DEVELOPMENT AND STEM CELLS
RESEARCH ARTICLE
693
Development 137, 693-704 (2010) doi:10.1242/dev.046896
© 2010. Published by The Company of Biologists Ltd
Isolation and propagation of enteric neural crest progenitor
cells from mouse embryonic stem cells and embryos
Jitsutaro Kawaguchi1,2,*, Jennifer Nichols1,3, Mathias S. Gierl4, Tiago Faial1,2 and Austin Smith1,2,†
SUMMARY
Neural crest is a source of diverse cell types, including the peripheral nervous system. The transcription factor Sox10 is expressed
throughout early neural crest. We exploited Sox10 reporter and selection markers created by homologous recombination to
investigate the generation, maintenance and expansion of neural crest progenitors. Sox10-GFP-positive cells are produced
transiently from mouse embryonic stem (ES) cells by treatment with retinoic acid in combination with Fgf8b and the cytokine
leukaemia inhibitory factor (Lif). We found that expression of Sox10 can be maintained using noggin, Wnt3a, Lif and endothelin 3
(NWLE). ES cell-derived Sox10-GFP-positive cells cultured in NWLE exhibit molecular markers of neural crest progenitors. They
differentiate into peripheral neurons in vitro and are able to colonise the enteric network in organotypic gut cultures. Neural crest
cells purified from embryos using the Sox10 reporter also survive in NWLE, but progressively succumb to differentiation. We
therefore applied selection to eliminate differentiating cells. Sox10-selected cells could be clonally expanded, cryopreserved, and
multiplied for over 50 days in adherent culture. They remained neurogenic in vitro and in foetal gut grafts. Generation of neural
crest from mouse ES cells opens a new route to the identification and validation of determination factors. Furthermore, the ability
to propagate undifferentiated progenitors creates an opportunity for experimental dissection of the stimuli and molecular circuitry
that govern neural crest lineage progression. Finally, the demonstration of robust enteric neurogenesis provides a system for
investigating and modelling cell therapeutic approaches to neurocristopathies such as Hirschsprung’s disease.
INTRODUCTION
Neural crest cells emerge from the dorsal margin of the neural plate
and produce a wide variety of cell types and tissues, including
melanocytes, neurons and glia of the peripheral nervous system,
mesenchymal stromal cells, adipocytes, medullary cells, and bone
and cartilage of the facial elements (Billon et al., 2007; Crane and
Trainor, 2006; Huang and Saint-Jeannet, 2004; Le Douarin et al.,
2004; Le Douarin and Dupin, 2003; Takashima et al., 2007). The
founder population of neural crest may first be specified at midgastrulation (Basch et al., 2006). Upon subsequent receipt of
inductive signals at the dorsal edge of the neural fold, definitive
neural crest is established (Meulemans and Bronner-Fraser, 2004).
Neural crest progenitor cells delaminate, proliferate and migrate
extensively to their final destinations, where they differentiate into
appropriate cell types. Some neural crest cells do not terminally
differentiate but remain in an immature state in the post-natal skin
(Fernandes et al., 2004; Sieber-Blum et al., 2004; Wong et al., 2006),
enteric nervous system (Kruger et al., 2002), carotid body (Pardal et
al., 2007), and as melanocyte stem cells in the bulge region of the
hair follicle (Nishimura et al., 2002).
Their broad differentiation potential and extensive tissue
colonisation pattern make neural crest cells a unique and interesting
population for investigating mechanisms of lineage progression.
1
Wellcome Trust Centre for Stem Cell Research, 2Department of Biochemistry, and
Department of Physiology, Development and Neuroscience, University of
Cambridge, Tennis Court Road, CB2 1QR Cambridge, UK. 4Max-Delbruck-Centrum
for Molecular Medicine, Robert-Rossle-Strasse 10, 13125 Berlin, Germany.
3
*Present address: RIKEN Center for Developmental Biology, 2-2-3 Minatojimaminamimachi, Chuo-ku, 650-0047 Kobe, Japan.
†
Author for correspondence ([email protected])
Accepted 30 December 2009
However, experimental characterisation of neural crest cells is
hampered by the difficulty of propagating them in vitro. Most of the
information about neural crest precursor cells has come from
transplantation and gain-of-function experiments in chick embryos
(Le Douarin, 2004; Meulemans and Bronner-Fraser, 2004).
Investigations of mammalian neural crest progenitor cells have
relied primarily on descriptive and transgenic approaches in whole
embryos. In vitro assays have largely been limited to short-term
primary cultures, although a sphere culture system for enteric
nervous system progenitor cells has been developed (Bondurand et
al., 2003).
Mouse embryonic stem (ES) cells can be used to study early
events in mammalian lineage commitment because of their
pluripotency and ability to recapitulate sequential events of
embryogenesis in vitro (Keller, 1995; Smith, 2001). ES cells have
also been exploited to capture tissue-specific stem and progenitor
cells by simulating the developmental process (Conti et al., 2005;
Moretti et al., 2006; Yamashita et al., 2000). Isolation of somatic
progenitors from ES cells enables investigation and manipulation
of lineage commitment and holds promise for regenerative
medicine (Keller, 2005; Smith, 2001). In this context, derivation
of neural crest progenitors from ES cells will be a beneficial
platform to gain insight into factors that govern their
specification, expansion and differentiation. The knowledge
obtained might eventually help us to develop cell-replacement
therapies for neurocristopathies such as Hirschsprung’s disease
(Gershon, 1997; Heanue and Pachnis, 2007). Several reports have
described the production of neural crest cells from human ES cells
(Jiang et al., 2009; Lee et al., 2007; Pomp et al., 2005; Pomp et
al., 2008). Neural crest derivatives, such as melanocytes,
peripheral neurons, osteoblasts and chondrocytes, have also been
reported from murine ES cells (Kawaguchi et al., 2005; Mizuseki
et al., 2003; Motohashi et al., 2007).
DEVELOPMENT
KEY WORDS: Embryonic stem cells, Enteric nervous system, Neural crest, Mouse
694
RESEARCH ARTICLE
Development 137 (5)
In this study we focused on the purification of neural crest
progenitors from differentiating mouse ES cells and from the
developing embryo. Using a Sox10-GFP knock-in reporter, we have
identified factors that support expansion of undifferentiated neural
crest cells ex vivo with retention of peripheral neuron differentiation
potential.
Immunostaining
Cells were fixed in 4% paraformaldehyde (PFA) in PBS, permeabilised and
blocked using 0.1% Triton X-100 and 3% serum of the primary antibody
species. Primary antibodies used are shown in Table 2. Alexa Fluorconjugated secondary antibodies (Invitrogen) were used at 1/200. Nuclei
were visualised using DAPI.
Flow cytometry analysis and sorting
MATERIALS AND METHODS
Cell culture and differentiation
ES cells were maintained without feeders in Glasgow modification of Eagle
medium (GMEM) supplemented with foetal calf serum (FCS, 10%), bmercaptoethanol and leukaemia inhibitory factor (Lif), hereafter referred to
as ES cell medium (Smith, 1991).
Embryoid bodies were formed by aggregation of 104 cells per 10 ml of
medium in hanging drops for 24 hours (Kawaguchi et al., 2005). Aggregates
were collected and cultured in suspension in serum-containing medium.
Sox10-GFP-positive cells were purified by flow cytometry and cultured in
a 1:1 mix of Neurobasal (Invitrogen) and DMEM/F12 (Invitrogen) media
supplemented with N2 (Invitrogen), B27 (Invitrogen), L-glutamine and bmercaptoethanol [N2B27 medium (Ying and Smith, 2003)] in the presence
of Bmp4 (R&D systems; 20 ng/ml), Gdnf (R&D systems; 20 ng/ml) and
bFgf (Sigma; 20 ng/ml) for neurogenesis, or in the presence of TGFb3
(R&D systems; 10 ng/ml) and bFgf (Sigma; 20 ng/ml) for smooth muscle
differentiation.
Sox10-GFP-positive cells were maintained in NCC medium [DMEM
supplemented with N2, B27, 10–7 M retinoic acid, 15% chick embryo extract
(CEE; a gift from V. Pachnis, National Institute for Medical Research,
London, UK), L-glutamine, b-mercaptoethanol, Egf (Sigma; 20 ng/ml) and
bFgf (20 ng/ml)], supplemented with noggin (R&D systems; 250 ng/ml),
Wnt3a (R&D systems: 100 ng/ml), Lif (100 units/ml, prepared in-house)
and endothelin 3 (Et-3) (Calbiochem; 100 nM).
