RESEARCH ARTICLE 1127
Development 137, 1127-1135 (2010) doi:10.1242/dev.046318
© 2010. Published by The Company of Biologists Ltd
no tail integrates two modes of mesoderm induction
Steven A. Harvey1,2,*, Stefan Tümpel1, Julien Dubrulle3, Alexander F. Schier3 and James C. Smith1,4,*
SUMMARY
During early zebrafish development the nodal signalling pathway patterns the embryo into three germ layers, in part by
inducing the expression of no tail (ntl), which is essential for correct mesoderm formation. When nodal signalling is inhibited ntl
fails to be expressed in the dorsal margin, but ventral ntl expression is unaffected. These observations indicate that ntl
transcription is under both nodal-dependent and nodal-independent regulation. Consistent with these observations and with a
role for ntl in mesoderm formation, some somites form within the tail region of embryos lacking nodal signalling. In an effort to
understand how ntl is regulated and thus how mesoderm forms, we have mapped the elements responsible for nodaldependent and nodal-independent expression of ntl in the margin of the embryo. Our work demonstrates that expression of ntl
in the margin is the consequence of two separate enhancers, which act to mediate different mechanisms of mesoderm
formation. One of these enhancers responds to nodal signalling, and the other to Wnt and BMP signalling. We demonstrate that
the nodal-independent regulation of ntl is essential for tail formation. Misexpression of Wnt and BMP ligands can induce the
formation of an ectopic tail, which contains somites, in embryos devoid of nodal signalling, and this tail formation is dependent
on ntl function. Similarly, nodal-independent tail somite formation requires ntl. At later stages in development ntl is required for
notochord formation, and our analysis has also led to the identification of the enhancer required for ntl expression in the
developing notochord.
INTRODUCTION
During early zebrafish development a nodal morphogen gradient
patterns the embryo into three germ layers by inducing the formation
of endoderm and mesoderm (Schier and Talbot, 2005). Cells
positioned at the margin of the developing embryo experience the
highest levels of nodal signalling and adopt mesodermal and
endodermal cell fates. Animal pole cells, which are positioned away
from the margin, experience the lowest levels of nodal signalling and
therefore become ectoderm. In the absence of nodal signalling all
endoderm and almost all mesoderm fails to form, with just a few
somites developing in the tail region (Feldman et al., 1998; Gritsman
et al., 1999).
A key event in the patterning of the early embryo is the induction
of goosecoid (gsc) at high levels of nodal signalling and the T-box
transcription factor no tail (ntl) at lower levels (Chen and Schier,
2001). The expression of ntl at these stages is a reliable indicator of
mesoderm formation, because the gene is expressed in mesodermal
progenitors throughout the margin of the early embryo. At later stages,
ntl expression is maintained in the tailbud and the developing
notochord. In the absence of ntl function, notochord and posterior
mesoderm fail to form, resulting in embryos without tails (Halpern et
al., 1993; Odenthal et al., 1996). Anterior mesoderm continues to form
1
Wellcome Trust and Cancer Research UK, Gurdon Institute and Department of
Zoology, University of Cambridge, Tennis Court Road, Cambridge CB2 1QN, UK.
The Wellcome Trust Sanger Institute, Hinxton, Cambridge CB10 1SA, UK.
3
Department of Molecular and Cellular Biology, Centre for Brain Science, Broad
Institute, Harvard Stem Cell Institute, Harvard University, Cambridge, MA 02138,
USA. 4MRC National Institute for Medical Research, The Ridgeway, Mill Hill,
London NW7 1AA.
2
*Authors for correspondence ([email protected]; [email protected])
Accepted 1 February 2010
in such embryos, owing to the presence of the ntl homologue, bra
(Martin and Kimelman, 2008). However, loss of both bra and ntl leads
to a loss of almost all mesoderm (Martin and Kimelman, 2008).
Although graded nodal signalling is key to patterning the early
embryo, an important observation suggests that mesoderm
formation is not under the sole control of nodal ligands. In embryos
in which nodal signalling has been completely inhibited, ntl
expression is absent in the dorsal margin of the embryo, but persists
ventrally and laterally (Feldman et al., 1998; Gritsman et al., 1999).
This demonstrates that ntl, a key regulator of mesoderm formation,
is under both nodal-dependent and nodal-independent regulation.
Consistent with this observation, some somites form in the tail
region of embryos lacking nodal signalling (Feldman et al., 1998;
Gritsman et al., 1999). Further evidence pointing to the complexity
of ntl transcriptional regulation comes from the observation that
nodal signalling is higher, and extends further towards the animal
pole, in the dorsal region of the embryo compared with lateral and
ventral positions (Harvey and Smith, 2009). This would predict that
ntl should be expressed in more cell tiers on the dorsal side of the
embryo than elsewhere, but in fact, the gene is expressed in
approximately the same number of tiers throughout the margin.
In an effort to understand the regulation of ntl, and thereby
mesoderm induction, we have mapped the regulatory elements
required for ntl expression in the developing embryo. As well as
mapping the elements responsible for ntl expression in the margin,
we have also identified an ntl notochord enhancer, the first such
enhancer isolated for any ntl orthologue in any vertebrate (Lerchner
et al., 2000; Yamaguchi et al., 1999). Our work shows that
expression of ntl in the margin of the zebrafish embryo represents
the effects of two independent enhancers – one that is responsive to
nodal signalling and another that is regulated in a nodal-independent
manner. We demonstrate that BMP and Wnt signals are responsible
for nodal-independent regulation of ntl, and we have highlighted
how this regulation is essential for tail formation.
DEVELOPMENT
KEY WORDS: Zebrafish, no tail, Mesoderm induction, Nodal signalling, Transcriptional regulation, Notochord
1128 RESEARCH ARTICLE
Luciferase assays
The –2.1 kb ntl promoter fragment was cloned by PCR using the primers 5⬘TAACGCGTATACAATTCCTTTGTGCTGTTGCAACAC-3⬘ and 5⬘ATCTCGAGATTTCCGATCAAATAAAGCTTGAGAT-3⬘ into the pGL3promoter luciferase plasmid (Promega). MluI and XhoI restriction enzyme
sites (underlined) were incorporated into the primers to allow cloning.
Embryos were injected at the 1-cell stage with 20 pg of the ntl
promoter:luciferase plasmid and 1 pg of Renilla plasmid (pRL-TK,
Promega). Assays were performed using the Dual-Luciferase reporter assay
(Promega) according to the manufacturer’s instructions. All luciferase
assays represent three different experiments each measured from 50
embryos at 6 hours postfertilisation (hpf). Data within each experiment were
normalised using Renilla levels and data sets were normalised by assuming
that luciferase levels in wild-type embryos injected with the –2.1 kb ntl
promoter:luciferase plasmid were 100%. Error bars represent one standard
deviation of the data set.
Constructs
PCR mutagenesis was performed using template plasmid DNA grown in
TOP10 cells (dam+, Invitrogen). PCR products were treated with DpnI to
digest dam+ template plasmid. Positive colonies were sequence verified.
