DEVELOPMENT AND STEM CELLS
RESEARCH ARTICLE 3667
Development 138, 3667-3678 (2011) doi:10.1242/dev.057778
© 2011. Published by The Company of Biologists Ltd
Depletion of Kcnq1ot1 non-coding RNA does not affect
imprinting maintenance in stem cells
Michael C. Golding1,2,3,*,†, Lauren S. Magri1,2,3,†, Liyue Zhang2,3, Sarah A. Lalone1,2,3, Michael J. Higgins4 and
Mellissa R. W. Mann1,2,3,‡
SUMMARY
To understand the complex regulation of genomic imprinting it is important to determine how early embryos establish imprinted
gene expression across large chromosomal domains. Long non-coding RNAs (ncRNAs) have been associated with the regulation of
imprinting domains, yet their function remains undefined. Here, we investigated the mouse Kcnq1ot1 ncRNA and its role in
imprinted gene regulation during preimplantation development by utilizing mouse embryonic and extra-embryonic stem cell
models. Our findings demonstrate that the Kcnq1ot1 ncRNA extends 471 kb from the transcription start site. This is significant as
it raises the possibility that transcription through downstream genes might play a role in their silencing, including Th, which we
demonstrate possesses maternal-specific expression during early development. To distinguish between a functional role for the
transcript and properties inherent to transcription of long ncRNAs, we employed RNA interference-based technology to deplete
Kcnq1ot1 transcripts. We hypothesized that post-transcriptional depletion of Kcnq1ot1 ncRNA would lead to activation of
normally maternal-specific protein-coding genes on the paternal chromosome. Post-transcriptional short hairpin RNA-mediated
depletion in embryonic stem, trophoblast stem and extra-embryonic endoderm stem cells had no observable effect on the
imprinted expression of genes within the domain, or on Kcnq1ot1 imprinting center DNA methylation, although a significant
decrease in Kcnq1ot1 RNA signal volume in the nucleus was observed. These data support the argument that it is the act of
transcription that plays a role in imprint maintenance during early development rather than a post-transcriptional role for the
RNA itself.
INTRODUCTION
Genomic imprinting is a specialized transcriptional regulatory
mechanism that restricts expression to the maternally or paternally
inherited allele (Verona et al., 2003; Barlow and Bartolomei, 2007).
Imprinted genes often cluster together in large domains that are
coordinately regulated by cis-acting regions known as imprinting
centers (ICs) or imprinting control regions (ICRs). ICRs harbor
gamete-derived parental allelic marks and are responsible for
imprinted gene regulation over hundreds of kilobases in a
bidirectional manner. Interestingly, imprinting domains are
associated with a non-coding RNA (ncRNA) that may regulate
imprinted gene expression for the entire cluster (Barlow and
Bartolomei, 2007). Generally, imprinted ncRNAs are transcribed
from the unmethylated ICR and can range from 2.2 to possibly
more than 1000 kb in length and thus are duly referred to as long
or macro ncRNAs.
The Kcnq1ot1/KCNQ1OT1 (potassium voltage-gated channel,
member 1, overlapping transcript 1) imprinting domain is located
on mouse chromosome 7 and human 11p15.5 (Verona et al., 2003;
Barlow and Bartolomei, 2007). This domain contains one
1
Departments of Obstetrics and Gynecology and Biochemistry, University of Western
Ontario, Schulich School of Medicine and Dentistry, London, ON N6A 5W9, Canada.
Children’s Health Research Institute, London, ON N6C 2V5, Canada. 3Lawson
Health Research Institute, London, ON N6C 2V5, Canada. 4Department of Molecular
and Cellular Biology, Roswell Park Cancer Institute, Buffalo, NY 14263, USA.
2
*Present address: Department of Veterinary Physiology, College of Veterinary
Medicine, Texas A&M University, College Station, TX 77843, USA
†
These authors contributed equally to this work
‡
Author for correspondence ([email protected])
Accepted 17 June 2011
paternally expressed ncRNA, Kcnq1ot1, and eight maternally
expressed protein-coding genes, including Slc22a18 (solute carrier
family 22a, member 18), Cdkn1c (cyclin-dependent kinase
inhibitor 1c), Kcnq1 (potassium voltage-gated channel, KQT-like
subfamily, member 1) and Ascl2 (achaete-scute homolog 2) (Fig.
1). The Kcnq1ot1 transcription start site (TSS) is located within the
ICR (Lee et al., 1999; Mitsuya et al., 1999; Smilinich et al., 1999;
Mancini-DiNardo et al., 2003). When methylated on the maternal
allele, Kcnq1ot1 is silent (Mancini-DiNardo et al., 2003). On the
paternal allele, the ICR is unmethylated and Kcnq1ot1 is
transcribed. Paternal deletion of the Kcnq1ot1 ICR results in
domain-wide loss of imprinting, demonstrating broad control by
the ICR of imprinted gene regulation (Fitzpatrick et al., 2002).
Activation of the normally silent paternal alleles of the proteincoding genes is also seen when Kcnq1ot1 is truncated, possibly
indicating a functional role for the macro ncRNA in imprinted
domain regulation (Mancini-DiNardo et al., 2006; Shin et al.,
2008).
The mechanism by which Kcnq1ot1 represses the expression of
genes located more than 300 kb away is not completely
understood, although various models have been proposed. These
include a role for the ncRNA in nucleating silent chromatin, similar
to Xist in X inactivation; a role for Kcnq1ot1 transcription in
initiating chromatin silencing through transcriptional interference,
repressive chromatin compartmentalization or chromatin looping;
or a combination of these mechanisms (Mancini-DiNardo et al.,
2003; Lewis et al., 2004; Lewis et al., 2006; Pauler et al., 2007;
Pandey et al., 2008; Shin et al., 2008; Terranova et al., 2008;
Koerner et al., 2009; Nagano and Fraser, 2009). Important
regulatory elements have been identified by mutational analysis but
such studies do not differentiate between these various possibilities.
DEVELOPMENT
KEY WORDS: Genomic imprinting, Noncoding RNA, RNA interference, Kcnq1ot1, Mouse
3668 RESEARCH ARTICLE
MATERIALS AND METHODS
Embryo collection
C57BL/6J (B6) and Mus musculus castaneus (CAST) mice were obtained
from Jackson Laboratory (Bar Harbor, ME, USA). B6(CAST7) mice
contain Mus musculus castaneus chromosome 7s on a B6 background
(Mann et al., 2004). B6 females were mated to CAST males to obtain
embryonic day (E) 7.5, 8.5 and 9.5 B6XCAST embryos and placentas.
CAST7 females were crossed with B6 males to recover E12.5 CAST7XB6
embryos and placentas. E9.5 placentas with a paternal IC2 deletion were
also analyzed (Fitzpatrick et al., 2002). Experiments were performed in
compliance with guidelines set by the Canadian Council for Animal Care
and policies and procedures approved by the University of Western Ontario
Council on Animal Care.
Transduction and transfection of stem cells
B6XCAST XEN, ES and TS cells were generated as described (Golding et
al., 2010). Stem cells were transduced with an shRNA targeting Kcnq1ot1
at 43 kb from the TSS (K43), a non-functional shRNA homologous to
Kcnq1ot1 at 82 kb (K82), or with an shRNA targeting the luciferase gene
(LUC) (Golding et al., 2010). K43 shRNA, which starts at Kcnq1ot1
position 43,804, 5⬘-TGCTGTTGACAGTGAGCGACCAGAGTTTGTCTTTCATAAATAGTGAAGCCACAGATGTATTTATGAAAGACAAACTCTGGGTGCCTACTGCCTCGGA-3⬘, was processed into the 22mer
5⬘-CCCAGAGTTTGTCTTTCATAAA-3⬘; and K82 shRNA, which begins
at Kcnq1ot1 position 82,541, 5⬘-TGCTGTTGACAGTGAGCGATGGCTTAAGCTGATCAATTAATAGTGAAGCCACAGATGTATTAATTGATCAGCTTAAGCCACTGCCTACTGCCTCGGA-3⬘ was processed into
the 22mer 5⬘-GTGGCTTAAGCTGATCAATTAA-3⬘. Production of
recombinant virus, infection, puromycin selection and passage of cells
were performed as described (Golding et al., 2010). Cells were collected
between passages 7 and 27. For the shRNA depletion studies, multiple
independent cell lines were generated and independent biological
replicates of wild-type (WT), LUC, K82 and K43 samples were used; six
to ten each for XEN cell samples, four each for ES cell samples, and four
to six each for TS cell samples. Robust depletion was observed in K43transduced stem cells (82-93% depleted) compared with control cells (see
Fig. S1 in the supplementary material). Importantly, there was considerable
sample overlap for Kcnq1ot1 length analysis, allelic expression analysis
and fluorescence in situ hybridization.
NIH 3T3 cells were obtained from the American Type Culture
Collection (Manassas, VA, USA). Custom siRNAs targeting the putative
Kcnq1ot1
ncRNA
were
designed
using
RNAi
Codex
(http://hannonlab.cshl.edu/GH_siRNA.html) and synthesized by
Dharmacon (Thermo Scientific, Lafayette, CO, USA). si7, 5⬘GGCAUACUGUCCAUACGUAUU-3⬘, starts at Kcnq1ot1 position 6933,
and si463, 5⬘-CCGAGCAGAUGAUACAGUAUU-3⬘, starts at Kcnq1ot1
position 463,032. Control siRNAs were an siGLO Green Transfection
Indicator to monitor transfection success and a scrambled sequence nontargeting siRNA (Dharmacon). Lipofectamine 2000 transfection reagent
(Invitrogen, Burlington, ON, Canada) was used to transfect 40 M siRNAs
into NIH 3T3 cells as per the manufacturer’s protocol. Cell collection was
performed at passage 4.