Quantitative reverse transcription (qRT) PCR
Total RNA was extracted using the Absolutely RNA RT-PCR Miniprep Kit
(Stratagene, La Jolla, CA, USA). First-strand cDNAs were prepared using
the Superscript First-Strand Synthesis System for RT-PCR (Life
Technologies, Rockville, MD, USA). cDNA was amplified with the primers
shown in Table 1. T-PCR was carried out using either the Light Cycler 2000
(Roche) or 7900HT (Applied Biosystems). Cyber Green or Taqman probes
were used for quantitation of amplicons.
Histochemical staining
For Oil Red O staining, cells were fixed with 10% formalin, equilibrated
with 60% isopropyl alcohol (IPA) for 1 minute, incubated with 2% Oil Red
O solution in 60% IPA and then washed in 60% IPA to eliminate excess
staining. Samples were stored in 75% glycerol. Embryos were stained for bgalactosidase activity as described (Hogan et al., 1994).
For immunolabelling, cultures were dissociated using Cell Dissociation
Buffer (Gibco). They were incubated sequentially with primary and
secondary antibody for 15 minutes each. Secondary antibody conjugated
with APC was purchased from Jackson ImmunoResearch. For GFP
analyses, cells were dissociated using trypsin. Cells from embryos were
dissociated by incubation with 0.1 U/ml collagenase, 0.8 U/ml dispase and
0.026 mg/ml trypsin solution for 1 hour. Cell debris was eliminated using a
strainer (30 mm) and dead cells were stained with 7-amino-actinomycin D
(7AAD). After several washes with PBS containing 1% FCS, cells were
analysed by flow cytometry using a BD Biosciences FACSCalibur or Dako
CyAn ADP flow cytometer. Sorting was performed using a MoFlo highspeed cell sorter. Data were analysed with Summit v4.3 software.
Metaphase analyses
Cells were incubated with KaryoMax Colcemid (Invitrogen) for 40 minutes
and dissociated with trypsin. After harvest, cells were incubated with 75 mM
KCl and fixed in a final concentration of 1.5% methanol/0.5% acetic acid.
Samples were spread on glass slides and chromosomes were stained with
DAPI. Images were captured by fluorescence imaging for chromosome
counting.
Gene targeting
Sox10-targeting vectors are detailed in Fig. S1 in the supplementary
material. Exon 1 of Sox10 was replaced by a green fluorescent protein (GFP)
or a GFP-IRES-BLS (blasticidin resistance) cassette. Following
electroporation, hygromycin-resistant clones were characterised by Southern
blotting. Targeted clones were transiently transfected with Cre, and marker
deletion in ganciclovir-resistant clones was confirmed by Southern
hybridisation.
Expression constructs for stable transfection
A Sox10 expression vector was generated by insertion of the Sox10 open
reading frame between the CAG promoter and IRES-Puro cassette of the
pPyFloxMTIPgfp plasmid derived from pPyFloxhNanogIPgfp (Chambers
et al., 2003). The DsRedT3 expression vector (pPyCAGMSTIhph) carries
a DsRed-IRES-Hygro cassette downstream of the CAG promoter.
Transfection was carried out using Lipofectamine 2000 (Invitrogen) and
transfectants were selected in either 1.5 mg/ml puromycin (for
pPyFloxSox10IPgfp) or 150 mg/ml hygromycin (for pPyCAGMSTIhph).
Table 1. Primers (5⬘ to 3⬘) and Taqman assays used in this study
Gapdh
Nanog
Oct4
Sox2
c-Myc
Id2
Id3
Pdgfra
Sip1
Slug
Sox9
Sox10
Snail
Ngfr (p75)
Erbb3
Amplicon
(bp)
274
467
312
196
488
195
217
360
419
402
203
490
225
Sense
CCCACTAACATCAAATGGGG
ATGAAGTGCAAGCGGTGGCAGAAA
GGCGTTCTCTTTGGAAAGGTGTTC
GGCGGCAACCAGAAGAACAG
TCGCCCAAATCCTGTACCTC
GGACATCAGCATCCTGTCCT
GTGCTGCCTGTCGGAACGTA
TGGAGGACAGCTTCCTGTAA
CTGAGCAGACAGGCTTACTT
ATGCCATCGAAGCTGAGAAG
ATTCCTCCTCCGGCATGAGT
CTAGGCAAGCTCTGGAGGTT
TGTCTGCACGACCTGTGGAA
Antisense
Assay ID
CCTTCCACAATGCCAAAGTT
CCTGGTGGAGTCACAGAGTAGTTC
CTCGAACCACATCCTTCTCT
GCTTGGCCTCGTCGATGAAC
CTCCTCTGACGTTCCAAGAC
CTCCTGGTGAAATGGCTGAT
CTCTGCCAGGACCACCTGAA
TGCTGGAGTTGTCTGCAGTA
GGCACCGTTATGACTCACTA
GCGACATTCTGGAGAAGGTT
GCTGCTCAGTTCACCGATGT
AGGTATTGGTCCAGCTCAGT
TGGTGCTTGTGGAGCAAGGA
4352339E
Mm02384862_g
Mm03053917_g1
Mm00487804_m1
Mm00492575_m1
Mm00441531_m1
Mm00448840_m1
Mm01300162_m1
Mm00441533_g1
Mm00446294_m1
Mm00695835-m1
DEVELOPMENT
Gene
Propagation of enteric neural crest progenitors
RESEARCH ARTICLE
695
Table 2. Antibodies used in this study
Antigen
Clone
Host
SMA
Oct4
Sox10
Peripherin
HuC/D
Type III tublin
Mash1
c-Ret
c-Ret
Npy
Vip
Th
DsRed
Phox2b
1A4
C10
20B7
Mouse
Mouse
Mouse
Rabbit
Mouse
Mouse
Mouse
Goat
Hamster
Rabbit
Rabbit
Rabbit
Rabbit
Rabbit
16A11
TuJ1
4B72D11.1
3A61D7/3A61C6/2C42H1
Isotype
IgG2a
IgG2b
IgG1
Polyclonal
IgG2b
IgG2a
IgG1
Polyclonal
Mix of monoclonal IgG
Polyclonal
Polyclonal
Polyclonal
Polyclonal
Polyclonal
Source
Cat. No.
Dilution
Sigma
Santa Cruz
David J. Anderson*
Chemicon
Invitrogen
Covance
BD Pharmingen
R&D systems
David J. Anderson*
Bio-genesis
Bio-genesis
Pel-Freez
Clontech
Christo Goridis†
A 2547
sc-8279
100
200
20
200
20
200
200
500
10
200
200
200
500
800
AB1530
A21271
MMS-435P
556604
AF482
6730-0004
9535-0204
P40101-0
632496
*Caltech, USA; †CNRS, Paris, France.
Gene targeting and Cre-mediated marker deletion were confirmed by
genomic DNA hybridisation analysis using standard Southern transfer
methods. For mouse genotyping, DNA was isolated and purified from
biopsies or embryos and subjected to genomic PCR. Primers used in this
study were (5⬘ to 3⬘): JK282, GTTGGGCTCTTCACGAGGAC; JK283,
CTCTTGCTGGCACCGTTGAC; and JK286, TGAACAGCTCCTCGCCCTTG. The wild-type amplicon of JK283 and JK284 is 371 bp, whereas
JK283 and JK286 give a 164 bp product from the targeted allele.
Grafting in ex vivo foetal gut culture
Grafting of cells into foetal gut was performed as described (Natarajan et al.,
1999). The entire foetal gut tube was dissected intact from E11.5 embryos
and 10-20 cells injected at multiple sites using glass capillary micropipettes.
Guts were cultured in Opti-MEM (Invitrogen) supplemented with Lglutamine for 7-10 days, then fixed for immunostaining. For hindgut grafts,
embryos were collected in the early morning at approximately E11.3 and the
hindgut separated from the rest of the gut tube.
Chimaeras
Chimaeras were generated by aggregation with eight-cell F1 (C57BL/6 ⫻
CBA) embryos. Zonae were removed using acid tyrode solution and
denuded embryos placed individually into small depressions (made using
a Hungarian darning needle) in 10 ml drops of KSOM (Chemicon, MR020P-5D) under mineral oil in a 30-mm plastic Petri dish, pre-equilibrated
to 37°C and 7% CO2. Individual clumps of 10-20 ES cells that had been
allowed to reaggregate in suspension for several hours following
trypsinisation were placed in each well in contact with an embryo and
incubated overnight. Blastocysts were then transferred to the uteri of
pseudopregnant female F1 mice and embryos subsequently dissected at
mid-gestation.