Primers used for deletion of E1 were 5⬘-GCTTAAAAAATTGAATGCAACCAGAGAAATGAAATCGAACATTTTAATTG-3⬘ and
5⬘-CAATTAAAATGTTCGATTTCATTTCTCTGGTTGCATTCAATTTTTTAAGC-3⬘; those for deletion of E2 were 5⬘-GCTTAAAAAATTGAATGCAACCAGAGAAATGAAATCGAACATTTTAATTG-3⬘
and 5⬘-AGACGGTGTCTGCTGCCTCGTCCCAGATACACATGTGAGA3⬘; and those for the removal of the Fast-1 binding site were 5⬘GGGACAACAAAAGATTAGCATTATTCGCACTGAGTTCAAAGGCAACGAGG-3⬘ and 5⬘-CCTCGTTGCCTTTGAACTCAGTGCGAATAATGCTAATCTTTTGTTGTCCC-3⬘.
The Alk3* receptor (Piek et al., 1999) was subcloned into pCS2+. A
3⫻Flag-sequence was added to the 3⬘ end of ntl in a bacterial artificial
chromosome (BAC) (CHORI73_28E5, BACPAC Resources) via
homologous recombination. We used a targeting construct that contained a
kanamycin resistance gene cassette (Kan-r), flanked with FRT sites.
Sequence 50 bp upstream and downstream of the ntl stop codon was
amplified by PCR and used as homology arms (the sequence of the 5⬘ arm
is 5⬘-AGTTCGAGAGCTCCATCGCCCGGCTCACAGCATCATGGGCGCCTGTGGCT-3⬘, sequence of the 3⬘ arm is 5⬘-GATCGCTTCACATTTAAGGACTGATGCTGCAGTTATGGACTTGATCTTGG-3⬘).
Sequencing confirmed the correct insertion of the Flag sequence and
excision of the Kan-r cassette.
Manipulation of embryos
PCR-based mapping of the ntl regulatory elements was performed as
previously described (Woolfe et al., 2005). Primers used to generate the –2.1
kb promoter fragment were (1) 5⬘-ATACAATTCCTTTGTGCTGTTGCAACAC-3⬘ and (2) 5⬘-ATTTCCGATCAAATAAAGCTTGAGAT–3⬘. For the two overlapping –1.4 kb fragments, primer (1) was used
with (3) 5⬘-GTGTCTGCTGCCTCGTTGCCT-3⬘ and primer (2) was used
with (4) 5⬘-TTCAGTTCAGAATTATTTTAG-3⬘. All RNA was synthesised
using mMessage mMachine (Ambion) according to the manufacturer’s
protocol. Animal pole injections were performed at the 128-cell stage with
50 pg wnt8 (Agathon et al., 2003), 50 pg bmp4 (Thisse and Thisse, 1999)
and 25 pg Venus RNA (to check injection). All other injections were
performed at the one-cell stage by injecting 500 pg lefty (antivin), 10 pg
Wnt8 (Sokol et al., 1991), 10 pg BMP4 (Jones et al., 1992), 600 pg dnBMPr
(Suzuki et al., 1994), 1 pg of Taram-d* (Renucci et al., 1996) and 10 pg
Alk3* encoding RNAs. The ntl morpholino has been described previously
(Feldman and Stemple, 2001).
Transgenic lines
For the generation of the ntl promoter transgenic line, –1 kb of the ntl
promoter was cloned upstream of CFP within the miniTol plasmid using the
primers 5⬘-ATCGAACATTTTAATTGTAGC-3⬘ and 5⬘-ATTTCCGATCAAATAAAGCTTGAGAT-3⬘. One-cell stage embryos were injected
with 25 pg of the –1 kb ntl:CFP miniTol plasmid and 25 pg of transposase
RNA. Injected fish were raised to adulthood and outcrossed. Embryos from
outcrosses were used to perform PCR screening for the transgene. The ntl
BAC transgenic line was generated by injecting embryos with 3 nl of BAC
DNA at ~70 ng/ml. Before injection BAC DNA was dialyzed with
Centriprep-YM30 column (Millipore) in microinjection buffer (10 mM Tris,
pH 7.4, 0.15 mM EDTA, pH 8.0). The embryos were raised to adulthood and
intercrossed. Embryos from intercrosses were used to perform PCR
screening for the transgene with the following primers 5⬘GGATGACGATGACAAGTGATGAAG-3⬘ and 5⬘-GCAATGGTTACCAGTTTTGAACATT-3⬘.
Expression analysis
In situ hybridization was performed essentially as described (Thisse et al.,
1993). Probes used were gata2 (Dooley et al., 2005) and ntl (Schulte-Merker
et al., 1994). Quantitative RT-PCR was performed using a Roche
LightCycler 480. Data shown represent three different experiments each
performed on 50 embryos at 6 hpf. Data within each set were normalised
using the expression levels of ornithine decarboxylase (ODC) and data sets
were normalised assuming the expression level in wild-type embryos was
100%. Primers used were: ODC 5⬘-GATGGCCTGGCTGTATGTTT-3⬘ and
5⬘-GTTTGCAGGCTGAGTGTGAA-3⬘; ntl: 5⬘-CGTCCGGTTTCATTGTATCA-3⬘ and 5⬘-CGGTCACTTTTCAAAGCGTAT-3⬘; bra: 5⬘TCACCGGTGGAAGTATGTGA-3⬘ and 5⬘-CCTCCGTTGAGTTTGTTGGT-3⬘. Immunostaining of ntl BAC transgenic embryos was performed
with an HRP tagged anti-Flag antibody (DDDDK-HRP, ab1238, Abcam).
RESULTS
Identification of the regulatory elements
responsible for ntl expression
As a starting point for the identification of ntl regulatory elements, we
used a BAC that spanned 133 kb of DNA surrounding the ntl open
reading frame, from –27.4 kb to +105.7 kb. Bacterial homologous
recombination was used to introduce a FLAG tag into the ntl BAC,
such that the FLAG amino acid sequence was positioned at the Cterminus of Ntl. We established a stable transgenic line with this BAC,
and immunostaining of transgenic embryos demonstrated that the ntl
BAC contained regulatory elements capable of driving expression in
the developing margin and later in the notochord (Fig. 1A,B).
