RESEARCH ARTICLE 1305
Development 137, 1305-1314 (2010) doi:10.1242/dev.044255
© 2010. Published by The Company of Biologists Ltd
Perinuclear P granules are the principal sites of mRNA export
in adult C. elegans germ cells
Ujwal Sheth1,2, Jason Pitt1,2, Shannon Dennis1,2,3 and James R. Priess1,2,3,*
SUMMARY
Germline-specific granules of unknown function are found in a wide variety of organisms, including C. elegans, where they are
called P granules. P granules are cytoplasmic bodies in oocytes and early embryos. Throughout most of the C. elegans life cycle,
however, P granules are associated with clusters of nuclear pore complexes (NPCs) on germ cell nuclei. We show that perinuclear P
granules differ from cytoplasmic P granules in many respects, including structure, stability and response to metabolic changes. Our
results suggest that nuclear-associated P granules provide a perinuclear compartment where newly exported mRNAs are collected
prior to their release to the general cytoplasm. First, we show that mRNA export factors are highly enriched at the NPCs associated
with P granules. Second, we discovered that the expression of high-copy transgenes could be induced in a subset of germ cells, and
used this system to demonstrate that nascent mRNA traffics directly to P granules. P granules appear to sequester large amounts of
mRNA in quiescent germ cells, presumably preventing translation of that mRNA. However, we did not find evidence that P granules
normally sequester aberrant mRNAs, or mRNAs targeted for destruction by the RNAi pathway.
INTRODUCTION
Germ cells or germ cell precursors in animals ranging from
nematodes to mammals have distinctive cytoplasm, called germ
plasm, with unique organelles called P granules in C. elegans
(reviewed by Seydoux and Braun, 2006). Genetic and
transplantation studies in Drosophila showed that germ plasm is
both necessary and sufficient for germline development (reviewed
by Extavour and Akam, 2003). Although similar transplantation
studies have not been possible in C. elegans, P granules contain
many proteins that are essential for germline development (reviewed
by Strome, 2005). Moreover, loss of P granules in mex-3;gld-1
mutants is associated with a germline teratoma phenotype, where
germ cells differentiate inappropriately as muscles and neurons
(Ciosk et al., 2006).
P granules are best known as cytoplasmic organelles in oocytes
and in early embryos, where they localize asymmetrically to germ
cell precursors (Strome, 2005). Once the germ lineage is established,
however, P granules associate with nuclei and remain perinuclear
throughout development (Strome, 2005). Cytoplasmic P granules
are highly dynamic, with rapid growth, fusion, and shrinkage
behaviors reminiscent of liquid droplets; the dynamics of
perinuclear P granules have not been determined (Brangwynne et
al., 2009). Diverse proteins have been shown to be enriched in
perinuclear and/or cytoplasmic P granules, such as components of
the RNAi pathway (DRH-3, EGO-1, CSR-1, PRG-1 and WAGO1); components of the spliceosome (Sm proteins); components of
processing bodies (P-bodies) and stress granules; PGL-1, a protein
that binds an isoform of the mRNA cap-binding protein eIF4E; the
poly(A) binding protein PAB-1; the DEAD box RNA helicase GLH1
Fred Hutchinson Cancer Research Center, Seattle, WA 98109, USA. 2Howard
Hughes Medical Institute, Seattle, WA 98109, USA. 3Molecular and Cellular Biology
Program, University of Washington, Seattle, WA 98195, USA.
*Author for correspondence ([email protected])
Accepted 9 February 2010
1; and PIE-1, a protein involved in transcriptional repression during
early embryogenesis (Amiri et al., 2001; reviewed by Anderson and
Kedersha, 2009; Mello et al., 1996; reviewed by Updike and Strome,
2009). The diversity of P granule components and the phenotypes
of mutants defective in individual components do not provide a
simple, single model for P granule function. Moreover, most P
granule components are localized to additional nuclear or
cytoplasmic compartments, and it is not known whether P granule
localization is crucial for the function of any component.
The finding that most P granule proteins have RNA binding
motifs suggests a role in RNA metabolism (Updike and Strome,
2009). Previous studies showed that perinuclear P granules in
quiescent, non-ovulating gonads contain high levels of mRNA,
although it is not known how this stored mRNA traffics to P granules
(Schisa et al., 2001). Yeast P-bodies can provide temporary storage
for non-translated mRNA, in addition to serving as sites for mRNA
degradation, and P granules contain the P-body-associated proteins
CGH-1 and DCAP-2 (reviewed by Rajyaguru and Parker, 2009).
However, P granules lack additional proteins that are found in Pbodies, and germ cells contain other granules that more closely
resemble conventional P-bodies (Anderson and Kedersha, 2009).
Although perinuclear P granules might store RNA in quiescent
gonads, their relationship to nascent mRNA in normal gonads is not
clear. Perinuclear P granules are localized at clusters of nuclear
pores, where they might interact with newly exported RNAs (Pitt et
al., 2000). However, normal gonads incubated with [3H]-uridine
show no enrichment of label in perinuclear P granules. Second,
specific mRNAs examined by in situ hybridization show little or no
enrichment in perinuclear P granules (Schisa et al., 2001). Thus,
nascent mRNA might either transit through perinuclear P granules
very rapidly upon export or be exported through nuclear pore
complexes (NPCs) that are not associated with perinuclear P
granules. The present study provides direct evidence that nascent
mRNAs are exported predominantly through the NPCs associated
with perinuclear P granules and that the nascent mRNA transits
through perinuclear P granules before entering the general
DEVELOPMENT
KEY WORDS: P granules, Export, mRNA, C. elegans
1306 RESEARCH ARTICLE
cytoplasm. Moreover, we show that perinuclear P granules, which
are normally found in actively transcribing adult germ cells, differ
in several respects from cytoplasmic P granules, which are found in
transcriptionally quiescent oocytes and early embryos.
MATERIALS AND METHODS
C. elegans strains
Nematodes were cultured and manipulated genetically as previously
described (Brenner, 1974). Unless otherwise indicated, experiments were
performed on the N2 strain (var. Bristol), maintained at 20°C and analyzed
as 1-day-old adults. The following strains and alleles were used: TJ375 [hsp16-2::GFP::unc-54 3⬘UTR]; BS3426 [rme-2(b1005) unc-24(e138)/unc5(e53) lin-45(dx19) (IV)]; JJ569 [mex-3(zu155)/hT1, him-5 (e1490)V];
RB912 [ddx-19(ok783)II]; CB3203 [ced-1(e1735)I]; MT5811 [ced1(e1735)I; ced-3(n717)IV]; JJ2101 [zuIs242(nmy-2::PGL-1::GFP); unc119]; and JJ2072 [zuIs237 (f58g11.2::F58G11.2::GFP); unc-119]. For
extrachromosomal transgenic strains, wild-type worms were injected with
either zuEx218 [pUS24 (hsp16.2::GFP::tbb-2 3⬘UTR)], zuEx215 [pUS22
(hsp16.2::GFP::pos-1 3⬘UTR)] or zuEx224 [pCL25 (hsp16.2::GFP::unc-54
3⬘UTR)] to obtain strains JJ1944, JJ1940 and JJ1959, respectively. For
extrachromosomal transgenic arrays, wild-type worms were injected with
plasmid plus a dominant rol-6 cotransformation marker (Mello and Fire,
1995). Strain JJ2072 with an integrated transgene zuIs237 was created by
microparticle bombardment of unc-119 worms (Praitis et al., 2001).