DNA and RNA isolation
DNA was extracted using the DNeasy Blood and Tissue Kit (Qiagen,
Mississauga, ON, Canada) and total RNA was extracted either using the
Roche High Pure RNA Tissue Kit (Roche Applied Science, Laval, QC,
Canada) or Trizol (Invitrogen) according to the manufacturers’ instructions.
cDNA synthesis
cDNA was synthesized from total RNA using Superscript II or III reverse
transcriptase (Invitrogen). Reactions were primed using both random
hexamers and oligo(dT) primers (Invitrogen). It was essential to ensure that
successful PCR amplification was not a result of contaminating genomic
DNA nor was impeded by any remaining RNA in the cDNA pool. To
eliminate DNA contamination, two DNase steps were performed, one
during and one after RNA extraction. Only Invitrogen DNaseI was used,
as DNases from other manufacturers (Sigma-Aldrich, Oakville, ON,
Canada; Roche Diagnostics, Laval, QC, Canada) were unable to
completely remove genomic DNA. After cDNA synthesis, samples were
treated with RNaseA to remove any residual RNA. Once the no-reversetranscriptase controls for each sample showed no RNA or DNA
contamination following beta-actin amplification (Table 1), the sample was
used for PCR amplification.
PCR amplification
Approximately 660 kb of DNA sequence was obtained from Ensembl
(http://www.ensembl.org/index.html) for distal chromosome 7
(150,418,839 to 149,758,443 bp). Primers were manually designed within
intronic and intergenic regions, with confirmation of appropriate primer
attributes by NetPrimer (http://www.premierbiosoft.com/netprimer/
index.html) (Table 1), and were synthesized by Sigma Genosys (Oakville,
ON, Canada). Primers were initially designed at ~50 kb increments from
the Kcnq1ot1 TSS to 619 kb downstream. Once amplification was
narrowed to a ~50 kb window, primer pairs were designed at ~5 kb
intervals, and then at 1 kb intervals to locate the end of the transcript. PCR
amplification was performed using illustra Ready-To-Go PCR Beads (GE
DEVELOPMENT
Deletion studies of the Kcnq1ot1 ICR domain indicate that the
ICR, a functional promoter and/or transcription are required for
domain imprinting (Fitzpatrick et al., 2002; Mancini-DiNardo et
al., 2006). Truncation studies suggest that it is the transcript or
transcription that has a role in silencing, as premature termination
of Kcnq1ot1 results in the derepression of imprinted protein-coding
genes within their domains (Mancini-DiNardo et al., 2006; Shin et
al., 2008). However, these studies are unable to differentiate the
function of the transcript from that of transcription. Additional
complexity arises from tissue-specific differential imprinted gene
regulation (Caspary et al., 1998; Lewis et al., 2004; Umlauf et al.,
2004; Shin et al., 2008; Weaver et al., 2010). Osbpl5, Tssc4, Cd81
and Ascl2 are imprinted only in the placenta, whereas Phlda2,
Slc22a18, Cdkn1c and Kcnq1 are imprinted in embryonic and
placental tissues (Fig. 1). Thus, functional studies should include
these different lineages in the analyses.
Because long ncRNAs may be central regulators of imprinted
domains, it is important to elucidate their modes of action. In this
study, we investigated the mouse Kcnq1ot1 ncRNA and its role in
imprinted gene regulation, specifically during preimplantation
development by utilizing embryonic and extra-embryonic stem
cells. Our findings demonstrate that the Kcnq1ot1 ncRNA
terminates 471 kb from the TSS, exists primarily as a full-length
transcript and originates from the Kcnq1ot1 ICR. The length of
Kcnq1ot1 is conserved in various tissues and at different
developmental time points, suggesting that Kcnq1ot1 length does
not contribute to differential tissue-specific silencing. However, the
length is significant as it raises the possibility that transcription
through downstream genes might play a role in their silencing,
including tyrosine hydroxylase (Th), which we show possesses
maternal-specific expression during early development. To
differentiate between the function of the transcript and that of
transcription, we employed RNA interference (RNAi)-based
technology to induce degradation of Kcnq1ot1 transcripts. We
hypothesized that post-transcriptional depletion of Kcnq1ot1
ncRNA would lead to activation of maternally transcribed genes
from the paternal chromosome. Short hairpin RNA (shRNA)mediated Kcnq1ot1 RNA depletion in embryonic stem (ES),
trophoblast stem (TS) and extra-embryonic endoderm stem (XEN)
cells had no observable effect on imprinted gene expression, nor
on ICR DNA methylation, although a significant decrease in
Kcnq1ot1 nuclear volume was observed. These data suggest that it
is the act of ncRNA transcription that predominantly influences
imprint maintenance during early development, rather than there
being a post-transcriptional role for the RNA itself.
Development 138 (17)
Kcnq1ot1 ncRNA depletion in stem cells
RESEARCH ARTICLE 3669
Table 1. Primers, annealing temperature and amplicon size
Primer
3k
65k
65kB
94k
118k
202k
228k
307k
380k
392k
410k
411k
433k
449k
457k
463k
464k
465k
466k
467k
468k
470k
470kZ
470kB1
471kA1
471kA2
471kB2
471
474k
475k
479k
486k
492k
510k
619k
Slc22a18
Cdkn1c
Kcnq1
Ascl2
Th
Airn
H19
H19 probes
BIS outer
BIS inner
Forward (5⬘ to 3⬘)
Reverse (5⬘ to 3⬘)
Tm (°C)
Size (bp)
ATTGGGAACTTGGGGTGGAAGC
ACAGGTTTGGTAGTATGAAGG
CCATTTTCCAACATACCCATACA
AAACTAACTTTGTATTCCTGAACC
CTTCCTTGTGAGAAAAGCATT
GCCAAGAGGGTACTAAGGTC
CTCGGAGGTGGAATGGCTG
ACACAGAGGTTTCCCCATCA
TGTCCTCCTCATTTCATCC
TGTGATAGGGTTATTTCTACTGAG
CAAATGAGGACCTGGAAAGAT
ATACAATAGTCAGATAATGGGGG
AACAGAGATGTGTAGCAGTAGGG
CCTTTTGACAATGTGGTAAC
CCACAAAGGGATAAAAACAT
AGGGCATTGGTGGACAGGA
CCGTTGAAAGGCATACTGTTGAA
GAACCAGACACAACATCACCAGT
GAAGAAACAGCGTTGGCATA
AATGTTATCCCCCTTCCCAG
TCGTTAGATGCGGAAAAAGC
GGCATCATCCTGAGTGAGGT
CCCCAATGGAGGAGCTAGAG
CCAGTACCCCAGAACTCTTGA
–
–
GAAAGAGAGGCCCTTTGGTCAGGCA
AAGAGAGGCCCTTTGGTCAGGCA
CAATGTCAACCTCAAGAAGA
ATGAGAGTTTGAAGAATGCCTT
CTTCCCAGTTTTCCCTCTA
TTTCAGATAGCAATACAAGTT
CTCGCTATATTTGGTCATTAT
GGTAACTGTGGGGGTGGAG
CTACAATCAAAAACCATCAGCAA
ATCAACAGGACTTTTGCCCC
GCCAATGCGAACGACTTC
CATCGGTGCCCGTCTGAACAGG
TGAGCATCCCACCCCCCTA
CTTCCGTGTGTTTCAGTGC
CCAGGAGGGAGTGTGTCAAT
CCTCAAGATGAAAGAAATGGT
CCACCTGTCGTCCATCTCC-FL
GGTTAGAAGTAGAGGTGATT
GTGTGATTTTATTTGGAGAG
GGCACACGGTATGAGAAAAGATTG
ATCCATTGTATCCATTTTGAC
TTCTACTCGAGCACAAAGACACA
CAGTGTCAGAAGTGAGATACCC
GCTGGGGATTGGGAGTAT
ACGTCTAGCATCCATGAGG
TCACGGCGGAACTGGGA
GGAGTCAGTGTAGTGCCTATGG
GCTGTAGCCTACCCATTAGTA
AGTTTGTGCTGCTGTGTATTC
TAACAGCACAAACTGAGGAAAT
AACAGGTTTGCCTTGCTCA
GCTCCAGTCAGCAAGCACTT
CAGACTTGGGTGTAGTGGG
AACCACCAAACATTCTACCA
ATTTGGTATTGATATTTTGCTCAGAC
GGCAATCCAACCTCTGTGTGTC
TTGTATATGATAGAGTTCTGTTTTTATAG
GGAAGAGAGGCAAAGCAAGA
GGCTGTTGCCAGGTAAATGT
CGAATTGCTCTGGCTAGGAC
ATCCCTGGAAATGGCAGTCTT
CCTACACACCCATTCCCATT
TTTCCAATGCTATCCCAAAAG
ATTACGTATTTTCCTCAATTA
TCCTTTTTTTTTTATTACGTATTTTCC
GCTTAAGGCTCTCCTATGTCTTTT
CAGGCCTCTAACAGGTCTTCA
GAAAGGACCCAGATGTAGC
TGTCCTCCCTGTCACCTAAAA
TATGCCTTTGTGGTAGTTTG
TAAGGTTCCACTCCCAC
AGATAGATTACACAGTGCTTTAT
CAGGCAGAGAATGAGAAGGAG
GCCTCTAAAGCCTACTCATCTTC
ACAGAATCTAGGCCCAGTG
TACACCTTGGGACCAGCGTACTCC
TTGCTGGGTAGGAAGAGCTCAG
CCAAACATCAGCGTCAGTATAG
ACCGTGGAGAGTTTTTCAA
CAAGGGTTCAATTCCCAAAA
AACACTTTATGATGGAACTGC
LC640-TCTGAGGGCAACTGGGTGTGG-P
CAAAACCACCCCTACTTCTAT
CCACTCACTACCTTAATACTAACCAC
54
58
60
52.8
56/58
56/57
58/60
58.8
50
58
60
60
61
58
60
60
62
60
59
60
60
59
60
55
55
56
55
57
51
56
58
54
53/55
63
61
58
58
58
58
58
58
55
–
58
52
814
922
291
472
350
407
293
220
426
416
211
333
376
307
358
497
224
276
252
271
247
270
234
246
281
317
201
284
505
215
598
411
391
332
646
227
364
189
474
195
376
641
–
571
207
k, kb from start site; BIS, bisulfite mutagenesis primer.