However, in contrast to the endogenous gene, transgene expression
was not observed in the tailbud. We used a PCR-based approach to
identify these regulatory elements (Woolfe et al., 2005) and found that
a –2.1 kb PCR fragment was capable of driving GFP expression in the
developing margin (Fig. 1C) and later in the notochord (data not
shown). Within this region we found that two overlapping 1.4 kb
fragments (Fig. 1D) displayed similar enhancer abilities to those of
the –2.1 kb fragment, suggesting that a 700 bp region (from –0.7 kb
to –1.4 kb) can recapitulate the expression of ntl in the developing
margin and notochord. We continued our analysis by focusing on two
areas within the 700 bp region, which we called enhancers one (40 bp)
and two (50 bp) (E1 and E2) (Fig. 1D). E1 was chosen because it
contains a putative E-box binding site, which, although not directly
required for Xbra and mouse brachyury expression, is present within
genomic regions that are required for their expression (Lerchner et al.,
2000; Yamaguchi et al., 1999). E2 contains a putative Fast-1 binding
site, which is a co-factor of Smad2 and mediates the transcriptional
response of nodal signalling (Schier, 2003). Alignments of E1 and E2
with stickleback and medaka ntl promoters suggest that these regions
are not highly conserved.
Nodal induction of ntl expression
To understand the functions of E1 and E2 we cloned a –1 kb ntl
promoter fragment, which excludes E1, upstream of cyan
fluorescent protein (CFP) and used this construct to create a stable
transgenic line (Fig. 2A,B). The –1 kb ntl promoter fragment drove
DEVELOPMENT
MATERIALS AND METHODS
Development 137 (7)
Two mechanisms of mesoderm formation
RESEARCH ARTICLE 1129
Fig. 1. Mapping the ntl regulatory elements.
(A,B) Anti-Flag immunostaining of ntl:Flag BAC
transgenic embryos shows expression in the
margin at 6 hpf (A) and in the notochord at 11 hpf
(B). (C) An embryo injected with a –2.1 kb ntl
promoter PCR fragment activates GFP expression
in the margin at 6 hpf. (D) An illustration of the
PCR fragments generated to map the ntl
regulatory elements. Two overlapping 1.4 kb
fragments displayed the same enhancer properties
as the 2.1 kb fragment. Within the overlapping
700 bp region (–0.7 kb to –1.4 kb) we focused on
enhancer 1 (E1, 40 bp) and enhancer 2 (E2, 50
bp). The sequences of E1 and E2 are shown.
(Fig. 2D, + Taram-d*). Removal of E2 (DE2) abolished the
responsiveness to nodal signalling (Fig. 2D), and deletion of the
putative Fast-1 binding site also eliminated nodal responsiveness
(Fig. 2D, DF). When embryos were injected with a construct in
which the –2.1 kb DE2 promoter was upstream of CFP, we observed
expression in the margin at 6 hpf but not in the developing notochord
(100% negative at 24 hpf, n=141) (Fig. 2E).
Together, these results demonstrate that a 50 bp region (E2) within
the –2.1 kb ntl promoter responds to nodal signalling in the margin
of the embryo and is required for maintenance of ntl expression in
the notochord at later stages of development. However, if the E2
element is removed, the –2.1 kb promoter is still capable of driving
reporter gene expression within the margin (Fig. 2E) and it still
produces some luciferase activity in the absence of nodal signalling
Fig. 2. Nodal-dependent activation of ntl
expression. (A,B) A transgenic line with –1 kb of
the ntl promoter upstream of CFP. (A) An animal
pole view shows transgene expression in the
developing margin. (B) The transgene is also
expressed in the developing notochord as shown at
24 hpf. (C,D) Luciferase assays performed at 6 hpf
with the –2.1 kb ntl promoter fragment. (D) Wild
type, –2.1 kb ntl promoter. DE2, –2.1 kb ntl
promoter, where E2 (50 bp) was removed. DF, –2.1
kb ntl promoter with the putative fast-binding site
(AAATATACA) removed from E2. (E) An embryo
injected with a plasmid containing the –2.1 kb
promoter fragment where E2 (50 bp) has been
deleted (–2.1 kb DE2) upstream of CFP. Expression
of CFP was observed in the developing margin at 6
hpf, but not in the notochord at 24 hpf.
DEVELOPMENT
reporter gene expression within the developing margin and later in
the notochord (Fig. 2A,B). At 5 hpf transgene expression was
stronger in the dorsal margin, compared with ventral positions.
Previous work has demonstrated that nodal signalling levels are
higher on the dorsal side of the embryo (Harvey and Smith, 2009),
suggesting that enhancer E2, within the –1 kb ntl promoter fragment,
is responsive to nodal signalling.
To test this idea we first performed luciferase assays on the –2.1
kb ntl promoter fragment at 6 hpf, the time at which endogenous ntl
is expressed. This fragment contains both the E1 and the E2
enhancers. We found that injection of the nodal antagonist lefty, at a
concentration that fully inhibits nodal signalling, reduced luciferase
levels but did not abolish them (Fig. 2C). When the nodal signalling
pathway was activated we observed an increase in luciferase levels
Fig. 3. Tail formation in the absence of nodal signalling.
(A) A wild-type embryo. (B) An MZoep embryo, with an arrowhead
highlighting somites within the tail region. (C,D) Embryos previously
injected at the 128-cell stage with zebrafish bmp4 and wnt8 (50 pg of
each). (C) Injection of bmp4 and wnt8 into wild-type embryos produced
an ectopic tail (arrow) containing somites. Ectopic tails formed in 22%
of injected embryos (n=117). Injection of Xenopus laevis BMP4 and
Wnt8 induced ectopic tails in 18% of injected embryos (data not
shown, n=114). (D) Injection of bmp4 and wnt8 into MZoep embryos
led to the formation of an ecoptic tail (arrow) in 29% of injected
embryos (n=29). A magnified image of the ectopic tail (inset), which
was identified by co-injection of a marker (not shown), highlights
somites within the tail (arrowhead).
(Fig. 2C). Thus, in addition to the E2 nodal responsive element, the
–2.1 kb ntl promoter fragment contains nodal-independent
regulatory region(s) that are distinct from E2 and may be represented
by the E1 region.
Nodal-independent regulation of ntl
If nodal signalling is abolished, some somites still form within the
tail region of zebrafish embryos (Fig. 3A,B) (Feldman et al., 1998;
Gritsman et al., 1999), and, consistent with this observation, ntl
expression is retained in the ventral and lateral margin (see Fig.
4A,B) (Feldman et al., 1998; Gritsman et al., 1999). These
observations suggest that factor(s) present in the ventral margin
activate ntl expression in a nodal-independent manner and that this
regulation is required for formation of somites within the tail. Two
candidates for the nodal-independent signal, both of which are
expressed in the ventral margin, are wnt8 and bmp4. In particular,
we note that misexpression of these factors in the zebrafish animal
pole region leads to the formation of ectopic tails that contain
somites but no axial structures (Agathon et al., 2003) (Fig. 3C), also
loss of BMP or Wnt function disrupts tail formation (Lekven et al.,
2001; Pyati et al., 2005). To ask whether these factors can induce
mesoderm and tail formation in a nodal-independent manner, we
injected wnt8 and bmp4 into the animal pole regions of maternal and
zygotic one-eyed pinhead (MZoep) embryos, which cannot
transduce nodal signalling (Gritsman et al., 1999). Ectopic tails were
indeed induced in MZoep embryos following the injection of bmp4
and wnt8 (Fig. 3D), with somites visible within those ectopic tails
(Fig. 3D, inset). Therefore, bmp4 and wnt8 can induce tail formation
and mesoderm in a nodal-independent manner.