Mouse studies were authorised by a UK Home Office Project Licence and
carried out in a Home Office designated facility.
RESULTS
Generation of Sox10-expressing neural crest
progenitors from embryonic stem cells
The HMG-box transcription factor Sox10 is uniquely expressed
throughout the neural crest at E10.5 (Britsch et al., 2001).
Oligodendrocyte progenitor cells in the central nervous system
also express Sox10, but this is observed only from E12.5.
Previously, we noted that retinoic acid (RA) treatment of embryoid
bodies in the presence of FCS leads to rapid activation of Sox10
mRNA expression, succeeded by other neural crest markers
(Kawaguchi et al., 2005). To be able to detect those cells in which
Sox10 was induced and thereby monitor the induction of putative
neural crest from ES cells, we introduced a GFP reporter into the
Sox10 locus (see Fig. S1 in the supplementary material). Following
targeting and Cre recombinase-mediated excision of the neomycin
selection cassette, GFP expression was undetectable in
undifferentiated ES cells (data not shown). However, in chimaeras
formed by morula aggregation, GFP was readily detectable
throughout neural crest derivatives at mid-gestation and was
absent from ectodermal, mesodermal and endodermal tissues (Fig.
1A). This Sox10-GFP reporter ES cell line is hereafter referred to
as S10G.
Upon aggregation of S10G cells and exposure to RA, we
observed upregulation of Sox10-GFP (Fig. 1B). However, only 1%
of cells became GFP positive and this effect was transient, peaking
24 hours after exposure to RA. Subsequent screening of a panel of
growth factors and cytokines revealed that Lif and Fgf8b each
increase the number of GFP-positive cells in the presence of RA.
Their effects are additive, with the highest yield at 10–8 M RA (Fig.
1C). Even with both factors, however, Sox10-GFP-positive cells
only persisted transiently.
Flow cytometric (FACS) purification was employed to
characterise the Sox10-GFP-positive cells (Fig. 1D). The GFP+
population isolated 24 hours after RA treatment expressed neural
crest markers including Sox10, Sox9, Id2, Id3, Slug (Snai2 –
Mouse Genome Informatics) and Snail (Snai1) (Fig. 1E). These
cells were negative for the pluripotency markers Oct4 (Pou5f1)
and Nanog. They also lacked Sox2, which marks both pluripotent
and neuroectodermal cells, and brachyury (data not shown),
which marks early endoderm and mesoderm. The sorted GFP+
cells were cultured in the presence of FCS, and after 10 days
differentiated into smooth muscle actin (SMA)-positive cells (Fig.
1F). Thus, the Sox10-GFP-expressing population exhibits
molecular markers and a differentiation phenotype consistent with
neural crest identity.
Forced expression of Sox10 enhances the
generation of neural crest progenitors
Sox10 itself is implicated in neural crest commitment (SaukaSpengler and Bronner-Fraser, 2008). We therefore engineered S10G
cells to express Sox10 constitutively under control of the CAG
promoter (S10G-S cells) (see Fig. S2 in the supplementary material).
Forced expression of Sox10 in undifferentiated ES cells did not have
an overt effect on pluripotent identity. Expression levels of the
pluripotent factors Oct4 and Nanog were maintained (see Fig. S2 in
the supplementary material; data not shown) and the cells
contributed extensively to embryo chimaeras.
DEVELOPMENT
Genotyping by Southern hybridisation
696
RESEARCH ARTICLE
Development 137 (5)
Upon aggregation and RA treatment, S10G-S cells gave an
increased yield of Sox10-GFP-positive cells: from ~2% to ~10%
(Fig. 1G). This result was reproduced in three independent clones of
Sox10 transfectants.
To assess the identity of the induced Sox10-GFP-positive cells,
we investigated differentiation potential. Neural crest progenitors
should differentiate into autonomic neurons of the peripheral
nervous system in response to Bmp and Gdnf (Bondurand et al.,
2003; Shah et al., 1996). In line with this prediction, FACS-purified
Sox10-GFP-positive cells produced clusters of neuron-like cells
when exposed to Bmp4 and Gdnf (Fig. 1H). By contrast, GFPnegative cells, which are predominantly Sox2-positive persisting ES
cells or neuroepithelial progenitors, did not produce neurons in these
conditions, consistent with the potent effect of Bmp to suppress
neural commitment (Ying et al., 2003a) and central nervous system
neurogenesis (Nakashima et al., 1999).
Interestingly, the highest yield of neurons was obtained after
induction with 10–6 M RA, even though more Sox10-GFPpositive cells were generated using lower concentrations of RA
(10–8 M). This might suggest that neurogenic capacity is confined
to a subset of neural crest precursors. It might also be related to
the forced expression of Sox10, which is inhibitory to neuronal
differentiation and maturation in the majority of neural crest
progenitors (Kim et al., 2003). Nonetheless, immunofluorescence
staining showed that Sox10-GFP cells differentiated in Gdnf and
Bmp expressed the generic neuronal marker class III b-tubulin
DEVELOPMENT
Fig. 1 Characterisation of Sox10 reporter (S10G) and Sox10 constitutive expression (S10G-S) mouse ES cells. (A) Fluorescence image of
E11.5 chimera produced by morula aggregation with S10G cells. (B) Flow cytometry analysis of Sox10-GFP-positive cells from embryoid bodies
made with S10G cells. (C) Effect of Lif and Fgf8b on generation of Sox10-GFP-positive cells from embryoid bodies. Bars represent mean value of
three independent plates. (D) Flow cytometry scatter plot for sorting Sox10-GFP-positive cells and bright-field images of sorted cells cultured
overnight. (E) RT-PCR analysis of pluripotency and neural crest markers in undifferentiated ES cells, Sox10-GFP-negative, and Sox10-GFP-positive
populations. (F) Sox10-GFP-positive purified cells cultured for 10 days in the presence of serum and immunostained for smooth muscle actin.
(G) GFP-positive cells quantified by flow cytometry during differentiation of S10G-S cells and cells transfected with empty vector (Mock). RA was
applied on day 2 at 10–8 M. (H) FACS purification of Sox10-GFP-positive S10G-S cells from day 3 embryoid bodies and subsequent neurogenesis in
serum-free N2B27 medium supplemented with Bmp4. Images show immunostaining for HuC/D. (I) Sox10-GFP-positive cells purified as in H
differentiate into neurons upon culture in Bmp4 and Gdnf for 4 days. Fixed cells were immunostained for the indicated markers. Scale bars: 500 mm
in H; in I, 200 mm left, 50 mm centre, 100 mm right-hand columns.
Propagation of enteric neural crest progenitors
RESEARCH ARTICLE
697
(TuJ1; Tubb3), and also Mash1 (Ascl1), Phox2b, c-Ret and
peripherin (Fig. 1I). Quantitative RT-PCR confirmed mRNA
expression for Mash1, Phox2b and peripherin (data not shown).
This constellation of markers is characteristic of autonomic
neurons.
We conclude that the combination of forced expression of Sox10
and a Sox10 reporter facilitate the production and purification of
neural crest precursors from mouse ES cells.
Identification of extrinsic factors that maintain
neural crest progenitors
In vitro expansion will facilitate experimental characterisation and
future biomedical exploitation of neural crest cells. Rat embryoderived neural crest cells can be maintained for some period in vitro
in the presence of chick embryo extract (CEE) with Egf and Fgf
(Stemple and Anderson, 1992). These conditions have not been
reported to sustain mouse embryonic neural crest progenitors,
however, and we found that they were not adequate to support ES
cell-derived Sox10-GFP cells. Nor is Sox10-GFP expression
maintained in the presence of foetal bovine serum. Therefore, we
exploited S10G-S cells to screen for factors that might maintain
undifferentiated neural crest cells.