Quantitative (q) PCR analysis
qPCR analysis of mRNA levels was carried out using the iQ SYBR Green
Supermix (Bio-Rad, Mississauga, ON, Canada) following the manufacturer’s
instructions. Reactions were performed in triplicate on three to six samples
each for control and experimental groups in shRNA experiments, and on two
samples each for control and experimental groups in siRNA experiments.
Using an MJ Thermocycler Chromo4 Real-Time PCR System (Bio-Rad),
qPCR was conducted at 95°C for 2 minutes, 35 to 40 cycles of 94°C for 20
seconds, 58°C for 30 seconds, 72°C for 45 seconds, then 72°C for 7 minutes.
Samples were normalized to the reference gene beta-actin or to mitochondrial
ribosomal protein L1 (Mrpl1). As controls for off-target effects, Airn and
H19 expression was examined in the shRNA depletion study. For analyses,
control samples (WT cells in shRNA studies and untreated cells in siRNA
experiments) were set to a value of 1, and experimental reactions were
normalized to the control. To determine relative levels of expression across
the Kcnq1ot1 ncRNA, qPCR was performed for three E9.5 placental and two
XEN cell cDNAs in duplicate and standardized to genomic DNA
amplification to control for primer efficiency. qPCR was performed in
triplicate using three different DNA samples. Mean expression levels for each
primer set were then standardized to the 3k primer set. Standard error of the
mean (s.e.m.) was calculated.
Allelic expression analysis
Primers (Table 1), polymorphisms between B6 and CAST, and allelespecific restriction enzymes were reported for Slc22a18 (Dao et al., 1998),
Cdkn1c (Doherty et al., 2000), Kcnq1 (Gould and Pfeifer, 1998; Jiang et
al., 1998), Kcnq1ot1 (Rivera et al., 2008) and Ascl2 (Mann et al., 2003).
For Th, a polymorphism between B6 (G) and CAST (A) was identified at
position 1046 (NM_009377). Restriction digestion with BsrI resulted in
124 and 71 bp fragments in B6, whereas the CAST amplicon was
uncleaved. For Airn, a polymorphism at SNP rs6154084 on chromosome
17:12972645 between B6 (T) and CAST (C) was utilized in a restriction
assay with AvaI to produce 220 and 156 bp fragments in CAST, whereas
the B6 amplicon was uncleaved. To quantify the relative amounts of
DEVELOPMENT
Healthcare Biosciences, Baie d-Urfe, QC, Canada) at 95°C for 2 minutes,
35 to 45 cycles of 95°C for 30 seconds, Tm (see Table 1) for 30 seconds,
and 72°C for 50 seconds, followed by 7 minutes at 72°C, with a 4°C hold.
3670 RESEARCH ARTICLE
3⬘ Rapid amplification of cDNA ends (3⬘RACE)
The 3⬘RACE System Kit (Invitrogen) was used for cDNA synthesis and
for semi-nested PCR according to manufacturer’s protocol with the 470F
(first round) or 471F (second round) forward primer (Table 1) paired with
the universal adapter primer on E9.5 placental and E12.5 embryo RNA.
Following electrophoresis, bands of interest were recovered using the
Qiaquick Gel Extraction Kit (Qiagen), DNA fragments were ligated into
the pGEM-T EASY vector (Promega, Napean, ON, Canada), and the
vector was transformed into competent Escherichia coli. DNA was
extracted from bacterial colonies using the GenElute Plasmid Miniprep Kit
(Sigma-Aldrich). Sequencing was performed at the London Regional
Genomics Centre (London, ON, Canada), Nanuq Sequencing Facility
(Montreal, QC, Canada) or BioBasic (Markham, ON, Canada). BLAST
analysis (http://blast.ncbi.nlm.nih.gov/Blast.cgi) was performed to align
resulting sequences with the GenBank database.
Bisulfite sequencing
Bisulfite mutagenesis and sequencing with agarose embedding was
performed as described (Market-Velker et al., 2010; Golding et al.,
2010). Lysed cells (10 l) were embedded in 20 l 2% low-meltingpoint agarose (Sigma). Following bisulfite mutagenesis, 22 l diluted
agarose was added to Ready-To-Go PCR Beads containing Kcnq1ot1
BIS outer primers (Table 1) and 1 l 240 ng/ml tRNA. PCR reactions
were halved, allowing for two independent PCR reactions. The first
round product (5 l) was seeded into each second round PCR reaction
with Kcnq1ot1 BIS inner primers (Table 1). Sequencing was performed
at the Nanuq Sequencing Facility or BioBasic. Sequences with less than
95% conversion rates were not included. Percentage methylation was
calculated as the number of hypermethylated DNA strands/total number
of DNA strands. Hypermethylated DNA strands displayed ≥50%
methylated CpGs.
RNA fluorescence in situ hybridization (FISH)
Kcnq1ot1 and Airn FISH probes were generated from a 32 kb region of
fosmid Wl1-2505B3 in the Kcnq1 intronic region and a 42 kb region of
fosmid Wl1-270O22, respectively (CHORI, Oakland, CA, USA), using the
BioPrime DNA Labeling System (Invitrogen) and fluorescein-12-dUTP
(Roche Diagnostics) with minor modifications; Invitrogen dNTPs were
used and labeling reactions were incubated for 12 hours. Unincorporated
dNTPs were removed using ProbeQuant G-50 Micro Columns (GE
Healthcare). Probes were precipitated with Cot-1 DNA, yeast tRNA and
salmon sperm DNA (Invitrogen) and washed with 75% and 100% ethanol.
Probes were air dried then resuspended in 100% deionized formamide and
denatured at 85°C for 10 minutes. After 2 minutes on ice, 2⫻ hybridization
mix (25% dextran sulfate, 4⫻ SSC) was added, incubated at 37°C for 3090 minutes, then stored at –20°C.
XEN cells were seeded on glass slides (VWR, Mississauga, ON, Canada),
permeabilized with sequential transfers into ice-cold cytoskeletal extraction
buffer (CSK) for 30 seconds, ice-cold CSK containing 0.25% Triton X-100
(Sigma-Aldrich) for 45 seconds and ice-cold CSK for 30 seconds (Kalantry
et al., 2009), fixed in 4% paraformaldehyde at room temperature for 10
minutes (Panning and Jaenisch, 1996), washed in PBS, dehydrated in
sequential washes of 85%, 95% and 100% ethanol, then air dried. RNAFISH probes were hybridized overnight and washed as described (Murakami
et al., 2007). Cells were mounted and stained with Vectashield augmented
with DAPI (Vector Laboratories, Burlington, ON, Canada) and imaged using
z-stacks on a FluoView FV1000 coupled to an IX81 motorized inverted
system microscope (Olympus, Markham, ON, Canada). Fluorescence signal
volumes were measured using intensity-based thresholds in Volocity (v5.2.0,
PerkinElmer, Woodbridge, ON, Canada).
Statistical analysis
One-tailed Student’s t-tests were performed on mean qPCR values and on
mean fluorescence signal volumes. P-values were considered to be
significant at P<0.05.
RESULTS
Kcnq1ot1 is a macro ncRNA
To better define the role of the Kcnq1ot1 ncRNA in imprinted gene
regulation, we first delineated transcript length, as at least four
conflicting reports exist regarding the ncRNA length (Horike et al.,
2000; Yatsuki et al., 2000; Pandey et al., 2008; Redrup et al., 2009).