To ask whether these factors are the endogenous nodalindependent regulator of ntl expression, we next injected embryos
with RNA encoding the nodal antagonist lefty followed by RNA
encoding Wnt8 and/or a constitutively active BMP receptor (Alk3*).
In the absence of nodal signalling, Wnt8 had little effect on ntl
Development 137 (7)
Fig. 4. Nodal-independent regulation of ntl. (A-F) Animal pole
views of ntl RNA in situ hybridizations at 6 hpf. (A) A wild-type embryo.
Embryos injected with lefty (B) (100% with displayed expression, n=61),
lefty + wnt8 (C) (100% with displayed expression, n=42), lefty + Alk3*
(D) (85% increased expression compared with B, n=40), lefty + wnt8 +
Alk3* (E) (87% increased expression compared with B, n=79), lefty +
dnBMPr (F) (80% no expression, n=40). (G) Luciferase assays performed
at 6 hpf with the –2.1 kb ntl promoter fragment in wild-type embryos
and embryos injected with RNA encoding Wnt8 and/or Alk3*. DE1 =
–2.1 kb ntl promoter where E1 (40 bp) was present. DE1DE2 = –2.1 kb
ntl promoter where E1 and E2 were removed.
expression (Fig. 4A-C). However, activation of the BMP signalling
pathway led to an increase in ntl expression (Fig. 4B,D). Activation
of both Wnt and BMP signalling led to a further mild increase in ntl
expression (Fig. 4D,E). These results indicate that nodal
independent induction of ntl expression is mediated predominantly
by BMP signalling. To test this we injected embryos with RNA
encoding lefty and then with RNA encoding a dominant-negative
BMP receptor (dnBMPr). Although ventral ntl expression was
retained in embryos injected with only lefty (Fig. 4B), ntl expression
was completely abolished in embryos injected with lefty and
dnBMPr (Fig. 4F).
The ntl promoter contains a nodal-independent
regulatory element
We went on to use luciferase assays to ask if the regulatory elements
responsible for nodal-independent regulation of ntl lie within the
–2.1 kb promoter region. Activation of the BMP signalling pathway,
in embryos also injected with lefty, caused an increase in luciferase
levels, and further injection with Wnt8 produced an additional 35%
increase (Fig. 4G). Deletion of E1 (DE1 2.1 kb) greatly reduced the
ability of Wnt and BMP signalling to activate the promoter (Fig.
4G). Together these results demonstrate that E1 responds to BMP
and Wnt signalling, whereas E2 responds to nodal signalling and is
also required to maintain expression in the notochord. When we
deleted both E1 and E2 (Fig. 4G, DE1, DE2) luciferase levels were
reduced to 9.5% of wild-type levels.
DEVELOPMENT
1130 RESEARCH ARTICLE
Fig. 5. Spatial and temporal regulation of ntl expression.
(A,D,D⬘,G) ntl expression in wild-type embryos. (B,E,E⬘,H,J) Expression
of the –1 kb ntl promoter transgene. (C,F,F⬘,I) The expression of ntl in
embryos injected with a dnBMPr. (A-C) Animal pole views of expression
at 5 hpf. (D-F⬘) Views of expression on opposing sides of individual
embryos at 5 hpf (transgene expression 84%, n=51 and dnBMPRr
injected 69%, n=46). (G-I) Lateral views of expression at 7 hpf. Arrows
indicate expression in the developing notochord. Brackets in G and I
highlight the enriched expression in the ventral margin of wild-type
embryos, which is not observed in embryos injected with the dnBMPr
(92%, n=37). (J) A magnified lateral view of a 7 hpf embryo shows the
transgene is expressed in the underlying endodermal cells (arrow) and
not the outer mesodermal cells (arrowhead) (100%, n=52).
Spatial and temporal regulation of the ntl
promoter
As nodal and BMP signalling are the main activators of ntl
expression in the margin, we compared the spatial and temporal
expression of the –1 kb ntl promoter transgene, which contains only
the nodal responsive enhancer, with ntl in wild-type embryos and in
embryos in which BMP signalling was inhibited (Fig. 5). In wildtype embryos, at 5 hpf, ntl is expressed in approximately the same
number of cell tiers throughout the margin (Fig. 5A,D,D⬘). At the
same time point the –1 kb ntl promoter transgene is expressed in
more cell tiers on the dorsal side of the embryo (Fig. 5B,E,E⬘). A
comparable expression pattern was observed in embryos in which
BMP signalling had been inhibited (Fig. 5C,F,F⬘). Such dorsal
enrichment of expression that was observed at 5 hpf was not
detectable at 6 hpf. As gastrulation commences ntl begins to be
expressed in the developing notochord (Fig. 5G, arrow) and is
enriched in the ventral margin (Fig. 5G, bracket). At this time point
the –1 kb ntl promoter transgene is also expressed in the developing
notochord (Fig. 5H, arrow), but in contrast to ntl expression in wildtype embryos, transgene expression is observed in many more cells
(Fig. 5H). Closer inspection reveals that the transgene is expressed
RESEARCH ARTICLE 1131
Fig. 6. Attenuation of nodal signalling in Tg(–1 kb ntl:CFP)
embryos. (A,B) Animal pole views showing transgene expression in
Tg(–1 kb ntl:CFP) embryos. Injection of high concentrations of lefty
(300 pg) completely abolished transgene expression (B) (100%, n=68).
(C,D) A transgenic embryo processed to show transgene and gata2
expression, which marks the ventral ectoderm. (D) The white bracket
highlights gata2 expression in the ventral ectoderm and the green
bracket shows transgene expression in the margin. The red bracket
shows a region that separates the expression domains of gata2 and the
transgene. (E,F) A transgenic embryo injected with a low concentration
of lefty (2 pg). (E) On the dorsal side of the embryo the transgene is
expressed in fewer cell tiers compared with uninjected embryos (C).
However, within the same embryo, transgene expression is abolished in
the ventral margin (arrow) (expression pattern observed in 43%; in
50% transgene expression was completely abolished, n=60).
in underlying cells of the endoderm at 7 hpf (Fig. 5J) and also at 8
hpf (not shown). Such expression suggests that ntl is actively
repressed in endodermal cells. However, another plausible
explanation is that the transgene transcripts are more stable than
endogenous ntl mRNA and that transgene expression in the
endoderm is not the consequence of de novo transcription. In
embryos where BMP signalling is inhibited, ntl is expressed in the
developing notochord but fails to be enriched in the ventral margin
(Fig. 5I, bracket).