We employed a culture medium developed for primary enteric
nervous system progenitor cells (Bondurand et al., 2003) that
contains CEE plus Egf and bFgf (Fgf2), hereafter called NCC
medium. As shown in Fig. 2A, this supports initial survival of
Sox10-GFP-positive cells. However, 3 days after plating only 5%
of the cells retained Sox10-GFP expression (Fig. 2B), indicating
DEVELOPMENT
Fig. 2. Maintenance of Sox10-GFP-positive neural crest progenitor cells in vitro. (A) Sox10-GFP-positive S10G-S cells cultured in neural crest
cell (NCC) medium in the absence or presence of chick embryo extract (CEE) for 3 days. (B) Effect of cytokines on the maintenance of Sox10-GFPpositive cells. Sorted cells were cultured in NCC medium supplemented with the indicated combinations of cytokines for 3 days and analysed by
flow cytometry. Bars represent mean ± s.d. of triplicate assays on three different S10G-S clones. The frequency of GFP-positive cells in NCC medium
without any additive is ~5%, 3 days after plating. Student’s t-test was performed against untreated samples; *, P<0.05, with P-values greater than
0.05 shown. (C) Neuronal differentiation of purified Sox10-GFP-positive cells from S10G-S cells cultured in NCC medium containing noggin, Wnt3a,
Lif and Et-3 for 7 days and subsequent culture in serum-free N2B27 medium containing Bmp4 and Gdnf for 7 days. Cells were immunostained for
HuC/D and TuJ1. (D) Representative fluorescence images of injected E11.5 gut immunostained for DsRed and TuJ1. The boxed region is shown at
higher magnification beneath. White arrows indicate DsRed (red) and TuJ1 (green) double-positive cells. Nuclei are stained with DAPI (blue).
(E) Serial confocal images through a region of E11.5 gut graft. (F,G) Confocal images of E11.3 distal hindguts immunostained for DsRed (F) and
merged DsRed with HuC/D (G). Right-hand panels show control hindgut cultured without grafting. Scale bars: 200 mm in C; in D, 500 mm above,
100 mm below.
RESEARCH ARTICLE
relatively rapid differentiation. We examined candidate factors and
conditions for their ability to prolong the presence of Sox10-GFPpositive cells.
We found that the proportion of Sox10-GFP-expressing cells after
3 days was more than doubled in the presence of recombinant Wnt3a
(Fig. 2B). Lif had a more modest effect that was statistically
insignificant but observed in three independent experiments. We
observed no positive effect of Gdnf and found that the presence of
Bmp suppressed Sox10-GFP expression, consistent with its effect
in promoting peripheral neuron differentiation. Although the
combination of Bmp4 and Wnt3a has been reported to be beneficial
for the maintenance of primary neural crest cells (Kleber et al.,
2005), we found that addition of Bmp actually reduced the positive
response to Wnt3a. We therefore tested the Bmp antagonist noggin.
Alone noggin had no significant effect, but in combination with Lif
and Wnt3a it increased the proportion of Sox10-GFP-positive cells
to over 30% (Fig. 2B). We also found that endothelin 3 (Et-3; Edn3
– Mouse Genome Informatics), which is a supportive factor for
enteric nervous system precursors (Bondurand et al., 2006), had a
modest additive effect on the maintenance of Sox10-GFP cells (Fig.
2B). When Sox10-positive cells were cultured in NCC
supplemented with noggin, Wnt3a, Lif and Et-3 (NWLE), ~40% of
cells remained positive for GFP 3 days after plating. Upon
subsequent withdrawal of NWLE and treatment with Bmp4 and
Gdnf, these cells differentiated into neurons (Fig. 2C).
These results indicate that in combination with forced expression
of Sox10, NWLE enables short-term maintenance of Sox10expressing cells generated from ES cells, with retention of
neurogenic potential.
ES cell-derived Sox10-GFP-expressing neural crest
progenitors can colonise the enteric nervous
system
Grafting into cultured embryonic gut tube provides an assay
system for the potential to colonise the enteric nervous system
(Natarajan et al., 1999). In this system, the gut tissue maintains
overall structure and viability for at least 14 days, providing an
environment for introduced neural crest cells to migrate and
differentiate (Natarajan et al., 1999). To enable tracing of grafted
cells we introduced a constitutive CAG-DsRedT3 reporter into
S10G-S ES cells. Sox10-GFP-positive cells were generated from
the resultant S10G-SR ES cells and cultured in NWLE medium
for 7 days. The Sox10-GFP-positive cells were then repurified by
flow cytometry. After recovery overnight, cells were injected into
embryonic gut cultures. Colonisation and differentiation were
analysed 7 days later. Numerous DsRed-positive cells were
observed to have survived and migrated from the injection sites.
GFP expression from grafted cells was negligible, indicating
downregulation of Sox10. Immunostaining revealed TuJ1
reactivity in a proportion of the DsRed-positive cells that also
exhibited neuron-like morphologies (Fig. 2D,E and see Fig. S3 in
the supplementary material).
The relatively low frequency of neuronal differentiation from
donor cells might be due to competition from endogenous enteric
nervous system progenitors. Furthermore, the presence of abundant
host neurons might obscure a definitive contribution from grafted
cells. We therefore isolated gut tubes from slightly earlier embryos,
at E11.3, and separated the distal portion of the hindgut. Time-lapse
studies have established that the wave front of neural crest cells has
not reached the hindgut at this stage (Druckenbrod and Epstein,
2005). Consistent with this, we found that after culture for 5 days
these hindguts exhibited very few, or no, HuC/D (Elavl3/4)-positive
Development 137 (5)
cells (Fig. 2F). By contrast, following injection of Sox10-GFP cells,
we observed extensive DsRed expression throughout the tissue, with
many cells exhibiting HuC/D (Fig. 2G).
These data indicate that ES cell-derived Sox10-positive neural
crest progenitors are competent for extensive colonisation of the gut
tube and contribution to enteric neurogenesis.
Propagation of embryo-derived neural crest cells
To test whether the ES cell differentiation system is representative
of normal neural crest we compared neural crest precursors
prepared from S10G-S ES cells with cells harvested from the
developing embryo (Fig. 3A). We isolated Sox10-GFP-positive
primary neural crest cells from E10.5 chimaeric embryos made
with S10G ES cells. Importantly, these cells do not contain the
Sox10 transgene. After purification by flow cytometry, GFP+ cells
were cultured in NWLE medium for 5-7 days. We then analysed
the expression of a panel of neural crest markers by qRT-PCR
(Fig. 3B). With the exception of Sox9, which was noticeably
lower in the ES cell derivatives, these markers were comparable
between the two populations. This indicates that the ES cellderived population is similar to embryonic neural crest and further
suggests that forced expression of Sox10 does not induce any
major transcriptional dysregulation.
We then examined the effect of NWLE on the maintenance of
primary neural crest precursors. Sorted cells were plated with or
without NWLE in NCC medium. Without NWLE, cultures rapidly
became heterogeneous. Many of the cells acquired a flattened
morphology and lost expression of Sox10-GFP within 5 days (Fig.
3C). By contrast, in the presence of NWLE, the majority of cells
retained immature morphology and Sox10-GFP expression during
the initial 5-7 days in culture. However, 3 weeks after plating, flow
cytometry analysis revealed that the number of Sox10-GFP-positive
cells was reduced to 11% in NCC medium and was only modestly
higher, at 18%, in the presence of NWLE (data not shown). NWLE
medium is therefore beneficial for short-term maintenance of
Sox10-positive neural crest cells, but only partially suppresses
differentiation over the long term.
Sox10 selection facilitates expansion of neural
crest progenitors
A recurrent theme in stem cell biology is the paracrine influence of
differentiating progeny to promote further differentiation (Tada et al.,
2005). To eliminate the influence of differentiated cells in neural crest
progenitor cultures, we created a selectable Sox10 allele. We replaced
the Sox10 coding sequence with GFP-IRES-BLS (blasticidin
resistance). Gene targeting was confirmed by Southern blotting (see
Fig. S1 in the supplementary material). The targeted cell line (S10GB) contributed to term chimeras and yielded germline transmission,
confirming essential ES cell identity and integrity.
Chimeric embryos formed by morula aggregation with S10GB cells were dissociated and total cell populations cultured in
NWLE medium for 3 days in the presence or absence of
blasticidin. Over 70% of cells surviving in the presence of
blasticidin expressed GFP, showing effective selection of Sox10GFP-positive cells. We then purified Sox10-GFP-positive cells
from E10.5 chimeric embryos and cultured them in various
combinations of NWLE or CEE without blasticidin (Fig. 3D,E).
Three days after plating, the percentage of Sox10-GFP-positive
cells was less than 20% in CEE only, whereas the proportion was
greater than 70% in the presence of NWLE plus CEE.
Interestingly, ~95% of cells remained positive for Sox10-GFP in
the NWLE(+) and CEE(–) condition. However, cells did not
DEVELOPMENT
698
Propagation of enteric neural crest progenitors
RESEARCH ARTICLE
699
expand in this condition. By contrast, in the presence of NWLE
plus CEE, the number of Sox10-positive cells increased up to 10fold. Cryopreserved Sox10-positive cells can be recovered in this
medium. Furthermore, clonogenic expansion is possible (see
below). These results indicate that NWLE is crucial for
maintenance of Sox10-positive cells, whereas CEE supports their
multiplication.