Development 137 (8)
otherwise indicated (Kamath et al., 2003). nxf-1: worms were soaked with
C15H11.3 dsRNA (Tan et al., 2000). ddx-19: strain RB912 (Arur et al.,
2009) was fed with T07D4.4 dsRNA for one generation at 25°C. npp-9:
worms were fed F59A2.1 dsRNA. glh-1: worms were fed T21G5.3 dsRNA
from the Vidal feeding library (Rual et al., 2004). smg-2: worms were fed
Y48G8AL.6 dsRNA from the Vidal feeding library (Rual et al., 2004). pos1 3⬘UTR: primers CAGAAGAGCTCTTTCTCTCGTCGAAATTTCTGA
and ATCGAACTAGTGAGCGCTTTAAATATTGGAAAC were used to
amplify the pos-1 3⬘UTR from genomic DNA. The PCR product was cloned
into feeding vector pPD129.36 (Timmons and Fire, 1998).
Heat shock, in situ hybridization and FISH
Worms were heat-shocked at 34°C for 30 minutes and processed for in situ
hybridization or FISH at various time points. The in situ procedure was
modified from the protocol of G. Broitman-Maduro and M. Maduro
(http://www.faculty.ucr.edu/~mmaduro/) as follows: 20-25 worms were cut
in culture media (Wolke et al., 2007) to extrude gonads. An equal volume
of 2⫻ Formaldehyde Fix was added for 1.5 minutes to make final
concentration to 1⫻, then removed and replaced with two washes of PBS
plus 0.025% triton, followed by three washes of PBS. The gonads were
affixed to a polylysine-glutaraldehyde slide prepared as follows: a small
drop of 5% glutaraldehyde in PBS was placed on a freshly coated polylysine
(Sigma) slide for 5 minutes and then removed. The gonads were immersed
in –20°C MeOH (5 minutes), briefly drained and the gonads fixed for an
additional 5 minutes in 2⫻ Formaldehyde Fix before rinsing in three
changes of PBS.
Confocal, live imaging was performed as previously described (Tenlen et
al., 2008; Wolke et al., 2007). The following settings were used for
acquisition: exposure, 400 milliseconds; laser intensity, 82%; gain, 1; step
size, 1 mm; acquisition interval, 15 seconds. Particles were tracked using
Imaris Image Analysis (5.5.3) software (Lammermann et al., 2008).
Photobleaching experiments were performed and analyzed as previously
described (Tenlen et al., 2008). Twenty images (0.5 second intervals) were
acquired before photobleaching; recovery was measured with 67 images (40
images at 0.5 second intervals, 20 images at 5 second intervals and 7 images
at 20 second intervals).
Immunocytochemistry and microscopy
The following peptides were used to generate antibodies as previously
described (Wayner and Carter, 1987): NPP-9 (YEPEVEFKPVIPLPDLVEVKT), NXF-1 (MERDGCFGNCWLRRWEKSD) and DDX-19
(QFVKPDSKYKFTKPATEE). P granules were immunostained as
previously described with aPGL-1 (Kawasaki et al., 1998), K76 (Strome
and Wood, 1983) or GLH-1 (Gruidl et al., 1996). The following antibodies
were used: for H14, RDI-RNAP2-H14 (Research Diagnostics Inc.); for
FISH, Fluorescent Antibody Enhancer Set for DIG Detection (Roche,
11768506910).
For immunostaining, adult hermaphrodites were dissected on microscope
slides in M9 buffer (Brenner, 1974), to which was added an equal volume of
2⫻ Formaldehyde Fix (6% paraformaldehyde in 40 mM NaCl, 5 mM KCl,
2 mM MgCl2 and 10 mM EGTA) to make a final concentration 1⫻ for 5
minutes. The slides were frozen on dry ice, the coverslips removed and the
slides immersed in –20°C MeOH (5 minutes) before rinsing in three changes
of PBS for 5 minutes each. Slides were incubated with antibody either at
37°C for 1 hour, or overnight at 4°C. Tissues prepared for aNXF-1 staining
were fixed with –20°C MeOH (5 minutes), then –20°C acetone (5 minutes),
briefly drained and the gonads fixed for 5 minutes in 2⫻ Formaldehyde Fix
(double strength). High magnification images were acquired with a
DeltaVision microscope and processed using deconvolution software
(Applied Precision). Electron microscopy was performed as previously
described (Pitt et al., 2000).
Inhibitor studies and RNA interference
a-amanitin (50 mg/ml in water; Sigma A2263) or cycloheximide (50 mg/ml
in water; Sigma C7698) were injected into worms that were allowed to
develop for the times indicated in the text before analysis. L4 worms were
used for RNAi experiments and analyzed as 1-day-old adults as follows; the
Ahringer library was used as source for dsRNA feeding strains unless
RESULTS
Perinuclear P granules are asymmetric structures
with dynamic components
Each of the two arms of the C. elegans hermaphrodite gonad is a
cylindrical array of germ cells progressing from mitosis through
meiosis (Fig. 1A). Each germ cell has an opening connecting it with
the shared, cytoplasmic core of the gonad; materials flow along the
core toward enlarging oocytes at the end of the gonad. P granules are
perinuclear in mitotic and meiotic germ cells until oogenesis, at
which time they detach and become cytoplasmic (Fig. 1A) (Strome,
2005). Cytoplasmic P granules in oocytes and early embryos appear
as homogenous, fibrillar granular bodies by electron microscopy,
whereas perinuclear P granules can contain a distinct electron-dense
base approximately 70-100 nm from the nuclear rim (Fig. 1E-G)
(Pitt et al., 2000; Wolf et al., 1983). We examined the ultrastructure
of perinuclear P granules in fourth larval stage (L4) germ cells and
in adult germ cells in mitosis and at all stages of meiosis. In addition
to the electron-dense base, we found that P granules have an
electron-dense ovoid structure that we term the crest at their
periphery (Fig. 1D-H; see also Fig. S1A in the supplementary
material). Germ nuclei in the mitotic zone often contain small P
granules with a crest but no obvious base; we presume that these are
newly formed P granules (Fig. 1C,D). The crest appears to decrease
in size and the base becomes less evident or disappears in late
diplotene and diakinetic oogonia when P granules detach from the
envelope (Fig. 1H,I).
We wanted to determine whether perinuclear P granules exhibited
the same dynamic behaviors of rapid growth, fusion and shrinkage
described for cytoplasmic P granules (Brangwynne et al., 2009).
Spinning disk confocal microscopy was used to generate movies of
live pachytene-stage germ cells expressing the P granule component
PGL-1 fused to Green Fluorescent Protein (GFP). Fifty perinuclear
P granules that were selected at random for analysis could be tracked
for 15-40 minutes before nuclear rotations or occasional body
movements of the anesthetized animals shifted the P granule out of
the visual field. During the period of observation, however, none of
the selected P granules appeared to fuse or show marked changes in
DEVELOPMENT
Time-lapse imaging and photobleaching experiment
P granules are sites of mRNA export
RESEARCH ARTICLE 1307
size (Fig. 2A,A⬘). We next asked whether PGL-1 itself was a stable
component of perinuclear P granules by FRAP (fluorescence
recovery after photobleaching) experiments. Individual
photobleached P granules showed very rapid recovery of PGL1::GFP fluorescence (t1/2 recovery=19±7 seconds, n=9; Fig. 2B2B⬙,C). Thus, perinuclear P granules are asymmetric, relatively
stable bodies that contain at least some highly dynamic components
such as PGL-1.