As our previous experiments suggested that the –1 kb ntl
promoter transgene contains only the nodal responsive enhancer, we
injected –1 kb ntl promoter transgenic embryos with a concentration
range of the nodal antagonist lefty (Fig. 6). Injection of high
concentrations of lefty (300 pg) resulted in the complete abolition of
transgene expression within the margin (Fig. 6A,B). Injection of
lower concentrations of lefty (2 pg) resulted in the transgene being
expressed in fewer cell tiers on the dorsal side of the embryo (Fig.
6C,E), whereas expression in the ventral margin was completely lost
(Fig. 6E,F). In these experiments we identified the ventral side of the
embryo by co-staining embryos for gata2 expression, which marks
the ventral ectoderm (Rentzsch et al., 2004). These results
demonstrate that the –1 kb ntl promoter responds to endogenous
nodal signals in the developing embryo and that ventral expression
driven by this promoter is the first to be abolished following a
reduction in nodal signalling.
DEVELOPMENT
Two mechanisms of mesoderm formation
1132 RESEARCH ARTICLE
Development 137 (7)
Fig. 7. Nodal-independent regulation of ntl is essential for tail
formation. (A,B) Quantitative RT-PCR of ntl (red) and bra (blue)
expression at 6 hpf. Absolute levels of wild-type ntl expression were
1.44 times greater than that of bra. (A) Embryos injected with Alk3*
and wnt8 displayed an increase in ntl, but not bra expression. Injection
of taram-d* produced an increase in both ntl and bra expression. (B)
Injection of embryos with lefty and then Alk3* and wnt8 demonstrated
that in the absence of nodal signalling BMP and Wnt signalling can
activate the expression of ntl but not bra. (C) An embryo injected with
an ntl morpholino and then further injected in the animal pole with
bmp4 and wnt8 leads to a small ectopic mass (arrow) in 29% of
embryos (n=77) (compare with Fig. 3C). (D) An MZoep embryo injected
at the one-cell stage with an ntl MO. Loss of ntl function abolished the
formation of somites within the tail region of MZoep embryos
(arrowhead, compare with Fig. 3B).
DISCUSSION
Mesoderm induction during zebrafish embryonic
development
An essential step in the patterning of the early vertebrate embryo is
the commitment of cells to one of the three germ layers. At the core
of this patterning is the transcription factor Brachyury, the zebrafish
homologues of which are called ntl and bra. The correct spatial and
temporal regulation of these Brachyury genes is essential for the
proper formation of mesoderm, because in their absence almost all
mesoderm fails to develop (Martin and Kimelman, 2008). We also
note that misexpression of Xenopus Brachyury (Xbra) in cells of the
animal pole, where endogenous Xbra is not expressed, leads to the
formation of mesoderm in tissue that would normally become
ectoderm (Cunliffe and Smith, 1992).
During zebrafish development a nodal morphogen gradient
induces the formation of mesoderm by activating the expression of
bra and ntl (Fig. 7A), and in the absence of nodal signalling
mesoderm formation is greatly inhibited (Fig. 3B) (Feldman et al.,
1998; Gritsman et al., 1999). However, our work, and that of others
(Feldman et al., 1998; Gritsman et al., 1999), indicates that
mesoderm can also form in the zebrafish embryo in a nodalindependent manner. In this paper we show that Wnt and BMP
signalling activates the expression of ntl in the ventral margin and
that such regulation is required for the formation of somites within
the tail region of embryos.
Tail formation is dependent on ntl and not bra
As the zebrafish genome contains two Brachyury homologues (ntl
and bra) (Martin and Kimelman, 2008), a complete understanding
of mesoderm formation during zebrafish development requires an
understanding of the regulation of both ntl and bra. To this end we
carried out quantitative RT-PCR to ask whether bra expression is
regulated in a similar manner to ntl (Fig. 7A,B). Both bra and ntl
expression increased in embryos injected with the constitutively
active nodal receptor Taram-d* and, consistent with our previous
experiments, ntl expression was also activated by BMP and Wnt
signalling (Fig. 7A). However, bra expression slightly decreased in
embryos injected with Alk3* and wnt8, perhaps because these
embryos become ventralised as a result of increased BMP signalling.
Similarly, BMP and Wnt signalling activated ntl expression in a
nodal-independent manner, but bra expression decreased somewhat
(Fig. 7B). These experiments show that the regulation of bra differs
from that of ntl, consistent with the observation that they play
different roles in the early zebrafish embryo.
As previously shown, misexpression of wnt8 and bmp4 in the
animal pole leads to the formation of an ectopic tail that contains
somites but no axial structures (Fig. 3C) (Agathon et al., 2003).
Because ntl, and not bra, is regulated by BMP and Wnt signalling,
the formation of such ectopic tails is likely to require ntl. To test this
idea we injected embryos with an ntl morpholino and then further
injected them, in the animal pole of the 128-cell embryo, with bmp4
and wnt8. Whereas injection of bmp4 and wnt8 into wild-type
embryos led to the formation of ectopic tails (see Fig. 3C), injection
into ntl morphants did not produce ectopic tails, but instead resulted
in the formation of a small ectopic mass (Fig. 7C, 29%, n=77). Our
observations suggest that the formation of somites within the tail
Marginal expression of ntl represents the
combined effects of two enhancer regions
During normal zebrafish development, at 5 hpf, ntl is expressed in
approximately the same numbers of cell tiers throughout the margin
(Fig. 8A). We show here that this uniform spatial expression derives
from the combined actions of two separate enhancers. One of these,
E1, responds to signalling by BMPs and Wnts, whereas the other,
E2, responds to nodal signalling (Fig. 8A). In the absence of nodal
signalling there is a ‘wedge’ of ntl expression, highest on the ventral
side and low on the dorsal (Fig. 8A, green) (Thisse and Thisse,
1999). The reciprocal expression pattern is obtained by the
activation of the promoter in response to nodal signalling (Fig. 8A,
red). The combination of these enhancers drives ntl expression
throughout the margin.
Injection of the nodal antagonist Cerberus-short (cer-s) into
Xenopus embryos demonstrated that it is the ventral expression of
Xbra that is most sensitive to the loss of nodal signalling (Agius
et al., 2000). By contrast, in previous studies, injection of lefty
into zebrafish embryos had suggested that ntl expression in the
dorsal margin is the more sensitive to the loss of nodal signalling
(Thisse and Thisse, 1999). Indeed, in the complete absence of
nodal signalling ntl continues to be expressed in the ventral
margin (Feldman et al., 1998; Gritsman et al., 1999). Our
observation that ntl expression is driven by the complementary
actions of two enhancers resolves this apparent discrepancy: in
zebrafish embryos in which nodal signalling is abolished,
expression persists in ventral regions thanks to enhancer E1,
which responds to BMPs and Wnts. In transgenic zebrafish
embryos in which a reporter gene is driven only by the nodal
responsive element E2, it is the ventral domain that is first
abolished following loss of nodal signalling (Fig. 6C-F), as is the
case for Xbra in the Xenopus embryo.
DEVELOPMENT
region of MZoep embryos must be dependent on ntl and not bra.
Injection of the ntl morpholino into MZoep embryos abolished the
formation of somites (Fig. 7D), thus confirming this idea.