Primer pairs were designed to amplify intronic and intergenic regions
from E9.5 placental cDNA starting at 3 kb from the Kcnq1ot1 TSS
and extending to 619 kb, within Ins2. Only primer sets that
successfully amplified genomic DNA were utilized. A failure of
primer pairs to amplify cDNA but not genomic DNA indicated that
there was no transcript present at that location. Amplification with
primer sets ~50 kb apart revealed that the 3⬘ end of Kcnq1ot1 resides
in a region between 449 to 486 kb (Fig. 1). Primer pairs were then
designed every ~5 kb within this 37 kb region. A fragment was
detected at 457, 463 and 468 kb, but not at 475 and 479 kb. Finally,
primer sets were designed at less than 1 kb intervals between 463 to
475 kb. Whereas primers between 463 and 470 kb successfully
amplified cDNA, primers at 471, 474 and 475 kb failed to produce
amplicons. To identify the 3⬘ end of the transcript, 3⬘RACE was
performed on E9.5 placental and E12.5 embryonic cDNA. Sequence
analysis of cloned 3⬘RACE products mapped the polyadenylation
signal to 471 kb (Fig. 1). To confirm transcript termination at the
polyadenylation signal, primer sets were designed between 470,857
and 471,291 bp (see Fig. S2 in the supplementary material). The end
of the transcript resides at 471,164 bp.
Kcnq1ot1 transcript length is invariant
Midgestation embryos display differential regulation of
imprinted genes in embryonic and placental tissue. One
explanation for this differential regulation is that alternative
Kcnq1ot1 transcripts exist with variant lengths. To determine
whether Kcnq1ot1 length was tissue-dependent, B6XCAST ES
cells, XEN cells, TS cells and neonatal brain samples, as well as
CAST7XB6 E12.5 embryo and placenta, were compared with
B6XCAST E9.5 placenta using selected primer sets along the
putative Kcnq1ot1 ncRNA. Amplification was observed up to
470 kb in all tissues, but not beyond (Fig. 2A). Thus, in all three
lineages and at all developmental time points examined,
Kcnq1ot1 length was conserved. To determine relative levels of
expression across the Kcnq1ot1 ncRNA, cDNA amplifications
for individual primer sets were standardized to the 3k primer set
(Fig. 2B). No statistical difference was observed in transcript
abundance across the ncRNA, supporting the premise that the
ncRNA is a single RNA moiety.
Kcnq1ot1 is primarily transcribed as a full-length
transcript that originates from the Kcnq1ot1
promoter
To definitively demonstrate that the amplified products
corresponded to the Kcnq1ot1 transcript, we employed RNAi
technology, as well as a targeted deletion of the paternal Kcnq1ot1
ICR. Given the demonstrated ability of short interfering RNAs
(siRNAs) and shRNAs to deplete nuclear transcripts (Robb et al.,
2005; Willingham et al., 2005; Zhao et al., 2008), we first
determined whether amplified PCR products were specific to the
Kcnq1ot1 ncRNA using RNAi. As a shRNA targeting Kcnq1ot1
DEVELOPMENT
amplicons, computer-assisted densitometry was performed with
QuantityOne 1-D Analysis Software (Bio-Rad) to calculate the adjusted
intensity/mm2 for each band. The H19 allelic expression assay using the
LightCycler Real-Time PCR System (Roche Molecular Biochemicals) was
performed with hybridization probes (Table 1) as described (Mann et al.,
2004). Parental allele-specific expression was calculated as the percentage
B6 or CAST expression relative to the total expression. Monoallelic
expression was defined as ≥90% from one parental allele.
Development 138 (17)
Kcnq1ot1 ncRNA depletion in stem cells
RESEARCH ARTICLE 3671
will result in degradation of the entire Kcnq1ot1 ncRNA (Hannon,
2002), it was expected that amplicons specific to Kcnq1ot1 would
exhibit reduced RNA levels compared with controls, whereas those
from another undefined transcript would be unaffected by RNA
depletion. Real-time qPCR was performed using cDNA from
transgenic XEN cells containing a shRNA targeting Kcnq1ot1 at
43 kb from the TSS (K43), control XEN cells harboring an
ineffectual shRNA (K82), and WT cells. XEN cells were chosen
because they are functionally relevant as preimplantation extraembryonic cells, exhibit abundant expression of Kcnq1ot1, and are
effectively transduced with the shRNA targeting vectors (Golding
et al., 2010). qPCR was performed with primers at intronic and
intergenic regions: 3k, 65k, 202k, 307k, 392k, 463K and 470k (Fig.
3A). Amplification of Kcnq1ot1 was significantly decreased (8897%) in K43-transduced XEN cells compared with controls for all
primer pairs examined (P<0.05) (Fig. 3C), indicating that all
amplicons represent the Kcnq1ot1 ncRNA. As controls for offtarget effects, the expression of two other ncRNAs, Airn and H19,
was examined. Expression of Airn and H19 was not statistically
different among WT, K82 and K43 XEN cells (Fig. 3C).
If a single full-length RNA is primarily produced, we would
expect that targeting near the terminal region of the transcript
would yield a similar depletion of amplified regions as targeting
the ncRNA near the TSS. If multiple transcripts are produced of
varying length, we would anticipate greater depletion for more
terminal regions than for more proximal regions when the ncRNA
is targeted at its distal end. To test this, siRNAs were designed to
target Kcnq1ot1 at the proximal and distal ends at 7 and 463 kb
from the TSS (si7 and si463) (Fig. 3A). Owing to the ease of
transfection and the availability of established protocols, mouse
embryonic fibroblast (NIH 3T3) cells were transfected with a
scrambled, non-targeting control siRNA, si7 or si463, and were
compared with non-transfected cells. Real-time RT-PCR analysis
was performed with primers 3k, 94k, 118k, 392k and 470k along
the length of the putative transcript. NIH 3T3 si7- and si463targeted cells had significantly reduced transcript abundance (for
si7 and si463, respectively: 3k, 70% and 76%; 94k, 84% and 93%;
118k, 98% and 100%; 392k, 93% and 97%; 470k, 84% and 82%)
compared with control cells (P<0.05) (Fig. 3D). As depletion of
Kcnq1ot1 at the proximal and distal ends of the transcript were not
statistically different for each primer set, and as distal amplicons
were no more reduced than proximal regions for si463, these
results indicate that the majority of Kcnq1ot1 transcripts are full
length and extend at least 470 kb.
As a final confirmation that the Kcnq1ot1 transcript extends 471
kb, a targeted deletion of the paternal Kcnq1ot1 ICR (Fitzpatrick et
al., 2002) was employed (Fig. 3B). qPCR was performed using
cDNA from E9.5 B6XCAST WT and paternal Kcnq1ot1 IC2
placenta using primer sets 3k, 65k, 118k, 202k, 307k, 392k, 463k
and 470k (Fig. 3E). For all primer sets, paternal IC2 placenta
failed to produce an amplification product, in contrast to control
placenta, verifying that Kcnq1ot1 transcript length is at least 470
kb and that the amplicons are specific to a transcript originating
from the Kcnq1ot1 ICR/promoter.
DEVELOPMENT
Fig. 1. The putative Kcnq1ot1 ncRNA extends 471 kb from the transcription start site. Organization of the mouse Kcnq1ot1 and H19
imprinting domains. Top and bottom strands correspond to maternal and paternal alleles, respectively. Intronic and intergenic regions from 3 to 619
kb (arrowheads) were amplified using E9.5 placental cDNA (P) and genomic DNA (G) as a positive control. The putative Kcnq1ot1 ncRNA extends
471 kb (471k) (vertical green line). 3⬘RACE identified a polyadenylation signal (underlined) at 471 kb. Wavy lines, ncRNAs; red boxes and wavy lines,
maternal expression in embryo and placenta; pink boxes, maternal expression in placenta; blue boxes and wavy lines, paternal expression; black
circles, methylated CpG island; white circles, unmethylated CpG island. ICR, imprinting control region.
3672 RESEARCH ARTICLE
Development 138 (17)
Imprinted status of Th
Th is located between the Kcnq1ot1 and H19 imprinting domains,
but is not recognized as a member of either domain as targeted
disruption of Th failed to demonstrate any parental origin effects
(Zhou et al., 1995). However, another study using microarray
technology to identify imprinted genes found that Th is maternally
expressed in placenta (Schulz et al., 2006). As we found that
Kcnq1ot1 was transcribed through Th, this warranted further
analysis of its imprinted status. RT-PCR was performed on
B6XCAST E7.5, E8.5, E9.5 and CAST7XB6 E12.5 embryonic and
placental cDNA. The relative maternal and paternal transcript
abundance was determined by BsrI allelic restriction digestion (Fig.
4). Th displayed maternal expression in E7.5 embryo and placenta
and E8.5 placenta, and preferential maternal expression in E9.5 and
E12.5 placenta, but was biallelically expressed in the corresponding
embryonic tissues. These results demonstrate that Th shares a
similar expression pattern with the neighboring genes Tssc4 and
Cd81, with maternal expression in extra-embryonic lineages but
progressive biallelic expression in the embryo (Caspary et al.,
1998; Lewis et al., 2004; Umlauf et al., 2004).