Sox10-GFP-positive cells grown in NWLE medium plus
blasticidin differentiated into neurons when transferred to N2B27
medium supplemented with bFgf/Bmp4/Gdnf and in the absence of
blasticidin. Occasionally, adipocytes were observed in these
cultures. However, adipogenic differentiation was invariably lost
after the second passage (data not shown), whereas neurogenic and
gliogenic potential was retained.
DEVELOPMENT
Fig. 3. Culture of embryo-derived neural crest cells in the presence of noggin, Wnt3a, Lif and Et-3. (A) Flow cytometric purification of
neural crest cells from E10.5 S10G chimaera. (B) qRT-PCR analysis of marker mRNA expression in: S10G-S ES cells; Sox10-GFP-positive cells purified
from S10G-S embryoid bodies and cultured in NWLE for 5 days; Sox10-GFP-positive cells purified from E10.5 S10G chimaeras and cultured in NWLE
for 7 days. The highest level of expression of each gene was defined as 100%. Bars represent means from duplicate PCR reactions. (C) Phasecontrast and fluorescence images of chimaera-derived neural crest cells in NCC medium with or without NWLE for 5 days. (D-K) Expansion of
embryo-derived neural crest cells with blasticidin selection for Sox10 expression. (D,E) Proportion (D) and proliferative index (E) of Sox10-GFPpositive cells 6 days after purification from E10.5 S10G-B chimaeras. GFP-positive cells were detected by flow cytometry. Bars represent mean ± s.d.
of six independent wells. Proliferation index was determined by dividing the number of GFP-positive cells by the initial cell number plated. (F) Longterm culture and growth of Sox10-GFP-positive neural crest cells purified from chimeric embryos and cultured in NWLE with blasticidin. Bars
represent total number of cells at indicated days and passage number. The proportions of GFP-positive and -negative cells, as quantified by flow
cytometry, are shown by white and black boxes, respectively. (G) Metaphase spread from neural crest progenitor culture in NWLE plus blasticidin. (H)
Phase-contrast image of culture at passage 5 expanded for over one month. (I) Flow cytometry analysis of Sox10-GFP and c-Ret in cultured neural
crest cells in NWLE and 5 days after transfer to N2B27 with Bmp and Gdnf. (J,K) Neuronal and glial differentiation of neural crest cells after 8
passages (over 50 days) in NWLE. Cells were transferred to medium containing bFgf/Bmp4/Gdnf for 5 days then fixed and immunostained for
HuC/D, TuJ1 and Gfap. Scale bars: 200 mm in H,J; 100 mm in K.
700
RESEARCH ARTICLE
Development 137 (5)
Fig. 4. Clonal expansion and
differentiation of Sox10-positive neural
crest progenitors. (A) Colony derived from
expansion of a single Sox10-GFP-positive
cell purified by flow cytometry from E10.5
S10G-B chimaera. Cells were cultured in
NWLE medium for 30 days with periodic
blasticidin selection. (B) Phase-contrast and
immunofluorescent images of clonal culture
after transfer to adherent culture in (left to
right) NWLE medium, bFgf/Bmp4/Gdnf, or
TGFb3. Scale bars: 200 mm in left-hand
panels; 500 mm in centre and right-hand
panels.
Clonal analysis of Sox10-GFP-positive cells in
NWLE medium
Limiting dilution analysis indicated that the cloning efficiency of
Sox10-positive cells acutely isolated from E10.5 chimeric embryos
was ~2% in medium supplemented with CEE/NWLE in 5% oxygen
(data not shown). After flow cytometry with single-cell deposition,
three colonies grew up from 96 wells, consistent with the limiting
dilution study. These colonies were initially adherent (Fig. 4A), but
eventually detached and grew as aggregates in suspension,
remaining GFP positive. After culturing for 30 days, the aggregates
were dissociated, replated on fibronectin/poly-L-ornithine-coated
dishes and cultured in various conditions. They exhibited the typical
undifferentiated morphology of neural crest precursors in NWLE
medium, differentiated into neurons in the presence of Bmp4/Gdnf,
and gave SMA-positive cells with spread morphology in the
presence of TGFb3 (Fig. 4B).
Grafting of cultured neural crest cells into foetal
gut cultures
Traceable S10G-B cells were generated by stable transfection with
CAG-DsRedT3. These S10G-BR ES cells yielded DsRed
expression throughout chimaeric embryos after morula aggregation,
while GFP was confined to neural crest cells. Double-positive cells
were purified by flow cytometry and grown in NWLE medium in
adherent culture for various periods. Cells were then introduced into
cultured embryonic gut at the level of either intestine or caecum.
Generation of neurons in the foetal gut cultures was detected by
TuJ1 staining of DsRed-positive cells after culture in NWLE
medium for 7 or 30 days (Fig. 5A,B).
Single-cell suspensions are difficult to graft in a controlled
manner and many cells are lost through dispersion. We therefore also
examined grafting of aggregates and pretreated these with Bmp4 and
Gdnf to encourage neuronal commitment. After expansion in
adherent culture for 4 days in NWLE, aggregates were formed by
suspension culture for 2 days in N2B27 supplemented with
bFgf/Bmp4/Gdnf (Fig. 5C). In vitro attachment and outgrowth from
these aggregates yielded abundant neurons immunopositive for cRet, neuropeptide Y (Npy), vasoactive intestinal peptide (Vip) and
tyrosine hydroxylase (Th) (Fig. 5D). These neurons retained
expression of visible levels of DsRed. We then grafted aggregates
into the stomach wall and intestine of gut tubes isolated from E11.5
embryos. Fig. 5E shows migration of the grafted cells and extension
of axons from the centre of grafting. Seven days after grafting,
specimens were fixed and stained with anti-DsRed and TuJ1
antibodies. DsRed-positive cells were detected away from the graft
site and intermingled with the enteric neuronal network. Some of the
donor cells acquired neuron-like morphology and stained for TuJ1
(Fig. 5F).
Finally, we injected suspension cells into the distal portion of
E11.3 hindgut. Similar to results using ES cell-derived Sox10positive cells (Fig. 2F), embryo-derived Sox10-positive cells
cultured in NWLE medium for 12 days before injection migrated
throughout the tissue. They differentiated to produce a striking
network of interconnected processes within 5 days (Fig. 5G). Many
of the DsRed-positive donor-derived cells were immunopositive for
the neuronal markers HuC/D and TuJ1 (Fig. 5H,I). Similar results
were obtained with frozen and thawed Sox10-positive cells.
We conclude that neural crest progenitor cells with a capacity for
extensive enteric neurogenesis can be expanded as relatively pure
adherent populations using NWLE with Sox10 selection.
DISCUSSION
To date, efforts to understand and control the commitment of
pluripotent stem cells into embryonic progenitors have largely
overlooked the neural crest. Here, we have confirmed that authentic
neural crest progenitor cells can be generated from mouse ES cells
in vitro. We show that Sox10-expressing cells with molecular
features of neural crest are produced in embryoid bodies treated with
RA. Retinoic acid has previously been shown to suppress mesoderm
formation (Kawaguchi et al., 2005) and promote neuroectodermal
fate (Aubert et al., 2002; Bain et al., 1995). Sox10 is induced within
24 hours of exposure to RA, but only in ~1% of cells. This frequency
DEVELOPMENT
We attempted to culture embryo-derived neural crest cells in
adherent conditions under low oxygen tension (Morrison et al., 2000)
with continuous blasticidin selection. Under selection, cells expanded
continuously and the percentage of Sox10-GFP-positive cells
remained ~90% or more over multiple passages (Fig. 3F). Over a 2week period, the total number of Sox10-GFP-positive cells increased
more than 10-fold. They retained a diploid chromosome complement
(Fig. 3G; see Fig. S4 in the supplementary material). The Sox10-GFPpositive cells exhibited relatively immature morphology (Fig. 3H) and
were c-Ret low or negative (Fig. 3I). If medium was switched from
CEE/NWLE to N2B27 containing Bmp4 and Gdnf, the majority of
cells shifted into a Sox10-GFP-negative and c-Ret-high population
preceding overt differentiation of neurons and glia (Fig. 3J,K).
