary
arterial hypertension: an important role for SMAD-8. Am. J. Respir. Crit. Care Med. 184,
1400-1408.
Gradus, B., Alon, I., and Hornstein, E. (2011). miRNAs control tracheal chondrocyte
differentiation. Dev. Biol. 360, 58-65.
Greenblatt, M. B., Shim, J., Glimcher, L., H. (2010). TAK1 mediates BMP signaling in
cartilage. Ann. N.Y. Acad. Sci.1192, 385-390.
Hata, A., and Davis, B.N. (2010). Regulation of pri-miRNA processing through SMADs.
In Reguation of microRNAs, Helge Grobhans, ed. (Landes Bioscience and Springer
Science), pp 15-27.
Heldin, C.H., and Moustakas, A. (2011). Role of SMADs in TGFβ signaling. Cell Tissue
Res. 347, 21-36.
Hoffmann, A., Preobrazhenska, O., Wodarczyk, C., Medler, Y., Winkel, A., Shahab, S.,
Huylebroeck, D., Gross, G., and Verschueren, K. (2005) Transforming growth factor-βactivated kinase-1 (TAK1), a MAP3K, interacts with SMAD proteins and interfers with
osteogenesis in murine mesenchymal progenitors. J. Biol. Chem. 280, 27271-27283.
Kobayashi, T., Lu., J., Cobb, B.S., Rodda, S.J., McMahon, A. P., Schipani, E.,
Merkenschlager, M., and Kronenberg, H.M. (2008). Dicer-dependent pathways regulate
chondrocyte proliferation and differentiation. PNAS 105, 1949-1954.
Kronenberg, H. M. (2003). Developmental regulation of the growth plate. Nature 423,
332-336.
Lewis, R., Feetham, C.H., and Barrett-Jolley, R. (2011). Cell volume regulation in
chondrocytes. Cell. Physiol. Biochem. 28, 1111-1122.
Li, Z., Hassan, M.Q., Volinia, S., van Wijnen, A.J., Stein, J.L., Croce, C.M., Lian, J.B.,
and Stein, G.S. (2008). A microRNA signature for a BMP2-induced osteoblast lineage
commitment program. PNAS 105, 13906-13911.
Lin, E.A., Kong, L., Bai, X.H., Luan, Y., amd Liu, C. (2009). miRNA-199a*, a bone
morphogenic protein 2-responsive microRNA, regulates chondrogenesis via direct
targeting to SMAD1. J. Biol. Chem. 284, 11326-11335.
Martinez-Sanchez, A., Dudek, K. A., and Murphy, C. L. (2011). Regulation of human
chondrocyte function through direct inhibition of cartilage master regulator Sox9 by
43
microRNA-145 (miRNA-145)*. J. Biol. Chem. 287, 916-924.
Matsuzawa, S. I,. and Reed, J., C. (2001). Siah-1, SIP, and Ebi collaborate in a novel
pathway for beta-cateinin degradation linked to p53 responses. Mol. Cell 7, 915-926.
Meyer, W.J., Schreiber, S., Guo, Y. I., Volkmann, T., Welte, M.A., and Muller, H. A. J.
(2006). Overlapping functions of Argonaute proteins in patterning and morphogenesis of
Drosophilia embryos. PLoS Genet. 2(8), e134.
Michon, F., Tummers, M., Kyyronen, M., Frilander, M. J., and Thesleff, I. (2010). Tooth
morphogenesis and ameloblast differentiation are regulated by micro-RNAs. Dev. Biol.
340, 355-368.
Mirtz, T. A., Chandler, J. P., and Eyers, C. M. (2011). The effects of physical activity on
the epiphyseal growth plates: a review of the literature on normal physiology and clinical
implications. J. Clin. Med. Res. 3, 1-7.