PGL-1 is present throughout the germ cell cytoplasm but is
enriched in P granules under normal growth conditions. However,
PGL-1 disappears from perinuclear P granules in late stages of
spermatogenesis and in pachytene germ cells of quiescent, nonovulating gonads (Amiri et al., 2001; Schisa et al., 2001). To ask
whether decreased transcriptional activity might trigger the loss
of PGL-1 from perinuclear P granules, we injected young adult
gonads with the transcriptional inhibitor a-amanitin. PGL-1::GFP
disappeared progressively from P granules in pachytene germ
cells beginning at 30 minutes (Fig. 2D,E; see also Fig. S2A in the
supplementary material; n=10 gonads). Similar to observations of
quiescent gonads, PGL-1::GFP persisted on P granules in
diplotene germ cells and oocytes for at least 5 hours post-injection
(see Fig. S2A in the supplementary material; data not shown). aamanitin injection caused a pachytene-specific loss of the P
granule component GLH-2 that was very similar to the loss of
PGL-1 (see Fig. S2A in the supplementary material). Importantly,
a-amanitin did not simply cause the loss of P granules;
perinuclear P granules remained visible in gonads prepared for
electron microscopy at 30 minutes and 3 hours after a-amanitin
injection (see Fig. S2B-G in the supplementary material). The loss
of perinuclear PGL-1 was not observed in (1) mock injected
animals (data not shown), (2) ama-1(m188) mutant animals with
a mutation in RNA polymerase II that confers resistance to aamanitin (Fig. 2F) (Sanford et al., 1983) or (3) wild-type animals
injected with a concentration of cycloheximide sufficient to block
or markedly reduce translation of mex-3 mRNA in the gonad (Fig.
2G; see also Fig. S2H-K in the supplementary material; n=5
gonads). Animals depleted in NXF-1, an essential mRNA export
factor in C. elegans (Tan et al., 2000), showed a similar,
pachytene-specific, loss of PGL-1 (Fig. 2H).
We found that the loss of perinuclear PGL-1 in spermatogonia
was associated with a marked decrease of immunostaining with
H14 (see Fig. S3A,B in the supplementary material), an antibody
that recognizes the phosphorylated carboxy-terminus of active
RNA polymerase (Seydoux and Dunn, 1997). Similarly, we found
that germ cells at early stages of apoptosis lost PGL-1 from
perinuclear P granules and that this loss was associated with
decreased staining with H14 (see Fig. S3C-F in the supplementary
material). Thus, although PGL-1 is a prominent component of
cytoplasmic P granules in oocytes and early embryos that are
transcriptionally quiescent, transcriptional activity is required for
PGL-1 to associate with perinuclear P granules in multiple
examples of germ cells.
DEVELOPMENT
Fig. 1. Perinuclear P granules are asymmetric. (A) One arm
of the adult hermaphrodite gonad showing nuclei (black) and
P granules (green). (B) A single P granule as described in the
text; compare with F. env, nuclear envelope; Pg-NPCs, P
granule-associated nuclear pore complexes. (C-E) Examples of
small, possibly newly formed, P granules in the mitotic zone
showing nuclear pores (small black arrows), presumptive crests
(white arrows) and the base (black arrowhead).
(F-H) Perinuclear P granules in the pachytene zone (F,G) and in
a late oogonium (H); note that NPCs are not clustered in late
oogonia and oocytes. (I) Detached, cytoplasmic P granule in a
young oocyte. Arrows and arrowheads are the same as in C-E.
Scale bars: 500 nm.
1308 RESEARCH ARTICLE
Development 137 (8)
mRNA export factors are concentrated at P
granule-associated NPCs
To examine the relationship between perinuclear P granules and
nascent mRNA, we wanted markers to visualize both the cytoplasmic
face of NPCs and the location of mRNA export factors. Previous
studies visualized presumptive NPCs with the antibody mAb414,
which recognizes several yeast and mammalian nucleoporins with
phenylalanine glycine (FG) repeats (Davis and Blobel, 1986; Radu et
al., 1995; Shah et al., 1998). However, mAb414 stains multiple
proteins of unknown identity in C. elegans immunoblots (Geles and
Adam, 2001), and some C. elegans proteins that are not nucleoporins
contain FG repeats, notably the P granule protein GLH-1 (see below).
Therefore, we generated monoclonal antibodies that recognize the C.
elegans nucleoporin NPP-9, a predicted export factor DDX-19 and a
known mRNA export factor NXF-1 (see Fig. S4A-G in the
supplementary material).
NPP-9 is an FG repeat-containing nucleoporin homologous to
vertebrate Nup358/RanBP2, a major component of the eight fibers
that extend from the cytoplasmic face of NPCs (Wu et al., 1995;
Yokoyama et al., 1995). aNPP-9 stained the rim of all somatic and
germ cell nuclei examined (Fig. 3A,B; see also Fig. S4A in the
supplementary material). As P granules detach from the nuclear
envelope during oogenesis, they appear to retain material stained by
aNPP-9 (Fig. 3C,D) (see also Pitt et al., 2000). Cytoplasmic foci of
PGL-1 were observed infrequently in the gonad core prior to P
granule detachment (box e in Fig. 3B); however, these foci were not
associated with NPP-9 (Fig. 3E). These foci might form de novo in
the core or result from P granule fragmentation during germ cell
apoptosis. NPP-9 was concentrated in large patches on germ nuclei
that we presume are clustered NPCs, and was present in much
smaller punctae that might be individual, or small groups of, NPCs
(Fig. 4A). Co-staining for PGL-1 showed that a P granule was
present on essentially all of the large patches of NPP-9: in a data set
of 100 large patches (NPP-9 surface area=1.5±0.7 mm2), 99% were
associated with a P granule. Small NPP-9 punctae (<0.8 mm2) were
not associated with typically sized P granules (Fig. 4B). We hereafter
refer to the large clusters of NPCs associated with P granules as PgNPCs (P granule-associated NPCs) to distinguish these from other
NPCs. Pg-NPCs appeared to be distributed randomly on the surface
of most germ nuclei. In L4 germ nuclei and in the zygotene/early
pachytene adult nuclei, however, only NPCs were present where a
prominent lobe from the nucleolus contacted the envelope (0/20 and
0/53 lobes were adjacent to Pg-NPCs in L4s and adults, respectively;
see Fig. S1, open arrows, in the supplementary material).
DDX-19 is a predicted DEAD-box helicase related to the mRNA
export factors DDX19 in mammals and Dbp5p in yeast (Arur et al.,
2009; Hodge et al., 1999; Schmitt et al., 1999; Tseng et al., 1998).
aDDX-19 showed low levels of staining at the nuclear rim and in
the cytoplasm of somatic cells but much stronger staining on germ
nuclei; staining diminished or disappeared on late oogonial nuclei
that cease transcription (Fig. 3A). At high magnification, DDX-19
appeared concentrated in patches on both adult and larval germ
nuclei (Fig. 3F; Fig. 4A). Co-staining with aNPP-9 and aPGL-1
showed that the vast majority of DDX-19 was localized at Pg-NPCs:
in the data set of 100 large patches of NPP-9 described above, 94%
of the P granule-positive patches colocalized with a patch of DDX19 (Fig. 3F; Fig. 4A,B). The profile of each DDX-19 patch typically
was smaller than the associated patch of NPP-9 but similar to that of
PGL-1 (Fig. 4A,B). In cross-sections of nuclei, DDX-19 appeared
concentrated between the zones of PGL-1 and NPP-9, forming a
tripartite sandwich (Fig. 3F); remarkably, P granules initially
maintained a similar, tripartite appearance after detaching from
oogonia nuclei (Fig. 3G and inset).
NXF-1 is the ortholog of the mRNA export factors NXF1/TAP in
humans and Mex67p in yeast, and depletion of NXF-1 causes
poly(A)-containing mRNA to be retained in C. elegans germ nuclei
(Tan et al., 2000). aNXF-1 showed strong staining at the nuclear rim
of somatic cells and germ cells (Fig. 5A). Co-staining experiments
with aPGL-1 and aNXF-1 showed that nearly all the NXF-1 at the
rim of germ nuclei is present at Pg-NPCs: surface views of nuclei
showed a P granule in close association with the prominent patches
of NXF-1 (Fig. 5B, arrow) and cross-sections showed that NXF-1
was concentrated at the bases of P granules (Fig. 5C, arrow). In
addition to staining at the nuclear rim, aNXF-1 stained foci at the
center of most germ nuclei, a region occupied by the nucleolus (Fig.