Imprinting is maintained upon Kcnq1ot1 RNA
depletion
Previous studies have shown that truncation of Kcnq1ot1 or
deletion of the Kcnq1ot1 promoter results in derepression of
imprinted genes within the domain. However, in these studies
there was no delineation between transcription of Kcnq1ot1 and
a functional role for the transcript itself (Fitzpatrick et al., 2002;
Mancini-DiNardo et al., 2006; Shin et al., 2008). If the transcript
has a function in silencing genes in this region, its depletion
would be expected to result in activation of maternally
transcribed genes from the paternal chromosome. To determine
whether Kcnq1ot1 depletion results in loss of imprinting within
the Kcnq1ot1 domain, imprinted methylation and expression
were assayed in ES, TS and XEN cells. The DNA methylation
status of the Kcnq1ot1 ICR was determined by the bisulfite
mutagenesis and sequencing assay. Results showed no change in
Kcnq1ot1 ICR methylation patterns in B6XCAST K43transduced cells as compared with B6XCAST WT and K82transduced control cells. Maternal DNA strands were
hypermethylated, whereas paternal DNA strands remained
hypomethylated (Fig. 5), indicating that depletion of the
Kcnq1ot1 transcript in stem cells had little effect on ICR
methylation.
To assess the effects of Kcnq1ot1 depletion on imprinted
expression, allelic expression analysis was performed for the
control genes H19 and Airn and for five imprinted genes in K43transduced cells, as well as WT, K82-transduced and LUCtransduced control ES, TS and XEN cells (Fig. 6). Depletion of
Kcnq1ot1 by shRNA K43 had no effect on H19 or Airn imprinted
expression. As bidirectional silencing of imprinted genes occurs
within the Kcnq1ot1 imprinted domain, two genes upstream
DEVELOPMENT
Fig. 2. Kcnq1ot1 transcript length is conserved in a variety
of tissues and at various developmental time points.
(A)Selected primers along the length of the Kcnq1ot1
transcript were used to amplify the transcript in mouse E9.5
placenta (9.5P), E12.5 embryo (12.5E) and placenta (12.5P),
neonatal brain, embryonic stem (ES), trophoblast stem (TS) and
extra-embryonic endoderm stem (XEN) cells, as well as genomic
DNA (gDNA) as a control. In all tissues, signal from the
transcript was detected up to and including 470k (470A1). No
amplification was detected 14 and 23 bp downstream at
470A2 and 471B2, respectively, or at 474k, 475K, 479k and
492k (data not shown) in cDNA as compared with control
gDNA. -actin and no RT (lacking reverse transcriptase)
reactions were included as positive and negative controls,
respectively. M, size marker. (B)To determine whether the
Kcnq1ot1 ncRNA was essentially a single RNA moiety, qRT-PCR
was performed along the length of the Kcnq1ot1 transcript and
standardized to the 3k primer set. No statistical difference was
observed in transcript abundance between the primer sets in
E9.5 placenta or in XEN cells. In this analysis, primer set 65kB
was used instead of 65k owing to its shorter amplicon and
better PCR amplification efficiency. Error bars indicate s.e.m.
Kcnq1ot1 ncRNA depletion in stem cells
RESEARCH ARTICLE 3673
(Slc22a18 and Cdkn1c) and three genes downstream (Kcnq1, Ascl2
and Th) of the Kcnq1ot1 ICR were analyzed. Similar to control ES,
TS and XEN cells, K43-transduced cells displayed primarily
monoallelic expression from the maternal Kcnq1 and Cdkn1c
alleles, as previously observed for WT ES and TS cells (Umlauf et
al., 2004; Lewis et al., 2006). For Slc22a18 and Th, K43transduced and control TS and XEN cells were found to have
monoallelic expression, whereas ES cells exhibited biallelic
expression. Ascl2 expression was monoallelic in TS cells but
biallelic in ES and XEN cells, with little difference between K43transduced and control cells. Thus, imprinted gene expression was
maintained in K43-transduced stem cells despite a ≥82% reduction
in the Kcnq1ot1 ncRNA. Thus, depletion of Kcnq1ot1 RNA in
embryonic and extra-embryonic stem cells does not result in
domain-wide loss of imprinting.
The Kcnq1ot1 ncRNA localizes to the nuclear compartment as a
strong signal that overlaps the paternal Kcnq1ot1 domain (Pandey et
al., 2008; Terranova et al., 2008; Redrup et al., 2009). Given that
imprinted expression and methylation were maintained despite a
substantial decrease in Kcnq1ot1 ncRNA, we next determined
whether Kcnq1ot1 ncRNA localization was abrogated by K43 RNAi
depletion. RNA FISH was performed using probes for Kcnq1ot1
and, as a control, Airn. Cells were analyzed by confocal microscopy,
and volumetric measurements were taken (Fig. 7). For the purposes
of comparison, signal volumes were classified according to Redrup
et al. (Redrup et al., 2009). Airn showed similar volume distributions
for WT and K43-transduced XEN cells: 47.9% and 50.4% for 0-0.4
m3, 21.4% and 20.9% for 0.4-0.8 m3, 16.3% and 12.5% for 0.81.2 m3, 8.3% and 5.1% for 1.2-1.6 m3, 3.3% and 5.1% for 1.6-2.0
m3 and 2.6% and 6.0% for >2.0 m3, respectively (Fig. 7). No
significant difference was found for mean Airn volume in WT and
K43-transduced cells, at 0.58 and 0.61 m3, respectively. This
contrasts with Kcnq1ot1, where volume size was significantly
decreased in K43-transduced cells compared with WT XEN cells:
68.8% versus 53.1% for 0-0.4 m3, 19.9% versus 24.9% for 0.4-0.8
m3, 8.4% versus 11.8% for 0.8-1.2 m3, 2.3% versus 6.1% for 1.21.6 m3, 0.3% versus 2.4% for 1.6-2.0 m3 and 0.3% versus 1.7%
for >2.0 m3, respectively (Fig. 7). Overall, mean Kcnq1ot1 volume
DEVELOPMENT
Fig. 3. Kcnq1ot1 RNA depletion and paternal IC2 deletion lead to a significant reduction in Kcnq1ot1 transcript abundance up to 470
kb. (A,B)The mouse Kcnq1ot1 imprinted domain. (A)RNAi analysis using shRNA K43 (dark-blue X) and siRNA si7 and si463 (light-blue Xs).
(B)Paternal IC2 deletion () analysis. Dashed line, putative Kcnq1ot1 ncRNA. See Fig. 1 for symbol details. qRT-PCR analysis was performed using
primer sets that mapped to intronic and intergenic regions (arrowheads). (C)XEN cells transduced with shRNA K43. Kcnq1ot1 was significantly
depleted in K43-transduced cells at 3, 65, 202, 307, 392, 463 and 470 kb (dark-blue text in A) as compared with control cells. (D)NIH 3T3 cells
transfected with si7, si463 or a non-targeting siRNA (NT). Reduced amplification of the transcript was seen with both si7 and si463 siRNAs versus
NT and wild-type (WT) control NIH 3T3 cells at 3, 94, 118, 392 and 470 kb (light-blue text in A). (E)Paternal IC2 deletion analysis in E9.5 placenta.
All regions examined showed significant loss of Kcnq1ot1 expression. Error bars, s.e.m.; *, P<0.05.
Fig. 4. Th is expressed primarily from the maternal allele in
placenta and becomes biallelic within the embryo during
postimplantation development. Th amplicons were subjected to BsrI
digestion to discriminate between B6 and CAST alleles and
densitometry was performed to determine relative maternal and
paternal transcript abundance. Multiple mouse embryos (n3-5) were
analyzed and means were calculated for each sample. E, embryo; P,
placenta. Error bars indicate s.e.m.
was significantly decreased in K43-transduced XEN cells: 0.30 m3,
as compared with 0.49 m3 for WT cells (P<6⫻10–7). Thus, we
conclude that imprinted methylation and expression are maintained
even though the majority (69%) of K43-transduced cells exhibit very
little or no RNA accumulation.
DISCUSSION
In this study, we found that the Kcnq1ot1 macro ncRNA extends to
471 kb from the TSS, exists predominantly as a full-length
transcript, and originates from the Kcnq1ot1 ICR. Kcnq1ot1 length
was conserved in embryonic and placental tissues, as well as in
embryo-derived stem cells and postnatal brain. The extensive
length of Kcnq1ot1 is significant as it suggests that transcription
through downstream genes might play a role in their silencing.
Post-transcriptional shRNA-mediated Kcnq1ot1 RNA depletion in
embryonic and extra-embryonic stem cells had no effect on the
imprinted expression of genes within the domain, nor on DNA
methylation at the Kcnq1ot1 ICR, although a significant decrease
in Kcnq1ot1 signal volume was observed. These data support the
argument that it is the act of transcription that plays a role in
imprint maintenance during early development, rather than there
being a post-transcriptional role for the RNA itself.
Kcnq1ot1 length and function
Original estimates placed Kcnq1ot1 at ~60 kb based on sequence
homology between mouse and human (Horike et al., 2000; Yatsuki
et al., 2000), 91.5 kb from the TSS (Pandey et al., 2008), or
between 80 kb and 120 kb with a polyadenylation site located 121
kb downstream (Redrup et al., 2009). In these studies, the Kcnq1ot
putative stop site falls short of the Kcnq1 TSS. Here, we
demonstrate using RNAi technology as well as a paternal IC2
deletion that the Kcnq1ot1 ncRNA extends through downstream
imprinted genes to 471 kb from the TSS.