Miyaki, S., Sato, T., Inoue, A., Otsuki, S., Ito, Y., Yokoyama, S., Kato, Y., Takemoto, F.,
Nasaka, T., Yamashita, S., et al. (2010). MicroRNA-140 plays dual roles in both cartilage
development and homeostasis. Gene. Dev. 24, 1173-1185.
Monemdjou, R., Vasheghani, F., Fahmi, H., Perez, G., Blati, M., Taniguchi, N., Lotz, M.,
St-Arnaud, R., Martel-Pelletier, J., Beier, F., and Kapoor, M. (2012). Association of
cartilage-specific peroxisome proliferator-activated receptor gamma with abnormal
endochondral ossificiation and impaired cartilage growth and development in a murine
model. Arthritis Rheum. 64,1551-1561.
Moriguchi, T., Kuroyanagi, N., Yamaguchi, K., Gotoh, Y., Irie, K., Kano, T., Shirakabe,
K., Muro, Y., Shibuya, H., Matsumoto, K., et al. (1996). A novel kinase cascade
mediated by mitogen-activated protein kinase kinase 6 and MKK3. J. Biol. Chem. 271,
13675-13679.
Moustakas, A., and Heldin, C.H., (2005). Non-SMAD TGF-β signals. J. Cell. Sci. 118,
3573-3584.
Nakamura, Y., Inloes, J.B., Katagiri, T., and Kobayashi, T. (2011). Chondrocyte-specific
microRNA-140 regulates endochondral bone development and targets Dnpep to modulate
bone morphogenic protein signaling. Mol. Cell. Biol. 31, 3019-3028.
Nellen, D., Affolter, M., Basler, K. (1994). Receptor serine/threonine kinases implicated
in the control of Drosophila body pattern by decapentaplegic. Cell 78, 225-237.
Nicolas, F. E., Pais, H., Schwach, F., Lindow, M., Kauppinen, S., Moulton, V., and
Dalmay, T. (2008). Experimental identification of microRNA-140 targets by silencing
and overexpressing miR-140. RNA 14, 2513-2520.
Oh, J.H., Park, S.Y., de Crombrugghe, B., and Kim, J.E. (2012). Chondrocyte-specific
ablation of Osterix leads to impaired endochondral ossification. Biochem. Bioph. Res.
Co. 418, 634-640.
44
Ovchinnikov, D. A., Deng, J. M., Ogunrinu, G., and Behringer, R. R. (2000). Col2a1directed expression of cre recombinase in differentiating chondrocytes in transgenic
mice. Genesis 26, 145-146.
Retting, K.N., Song, B., Yoon, B.S., and Lyons, K.M. (2009). BMP canonical SMAD
signaling through SMAD1 and SMAD5 is required for endochondral bone formation.
Development 136, 1093-1104.
Rodriguez, A., Griffiths-Jones, S., Ashurst, J.L., and Bradley, A. (2004). Identification of
mammalian microRNA host genes and transcription units. Genome Res. 14, 1902-1910.
Sakurai, K., Furukawa, C., Haraguchi, T., Inada, K., Shiogama, K., Tagawa, T., Fujita,
S., Ueno, Y., Ogata, A., Ito, M., et al. (2011). MicroRNAs miRNA-199a-5p and -3p
target the Brm subunit of SWI/SNF to generate a double-negative feedback loop in a
variety of human cancers. Cancer Res. 71, 1680-1689.
Schmittgen, T. D., and Livak, K. J. (2008). Analyzing real-time PCR data by the
comparative Ct method. Nat. Protoc. 3, 1101-1108.
Sekelsky, J. J., Newfeld, S. J., Raftery, L. A., Chartoff, E. H., and Gelbart, W. M. (1995).
Genetic characterization and cloning of Mothers against dpp, a gene required for
decapentaplegic function in Drosophila melanogaster. Genetics, 139, 1347-1358.
Selbach, M., Schwanhausser, B., Thierfelder, N., Fang, Z., Khanin, R., and Rajewsky, N.