5C, arrowhead). NXF-1 localization at the nuclear rim was very
DEVELOPMENT
Fig. 2. Perinuclear P granules are persistent structures
with dynamic components. (A,A⬘) P granules
(numbered) on three pachytene germ nuclei filmed for 20
minutes. (B-B⬙) Photobleaching of a single perinuclear P
granule (arrow); the elapsed time shown is 79 seconds.
(C) Quantified fluorescence recovery curve for the P granule
photobleached in B (black diamonds) compared with a
single-exponential best-fit curve (white circles).
(D) Dissected, normal gonad showing PGL-1::GFP in P
granules and in the cytoplasm. (E) Gonad 5 hours after
injection with a-amanitin showing PGL-1::GFP; clumps of
PGL-1 persist in the distal mitotic germ cells but PGL-1 is
lost from pachytene P granules. (F) High magnification of
germ nuclei from the gonad in panel E; inset shows the
same magnification of pachytene germ nuclei in an aamanitin-injected ama-1(m188) control gonad.
(G) Pachytene nuclei 5 hours after injection of
cycloheximide. (H) The left panel shows pachytene-specific
loss of PGL-1::GFP in an nxf-1(RNAi) gonad; the right panel
shows the nuclear envelope staining (NPP-9) in the same
gonad. Asterisk indicates the distal tip of the gonad. Scale
bars: 2.5 mm in A,B; 25 mm in D,E,H; 5 mm in F,G.
P granules are sites of mRNA export
RESEARCH ARTICLE 1309
Fig. 3. DDX-19 is enriched at the base of P granules. (A) Gonad
and intestine co-stained for NPP-9 and DDX-19 as indicated. (B) Eightplane projection of gonad co-stained for NPP-9 and PGL-1 as indicated.
(C-E) Single-plane merged images of dashed boxes in c, d and e are
shown at high magnification in C (rotated), D and E, respectively.
(F) Germ nucleus from a fourth larval stage (L4) gonad co-stained for
DDX-19, PGL-1 and NPP-9 as indicated. (G) Adult oogonia showing
detached P granules (green), NPP-9 (blue) and DDX-19 (red); inset
shows a detached P granule at high magnification. Arrows indicate
examples of detached P granules. Scale bars: 25 mm in A,B; 5 mm in
C-E,G; 2.5 mm in F.
similar to NPP-9 localization (Fig. 5D). Indeed, the aNXF-1 and
aNPP-9 antibodies showed strong competition for staining on
formaldehyde-fixed nuclei, necessitating the use of a denaturing
fixative.
Nascent mRNA is exported primarily from Pg-NPCs
and enters P granules
The above results show that two factors associated with mRNA
export are localized predominantly at Pg-NPCs, strongly suggesting
that Pg-NPCs are the principal sites of mRNA export under normal
growth conditions. To examine nascent mRNA directly, we
developed a technique for inducing and visualizing transgene
expression in germ cells. Promoters for heat shock genes such as
hsp-16.2 are used to induce expression in somatic cells (Fire et al.,
1990), but endogenous hsp-16.2 is poorly expressed in germ cells
(our unpublished data). Although high-copy transgenic arrays can
greatly amplify somatic expression, such arrays are subject to
repeat-induced silencing in germ cells (Kelly et al., 1997).
Consistent with this view, we found that a high-copy transgene
containing the hsp-16.2 promoter, the coding region for GFP and an
unc-54 3⬘UTR [hsp-16.2::gfp::unc-54 (3⬘UTR)] (Link et al., 1999)
showed no detectable mRNA expression in most germ cells
following heat shock. Surprisingly, however, mRNA from this
transgene was expressed at very high levels in late
pachytene/diplotene germ cells; we refer to this region of the gonad
as the expression zone (Fig. 6A,C).
Several experiments were performed to characterize the induction
of transgene-derived mRNA in the expression zone; in brief, these
results suggest that the expression zone contains primarily sense,
full-length mRNA (see Fig. S5 in the supplementary material). To
examine nascent mRNA traffic, transgenic animals were heatshocked at 34°C for 30 minutes, allowed to recover for 0 to 60
minutes, then processed for FISH (fluorescence in situ
hybridization) and immunocytochemistry. Immediately following
heat shock (t=0 minutes), transgenic mRNA appeared at high levels
in two intranuclear foci that probably represent positions of the
integrated transgene on the paired chromosomes (see legend to Fig.
S5 in the supplementary material). Lower levels of mRNA were
present throughout the nucleoplasm but not detected in the
cytoplasm (Fig. 6B,C; see also summary in Table S1 in the
supplementary material). By 10-15 minutes, the nascent mRNA
showed additional localization to numerous perinuclear foci that colocalized with the P granule marker GLH-1 (Fig. 6E,F). Optical
cross-sections showed that the nascent mRNA extended throughout
P granules (Fig. 6G) and was largely outside the zone of NPP-9 (Fig.
7B). Between 15 and 30 minutes, the level of nascent mRNA
decreased in P granules and increased in the cytoplasm and gonad
core (Fig. 6D; data not shown). By 45 minutes, some mRNA
appeared in late oogonia and oocytes, presumably through
cytoplasmic flow (see below; data not shown). For comparison,
measured rates of cytoplasmic flow in the core (~7 mm/minute)
(Wolke et al., 2007) would be expected to transport materials the
DEVELOPMENT
Fig. 4. DDX-19 is concentrated at Pg-NPCs. (A) Surface view of germ
nuclei in a gonad stained for NPP-9, PGL-1 and DDX-19 as indicated.
(B) Merged images as indicated of a single germ nucleus (outlined) from
A, stained as indicated. In all panels, arrows indicate large patches of
NPP-9 associated with P granules (Pg-NPCs) and arrowheads indicate
small foci of NPP-9 (NPCs). Scale bars: 2.5 mm.
Fig. 5. NXF-1 is concentrated at Pg-NPCs. (A) Gonad and intestine
(inset) co-stained for NPP-9 and NXF-1 as indicated. (B) Surface view of
a single pachytene germ nucleus (outlined) stained for NXF-1 and PGL1 as indicated; note extensive association of the two proteins (arrow).
(C) Optical cross-section of a single pachytene nucleus stained for NXF1, PGL-1 and DNA as indicated. Note NXF-1 localization to the base of
P granules (arrow) and in the nucleolus (arrowhead). (D) Optical crosssection of a single pachytene nucleus stained for NXF-1, NPP-9 and
DNA as indicated. Scale bars: 25 mm in A; 2.5 mm in B-D.
distance from the expression zone to the oocytes in about 25-30
minutes. Finally, mRNA levels in all regions of the gonad
diminished markedly by 60-90 minutes (see Fig. S5 in the
supplementary material). We observed essentially identical temporal
and spatial patterns of mRNA localization for transgenes encoding
GFP with 3⬘UTRs from mRNAs that are either (1) transcribed and
translated in the gonad, (2) transcribed but not translated in the
gonad or (3) not normally expressed in the gonad (see Table S2 in
the supplementary material). Thus, nascent mRNAs in general
appear to localize transiently to P granules before dispersing in the
cytoplasm.
Perinuclear localization of nascent mRNA depends
on P granule proteins
Transient, perinuclear localization might result from specific
mechanisms moving newly exported mRNA into and through P
granules. Alternatively, localization might result simply from pulsed
mRNA moving through clustered NPCs; if so, cells lacking P granules
might show analogous localization. We examined the localization of
nascent mRNA in intestinal cells; these polyploid cells produce much
more transgene-derived mRNA than germ cells and have a high
density of NPCs comparable to NPC clusters on germ nuclei (Fig. 6A;
data not shown) (see also Pitt et al., 2000). Nascent mRNA was
detected in the nucleoplasm and intestinal cytoplasm by 15 minutes
post-heat shock but showed no obvious enrichment near the zone of
NPP-9 (Fig. 7A). By contrast, germ cells in the same animals showed
mRNA concentrated near the NPP-9 zone, within P granules (Fig.