The mouse and human Kcnq1ot1/KCNQ1OT1 domains possess
a high degree of synteny (Paulsen et al., 1998; Engemann et al.,
2000; Onyango et al., 2000; Paulsen et al., 2000; Yatsuki et al.,
2000). Both domains are ~1 Mb and the maternal ICR is
methylated and the Kcnq1ot1/KCNQ1OT1 ncRNA is expressed
from the paternal allele (Verona et al., 2003; Barlow and
Development 138 (17)
Bartolomei, 2007). However, notable differences also exist. In
mouse, the region between Th and Ins2 is over 200 kb and contains
an extraordinarily high concentration of tandem repeats, long
interspersed nuclear element (LINE) retrotransposons and
endogenous retroelements (Shirohzu et al., 2004). This repeat-rich
region also exhibits asynchronous replication, similar to the rest of
the domain, and contains 18 matrix attachment regions (Yatsuki et
al., 2000; Purbowasito et al., 2004). In human, the distance between
TH and INS is considerably shorter (~10 kb). However, a highly
repetitive region that is enriched for LINEs and SINEs (short
interspersed elements) and retroelements is found between ASCL2
and TH (a ~115 kb region) in humans (Shirohzu et al., 2004) and
in the marsupial tammar wallaby (Ager et al., 2008). If repetitive
regions play a role in boundary function, this might indicate that
the boundary between the KCNQ1OT1 and H19 domains in
humans is within the ASCL2 and TH repetitive region. Current
evidence argues against this, however, as ASCL2 apparently
escapes genomic imprinting in humans (Miyamoto et al., 2002).
Alternatively, if repetitive elements are unrelated to boundary
function, the boundary might lie within the conserved region
upstream of INS/Ins2. A recent investigation of a maternally
expressed GFP reporter located more than 600 kb downstream of
the Kcnq1ot1 ICR and 2.6 kb upstream of Ins2 (Jones et al., 2011)
found that the reporter was regulated in the same manner as other
maternally expressed genes within the Kcnq1ot1 imprinted domain,
possibly placing the boundary within 2.6 kb of Ins2.
Imprinted Kcnq1ot1 domain regulation
Precedent exists for macro ncRNAs residing within imprinted
domains (Koerner et al., 2009), ranging from Xist as a 17 kb
ncRNA to Ube3a-ats (Snrpnlt, Lncat), which possibly extends
more than 1000 kb (Koerner et al., 2009). If the Kcnq1ot1 ncRNA
functioned similarly to Xist, a ncRNA involved in X chromosome
inactivation (Pauler et al., 2007), then an excessively long RNA
would be unnecessary as the 17 kb Xist ncRNA is more than
sufficient to coat and effectively silence an entire chromosome
(Brockdorff et al., 1992). In addition, if transcript length is a
determining factor in imprinted gene regulation, we would expect
that differential regulation of the Kcnq1ot1 domain in embryonic
and extra-embryonic tissues would correlate with shorter and
longer transcript lengths, respectively. Instead, we observed that the
Kcnq1ot1 transcript length remained the same in embryonic and
extra-embryonic lineages and at all developmental stages
examined, indicating that Kcnq1ot1 mRNA length does not
contribute to differential silencing.
Various models have been proposed for Kcnq1ot1 imprinted
domain regulation, including a role for the ncRNA itself and a role
for Kcnq1ot1 transcription in initiating chromatin silencing
(Mancini-DiNardo et al., 2003; Lewis et al., 2004; Lewis et al.,
2006; Pauler et al., 2007; Shin et al., 2008; Koerner et al., 2009;
Nagano and Fraser, 2009). To differentiate between functions of the
transcript and of transcription, we employed RNAi technology that
preserves transcription but degrades the macro ncRNA posttranscriptionally. Kcnq1ot1 transcripts were depleted in both
embryonic and extra-embryonic stem cells, in case the Kcnq1ot1
transcript or its transcription had different regulatory roles in these
cell types. Despite significant depletion (>80%), the imprinted
expression of genes within the domain and the imprinted DNA
methylation of the Kcnq1ot1 ICR were maintained in all three
lineages of the early embryo. These results suggest that it is the act
of transcription that plays a role in imprinted gene regulation rather
than there being a post-transcriptional role for the RNA itself. If the
DEVELOPMENT
3674 RESEARCH ARTICLE
Kcnq1ot1 ncRNA depletion in stem cells
RESEARCH ARTICLE 3675
ncRNA had played a post-transcriptional role in imprinted gene
regulation, we would have anticipated the activation of the
normally silent paternal alleles of protein-coding genes in these
cells, which would have been detected in the allelic expression
assays.
RNA-depletion studies have also been performed for the Gtl2
(Meg3 – Mouse Genome Informatics) and Xist ncRNAs. Depletion
of Gtl2 results in a ~50% reduction in histone H3 lysine 27
trimethylation (H3K27me3) and in the overexpression of
neighboring imprinted genes (Zhao et al., 2010); this study also
demonstrates that 50-70% ncRNA depletion is sufficient to produce
a change in imprinted gene regulation. Depletion of the 1.6 kb
RepA ncRNA within the Xist locus in female ES cells abolishes
Xist localization and H3K27me3 (Zhao et al., 2008). This contrasts
with female ES cells transduced with a shRNA targeting Xist exon
1, where a 70-80% depletion of Xist reduced the number of cells
exhibiting Xist localization but had no perceptible effect on
H3K27me3. Furthermore, compacted preimplantation embryos
lacking Xist were proficient at silencing X-linked genes on the
paternal chromosome, indicating that initiation of X inactivation
can occur in the absence of the Xist ncRNA (Kalantry et al., 2009).
Together, these studies suggest a limited post-transcriptional role
for the long ncRNAs Xist and Kcnq1ot1.
One caveat of these RNA-depletion experiments is that they
represent a snapshot in time. Thus, the Kcnq1ot1 ncRNA might
be required later in development to maintain domain imprinting,
similar to the Xist ncRNA, which stably silences paternal Xlinked genes in postimplantation extra-embryonic tissues
(Kalantry et al., 2009). As Slc22a18 has still to acquire imprinted
expression in ES cells, this indicates that imprinting within the
Kcnq1ot1 domain has not yet been completely established.
Consistent with this, parental-specific histone modifications have
not yet been acquired in ES and TS cells at imprinted genes that
exhibit postimplantation placenta-specific imprinted expression
(Lewis et al., 2006). Thus, further studies are required during
late embryogenesis to delineate the role of the Kcnq1ot1 ncRNA
in imprinted gene regulation. Alternatively, the Kcnq1ot1
ncRNA might function in imprinted domain establishment. As
depletion occurred after fertilization in late preimplantation stem
cells (i.e. not in germline-inherited cells), imprinting of the
Kcnq1ot1 domain may have already been largely established,
after which point the Kcnq1ot1 ncRNA might have little or no
role to play in imprint maintenance. This would argue for an
examination of Kcnq1ot1 function by RNAi-based methods prior
to the two-cell stage, when the RNA is first transcribed. Either
way, our data, produced by shRNA-targeted depletion of the
DEVELOPMENT
Fig. 5. Imprinted methylation is
preserved in Kcnq1ot1-depleted stem
cells. Methylation status of the Kcnq1ot1
ICR in B6XCAST K43-transduced and
control ES, TS and XEN mouse cells. Black
circles, methylated CpGs; white circles,
unmethylated CpGs. Each line denotes
an individual DNA strand. Percentage of
hypermethylation is indicated above each
set of DNA strands. Twenty CpG
dinucleotides within the Kcnq1ot1 ICR
(nucleotide position 141392-141598,
accession number AJ271885) were
analyzed (Market-Velker et al., 2010).
Mat, maternal; Pat, paternal.
3676 RESEARCH ARTICLE
Development 138 (17)
Kcnq1ot1 ncRNA, suggest that any post-transcriptional role for
the ncRNA in imprint maintenance during early development is
limited.
One can envisage three transcription-based regulatory models
for the Kcnq1ot1 imprinted domain. First, transcription of
Kcnq1ot1 might cause interference with RNA polymerase II
access to other promoters, thereby preventing paternal proteincoding gene transcription (Pauler et al., 2007; Koerner et al.,
2009). A 471 kb macro ncRNA could effectively silence genes
as it is transcribed through them. However, we found that the
Kcnq1ot1 ncRNA is of invariant length. This means that the
Kcnq1ot1 ncRNA would be transcribed through all promoters in
both embryonic and extra-embryonic tissues, including those in
the embryo/embryonic stem cells that are not silenced, such as
Ascl2 and Th. Second, the ncRNA might not be required post-
transcriptionally but is instead needed during the act of
transcription, with the ncRNA acting as a tether or a cis-guide
for recruiting repressive complexes (Lee, 2009; Tsai et al.,
2010). However, the transcriptional interference and RNAtethering mechanisms fail to explain how genes on the opposite
side of the Kcnq1ot1 promoter are silenced and thus cannot be
the sole mechanism of imprinted gene regulation. Third,
transcription through one or more cis-regulatory elements might
be necessary to evoke domain-wide silencing. In this case,
ncRNA transcription might function to set up a repressive
nuclear compartment (Shin et al., 2008; Nagano and Fraser,
2009), possibly via retroelement transcription and Argonaut1
repressive remodeling complex recruitment (Golding et al.,
2010) or by chromatin looping (Koerner et al., 2009). The fact
that Kcnq1 and Th displayed imprinted expression in XEN
DEVELOPMENT
Fig. 6. Imprinted expression is
preserved in Kcnq1ot1-depleted
stem cells. Imprinted expression
analysis of the control genes H19
and Airn and of the imprinted
genes Scl22a18, Cdkn1c, Kcnq1,
Ascl2 and Th within the Kcnq1ot1
domain was performed on K43transduced and control ES, XEN
and TS mouse cells. Multiple
biological replicates (n3-6) were
analyzed. For each sample, allelic
expression was calculated as the
percentage expression of the B6 or
CAST allele relative to the total
expression of both alleles. Mean
allelic expression was then
determined. As controls, allelic
expression analysis was also
performed on cDNA from
B6XCAST E9.5 placenta (BXC Pl)
and CASTXB6 IC E9.5 placenta
(CXBIC Pl) and on cDNA from
mixed B6 (B) and CAST (C) parental
RNA (e.g. 75B:25C is 75% B6 and
25% CAST). Error bars indicate
s.e.m.