(2008). Widespread changes in protein synthesis induced by microRNAs. Nature 455, 5863.
Shi, Y., and Massague, J. (2003). Mechanism of TGF-β signaling from cell membrane to
nucleus. Cell 113, 685-700.
Sirard, C., de la Pompa, J.J., Elia, A., Itie, A., Mirtsos, C., Cheung, A., Hahn, S.,
Wakeman, A., Schwartz, L., Kern, S.E., et al. (1998). The tumor suppressor gene
SMAD4/Dpc4 is required for gastrulation and later for anterior development of the
mouse embryo. Genes & Devel., 12, 107-119.
Sieber, C., Kopf, J., Hiepen, C., and Knaus, P. (2009). Recent advances in BMP receptor
signaling. Cytokine Growth F. R. 20, 343-355.
Sumiyoshi, K., Kubota, S., Ohgawara, T., Kawata, K., Nishida, T., Shimo, T.,
Yamashiro, T., and Takigawa, M. (2010). Identification of miR-1 as a microRNA that
supports late-stage differentiation of growth cartilage cells. Biochem. Bioph. Res. Co.
408, 286-290.
Suomi, S., Taipaleenmaki, H., Seppanen, A., Ripatti, T., Vaananen, K., Hentunen, T.,
Saamanen, A.M., and Laitala-Leinonen, T. (2008). MicroRNAs regulate osteogenesis and
chondrogenesis of mouse bone marrow stromal cells. Gene Reg. Sys. Biol. 2, 177-191.
Tardif, G., Hum, D., Pelletier, J.P., Ducal, N., and Martel-Pelletier, J. (2009). Regulation
of the IGFBP-5 and MMP-13 genes by the microRNAs miRNA-140 and mir-27a in
45
human osteoarthritic chondrocytes. BMC Musculoskel. Dis. 10, 148.
Tu, X., Joeng, K.S., and Long, F. (2012). Indian hedgehog requires additional effectors
besides Runx2 to induce osteoblast differentiation. Dev. Biol. 362, 76-82.
Tuddenham, L., Wheeler, G., Ntounia-Fousara, S., Waters, J., Hajihosseini, M.K., Clark,
I., and Dalmay, T. (2006). The cartilage specific microRNA-140 targets histone
deacetylase 4 in mouse cells. FEBS Lett. 580, 4214-4217.
van der Kraan, P. M. (2013). Understanding developmental mechanisms in the context of
osteoarthritis. Curr. Rheumatol. Rep. 15, 333.
Wilson, R., Norris, E.L., Brachvogel, B., Angelucci, C., Zivkovic, S., Gordon, L.,
Bernardo, B. C., Stermann, J., Sekiguchi, K., Gorman, J. J., et al. (2012). Changes in
chondrocyte and extracellular matrix proteome during post-natal mouse cartilage
development. Mol. Cell. Proteomics 11, 1-18.
Winter, J., Jung, S., Keller, S., Gregory, R. I., and Diederichs, S. (2009). Many roads to
maturity: microRNA biogenesis pathways and their regulation. Nat. Cell Biol. 11, 228234.
Xu, L. (2006). Regulation of SMAD activites. Biochim. Biophys. Acta 1759, 503-513.
Xu, X., Han, J., Ito, Y., Bringas Jr., P., Deng, C., and Chai, Y. (2008). Ectodermal
SMAD4 and p38 MAPK are functionally redundant in mediating TGF-β/BMP signaling
during tooth and palate development. Dev. Cell 15, 322-329.
Yoon, B.S., and Lyons, K.M. (2004). Multiple functions of BMPs in chondrogenesis. J.
Cell. Biochem. 93, 93-103.
Zhang, J., Tan, X., Li, W., Wang, Y., Wang, J., Cheng, X., Yang, X. (2005). SMAD4 is
required for the normal organization of the cartilage growth plate. Dev. Biol. 284, 311322.
46