Propagation of enteric neural crest progenitors
RESEARCH ARTICLE
701
doubles in response to Fgf8b plus Lif. Fgf8 has been identified as a
neural crest inducer in Xenopus (Monsoro-Burq et al., 2003). We
found no positive effect of Wnt or Bmp, which are implicated in
embryonic neural crest induction at the neural border (Garcia-Castro
et al., 2002; Marchant et al., 1998). This might be because the
embryoid bodies produce antagonists, such as the Wnt-binding
protein Sfrp2 (Aubert et al., 2002). Unfortunately, our attempts to
develop an adherent culture system for neural crest commitment, as
achieved for other germ layers (Nishikawa et al., 1998; Tada et al.,
2005; Ying et al., 2003b), have so far proved unsuccessful for neural
crest. This remains an important challenge for future studies.
Class E Sox factors are implicated in the specification of
definitive neural crest in the embryo (Sauka-Spengler and BronnerFraser, 2008). Consistent with this, we found that forced expression
of Sox10 significantly enhanced the yield of neural crest progenitors
from the embryoid body differentiation system. This kick-start to
neural crest commitment appears to bypass the embryonic sequence
in which Sox9 expression precedes that of Sox10. This effect is
unlikely to be due simply to autoregulation because although a small
fraction of GFP-positive cells was apparent in ES cell culture
conditions, aggregation and retinoic acid treatment induced a
significant increase. Furthermore, the GFP-positive population is
only transiently induced. This transience emphasizes the
vulnerability of nascent neural crest to the cellular environment. The
ability to generate consistently ~10% Sox10-GFP-positive cells via
forced expression of Sox10 allowed routine isolation and analysis
of this population. A potential drawback of this strategy is that
constitutive expression of Sox10 can suppress neuronal
differentiation (Bondurand et al., 2006; Kim et al., 2003). Indeed,
using a doxycycline-regulatable Sox10 transgene we find that the
DEVELOPMENT
Fig. 5. Grafting of culture-expanded
embryo-derived neural crest cells into
foetal gut ex vivo. (A,B) Immunostaining
for DsRed and TuJ1 of guts grafted with
Sox10-positive cells after culture in NWLE
medium for 7 (A) or 30 (B) days. Righthand images are confocal sections.
(C) Aggregate formation from neural crest
cells cultured in the presence of
Bmp4/Gdnf. Merge of phase-contrast and
fluorescence (DsRed) images.
(D) Immunostaining for DsRed, HuC/D,
c-Ret, Npy, Vip and Th in TuJ1-positive
neurons differentiated in vitro from
aggregates shown in C. (E) Migration of
neural crest cells and extension of axonlike structure from grafted aggregate after
24 hours. Merged phase-contrast and
fluorescence images. (F) Immunostaining
for TuJ1 and DsRed showing contribution
of grafted neural crest aggregate after
9 days. The boxed region is shown at
higher magnification beneath. Arrows
indicate DsRed (red) and TuJ1 (green)
double-positive cells. (G-I) Immunostaining
of neuronal network formed in the distal
hindgut by grafted cells. Embryo-derived
Sox10-GFP cells were cultured for 12 days
in NWLE medium prior to grafting. Shown
are a confocal image of DsRed
immunostaining (G), a merged image of
DsRed and TuJ1 immunostaining (H), and
a high-magnification image of TuJ1 and
HuC/D immunostaining (I). Scale bars: 100
mm in A,B; 200 mm in C,E; in D, 100 mm
left and middle, 200 mm right; in F, 200
mm above, 100 mm below.
RESEARCH ARTICLE
frequency of neuronal differentiation is increased if the transgene is
repressed after isolation of Sox10-GFP-positive cells (data not
shown).
The consistent production of Sox10-GFP cells by ES cell
differentiation enabled us to determine conditions for the
maintenance of undifferentiated progenitors. Fgf, Egf and CEE did
not sustain appreciable numbers of Sox10-positive cells for more
than a few days, but by empirical trial we found additive effects of
noggin, Wnt, Lif and Et-3 (NWLE). Importantly, the maintenance
of Sox10 expression in these conditions is neither specific to ES cell
differentiation, nor dependent on Sox10 transgene expression, as
neural crest precursors isolated from E10.5 chimaeric embryos
responded similarly. The requirement for noggin can be rationalised
as antagonising the differentiation-inducing effects of Bmp, whereas
Wnt3 has been shown to contribute to neural crest cell progenitor
maintenance (Kleber et al., 2005). A role for Lif or other gp130
cytokines in neural crest progenitors has not previously been
described and it would be of interest to evaluate the pleiotropic
developmental phenotypes of Lif receptor and gp130 mutants from
this perspective (Li et al., 1995; Ware et al., 1995; Yoshida et al.,
1996). Endothelins have been implicated in a variety of
physiopathologies and diseases such as pulmonary hypertension,
renal disease, diabetes and cancer (Barton and Yanagisawa, 2008).
Et-3 is expressed in endothelial cells, neurons, renal tubular
epithelial cells and intestinal epithelial cells. Gene targeting and
natural mutations in mice have revealed a crucial requirement for
Et-3 and the endothelin-B receptor in development of the enteric
nervous system (Baynash et al., 1994; Gershon, 1995; Hosoda et al.,
1994; Puffenberger et al., 1994). Subsequent studies showed that Et3 affects the survival, proliferation and migration of enteric nervous
system progenitor cells (Barlow et al., 2003; Lahav et al., 1998; Shin
et al., 1999; Taraviras et al., 1999), and mutations in the Et-3
receptor gene EDNRB cause Hirschsprung’s disease (Heanue and
Pachnis, 2007). Et-3 has been reported to enhance the maintenance
of enteric nervous system progenitors in sphere cultures (Bondurand
et al., 2006), but is not known at what stage neural crest cells first
become responsive to Et-3.
Even in NWLE, however, a pure Sox10-GFP-expressing
population could not be expanded and cultures were overtaken by
differentiation. Opportunity remains, therefore, to improve this
culture system and better define the requirements of the neural crest
progenitors. For the present study, we adopted a selection approach
and found that ablation of differentiating cells dramatically
improves the expansion of Sox10-expressing progenitors, enabling
both clonal proliferation and continuous multiplication for over 50
days. It is important to emphasize that this result was obtained
without forced expression of Sox10. Indeed, we used Sox10heterozygous cells, which could even have reduced self-renewal
capabilities. Although heterozygosity for Sox10 does not cause any
major perturbation of neural crest development and pups are viable,
migration into the caudal hindgut appears delayed (see Fig. S5 in
the supplementary material), which is indicative of partial
haploinsufficiency. Nonetheless, NWLE-expanded Sox10-GFPexpressing cells were competent for neuronal differentiation in vitro
and able to differentiate in the enteric network when introduced into
foetal gut cultures. Their potency is confirmed by robust
colonisation of the E11.3 hindgut, which was isolated prior to
colonisation by endogenous neural crest progenitors. This
modification of the established foetal gut graft protocol (Natarajan
et al., 1999) provides a convenient assay system and might be
useful for modelling cell therapy approaches to Hirschsprung’s
disease.
Development 137 (5)
Neural crest development may proceed through a succession of
increasingly restricted progenitors (Crane and Trainor, 2006). Future
studies will address whether NWLE selects for, or induces,
progression to restricted enteric nervous system progenitor cells, or
is sufficient to maintain broader neural crest potency. The loss of
adipogenic differentiation after initial passages is suggestive of
lineage segregation, although more detailed studies are required to
establish this definitively and to determine whether any loss of
potency can be modulated by extrinsic cues.
Further opportunities afforded by the Sox10-GFP reporter/
selection system include screening for additional neural crest
commitment signals and factors, and identification of cell surface
markers for purification of precursors without genetic manipulation.
Such studies might facilitate the harvesting of neural crest
progenitors from human embryo-derived or induced pluripotent
stem cells. It will also be of interest to determine whether the NWLE
culture system can be applied to enteric nervous system progenitors
isolated from human gut, which could have potential for therapeutic
application in Hirschsprung’s disease.
Acknowledgements
We thank Carmen Birchmeier, Vassilis Pachnis, Dipa Natarajan, Hideki
Enomoto and Val Wilson for advice, discussion and provision of materials;
Hitoshi Niwa for support; David Anderson for generously providing Sox10
and c-Ret antibodies; Christo Goridis for the Phox2b antibody; Rachael
Walker, Nigel Miller and Jan Vrana for flow cytometric sorting; William
Mansfield, Ken Jones and Mary Chol for chimaera production; and Sameera
Patel for genotyping. This research was supported by the Biotechnology and
Biological Sciences Research Council, the Medical Research Council, the
Wellcome Trust and the European Commission Project EuroStemCell. A.S. is
a Medical Research Council Professor. Deposited in PMC for release after
6 months.