7B). We next examined mRNA localization in germ cells depleted of
Development 137 (8)
Fig. 6. Newly exported mRNA traffics through P granules.
(A-G) Panels show in situ hybridization detection with either alkaline
phosphatase (A) or fluorescence (all others) of tissues/nuclei after
recovery from heat shock for the times (t) indicated. Worms contained a
high-copy array of a hsp16.2::gfp::unc-54 3⬘UTR transgene; nascent
mRNA was visualized with an in situ probe against gfp mRNA. (A) Gonad
and intestine. The transgene is expressed in all intestinal nuclei, somatic
nuclei in the gonad (arrowhead) and germ nuclei within the expression
zone (bracket). (B) High magnification of a pachytene nucleus in the
expression zone showing P granules, mRNA and DNA as indicated; the
arrowhead indicates the presumptive site of transgene (TG) expression.
(C) Surface view of the gonad immediately after heat shock. (D) Optical
section through the gonad core 30 minutes after heat shock; transgenederived mRNA is abundant in the core underlying the expression zone.
(E) Germ nuclei 15 minutes after heat shock showing nascent mRNA and
the P granule marker GLH-1 as indicated. The arrow points to one
example of perinuclear foci of mRNA coinciding with P granules.
(F) High-magnification surface view of a single pachytene nucleus
stained for the induced mRNA and GLH-1 as indicated. Arrows indicate
the same as in E. (G) Optical cross-section through a pachytene nucleus
showing mRNA (green) in P granules (red). Merge is in yellow. Scale
bars: 25 mm in A,C,D; 2.5 mm in B,E-G.
GLH-1 by glh-1(RNAi); this treatment results in small, abnormal P
granules that lack multiple P granule components (Gruidl et al., 1996;
Kawasaki et al., 1998; Schisa et al., 2001). Similar to intestinal cells,
the glh-1(RNAi) germ cells showed little mRNA accumulation near
the zone of NPP-9, in contrast to mock-treated controls (Fig. 7C-D⬘;
see Table S1 in the supplementary material).
P granules do not sequester mRNAs that are targeted
for degradation by the RNAi or NMD pathways
Because the double-stranded RNA-specific endonuclease Dicer is a
component of nuclear-associated chromatoid bodies in mouse germ
cells (Kotaja et al., 2006), we wanted to determine if mRNA
DEVELOPMENT
1310 RESEARCH ARTICLE
P granules are sites of mRNA export
RESEARCH ARTICLE 1311
Fig. 7. Perinuclear mRNA localization requires P granules.
(A) Intestinal cell 15 minutes after heat shock, showing little or no mRNA
(green) adjacent to the NPP-9 zone (red). (B) Germ cell in the same
animals showing perinuclear foci of RNA (green, left panel) adjacent to
the NPP-9 zone (red) and coincident with P granules (green, right panel).
(C,C⬘) Single pachytene germ cell from a heat-shocked, glh-1(RNAi)
animal. Staining as indicated for transgenic mRNA, NPP-9 and DNA. Note
the very low level of perinuclear mRNA (arrow; shown at high
magnification in C⬘). (D,D⬘) Germ cell from mock-treated control animal
stained as indicated and showing a high level of perinuclear mRNA
(arrow; shown at high magnification in D⬘). Scale bars: 25 mm in A,C,D;
2.5 mm in B,E-G.
Multiple P granule proteins contain FG repeats
mRNA export through NPCs involves export factors such as NXF1
that bind clustered FG repeats on nucleoporins such as
Nup358/RanBP2 (reviewed in Tran and Wente, 2006), and we noted
Fig. 8. mRNAs targeted for degradation are not enriched in P
granules. (A,B) FISH analysis of hsp16.2::gfp::pos-1 3⬘UTR expression
on worms exposed to dsRNA for the pos-1 3⬘UTR. (A) Pachytene nuclei;
double-headed arrow indicates an example of colocalized nascent
mRNA (green) and P granules (red). (B) Low magnification view of the
same gonad in A, showing that the induced mRNA has entered the
gonad core and moved downstream to oogonia. (C-E) Panels show
wild-type (WT) or mutant mex-3 mRNA detected by in situ hybridization
in the strains indicated. mex-3(zu155) mRNA with a premature stop
codon is degraded in the most mature oocytes, where it normally is
translated (D, arrowhead), but persists when the NMD pathway is
inhibited [smg-2(RNAi)] (E). (F-I⬘) FISH of the indicated mRNA in WT or
mutant gonads (F-I); high magnification of the respective regions
indicated by arrowheads are shown in F⬘-I⬘. Adjacent mRNA (green)
and PGL-1 (red) signals are indicated in F⬘ for perinuclear P granules
(arrowhead) and cytoplasmic P granules (arrows). Scale bars: 2.5 mm in
A; 25 mm in B-I; 5 mm in F⬘-I⬘.
previously that the GLH family of P granule proteins also contain
clustered FG repeats (Fig. 9A) (Schisa et al., 2001). We noticed that
one of the four predicted isoforms of C. elegans DDX-19 has a
cluster of 20 FG-repeats, including 16 repeats of a GxFG motif
found in a subset of nucleoporins (Fig. 9A). By contrast, human
DDX19 has only a single FG sequence, and yeast Dbp5p has only
two, widely separated FG sequences (GenBank accession numbers
BC003626 and U28135). Nearly all of the FG repeats in the C.
elegans DDX-19 isoform are encoded by a single, alternatively
spliced fourth exon (Fig. 9A). We found that ddx-19 mRNA
containing the fourth exon is abundant in germ cells but not detected
above background in somatic cells (Fig. 9B,C).
Proteomic analyses in yeast and mammals have provided lists of
all putative nucleoporins and major NPC-associated proteins
(Cronshaw et al., 2002; Rout et al., 2000). We searched the C.
elegans proteome for examples of predicted proteins with clustered
GxFG repeats that are not known nucleoporins. In addition to the
DEVELOPMENT
destined for degradation by the RNAi pathway is sequestered or
degraded in P granules. We used the pos-1 gene to analyze the RNAi
pathway, as pos-1 is abundant in germ cells and highly sensitive to
RNAi (Tabara et al., 1998). We first established that dsRNA
targeting the pos-1 3⬘UTR was effective in depleting endogenous
pos-1 mRNA within 24 hours (data not shown). Next, worms
expressing a hsp-16.2::GFP transgene with the pos-1 3⬘UTR were
treated with the same dsRNA for 24 hours, then heat shocked to
induce mRNA expression. As observed under non-RNAi conditions,
the mRNA passed through P granules into the cytoplasm by 30
minutes (Fig. 8A,B; see Table S1 in the supplementary material).
P granules contain some proteins found in P-bodies (see
Introduction), and yeast mRNAs with premature stop codons
accumulate in P-bodies (Sheth and Parker, 2006). To determine
whether nonsense-containing mRNAs accumulate in P granules, we
analyzed mex-3 and rme-2 mRNAs that are normally translated in
oocytes (with cytoplasmic P granules) and late pachytene germ
cells (perinuclear P granules), respectively. mex-3(zu155) and rme2(b1005) mutants have mRNAs with premature stop codons and
can be suppressed by inhibiting the NMD (nonsense-mediated
decay) pathway (Fig. 8C-E) (Lee and Schedl, 2004). As expected
for NMD, the mex-3 and rme-2 mutant mRNAs were present
initially at wild-type levels but disappeared from oocytes and the
pachytene zone, respectively, where translation normally ensues
(compare Fig. 8F with 8G and Fig. 8H with 8I). We found that the
mutant mRNAs showed no obvious enrichment in perinuclear or
cytoplasmic P granules either before, or within, the degradation
zones (Fig. 8F⬘-I⬘). Indeed, overlapping or adjacent foci of mRNA
and PGL-1 staining were observed much more frequently for the
abundant wild-type mRNAs than for the mutant mRNAs,
presumably reflecting their relative abundance (compare Fig. 8F⬘
with 8G⬘).