Fig. 8. A model of ntl regulation. (A) The ntl promoter contains two
different regulatory elements that activate ntl expression in the
developing margin. BMP and Wnt signalling acts through one element
(E1, shown in green) to activate ntl expression in the ventral margin.
Nodal signalling induces ntl expression via a separate regulatory
element (E2, shown in red), resulting in an enrichment of expression in
the dorsal margin. (B) BMP and Wnt induction of ntl is required for tail
mesoderm formation (shown in green). Anterior mesoderm (shown in
red) results from the induction of ntl and ntl expression by nodal
signalling. Notochord formation (shown in yellow) is dependent on
regulatory elements that also lie within E2 of the ntl promoter.
Interestingly, the expression pattern of bra in the zebrafish
resembles that of our –1 kb ntl promoter transgenic line, which
contains only the nodal responsive enhancer (Fig. 5B,E,E⬘) (Martin
and Kimelman, 2008). Expression from the –1 kb ntl transgenic line
and of bra is enriched in the dorsal margin and is later maintained in
the notochord (Martin and Kimelman, 2008). The dorsal enrichment
of expression coincides with high levels of nodal signalling in the
dorsal margin of the zebrafish embryo (Harvey and Smith, 2009).
These observations are consistent with the conclusion that bra, like
ntl, can be induced by nodal signalling, but that only ntl can be
activated by BMPs and Wnts (Fig. 7A,B). We note that Xenopus
Brachyury, Xbra, can be induced by BMP signalling (Finley et al.,
1999; Re’em-Kalma et al., 1995; Zhang et al., 2008), suggesting that
bra has lost responsiveness to BMP and Wnt signalling following
the duplication of their common ancestor. However, in the absence
of data from a basal species such as amphioxus we cannot exclude
the possibility that ntl acquired the ability to respond to BMPs and
Wnts.
In the absence of ntl, posterior mesoderm and notochord
formation is disrupted, but anterior mesoderm continues to develop
(Halpern et al., 1993; Martin and Kimelman, 2008). Our work,
together with that of others (Martin and Kimelman, 2008), suggests
that differences in anterior and posterior (tail) mesoderm formation
derive from the differential regulation of ntl and bra. During anterior
mesoderm formation, ntl and bra compensate for the loss of one
another, and our experiments suggest that this is because both genes
are regulated by nodal signalling. In the absence of ntl function, bra
continues to be activated by nodal signalling, and its expression
ensures the correct formation of anterior mesoderm. However, the
RESEARCH ARTICLE 1133
differential requirement of ntl and bra during posterior mesoderm
formation derives from the fact that only ntl is regulated by BMP
and Wnt signalling. In the absence of ntl, BMP and Wnt signalling
cannot induce mesoderm, and subsequently tail formation is
disrupted. By contrast, posterior mesoderm formation continues
normally in the absence of bra, because ntl expression is activated
in the ventral margin in response to BMP and Wnt signals (Fig. 8).
Consistent with this idea, cell transplantation experiments have
shown that when cells are exposed to nodal signalling they form
anterior somites, whereas exposure to BMP signalling leads to the
formation of tail somites (Szeto and Kimelman, 2006). Similarly, it
has been shown that oep genetically interacts with ntl (Schier et al.,
1997). Loss of both maternal and zygotic oep abolishes all nodal
signalling and severely affects mesoderm formation (Gritsman et al.,
1999), but loss of only zygotic oep does not affect the expression of
the mesodermal markers myoD and a-tropomyosin (Schier et al.,
1997). As expected, posterior expression of these markers was
disrupted in ntl mutant embryos but anterior expression is
unaffected. However, anterior mesoderm formation is severely
affected in oep ntl double-mutant embryos. This suggests that
maternal levels of oep are sufficient to activate bra and ntl
expression to a level that induces anterior mesoderm formation.
However, maternal oep is insufficient to induce anterior mesoderm
with only bra (i.e. in the absence of ntl). Such a model would
therefore predict a similar genetic interaction between zygotic oep
and bra loss of function.
With this in mind, why does notochord formation require ntl,
when bra is also expressed in the developing notochord in response
to nodal signals? One possibility is that although the amino acid
sequences of bra and ntl are 65% identical (ClustalW alignment),
bra cannot substitute for ntl function in the notochord. Alternatively,
formation of the notochord may require higher levels of Brachyury
activity than are needed for anterior mesoderm formation, and
perhaps bra is not expressed at high enough levels to compensate for
loss of ntl.
In the absence of nodal signalling bra and ntl expression levels
are both reduced to 18% of wild-type levels (Fig. 7A,B). Our results
indicate that the residual expression of ntl derives from BMP and
Wnt signalling, but these pathways do not regulate bra, suggesting
that it is regulated to some extent by pathways that are independent
of nodals, BMPs and Wnts.
Vertebrate mesoderm formation
The regulation of Brachyury has been extensively studied during
mouse and Xenopus development. In contrast to the zebrafish,
inhibition of nodal signalling in Xenopus leads to a complete loss of
Xbra expression and of mesoderm formation (Agius et al., 2000;
Dorey and Hill, 2006; Piccolo et al., 1999), suggesting that there is
no nodal-independent induction of Xbra. However, as in the
zebrafish, BMP signalling can nevertheless induce Xbra in Xenopus,
and it can activate brachyury in mouse and human embryonic stem
(ES) cells (Finley et al., 1999; Re’em-Kalma et al., 1995; Zhang et
al., 2008). These species have therefore evolved different roles for
BMP signalling in mesoderm formation. Interestingly, inhibition of
Nodal signalling blocks the ability of BMPs to induce mesoderm in
human ES cells (Zhang et al., 2008), suggesting that BMP signalling
induces mesoderm in these cells by upregulating expression of a
Nodal ligand.
It has also been shown in Xenopus that in the absence of FGF
signalling Xbra expression is abolished dorsally but retained
ventrally (Northrop et al., 1995), whereas simultaneous FGF and
BMP inhibition leads to a complete loss of Xbra expression. Thus,
DEVELOPMENT
Two mechanisms of mesoderm formation
1134 RESEARCH ARTICLE
Mesoderm and tail formation
Several lines of evidence suggest that zebrafish and Xenopus have
evolved different mechanisms to induce mesoderm and tail
formation. Transplantation of ventral tissue from 6 hpf zebrafish
embryos into the animal pole of a host embryo induces the formation
of an ectopic tail in a manner that does not require the dorsal
organizer (shield) (Agathon et al., 2003). Comparable ventral tissue
regions of the Xenopus embryo, however, do not posses tailinducing activity (De Robertis and Kuroda, 2004). Rather, it is
thought the tail is induced at later stages of development, near the
end of gastrulation, by the progeny of the dorsal organizer (Gont et
al., 1993).
During zebrafish development, BMP and Wnt signalling can
recapitulate the tail organising activity of the ventral margin (Fig.