Kcnq1ot1 ncRNA depletion in stem cells
RESEARCH ARTICLE 3677
Fig. 7. Kcnq1ot1 signal volume is significantly reduced in Kcnq1ot1-depleted stem cells. RNA FISH was performed on K43-transduced and
WT XEN mouse cells using RNA probes for Airn and Kcnq1ot1. Nuclei were counterstained with DAPI (blue) and imaged by confocal microscopy
(Airn, n193 cells; Kcnq1ot1, n298). Representative images are shown. Arrows point to very small signal volumes. Volumetric measurements of
signal were rendered using Volocity. The mean volume of the Kcnq1ot1 signal was significantly decreased in K43-transduced XEN cells as compared
with WT cells (P<6⫻10–7). No significant difference was found for the Airn mean signal volume in WT and K43-transduced XEN cells (P<0.7). Error
bars indicate s.e.m. Scale bars: 1m.
Acknowledgements
We thank Rosemary Oh and Louis Lefebvre for IC placenta; Andy Fedoriw
and Terry Magnuson for FISH reagents, protocols and advice; Liana Kaufman,
Morgan McWilliam and Malaika Roussouw-Miles for technical assistance. The
authors acknowledge the late Galina V. Fitzpatrick, who generated the
Kcnq1ot1 ICR deletion mice. She will be sorely missed. This work was
supported by research grants from NSERC 326876-06, Lawson Health
Research Institute and Department of Obstetrics and Gynecology, University of
Western Ontario to M.R.W.M., and by NCI/NIH grant 2RO1 CA089426 to
M.J.H. M.R.W.M. was supported by the Ontario Women’s Health Council/CIHR
Institute of Gender and Health New Investigator Award. M.C.G. was
supported by the Ontario Women’s Health Council/CIHR Institute of Gender
and Health Fellowship Award and the Dr David Whaley Postdoctoral
Fellowship in Maternal/Fetal and Neonatal Research. Deposited in PMC for
release after 12 months.
Competing interests statement
The authors declare no competing financial interests.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/lookup/suppl/doi:10.1242/dev.057778/-/DC1
References
Ager, E. I., Pask, A. J., Gehring, H. M., Shaw, G. and Renfree, M. B. (2008).
Evolution of the CDKN1C-KCNQ1 imprinted domain. BMC Evol. Biol. 8, 163.
Barlow, D. P. and Bartolomei, M. S. (2007). Genomic imprinting in mammals. In
Epigenetics (ed. C. D. Allis, T. Jenuwein, D. Reinberg and M.-L. Caparros), pp.
357-375. Cold Spring Harbor: Cold Spring Harbor Laboratory Press.
Brockdorff, N., Ashworth, A., Kay, G. F., McCabe, V. M., Norris, D. P., Cooper,
P. J., Swift, S. and Rastan, S. (1992). The product of the mouse Xist gene is a
15 kb inactive X-specific transcript containing no conserved ORF and located in
the nucleus. Cell 71, 515-526.
Caspary, T., Cleary, M. A., Baker, C. C., Guan, X.-J. and Tilghman, S. M.
(1998). Multiple mechanisms regulate imprinting of the mouse distal
chromosome 7 gene cluster. Mol. Cell. Biol. 18, 3466-3474.
Dao, D., Frank, D., Qian, N., O’Keefe, D., Vosatka, R. J., Walsh, C. P. and
Tycko, B. (1998). IMPT1, an imprinted gene similar to polyspecific transporter
and multi-drug resistance genes. Hum. Mol. Genet. 7, 597-608.
Doherty, A. S., Mann, M. R. W., Tremblay, K. D., Bartolomei, M. S. and
Schultz, R. M. (2000). Differential effects of culture on imprinted H19
expression in the preimplantation mouse embryo. Biol. Reprod. 62, 1526-1535.
Engemann, S., Strodicke, M., Paulsen, M., Franck, O., Reinhardt, R., Lane,
N., Reik, W. and Walter, J. (2000). Sequence and functional comparison in the
Beckwith-Wiedemann region: implications for a novel imprinting centre and
extended imprinting. Hum. Mol. Genet. 9, 2691-2706.
Fitzpatrick, G. V., Soloway, P. D. and Higgins, M. J. (2002). Regional loss of
imprinting and growth deficiency in mice with a targeted deletion of KvDMR1.
Nat. Genet. 32, 426-431.
DEVELOPMENT
cells but Ascl2 was biallelically expressed might support this
model, with Ascl2 excluded from the repressive compartment
or loop. Interestingly, each of these models is congruent with
the fact that the majority of WT XEN cells possessed very low
to no Kcnq1ot1 nuclear signal, an observation that might be
reflective of a more transient role for the ncRNA or for its
transcription.
Much further investigation will be required to unravel the
functional complexities of ncRNAs and their transcription in
imprinted gene regulation. Novel technologies in transcription
biology, such as the use of synthetic pyrrole-imidazole polyamide
gene silencers, as well as the identification of a larger number of
chromatin remodelers/modifiers involved in imprinted gene
regulation, will lead to advances in our understanding of these
mechanisms.
Golding, M. C., Zhang, L. and Mann, M. R. (2010). Multiple epigenetic
modifiers induce aggressive viral extinction in extraembryonic endoderm stem
cells. Cell Stem Cell 6, 457-467.
Gould, T. D. and Pfeifer, K. (1998). Imprinting of mouse Kvlqt1 is
developmentally regulated. Hum. Mol. Genet. 7, 483-487.
Hannon, G. J. (2002). RNA interference. Nature 418, 244-251.
Horike, S., Mitsuya, K., Meguro, M., Kotobuki, N., Kashiwagi, A., Notsu, T.,
Schulz, T. C., Shirayoshi, Y. and Oshimura, M. (2000). Targeted disruption of
the human LIT1 locus defines a putative imprinting control element playing an
essential role in Beckwith-Wiedemann syndrome. Hum. Mol. Genet. 9, 20752083.
Jiang, S., Hemann, M. A., Lee, M. P. and Feinberg, A. P. (1998). Straindependent developmental relaxation of imprinting of an endogenous mouse
gene, Kvlqt1. Genomics 53, 395-399.
Jones, M. J., Bogutz, A. B. and Lefebvre, L. (2011). An extended domain of
Kcnq1ot1 silencing revealed by an imprinted fluorescent reporter. Mol. Cell. Biol.
31, 2827-2837.
Kalantry, S., Purushothaman, S., Bowen, R. B., Starmer, J. and Magnuson, T.
(2009). Evidence of Xist RNA-independent initiation of mouse imprinted Xchromosome inactivation. Nature 460, 647-651.
Koerner, M. V., Pauler, F. M., Huang, R. and Barlow, D. P. (2009). The function
of non-coding RNAs in genomic imprinting. Development 136, 1771-1783.
Lee, J. T. (2009). Lessons from X-chromosome inactivation: long ncRNA as guides
and tethers to the epigenome. Genes Dev. 23, 1831-1842.
Lee, M. P., DeBaun, M. R., Mitsuya, K., Galonek, H. L., Brandenburg, S.,
Oshimura, M. and Feinberg, A. P. (1999). Loss of imprinting of a paternally
expressed transcript, with antisense orientation to KVLQT1, occurs frequently in
Beckwith-Wiedemann syndrome and is independent of insulin-like growth factor
II imprinting. Proc. Natl. Acad. Sci. USA 96, 5203-5208.
Lewis, A., Mitsuya, K., Umlauf, D., Smith, P., Dean, W., Walter, J., Higgins,
M., Feil, R. and Reik, W. (2004). Imprinting on distal chromosome 7 in the
placenta involves repressive histone methylation independent of DNA
methylation. Nat. Genet. 36, 1291-1295.
Lewis, A., Green, K., Dawson, C., Redrup, L., Huynh, K. D., Lee, J. T.,
Hemberger, M. and Reik, W. (2006). Epigenetic dynamics of the Kcnq1
imprinted domain in the early embryo. Development 133, 4203-4210.
Mancini-DiNardo, D., Steele, S. J., Ingram, R. S. and Tilghman, S. M. (2003).
A differentially methylated region within the gene Kcnq1 functions as an
imprinted promoter and silencer. Hum. Mol. Genet. 12, 283-294.
Mancini-DiNardo, D., Steele, S. J., Levorse, J. M., Ingram, R. S. and
Tilghman, S. M. (2006). Elongation of the Kcnq1ot1 transcript is required for
genomic imprinting of neighboring genes. Genes Dev. 20, 1268-1282.