1312 RESEARCH ARTICLE
Development 137 (8)
Fig. 9. FG-repeat proteins in P granules. (A) Diagram showing FG
repeats (vertical bars) in the nucleoporin NPP-9 and in four additional C.
elegans proteins encoded by gonad-enriched mRNAs. (B,C) In situ
hybridization for sense (B) and antisense (C) ddx-19(exon4) mRNA. (D,E) In
situ hybridization for sense (D) and antisense (E) f58g11.2 mRNA. (F) Twocell embryo showing colocalization of F58G11.2::GFP with cytoplasmic P
granules (arrow). (G) Fifty-cell embryo showing colocalization of
F58G11.2::GFP with P granules (arrow). Scale bars: 25 mm.
GLH proteins and the DDX-19 isoform, a cluster of GxFG repeats
were present in PQN-75, a novel protein, and in F58G11.2, a
predicted RNA helicase with no clear mammalian ortholog (Fig.
9A). A genomic in situ hybridization database indicated that both of
the latter genes are highly enriched in gonads (NEXTDB Ver.4.0 at
http://nematode.lab.nig.ac.jp/db2), and we confirmed this result for
F58G11.2 (Fig. 9D,E). Despite several attempts, we failed to recover
viable strains expressing GFP fused to PQN-75. However, worms
expressing GFP fused to F58G11.2 showed variable localization to
P granules in adult gonads and consistent localization to cytoplasmic
P granules in early embryos (Fig. 9F) and to the nuclear-associated
P granules in later embryos (Fig. 9G). We conclude that P granules
contain at least three components with clustered GxFG repeats – the
GLH family, DDX-19 and F58G11.2.
Newly exported mRNA traffics through P granules
As viewed by electron microscopy, the cytoplasmic fibrils of NPCs
are approximately 50 nm in length (Stoffler et al., 1999), whereas
the electron-dense base of the P granule begins approximately 70 nm
from the nuclear rim. As observed by immunocytochemistry, the
mRNA export factor NXF-1 is concentrated below the P granules
and is essentially coincident with NPP-9, a presumptive component
of the NPC fibrils. Thus, mRNA released from an NPC should be at
or near the electron-dense base of a P granule. P granules extend
300-400 nm from the nuclear rim into the cytoplasm, well beyond
the predicted terminus of NPC fibrils, and our immunostaining
experiments show that the P granule proteins GLH-1 and PGL-1
localize predominantly outside the zone of NPP-9 (Figs 6, 7). Thus,
our FISH analysis allows us to conclude that (1) the perinuclear foci
of newly exported RNA are clearly outside of NPCs (Fig. 7) and (2)
that these foci overlap extensively with P granules (Fig. 6). Thus,
most mRNAs enter a distinct compartment, the P granule, after their
export from germ nuclei. We argue that perinuclear localization does
not result simply from the pulsed generation of heat-shock-induced
mRNA because this localization does not occur in intestinal cells
lacking P granules or in germ cells lacking a subset of P granule
proteins (Fig. 7). Instead, we propose that perinuclear localization
results because nascent mRNAs move through P granules, and that
this movement is significantly slower than diffusion in the
surrounding cytoplasm.
DEVELOPMENT
DISCUSSION
Pg-NPCs are principal sites of mRNA export in
germ cells
We have shown that perinuclear P granules and cytoplasmic P
granules differ in both morphology and dynamics. Although
cytoplasmic P granules exist in transcriptionally quiescent oocytes,
our study demonstrates that perinuclear P granules and their
associated NPCs (Pg-NPCs) are the major sites of mRNA export in
germ cells. We showed here that known and predicted mRNA export
factors are localized at Pg-NPCs in both larval and adult germ cells
under normal growth conditions (Figs 3, 5). Further, we showed that
heat shock can induce expression of high-copy, transgenic arrays in
a subset of germ cells, and that most of this nascent mRNA appears
to be exported through Pg-NPCs (Fig. 6). We do not yet know why
the transgenes are expressed only in these germ cells. However, the
spatial, temporal, and genetic parameters of expression parallel the
normal pattern of X chromosome-specific expression, suggesting a
shared mechanism of activation or derepression (Kelly et al., 2002).
If most nascent mRNA is exported through Pg-NPCs, other NPCs
might have distinct functions. For example, NPCs that are adjacent
to the asymmetrically positioned nucleolus in yeast nuclei lack
proteins such as Mlp1p and Mlp2p that prevent the export of nonspliced mRNAs (Galy et al., 2004; Strambio-de-Castillia et al.,
1999); this functional asymmetry suggests that the nucleolarassociated NPCs might be specialized for transport in ribosome
biogenesis (Tran and Wente, 2006). Interestingly, we found that
NPCs, but not Pg-NPCs, were present where a lobe of the nucleolus
contacts the nuclear envelope in some germ cells (see Fig. S1 in the
supplementary material). Moreover, [3H]-uridine-labeled C. elegans
gonads do not show an enrichment of label on perinuclear P granules
(Schisa et al., 2001), and analogous labeling studies on C. bergerac
gonads showed that most of this label is incorporated in rRNA rather
than mRNA (Starck and Brun, 1977; Starck et al., 1983). If rRNA is
not exported through Pg-NPCs, this might explain why perinuclear
P granules in old, quiescent gonads accumulate large quantities of
mRNA but lack detectable rRNA (Schisa et al., 2001).
Movement of mRNA through P granules might be similar to
transport through the NPC. Free diffusion through the NPC is
restricted because FG repeat nucleoporins form a hydrophobic
meshwork in the central channel (reviewed by D’Angelo and Hetzer,
2008). The P granule protein GLH-1 contains a cluster of FG
repeats, and we showed here that two additional P granule-enriched
proteins (F58G11.2 and a germline-specific isoform of DDX-19)
contain similar repeats. The presence of multiple FG repeat proteins
in P granules raises the possibility that P granules confront newly
exported mRNA with a second hydrophobic barrier to free diffusion.
Indeed, we speculate that exposed hydrophobic domains of P
granule proteins might underlie the unusual fusion behaviors of
cytoplasmic P granules after detachment from the nuclear envelope
(Brangwynne et al., 2009).
Transport through the NPC involves factors such as NXF1 that
bind specifically to FG repeats, possibly dissolving the local
hydrophobic meshwork (Ribbeck and Gorlich, 2001; Rout et al.,
2000). In future studies, it will be interesting to determine whether
mRNA movement through P granules involves analogous, dedicated
transport factors or a sequence of random bind-and-release
interactions with RNA-binding components of P granules. The
finding that P granules have asymmetric morphology raises the
possibility some of these components have ordered positions that
contribute to mRNA movement or release.
P granules: assembly sites versus disposal centers
Materials diffusing randomly in germ cell cytoplasm would quickly
exit into the gonad core, where they would be swept away toward
distant oogonia (Wolke et al., 2007). Thus, perinuclear P granules
might provide a crucial compartment to assemble complexes
between nascent mRNA and regulatory small RNAs or proteins
before the mRNA is diluted in the core cytoplasm. The germline
teratoma phenotype of mex-3; gld-1 double mutants that lose P
granules appears to result in part from the premature expression of
somatic-specific transcription factors that normally function in early
embryogenesis (see Introduction; Ciosk et al., 2006). Thus, the
mutant germ cells might express the appropriate regulatory
molecules but be inefficient in assembling complexes with target
mRNAs in the absence of P granules. Totipotent germ cells could be
particularly sensitive to the inappropriate expression of these
transcription factors, as the misexpression of such factors can readily
respecify the fates of multipotent early embryonic cells (Zhu et al.,
1998).
We did not find evidence that P granules sequester or degrade
mRNAs targeted by the RNAi pathway. Instead, the targeted mRNA
moved through P granules into the general cytoplasm, similar to all
other transgenic mRNAs examined in our study (Fig. 6).