Competing interests statement
The authors declare no competing financial interests.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/lookup/suppl/doi:10.1242/dev.046896/-/DC1
References
Aubert, J., Dunstan, H., Chambers, I. and Smith, A. (2002). Functional gene
screening in embryonic stem cells implicates Wnt antagonism in neural
differentiation. Nat. Biotechnol. 20, 1240-1245.
Bain, G., Kitchens, D., Yao, M., Huettner, J. E. and Gottlieb, D. I. (1995).
Embryonic stem cells express neuronal properties in vitro. Dev. Biol. 168, 342357.
Barlow, A., de Graaff, E. and Pachnis, V. (2003). Enteric nervous system
progenitors are coordinately controlled by the G protein-coupled receptor
EDNRB and the receptor tyrosine kinase RET. Neuron 40, 905-916.
Barton, M. and Yanagisawa, M. (2008). Endothelin: 20 years from discovery to
therapy. Can. J. Physiol. Pharmacol. 86, 485-498.
Basch, M. L., Bronner-Fraser, M. and Garcia-Castro, M. I. (2006). Specification
of the neural crest occurs during gastrulation and requires Pax7. Nature 441,
218-222.
Baynash, A. G., Hosoda, K., Giaid, A., Richardson, J. A., Emoto, N., Hammer,
R. E. and Yanagisawa, M. (1994). Interaction of endothelin-3 with endothelinB receptor is essential for development of epidermal melanocytes and enteric
neurons. Cell 79, 1277-1285.
Billon, N., Iannarelli, P., Monteiro, M. C., Glavieux-Pardanaud, C.,
Richardson, W. D., Kessaris, N., Dani, C. and Dupin, E. (2007). The
generation of adipocytes by the neural crest. Development 134, 2283-2292.
Bondurand, N., Natarajan, D., Thapar, N., Atkins, C. and Pachnis, V. (2003).
Neuron and glia generating progenitors of the mammalian enteric nervous
system isolated from foetal and postnatal gut cultures. Development 130, 63876400.
Bondurand, N., Natarajan, D., Barlow, A., Thapar, N. and Pachnis, V. (2006).
Maintenance of mammalian enteric nervous system progenitors by SOX10 and
endothelin 3 signalling. Development 133, 2075-2086.
Britsch, S., Goerich, D. E., Riethmacher, D., Peirano, R. I., Rossner, M.,
Nave, K. A., Birchmeier, C. and Wegner, M. (2001). The transcription factor
Sox10 is a key regulator of peripheral glial development. Genes Dev. 15, 6678.
DEVELOPMENT
702
Chambers, I., Colby, D., Robertson, M., Nichols, J., Lee, S., Tweedie, S. and
Smith, A. (2003). Functional expression cloning of Nanog, a pluripotency
sustaining factor in embryonic stem cells. Cell 113, 643-655.
Conti, L., Pollard, S. M., Gorba, T., Reitano, E., Toselli, M., Biella, G., Sun, Y.,
Sanzone, S., Ying, Q. L., Cattaneo, E. et al. (2005). Niche-independent
symmetrical self-renewal of a mammalian tissue stem cell. PLoS Biol. 3, e283.
Crane, J. F. and Trainor, P. A. (2006). Neural crest stem and progenitor cells.
Annu. Rev. Cell Dev. Biol. 22, 267-286.
Druckenbrod, N. R. and Epstein, M. L. (2005). The pattern of neural crest
advance in the cecum and colon. Dev. Biol. 287, 125-133.
Fernandes, K. J., McKenzie, I. A., Mill, P., Smith, K. M., Akhavan, M.,
Barnabe-Heider, F., Biernaskie, J., Junek, A., Kobayashi, N. R., Toma, J. G.
et al. (2004). A dermal niche for multipotent adult skin-derived precursor cells.
Nat. Cell Biol. 6, 1082-1093.
Garcia-Castro, M. I., Marcelle, C. and Bronner-Fraser, M. (2002). Ectodermal
Wnt function as a neural crest inducer. Science 297, 848-851.
Gershon, M. D. (1995). Neural crest development. Do developing enteric neurons
need endothelins? Curr. Biol. 5, 601-604.
Gershon, M. D. (1997). Genes and lineages in the formation of the enteric
nervous system. Curr. Opin. Neurobiol. 7, 101-109.
Heanue, T. A. and Pachnis, V. (2007). Enteric nervous system development and
Hirschsprung’s disease: advances in genetic and stem cell studies. Nat. Rev.
Neurosci. 8, 466-479.
Hogan, B., Beddington, R., Costantini, F. and Lacy, E. (1994). Manipulating the
Mouse Embryo: a Laboratory Manual. Cold Spring Harbor, New York: Cold
Spring Harbor Laboratory Press.
Hosoda, K., Hammer, R. E., Richardson, J. A., Baynash, A. G., Cheung, J. C.,
Giaid, A. and Yanagisawa, M. (1994). Targeted and natural (piebald-lethal)
mutations of endothelin-B receptor gene produce megacolon associated with
spotted coat color in mice. Cell 79, 1267-1276.
Huang, X. and Saint-Jeannet, J. P. (2004). Induction of the neural crest and the
opportunities of life on the edge. Dev. Biol. 275, 1-11.
Jiang, X., Gwye, Y., McKeown, S. J., Bronner-Fraser, M., Lutzko, C. and
Lawlor, E. R. (2009). Isolation and characterization of neural crest stem cells
derived from in vitro-differentiated human embryonic stem cells. Stem Cells Dev.
18, 1059-1070.
Kawaguchi, J., Mee, P. J. and Smith, A. G. (2005). Osteogenic and
chondrogenic differentiation of embryonic stem cells in response to specific
growth factors. Bone 36, 758-769.
Keller, G. M. (1995). In vitro differentiation of embryonic stem cells. Curr. Opin.
Cell Biol. 7, 862-869.
Keller, G. (2005). Embryonic stem cell differentiation: emergence of a new era in
biology and medicine. Genes Dev. 19, 1129-1155.
Kim, J., Lo, L., Dormand, E. and Anderson, D. J. (2003). SOX10 maintains
multipotency and inhibits neuronal differentiation of neural crest stem cells.
Neuron 38, 17-31.
Kleber, M., Lee, H. Y., Wurdak, H., Buchstaller, J., Riccomagno, M. M., Ittner,
L. M., Suter, U., Epstein, D. J. and Sommer, L. (2005). Neural crest stem cell
maintenance by combinatorial Wnt and BMP signaling. J. Cell Biol. 169, 309-320.
Kruger, G. M., Mosher, J. T., Bixby, S., Joseph, N., Iwashita, T. and Morrison,
S. J. (2002). Neural crest stem cells persist in the adult gut but undergo changes
in self-renewal, neuronal subtype potential, and factor responsiveness. Neuron
35, 657-669.
Lahav, R., Dupin, E., Lecoin, L., Glavieux, C., Champeval, D., Ziller, C. and Le
Douarin, N. M. (1998). Endothelin 3 selectively promotes survival and
proliferation of neural crest-derived glial and melanocytic precursors in vitro.
Proc. Natl. Acad. Sci. USA 95, 14214-14219.
Le Douarin, N. M. (2004). The avian embryo as a model to study the
development of the neural crest: a long and still ongoing story. Mech. Dev. 121,
1089-1102.
Le Douarin, N. M. and Dupin, E. (2003). Multipotentiality of the neural crest.
Curr. Opin. Genet. Dev. 13, 529-536.
Le Douarin, N. M., Creuzet, S., Couly, G. and Dupin, E. (2004). Neural crest cell
plasticity and its limits. Development 131, 4637-4650.
Lee, G., Kim, H., Elkabetz, Y., Al Shamy, G., Panagiotakos, G., Barberi, T.,
Tabar, V. and Studer, L. (2007). Isolation and directed differentiation of neural
crest stem cells derived from human embryonic stem cells. Nat. Biotechnol. 25,
1468-1475.
Li, M., Sendtner, M. and Smith, A. (1995). Essential function of LIF receptor in
motor neurons. Nature 378, 724-727.
Marchant, L., Linker, C., Ruiz, P., Guerrero, N. and Mayor, R. (1998). The
inductive properties of mesoderm suggest that the neural crest cells are specified
by a BMP gradient. Dev. Biol. 198, 319-329.