Mann, M. R., Chung, Y. G., Nolen, L. D., Verona, R. I., Latham, K. E. and
Bartolomei, M. S. (2003). Disruption of imprinted gene methylation and
expression in cloned preimplantation stage mouse embryos. Biol. Reprod. 69,
902-914.
Mann, M. R., Lee, S. S., Doherty, A. S., Verona, R. I., Nolen, L. D., Schultz, R.
M. and Bartolomei, M. S. (2004). Selective loss of imprinting in the placenta
following preimplantation development in culture. Development 131, 37273735.
Market-Velker, B. A., Zhang, L., Magri, L. S., Bonvissuto, A. C. and Mann, M.
R. W. (2010). Dual effects of superovulation: loss of maternal and paternal
imprinted methylation in a dose-dependent manner. Hum. Mol. Genet. 19, 3651.
Mitsuya, K., Meguro, M., Lee, M. P., Katoh, M., Schulz, T. C., Kugoh, H.,
Yoshida, M. A., Niikawa, N., Feinberg, A. P. and Oshimura, M. (1999). LIT1,
an imprinted antisense RNA in the human KvLQT1 locus identified by screening
for differentially expressed transcripts using monochromosomal hybrids. Hum.
Mol. Genet. 8, 1209-1217.
Miyamoto, T., Hasuike, S., Jinno, Y., Soejima, H., Yun, K., Miura, K.,
Ishikawa, M. and Niikawa, N. (2002). The human ASCL2 gene escaping
genomic imprinting and its expression pattern. J. Assist. Reprod. Genet. 19, 240244.
Murakami, K., Oshimura, M. and Kugoh, H. (2007). Suggestive evidence for
chromosomal localization of non-coding RNA from imprinted LIT1. J. Hum.
Genet. 52, 926-933.
Nagano, T. and Fraser, P. (2009). Emerging similarities in epigenetic gene
silencing by long noncoding RNAs. Mamm. Genome 20, 557-562.
Onyango, P., Miller, W., Lehoczky, J., Leung, C. T., Birren, B., Wheelan, S.,
Dewar, K. and Feinberg, A. P. (2000). Sequence and comparative analysis of
the mouse 1-megabase region orthologous to the human 11p15 imprinted
domain. Genome Res. 10, 1697-1710.
Pandey, R. R., Mondal, T., Mohammad, F., Enroth, S., Redrup, L.,
Komorowski, J., Nagano, T., Mancini-DiNardo, D. and Kanduri, C. (2008).
Kcnq1ot1 antisense noncoding RNA mediates lineage-specific transcriptional
silencing through chromatin-level regulation. Mol. Cell 32, 232-246.
Development 138 (17)
Panning, B. and Jaenisch, R. (1996). DNA hypomethylation can activate Xist
expression and silence X-linked genes. Genes Dev. 10, 1991-2002.
Pauler, F. M., Koerner, M. V. and Barlow, D. P. (2007). Silencing by imprinted
noncoding RNAs: is transcription the answer? Trends Genet. 23, 284-292.
Paulsen, M., Davies, K. R., Bowden, L. M., Villar, A. J., Franck, O., Dean, W.
L., Moore, T. F., Rodrigues, N., Davies, K. E., Hu, R.-J. et al. (1998). Syntenic
organization of the mouse distal chromosome 7 imprinting cluster and the
Beckwith-Wiedemann syndrome region in chromosome 11p15.5. Hum. Mol.
Genet. 7, 1149-1159.
Paulsen, M., El-Maarri, O., Engemann, S., Strodicke, M., Franck, O., Davies,
K., Reinhardt, R., Reik, W. and Walter, J. (2000). Sequence conservation and
variability of imprinting in the Beckwith-Wiedemann syndrome gene cluster in
human and mouse. Hum. Mol. Genet. 9, 1829-1841.
Purbowasito, W., Suda, C., Yokomine, T., Zubair, M., Sado, T., Tsutsui, K. and
Sasaki, H. (2004). Large-scale identification and mapping of nuclear matrixattachment regions in the distal imprinted domain of mouse chromosome 7.
DNA Res. 11, 391-407.
Redrup, L., Branco, M. R., Perdeaux, E. R., Krueger, C., Lewis, A., Santos, F.,
Nagano, T., Cobb, B. S., Fraser, P. and Reik, W. (2009). The long noncoding
RNA Kcnq1ot1 organises a lineage-specific nuclear domain for epigenetic gene
silencing. Development 136, 525-530.
Rivera, R. M., Stein, P., Weaver, J. R., Mager, J., Schultz, R. M. and
Bartolomei, M. S. (2008). Manipulations of mouse embryos prior to
implantation result in aberrant expression of imprinted genes on day 9.5 of
development. Hum. Mol. Genet. 17, 1-14.
Robb, G. B., Brown, K. M., Khurana, J. and Rana, T. M. (2005). Specific and
potent RNAi in the nucleus of human cells. Nat. Struct. Mol. Biol. 12, 133-137.
Schulz, R., Menheniott, T. R., Woodfine, K., Wood, A. J., Choi, J. D. and
Oakey, R. J. (2006). Chromosome-wide identification of novel imprinted genes
using microarrays and uniparental disomies. Nucleic Acids Res. 34, e88.
Shin, J. Y., Fitzpatrick, G. V. and Higgins, M. J. (2008). Two distinct mechanisms
of silencing by the KvDMR1 imprinting control region. EMBO J. 27, 168-178.
Shirohzu, H., Yokomine, T., Sato, C., Kato, R., Toyoda, A., Purbowasito, W.,
Suda, C., Mukai, T., Hattori, M., Okumura, K. et al. (2004). A 210-kb
segment of tandem repeats and retroelements located between imprinted
subdomains of mouse distal chromosome 7. DNA Res. 11, 325-334.
Smilinich, N. J., Day, C. D., Fitzpatrick, G. V., Caldwell, G. M., Lossie, A. C.,
Cooper, P. R., Smallwood, A. C., Joyce, J. A., Schofield, P. N., Reik, W. et al.
(1999). A maternally methylated CpG island in KvLQT1 is associated with an
antisense paternal transcript and loss of imprinting in Beckwith-Wiedemann
syndrome. Proc. Natl. Acad. Sci. USA 96, 8064-8069.
Terranova, R., Yokobayashi, S., Stadler, M. B., Otte, A. P., van Lohuizen, M.,
Orkin, S. H. and Peters, A. H. (2008). Polycomb group proteins Ezh2 and Rnf2
direct genomic contraction and imprinted repression in early mouse embryos.
Dev. Cell 15, 668-679.
Tsai, M. C., Manor, O., Wan, Y., Mosammaparast, N., Wang, J. K., Lan, F., Shi,
Y., Segal, E. and Chang, H. Y. (2010). Long noncoding RNA as modular
scaffold of histone modification complexes. Science 329, 689-693.
Umlauf, D., Goto, Y., Cao, R., Cerqueira, F., Wagschal, A., Zhang, Y. and Feil,
R. (2004). Imprinting along the Kcnq1 domain on mouse chromosome 7
involves repressive histone methylation and recruitment of Polycomb group
complexes. Nat. Genet. 36, 1296-1300.
Verona, R. I., Mann, M. R. W. and Bartolomei, M. S. (2003). Genomic
imprinting: intricacies of epigenetic regulation in clusters. Annu. Rev. Cell Dev.
Biol. 19, 237-259.
Weaver, J. R., Sarkisian, G., Krapp, C., Mager, J., Mann, M. R. and
Bartolomei, M. S. (2010). Domain-specific response of imprinted genes to
reduced DNMT1. Mol. Cell. Biol. 30, 3916-3928.
Willingham, A. T., Orth, A. P., Batalov, S., Peters, E. C., Wen, B. G., AzaBlanc, P., Hogenesch, J. B. and Schultz, P. G. (2005). A strategy for probing
the function of noncoding RNAs finds a repressor of NFAT. Science 309, 15701573.
Yatsuki, H., Watanabe, H., Hattori, M., Joh, K., Soejima, H., Komoda, H.,
Xin, Z., Zhu, X., Higashimoto, K., Nishimura, M. et al. (2000). Sequencebased structural features between Kvlqt1 and Tapa1 on mouse chromosome
7F4/F5 corresponding to the Beckwith-Wiedemann syndrome region on human
11p15.5: long-stretches of unusually well conserved intronic sequences of kvlqt1
between mouse and human. DNA Res. 7, 195-206.
Zhao, J., Sun, B. K., Erwin, J. A., Song, J. J. and Lee, J. T. (2008). Polycomb
proteins targeted by a short repeat RNA to the mouse X chromosome. Science
322, 750-756.
Zhao, J., Ohsumi, T. K., Kung, J. T., Ogawa, Y., Grau, D. J., Sarma, K., Song, J.
J., Kingston, R. E., Borowsky, M. and Lee, J. T. (2010). Genome-wide
identification of polycomb-associated RNAs by RIP-seq. Mol. Cell 40, 939-953.
Zhou, Q. Y., Quaife, C. J. and Palmiter, R. D. (1995). Targeted disruption of the
tyrosine hydroxylase gene reveals that catecholamines are required for mouse
fetal development. Nature 374, 640-643.
DEVELOPMENT
3678 RESEARCH ARTICLE