Conversely, nonsense-containing mutant mRNAs did not appear to
relocate from the cytoplasm into P granules prior to or during
degradation. However, we cannot exclude the possibility that
degradation occurs so rapidly in P granules that relocation could not
be detected. For example, although some yeast mRNAs targeted for
NMD become visibly enriched in P-bodies, others do not (Sheth and
Parker, 2006).
Although P granules do not appear to sequester mRNAs targeted
for degradation, they store large amounts of mRNA in gonads that
are not ovulating and can release this mRNA if ovulation resumes
(Schisa et al., 2001). We favor the hypothesis that P granules are
sequestering nascent mRNA in the quiescent gonads but could not
test this directly with our heat shock system as these conditions
prevented transgene expression (our unpublished observations).
However, we showed that the localization of at least two P granule
RESEARCH ARTICLE 1313
components, PGL-1 and GLH-2, is dependent on active
transcription in pachytene germ cells, indicating that the
composition, and possibly function(s), of P granules can be
regulated by physiological state.
In conclusion, our results draw several basic distinctions between
perinuclear P granules and cytoplasmic P granules. We suggest that
perinuclear P granules are compartments where newly exported
mRNAs find appropriate regulatory molecules before being released
to the general cytoplasm. In this view, P granules might not have a
unitary function in mRNA metabolism, but rather contribute to
multiple facets of mRNA regulation. Clearly, much remains to be
learned in future studies about the structure, composition and
physiology of these interesting organelles.
Acknowledgements
We thank Elizabeth Wayner, Karen Bennett, Susan Strome, Christopher Link
and Barbara Felder for reagents, Elizabeth Wayner, Kathryn English and
Jacqualyn Burnson for technical assistance and Jessica Feldman and members
of the Priess laboratory for critical reading of the manuscript. We thank Jeff
Molk, Julio Vazquez and Dave McDonald for advice on imaging and analysis.
Some of the nematode strains used in this work were provided by the
Caenorhabditis Genetic Center, which is funded by the NIH National Center
for Research Resources (NCRR). U.S. was supported by a fellowship from the
Helen Hay Whitney Foundation and Howard Hughes Medical Institute (HHMI).
S.D. was supported by a Developmental Biology Predoctoral Training Grant
(T32HD007183) from the National Institute of Child Health and Human
Development and HHMI. J.R.P. and J.P. were supported by the HHMI.
Deposited in PMC for release after 6 months.
Competing interests statement
The authors declare no competing financial interests.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/lookup/suppl/doi:10.1242/dev.044255/-/DC1
References
Amiri, A., Keiper, B. D., Kawasaki, I., Fan, Y., Kohara, Y., Rhoads, R. E. and
Strome, S. (2001). An isoform of eIF4E is a component of germ granules and is
required for spermatogenesis in C. elegans. Development 128, 3899-3912.
Anderson, P. and Kedersha, N. (2009). RNA granules: post-transcriptional and
epigenetic modulators of gene expression. Nat. Rev. Mol. Cell Biol. 10, 430436.
Arur, S., Ohmachi, M., Nayak, S., Hayes, M., Miranda, A., Hay, A., Golden, A.
and Schedl, T. (2009). Multiple ERK substrates execute single biological
processes in Caenorhabditis elegans germ-line development. Proc. Natl. Acad.
Sci. USA 106, 4776-4781.
Brangwynne, C. P., Eckmann, C. R., Courson, D. S., Rybarska, A., Hoege, C.,
Gharakhani, J., Julicher, F. and Hyman, A. A. (2009). Germline P granules are
liquid droplets that localize by controlled dissolution/condensation. Science 324,
1729-1732.
Brenner, S. (1974). The Genetics of Caenorhabditis elegans. Genetics 77, 71-94.
Ciosk, R., DePalma, M. and Priess, J. R. (2006). Translational regulators maintain
totipotency in the Caenorhabditis elegans germline. Science 311, 851-853.
Cronshaw, J. M., Krutchinsky, A. N., Zhang, W., Chait, B. T. and Matunis, M.
J. (2002). Proteomic analysis of the mammalian nuclear pore complex. J. Cell
Biol. 158, 915-927.
D’Angelo, M. A. and Hetzer, M. W. (2008). Structure, dynamics and function of
nuclear pore complexes. Trends Cell Biol. 18, 456-466.
Davis, L. I. and Blobel, G. (1986). Identification and characterization of a nuclear
pore complex protein. Cell 45, 699-709.
Extavour, C. G. and Akam, M. (2003). Mechanisms of germ cell specification
across the metazoans: epigenesis and preformation. Development 130, 58695884.
Fire, A., Harrison, S. W. and Dixon, D. (1990). A modular set of lacZ fusion
vectors for studying gene expression in Caenorhabditis elegans. Gene 93, 189190.
Galy, V., Gadal, O., Fromont-Racine, M., Romano, A., Jacquier, A. and
Nehrbass, U. (2004). Nuclear retention of unspliced mRNAs in yeast is mediated
by perinuclear Mlp1. Cell 116, 63-73.
Geles, K. G. and Adam, S. A. (2001). Germline and developmental roles of the
nuclear transport factor importin alpha3 in C. elegans. Development 128, 18171830.
Gruidl, M. E., Smith, P. A., Kuznicki, K. A., McCrone, J. S., Kirchner, J.,
Roussell, D. L., Strome, S. and Bennett, K. L. (1996). Multiple potential germ-
DEVELOPMENT
P granules are sites of mRNA export
line helicases are components of the germ-line-specific P granules of
Caenorhabditis elegans. Proc. Natl. Acad. Sci. USA 93, 13837-13842.
Hodge, C. A., Colot, H. V., Stafford, P. and Cole, C. N. (1999). Rat8p/Dbp5p is a
shuttling transport factor that interacts with Rat7p/Nup159p and Gle1p and
suppresses the mRNA export defect of xpo1-1 cells. EMBO J. 18, 5778-5788.
Kamath, R. S., Fraser, A. G., Dong, Y., Poulin, G., Durbin, R., Gotta, M.,
Kanapin, A., Le Bot, N., Moreno, S., Sohrmann, M. et al. (2003). Systematic
functional analysis of the Caenorhabditis elegans genome using RNAi. Nature
421, 231-237.
Kawasaki, I., Shim, Y. H., Kirchner, J., Kaminker, J., Wood, W. B. and Strome,
S. (1998). PGL-1, a predicted RNA-binding component of germ granules, is
essential for fertility in C. elegans. Cell 94, 635-645.
Kelly, W. G., Xu, S., Montgomery, M. K. and Fire, A. (1997). Distinct
requirements for somatic and germline expression of a generally expressed
Caernorhabditis elegans gene. Genetics 146, 227-238.
Kelly, W. G., Schaner, C. E., Dernburg, A. F., Lee, M.-H., Kim, S. K.,
Villeneuve, A. M. and Reinke, V. (2002). X-chromosome silencing in the
germline of C. elegans. Development 129, 479-492.
Kotaja, N., Bhattacharyya, S. N., Jaskiewicz, L., Kimmins, S., Parvinen, M.,
Filipowicz, W. and Sassone-Corsi, P. (2006). The chromatoid body of male
germ cells: Similarity with processing bodies and presence of Dicer and
microRNA pathway components. Proc. Natl. Acad. Sci. USA 103, 2647-2652.
Lammermann, T., Bader, B. L., Monkley, S. J., Worbs, T., Wedlich-Soldner, R.,
Hirsch, K., Keller, M., Forster, R., Critchley, D. R., Fassler, R. et al. (2008).
Rapid leukocyte migration by integrin-independent flowing and squeezing.
Nature 453, 51-55.
Lee, M. H. and Schedl, T. (2004). Translation repression by GLD-1 protects its
mRNA targets from nonsense-mediated mRNA decay in C. elegans. Genes Dev.
18, 1047-1059.