Meulemans, D. and Bronner-Fraser, M. (2004). Gene-regulatory interactions in
neural crest evolution and development. Dev. Cell 7, 291-299.
Mizuseki, K., Sakamoto, T., Watanabe, K., Muguruma, K., Ikeya, M.,
Nishiyama, A., Arakawa, A., Suemori, H., Nakatsuji, N., Kawasaki, H. et
al. (2003). Generation of neural crest-derived peripheral neurons and floor plate
cells from mouse and primate embryonic stem cells. Proc. Natl. Acad. Sci. USA
100, 5828-5833.
RESEARCH ARTICLE
703
Monsoro-Burq, A. H., Fletcher, R. B. and Harland, R. M. (2003). Neural crest
induction by paraxial mesoderm in Xenopus embryos requires FGF signals.
Development 130, 3111-3124.
Moretti, A., Caron, L., Nakano, A., Lam, J. T., Bernshausen, A., Chen, Y.,
Qyang, Y., Bu, L., Sasaki, M., Martin-Puig, S. et al. (2006). Multipotent
embryonic isl1+ progenitor cells lead to cardiac, smooth muscle, and endothelial
cell diversification. Cell 127, 1151-1165.
Morrison, S. J., Csete, M., Groves, A. K., Melega, W., Wold, B. and
Anderson, D. J. (2000). Culture in reduced levels of oxygen promotes
clonogenic sympathoadrenal differentiation by isolated neural crest stem cells. J.
Neurosci. 20, 7370-7376.
Motohashi, T., Aoki, H., Chiba, K., Yoshimura, N. and Kunisada, T. (2007).
Multipotent cell fate of neural crest-like cells derived from embryonic stem cells.
Stem Cells 25, 402-410.
Nakashima, K., Yanagisawa, M., Arakawa, H., Kimura, N., Hisatsune, T.,
Kawabata, M., Miyazono, K. and Taga, T. (1999). Synergistic signaling in
fetal brain by STAT3-Smad1 complex bridged by p300. Science 284, 479-482.
Natarajan, D., Grigoriou, M., Marcos-Gutierrez, C. V., Atkins, C. and Pachnis,
V. (1999). Multipotential progenitors of the mammalian enteric nervous system
capable of colonising aganglionic bowel in organ culture. Development 126,
157-168.
Nishikawa, S. I., Nishikawa, S., Hirashima, M., Matsuyoshi, N. and Kodama,
H. (1998). Progressive lineage analysis by cell sorting and culture identifies
FLK1+ VE-cadherin+ cells at a diverging point of endothelial and hemopoietic
lineages. Development 125, 1747-1757.
Nishimura, E. K., Jordan, S. A., Oshima, H., Yoshida, H., Osawa, M.,
Moriyama, M., Jackson, I. J., Barrandon, Y., Miyachi, Y. and Nishikawa, S.
(2002). Dominant role of the niche in melanocyte stem-cell fate determination.
Nature 416, 854-860.
Pardal, R., Ortega-Saenz, P., Duran, R. and Lopez-Barneo, J. (2007). Glia-like
stem cells sustain physiologic neurogenesis in the adult mammalian carotid
body. Cell 131, 364-377.
Pomp, O., Brokhman, I., Ben-Dor, I., Reubinoff, B. and Goldstein, R. S.
(2005). Generation of peripheral sensory and sympathetic neurons and neural
crest cells from human embryonic stem cells. Stem Cells 23, 923-930.
Pomp, O., Brokhman, I., Ziegler, L., Almog, M., Korngreen, A., Tavian, M.
and Goldstein, R. S. (2008). PA6-induced human embryonic stem cell-derived
neurospheres: a new source of human peripheral sensory neurons and neural
crest cells. Brain Res. 1230, 50-60.
Puffenberger, E. G., Hosoda, K., Washington, S. S., Nakao, K., deWit, D.,
Yanagisawa, M. and Chakravart, A. (1994). A missense mutation of the
endothelin-B receptor gene in multigenic Hirschsprung’s disease. Cell 79, 12571266.
Sauka-Spengler, T. and Bronner-Fraser, M. (2008). A gene regulatory network
orchestrates neural crest formation. Nat. Rev. Mol. Cell Biol. 9, 557-568.
Shah, N. M., Groves, A. K. and Anderson, D. J. (1996). Alternative neural crest
cell fates are instructively promoted by TGFbeta superfamily members. Cell 85,
331-343.
Shin, M. K., Levorse, J. M., Ingram, R. S. and Tilghman, S. M. (1999). The
temporal requirement for endothelin receptor-B signalling during neural crest
development. Nature 402, 496-501.
Sieber-Blum, M., Grim, M., Hu, Y. F. and Szeder, V. (2004). Pluripotent neural
crest stem cells in the adult hair follicle. Dev. Dyn. 231, 258-269.
Smith, A. G. (1991). Culture and differentiation of embryonic stem cells. J. Tiss.
Cult. Meth. 13, 89-94.
Smith, A. G. (2001). Embryo-derived stem cells: of mice and men. Ann. Rev. Cell
Dev. Biol. 17, 435-462.
Stemple, D. L. and Anderson, D. J. (1992). Isolation of a stem cell for neurons
and glia from the mammalian neural crest. Cell 71, 973-985.
Tada, S., Era, T., Furusawa, C., Sakurai, H., Nishikawa, S., Kinoshita, M.,
Nakao, K., Chiba, T. and Nishikawa, S. (2005). Characterization of
mesendoderm: a diverging point of the definitive endoderm and mesoderm in
embryonic stem cell differentiation culture. Development 132, 4363-4374.
Takashima, Y., Era, T., Nakao, K., Kondo, S., Kasuga, M., Smith, A. G. and
Nishikawa, S. (2007). Neuroepithelial cells supply an initial transient wave of
MSC differentiation. Cell 129, 1377-1388.
Taraviras, S., Marcos-Gutierrez, C. V., Durbec, P., Jani, H., Grigoriou, M.,
Sukumaran, M., Wang, L. C., Hynes, M., Raisman, G. and Pachnis, V.
(1999). Signalling by the RET receptor tyrosine kinase and its role in the
development of the mammalian enteric nervous system. Development 126,
2785-2797.
Ware, C. B., Horowitz, M. C., Renshaw, B. R., Hunt, J. S., Liggit, D., Koblar, S.
A., Gliniak, B. C., McKenna, H. J., Papayannopoulou, T., Thoma, B. et al.
(1995). Targeted disruption of the low-affinity leukemia inhibitory factor
receptor gene causes placental, skeletal, neural and metabolic defects and
results in perinatal death. Development 121, 1283-1299.
Wong, C. E., Paratore, C., Dours-Zimmermann, M. T., Rochat, A., Pietri, T.,
Suter, U., Zimmermann, D. R., Dufour, S., Thiery, J. P., Meijer, D. et al.
(2006). Neural crest-derived cells with stem cell features can be traced back to
multiple lineages in the adult skin. J. Cell Biol. 175, 1005-1015.
DEVELOPMENT
Propagation of enteric neural crest progenitors
RESEARCH ARTICLE
Yamashita, J., Itoh, H., Hirashima, M., Ogawa, M., Nishikawa, S., Yurugi, T.,
Naito, M. and Nakao, K. (2000). Flk1-positive cells derived from embryonic
stem cells serve as vascular progenitors. Nature 408, 92-96.
Ying, Q. L. and Smith, A. G. (2003). Defined conditions for neural commitment
and differentiation. Methods Enzymol. 365, 327-341.
Ying, Q. L., Nichols, J., Chambers, I. and Smith, A. (2003a). BMP induction of
Id proteins suppresses differentiation and sustains embryonic stem cell selfrenewal in collaboration with STAT3. Cell 115, 281-292.
Development 137 (5)
Ying, Q. L., Stavridis, M., Griffiths, D., Li, M. and Smith, A. (2003b).
Conversion of embryonic stem cells into neuroectodermal precursors in adherent
monoculture. Nat. Biotechnol. 21, 183-186.
Yoshida, K., Taga, T., Saito, M., Suematsu, S., Kumanogoh, A., Tanaka, T.,
Fujiwara, H., Hirata, M., Yamagami, T., Nakahata, T. et al. (1996). Targeted
disruption of gp130, a common signal transducer for the interleukin 6 family of
cytokines, leads to myocardial and hematological disorders. Proc. Natl. Acad. Sci.
USA 93, 407-411.
DEVELOPMENT
704