3C), and our work shows that this occurs through the activation of
ntl (Fig. 7C,D). The timing of ntl expression in response to BMP
signalling at approximately 5 hpf coincides with the stage at which
the tail is induced (Pyati et al., 2005; Szeto and Kimelman, 2006;
Tucker et al., 2008). Specifically our results show that BMP and Wnt
signalling induces tail formation in the absence of nodal signalling
(Fig. 3), whereas it has previously been suggested that tail formation
is nodal dependent (Agathon et al., 2003).
Despite the differences in tail formation during zebrafish and
Xenopus development, one common feature is that BMP signalling
is essential for tail formation in both species (Pyati et al., 2005;
Reversade et al., 2005; Tucker et al., 2008). Although BMP
signalling can induce the expression of both Xbra and ntl, only ntl
is regulated by a nodal-independent mechanism (Fig. 4A-F) (Agius
et al., 2000; Dorey and Hill, 2006; Re’em-Kalma et al., 1995). As
nodal-independent regulation of ntl is essential for tail formation
during zebrafish development, the differential regulation of
mesoderm induction by BMP signalling during Xenopus and
zebrafish development may be central to differences in tail
formation.
Acknowledgements
We thank past and present members of the Smith lab for their help and
advice, and Caroline Hill, Fiona Wardle and Greg Elgar for reagents. This work
is supported by the VolkswagenStiftung and by a Wellcome Trust Programme
Grant awarded to J.C.S. A.F.S. is supported by the NIH. Deposited in PMC for
release after 6 months.
Competing interests statement
The authors declare no competing financial interests.
References
Agathon, A., Thisse, C. and Thisse, B. (2003). The molecular nature of the
zebrafish tail organizer. Nature 424, 448-452.
Agius, E., Oelgeschlager, M., Wessely, O., Kemp, C. and De Robertis, E. M.
(2000). Endodermal Nodal-related signals and mesoderm induction in Xenopus.
Development 127, 1173-1183.
Chen, Y. and Schier, A. F. (2001). The zebrafish Nodal signal Squint functions as a
morphogen. Nature 411, 607-610.
Cunliffe, V. and Smith, J. C. (1992). Ectopic mesoderm formation in Xenopus
embryos caused by widespread expression of a Brachyury homologue. Nature
358, 427-430.
De Robertis, E. M. and Kuroda, H. (2004). Dorsal-ventral patterning and neural
induction in Xenopus embryos. Annu. Rev. Cell Dev. Biol. 20, 285-308.
Dooley, K. A., Davidson, A. J. and Zon, L. I. (2005). Zebrafish scl functions
independently in hematopoietic and endothelial development. Dev. Biol. 277,
522-536.
Dorey, K. and Hill, C. S. (2006). A novel Cripto-related protein reveals an essential
role for EGF-CFCs in Nodal signalling in Xenopus embryos. Dev. Biol. 292, 303316.
Feldman, B. and Stemple, D. L. (2001). Morpholino phenocopies of sqt, oep,
and ntl mutations. Genesis 30, 175-177.
Feldman, B., Gates, M. A., Egan, E. S., Dougan, S. T., Rennebeck, G.,
Sirotkin, H. I., Schier, A. F. and Talbot, W. S. (1998). Zebrafish organizer
development and germ-layer formation require nodal-related signals. Nature
395, 181-185.
Finley, M. F., Devata, S. and Huettner, J. E. (1999). BMP-4 inhibits neural
differentiation of murine embryonic stem cells. J. Neurobiol. 40, 271-287.
Galceran, J., Hsu, S. C. and Grosschedl, R. (2001). Rescue of a Wnt mutation by
an activated form of LEF-1: regulation of maintenance but not initiation of
Brachyury expression. Proc. Natl. Acad. Sci. USA 98, 8668-8673.
Gont, L. K., Steinbeisser, H., Blumberg, B. and de Robertis, E. M. (1993). Tail
formation as a continuation of gastrulation: the multiple cell populations of the
Xenopus tailbud derive from the late blastopore lip. Development 119, 9911004.
Gritsman, K., Zhang, J., Cheng, S., Heckscher, E., Talbot, W. S. and Schier, A.
F. (1999). The EGF-CFC protein one-eyed pinhead is essential for nodal
signaling. Cell 97, 121-132.
Halpern, M. E., Ho, R. K., Walker, C. and Kimmel, C. B. (1993). Induction of
muscle pioneers and floor plate is distinguished by the zebrafish no tail
mutation. Cell 75, 99-111.
Harvey, S. A. and Smith, J. C. (2009). Visualisation and quantification of
morphogen gradient formation in the zebrafish. PLoS Biol. 7, e101.
Jones, C. M., Lyons, K. M., Lapan, P. M., Wright, C. V. and Hogan, B. L.
(1992). DVR-4 (bone morphogenetic protein-4) as a posterior-ventralizing factor
in Xenopus mesoderm induction. Development 115, 639-647.
Latinkic, B. V., Umbhauer, M., Neal, K. A., Lerchner, W., Smith, J. C. and
Cunliffe, V. (1997). The Xenopus Brachyury promoter is activated by FGF and
low concentrations of activin and suppressed by high concentrations of activin
and by paired-type homeodomain proteins. Genes Dev. 11, 3265-3276.
Lekven, A. C., Thorpe, C. J., Waxman, J. S. and Moon, R. T. (2001). Zebrafish
wnt8 encodes two wnt8 proteins on a bicistronic transcript and is required for
mesoderm and neurectoderm patterning. Dev. Cell 1, 103-114.
Lerchner, W., Latinkic, B. V., Remacle, J. E., Huylebroeck, D. and Smith, J. C.
(2000). Region-specific activation of the Xenopus brachyury promoter involves
active repression in ectoderm and endoderm: a study using transgenic frog
embryos. Development 127, 2729-2739.
Marlow, F., Gonzalez, E. M., Yin, C., Rojo, C. and Solnica-Krezel, L. (2004). No
tail co-operates with non-canonical Wnt signaling to regulate posterior body
morphogenesis in zebrafish. Development 131, 203-216.
Martin, B. L. and Kimelman, D. (2008). Regulation of canonical Wnt signaling by
Brachyury is essential for posterior mesoderm formation. Dev. Cell 15, 121-133.
Northrop, J., Woods, A., Seger, R., Suzuki, A., Ueno, N., Krebs, E. and
Kimelman, D. (1995). BMP-4 regulates the dorsal-ventral differences in
DEVELOPMENT
while nodal signalling is required to induce Xbra, FGF and BMP
pathways may be required to maintain expression. Interaction
between the FGF and BMP pathways can occur through FGFdependent phosphorylation of BMP-specific Smads (Pera et al.,
2003), suggesting that in the normal embryo FGF signalling
prevents BMPs from activating Xbra.