Link, C. D., Cypser, J. R., Johnson, C. J. and Johnson, T. E. (1999). Direct
observation of stress response in Caenorhabditis elegans using a reporter
transgene. Cell Stress Chaperones 4, 235-242.
Mello, C. and Fire, A. (1995). DNA transformation. Methods Cell Biol. 48, 45182.
Mello, C. C., Schubert, C., Draper, B., Zhang, W., Lobel, R. and Priess, J. R.
(1996). The PIE-1 protein and germline specification in C. elegans embryos.
Nature 382, 710-712.
Pitt, J. N., Schisa, J. A. and Priess, J. R. (2000). P granules in the germ cells of
Caenorhabditis elegans adults are associated with clusters of nuclear pores and
contain RNA. Dev. Biol. 219, 315-333.
Praitis, V., Casey, E., Collar, D. and Austin, J. (2001). Creation of low-copy
integrated transgenic lines in Caenorhabditis elegans. Genetics 157, 1217-1226.
Radu, A., Moore, M. S. and Blobel, G. (1995). The peptide repeat domain of
nucleoporin Nup98 functions as a docking site in transport across the nuclear
pore complex. Cell 81, 215-222.
Rajyaguru, P. and Parker, R. (2009). CGH-1 and the control of maternal mRNAs.
Trends Cell Biol. 19, 24-28.
Ribbeck, K. and Gorlich, D. (2001). Kinetic analysis of translocation through
nuclear pore complexes. EMBO J. 20, 1320-1330.
Rout, M. P., Aitchison, J. D., Suprapto, A., Hjertaas, K., Zhao, Y. and Chait, B.
T. (2000). The yeast nuclear pore complex: composition, architecture, and
transport mechanism. J. Cell Biol. 148, 635-652.
Rual, J. F., Ceron, J., Koreth, J., Hao, T., Nicot, A. S., Hirozane-Kishikawa, T.,
Vandenhaute, J., Orkin, S. H., Hill, D. E., van den Heuvel, S. et al. (2004).
Toward improving Caenorhabditis elegans phenome mapping with an
ORFeome-based RNAi library. Genome Res. 14, 2162-2168.
Sanford, T., Golomb, M. and Riddle, D. L. (1983). RNA polymerase II from wild
type and alpha-amanitin-resistant strains of Caenorhabditis elegans. J. Biol.
Chem. 258, 12804-12809.
Schisa, J. A., Pitt, J. N. and Priess, J. R. (2001). Analysis of RNA associated with P
granules in germ cells of C. elegans adults. Development 128, 1287-1298.
Schmitt, C., von Kobbe, C., Bachi, A., Pante, N., Rodrigues, J. P., Boscheron,
C., Rigaut, G., Wilm, M., Seraphin, B., Carmo-Fonseca, M. et al. (1999).
Dbp5, a DEAD-box protein required for mRNA export, is recruited to the
Development 137 (8)
cytoplasmic fibrils of nuclear pore complex via a conserved interaction with
CAN/Nup159p. EMBO J. 18, 4332-4347.
Seydoux, G. and Dunn, M. A. (1997). Transcriptionally repressed germ cells lack
a subpopulation of phosphorylated RNA polymerase II in early embryos of
Caenorhabditis elegans and Drosophila melanogaster. Development 124, 21912201.
Seydoux, G. and Braun, R. E. (2006). Pathway to totipotency: lessons from germ
cells. Cell 127, 891-904.
Shah, S., Tugendreich, S. and Forbes, D. (1998). Major binding sites for the
nuclear import receptor are the internal nucleoporin Nup153 and the adjacent
nuclear filament protein Tpr. J. Cell Biol. 141, 31-49.
Sheth, U. and Parker, R. (2006). Targeting of aberrant mRNAs to cytoplasmic
processing bodies. Cell 125, 1095-1109.
Starck, J. and Brun, J. (1977). Autoradiographic localization of RNA synthesis in
vitro during oogenesis in Parascaris equorum. C. R. Acad. Sci. Hebd. Seances
Acad. Sci. D 284, 1341-1344.
Starck, J., Gibert, M.-A., Brun, J. and Bosch, C. (1983). Ribosomal RNA synthesis
and processing during oogenesis of the free living nematode Caenorhabditis
elegans. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 75, 575-580.
Stoffler, D., Goldie, K. N., Feja, B. and Aebi, U. (1999). Calcium-mediated
structural changes of native nuclear pore complexes monitored by time-lapse
atomic force microscopy. J. Mol. Biol. 287, 741-752.
Strambio-de-Castillia, C., Blobel, G. and Rout, M. P. (1999). Proteins connecting
the nuclear pore complex with the nuclear Interior. J. Cell Biol. 144, 839-855.
Strome, S. (2005). Specification of the germ line. WormBook, 1-10.
doi/10.1895/wormbook.1.9.1, http://www.wormbook.org
Strome, S. and Wood, W. B. (1983). Generation of asymmetry and segregation
of germ-line granules in early C. elegans embryos. Cell 35, 15-25.
Tabara, H., Grishok, A. and Mello, C. C. (1998). RNAi in C. elegans: soaking in
the genome sequence. Science 282, 430-431.
Tan, W., Zolotukhin, A. S., Bear, J., Patenaude, D. J. and Felber, B. K. (2000).
The mRNA export in Caenorhabditis elegans is mediated by Ce-NXF-1, an
ortholog of human TAP/NXF and Saccharomyces cerevisiae Mex67p. RNA 6,
1762-1772.
Tenlen, J. R., Molk, J. N., London, N., Page, B. D. and Priess, J. R. (2008). MEX5 asymmetry in one-cell C. elegans embryos requires PAR-4- and PAR-1dependent phosphorylation. Development 135, 3665-3675.
Timmons, L. and Fire, A. (1998). Specific interference by ingested dsRNA. Nature
395, 854.
Tran, E. J. and Wente, S. R. (2006). Dynamic nuclear pore complexes: life on the
edge. Cell 125, 1041-1053.
Tseng, S. S., Weaver, P. L., Liu, Y., Hitomi, M., Tartakoff, A. M. and Chang, T.H. (1998). Dbp5p, a cytosolic RNA helicase, is required for poly(A)+ RNA export.
EMBO J. 17, 2651-2662.
Updike, D. L. and Strome, S. (2009). P granule assembly and function in C.
elegans germ cells. J. Androl. (in press).
Wayner, E. A. and Carter, W. G. (1987). Identification of multiple cell adhesion
receptors for collagen and fibronectin in human fibrosarcoma cells possessing
unique alpha and common beta subunits. J. Cell Biol. 105, 1873-1884.
Wolf, N., Priess, J. and Hirsh, D. (1983). Segregation of germline granules in
early embryos of Caenorhabditis elegans: an electron microscopic analysis. J.
Embryol. Exp. Morphol. 73, 297-306.
Wolke, U., Jezuit, E. A. and Priess, J. R. (2007). Actin-dependent cytoplasmic
streaming in C. elegans oogenesis. Development 134, 2227-2236.
Wu, J., Matunis, M. J., Kraemer, D., Blobel, G. and Coutavas, E. (1995).
Nup358, a cytoplasmically exposed nucleoporin with peptide repeats, Ran-GTP
binding sites, zinc fingers, a cyclophilin, a homologous domain, and a leucinerich region. J. Biol. Chem. 270, 14209-14213.
Yokoyama, N., Hayashi, N., Seki, T., Pante, N., Ohba, T., Nishii, K., Kuma, K.,
Hayashida, T., Miyata, T., Aebi, U. et al. (1995). A giant nucleopore protein
that binds Ran/TC4. Nature 376, 184-188.
Zhu, J., Fukushige, T., McGhee, J. D. and Rothman, J. H. (1998).
Reprogramming of early embryonic blastomeres into endodermal progenitors by
a Caenorhabditis elegans GATA factor. Genes Dev. 12, 3809-3814.
DEVELOPMENT
1314 RESEARCH ARTICLE