Previous work has demonstrated that Wnt signalling, although
not required for the initiation of brachyury expression during
mouse development, is required for its maintenance (Galceran et
al., 2001; Yamaguchi et al., 1999). Our work shows that Wnt
signalling does not play a major role in the induction of ntl
expression, but it remains possible that Wnts are required to
maintain ntl expression later in development. Indeed, expression
of wnt8 in the early embryo depends on ntl, and there is a genetic
interaction between ntl and Wnt signalling (Marlow et al., 2004;
Martin and Kimelman, 2008).
Finally, studies of –2.1 kb of the Xenopus Brachyury (Xbra)
promoter have shown that this fragment responds to Nodal/Activin
signalling and is expressed throughout the margin of Xenopus
embryos, but excluded from the organiser and notochord (Latinkic
et al., 1997; Lerchner et al., 2000). A comparable region of the
mouse brachyury promoter is similarly expressed in pre-somitic
mesoderm but excluded from the notochord and node (Yamaguchi
et al., 1999). Our work demonstrates that a 50 bp region within the
–2.1 kb ntl promoter is similarly responsive to nodal signalling, but
also drives expression in the notochord (E2, Fig. 2B). Thus, although
there has been conservation of the ability of comparable promoter
regions to respond to Nodal/Activin signalling, there has been
divergence with respect to notochord expression, with the Xenopus
and mouse notochord enhancers located outside the studied regions.
Development 137 (7)
FGF/MAPKK-mediated mesoderm induction in Xenopus. Dev. Biol. 172, 242252.
Odenthal, J., Haffter, P., Vogelsang, E., Brand, M., van Eeden, F. J., FurutaniSeiki, M., Granato, M., Hammerschmidt, M., Heisenberg, C. P., Jiang, Y. J.
et al. (1996). Mutations affecting the formation of the notochord in the
zebrafish, Danio rerio. Development 123, 103-115.
Pera, E. M., Ikeda, A., Eivers, E. and De Robertis, E. M. (2003). Integration of
IGF, FGF, and anti-BMP signals via Smad1 phosphorylation in neural induction.
Genes Dev. 17, 3023-3028.
Piccolo, S., Agius, E., Leyns, L., Bhattacharyya, S., Grunz, H., Bouwmeester,
T. and De Robertis, E. M. (1999). The head inducer Cerberus is a
multifunctional antagonist of Nodal, BMP and Wnt signals. Nature 397, 707710.
Piek, E., Moustakas, A., Kurisaki, A., Heldin, C. H. and ten Dijke, P. (1999).
TGF-(beta) type I receptor/ALK-5 and Smad proteins mediate epithelial to
mesenchymal transdifferentiation in NMuMG breast epithelial cells. J. Cell Sci.
112, 4557-4568.
Pyati, U. J., Webb, A. E. and Kimelman, D. (2005). Transgenic zebrafish reveal
stage-specific roles for Bmp signaling in ventral and posterior mesoderm
development. Development 132, 2333-2343.
Re’em-Kalma, Y., Lamb, T. and Frank, D. (1995). Competition between noggin
and bone morphogenetic protein 4 activities may regulate dorsalization during
Xenopus development. Proc. Natl. Acad. Sci. USA 92, 12141-12145.
Rentzsch, F., Bakkers, J., Kramer, C. and Hammerschmidt, M. (2004). Fgf
signaling induces posterior neuroectoderm independently of Bmp signaling
inhibition. Dev. Dyn. 231, 750-757.
Renucci, A., Lemarchandel, V. and Rosa, F. (1996). An activated form of type I
serine/threonine kinase receptor TARAM-A reveals a specific signalling pathway
involved in fish head organiser formation. Development 122, 3735-3743.
Reversade, B., Kuroda, H., Lee, H., Mays, A. and De Robertis, E. M. (2005).
Depletion of Bmp2, Bmp4, Bmp7 and Spemann organizer signals induces
massive brain formation in Xenopus embryos. Development 132, 3381-3392.
Schier, A. F. (2003). Nodal signaling in vertebrate development. Annu. Rev. Cell
Dev. Biol. 19, 589-621.
Schier, A. F. and Talbot, W. S. (2005). Molecular genetics of axis formation in
zebrafish. Annu. Rev. Genet. 39, 561-613.
RESEARCH ARTICLE 1135
Schier, A. F., Neuhauss, S. C., Helde, K. A., Talbot, W. S. and Driever, W.
(1997). The one-eyed pinhead gene functions in mesoderm and endoderm
formation in zebrafish and interacts with no tail. Development 124, 327-342.
Schulte-Merker, S., van Eeden, F. J., Halpern, M. E., Kimmel, C. B. and
Nusslein-Volhard, C. (1994). no tail (ntl) is the zebrafish homologue of the
mouse T (Brachyury) gene. Development 120, 1009-1015.
Sokol, S., Christian, J. L., Moon, R. T. and Melton, D. A. (1991). Injected Wnt
RNA induces a complete body axis in Xenopus embryos. Cell 67, 741-752.
Suzuki, A., Thies, R. S., Yamaji, N., Song, J. J., Wozney, J. M., Murakami, K.
and Ueno, N. (1994). A truncated bone morphogenetic protein receptor affects
dorsal-ventral patterning in the early Xenopus embryo. Proc. Natl. Acad. Sci.
USA 91, 10255-10259.
Szeto, D. P. and Kimelman, D. (2006). The regulation of mesodermal progenitor
cell commitment to somitogenesis subdivides the zebrafish body musculature
into distinct domains. Genes Dev. 20, 1923-1932.
Thisse, C. and Thisse, B. (1999). Antivin, a novel and divergent member of the
TGFbeta superfamily, negatively regulates mesoderm induction. Development
126, 229-240.
Thisse, C., Thisse, B., Schilling, T. F. and Postlethwait, J. H. (1993). Structure of
the zebrafish snail1 gene and its expression in wild-type, spadetail and no tail
mutant embryos. Development 119, 1203-1215.
Tucker, J. A., Mintzer, K. A. and Mullins, M. C. (2008). The BMP signaling
gradient patterns dorsoventral tissues in a temporally progressive manner along
the anteroposterior axis. Dev. Cell 14, 108-119.
Woolfe, A., Goodson, M., Goode, D. K., Snell, P., McEwen, G. K., Vavouri, T.,
Smith, S. F., North, P., Callaway, H., Kelly, K. et al. (2005). Highly conserved
non-coding sequences are associated with vertebrate development. PLoS Biol. 3,
e7.
Yamaguchi, T. P., Takada, S., Yoshikawa, Y., Wu, N. and McMahon, A. P.
(1999). T (Brachyury) is a direct target of Wnt3a during paraxial mesoderm
specification. Genes Dev. 13, 3185-3190.
Zhang, P., Li, J., Tan, Z., Wang, C., Liu, T., Chen, L., Yong, J., Jiang, W., Sun,
X., Du, L. et al. (2008). Short-term BMP-4 treatment initiates mesoderm
induction in human embryonic stem cells. Blood 111, 1933-1941.
DEVELOPMENT
Two mechanisms of mesoderm formation