RESEARCH ARTICLE
651
Development 137, 651-660 (2010) doi:10.1242/dev.038554
© 2010. Published by The Company of Biologists Ltd
Repression of zygotic gene expression in the Xenopus
germline
Thiagarajan Venkatarama, Fangfang Lai*, Xueting Luo*, Yi Zhou, Karen Newman and Mary Lou King†
SUMMARY
Primordial germ cells (PGCs) in Xenopus are specified through the inheritance of germ plasm. During gastrulation, PGCs remain
totipotent while surrounding cells in the vegetal mass become committed to endoderm through the action of the vegetal localized
maternal transcription factor VegT. We find that although PGCs contain maternal VegT RNA, they do not express its downstream
targets at the mid-blastula transition (MBT). Transcriptional repression in PGCs correlates with the failure to phosphorylate serine 2
in the carboxy-terminal domain (CTD) of the large subunit of RNA polymerase II (RNAPII). As serine 5 is phosphorylated, these
results are consistent with a block after the initiation step but before the elongation step of RNAPII-based transcription. Repression
of PGC gene expression occurs despite an apparently permissive chromatin environment. Phosphorylation of CTD-serine 2 and
expression of zygotic mRNAs in PGCs are first detected at neurula, some 10 hours after MBT, indicating that transcription is
significantly delayed in the germ cell lineage. Significantly, Oct-91, a POU subclass V transcription factor related to mammalian
Oct3/4, is among the earliest zygotic transcripts detected in PGCs and is a likely mediator of pluripotency. Our findings suggest that
PGCs are unable to respond to maternally inherited endoderm determinants because RNAPII activity is transiently blocked while
these determinants are present. Our results in a vertebrate system further support the concept that one strategy used repeatedly
during evolution for preserving the germline is RNAPII repression.
INTRODUCTION
Specification of both the germline and somatic cell lineages is
established quite early in Xenopus through the inheritance of specific
maternal RNAs that localize to the vegetal pole during oogenesis.
Germline RNAs and proteins are found in germ plasm, a
cytoplasmic domain exclusive to germ cells that becomes deposited
within the oocyte vegetal cortex. In the early embryo, germ plasm
passes asymmetrically to one daughter cell of mitotic pairs, yielding
a small number of germ plasm bearing blastomeres. Only cells
receiving sufficient amounts of germ plasm will remain totipotent
and give rise to primordial germ cells (PGCs), the future gametes of
the organism (reviewed by Houston and King, 2000). The other
blastomeres are fated to become endoderm through the action of the
maternal transcription factor VegT, which is also localized to the
vegetal cortex (Zhang et al., 1998; Casey et al., 1999; Xanthos et al.,
2001). Commitment to an endoderm fate occurs by early gastrula
stage, as shown in single cell transplantation assays (Wylie et al.,
1987). Thus, both the future germline and the endodermal lineage
originate from a common vegetal cytoplasm. An important question
is, how does the presence of germ plasm promote totipotency and
prevent an endodermal fate in PGCs?
In Drosophila and Caenorhabditis elegans, global repression of
mRNA transcription is one mechanism that prevents the germ cell
lineage from responding to regional signals specifying somatic fates
(Seydoux et al., 1996; Van Doren et al., 1998; Strome and Lehmann,
2007; Timinszky et al., 2008). In the germline of both these
Department of Cell Biology and Anatomy, University of Miami School of Medicine,
1011 NW 15th Street, Miami, FL 33136, USA.
*These authors contributed equally to this work
†
Author for correspondence ([email protected])
Accepted 7 December 2009
invertebrate model systems, RNA polymerase II (RNAPII) activity
is temporarily blocked through regulating the phosphorylated state
of the heptapeptide repeat YSPTSPS (>40 tandem copies) found in
the carboxy-terminal domain (CTD). During a normal round of
transcription, unphosphorylated RNAPII is recruited to promoters
where, within the initiation complex, each CTD-serine 5 is
phosphorylated (P-Ser5) by the cyclin-dependent kinase CDK7 (for
reviews, see Bensaude et al., 1999; Price, 2000; Phatnani and
Greenleaf, 2006). Initiation is followed by an elongation step that
requires the phosphorylation of serine 2 (P-Ser2) by the cyclindependent kinase CDK9. Thus, specific serine phosphorylation
events have been correlated with transcriptional initiation and
elongation events. Recycling of RNAPII for additional rounds of
transcription requires the action of CTD-phosphatases, another
potential point of regulation (Cho et al., 1999). In Drosophila and C.
elegans, specific monoclonal antibodies directed at P-Ser5 and PSer2 revealed that expression is very low or missing in the germline,
in sharp contrast to the neighboring somatic cells (Seydoux and
Dunn, 1997; Deshpande et al., 1999; Deshpande et al., 2005; Ghosh
and Seydoux, 2008).
Germline transcriptional repression in C. elegans requires OMA1/OMA-2 very early (Guven-Ozkan et al., 2008) and PIE-1 later
(Seydoux et al., 1996). Recent evidence indicates that OMA1/OMA-2 retains TAF-4 (TATA-binding protein associated factor 4)
in the cytoplasm (Guven-Ozkan et al., 2008) and that PIE-1
completely inhibits CDK7 and partially blocks CDK9 activity,
which suggests that both initiation and elongation steps are targets
for repression. Interestingly, however, it is the repression of CDK7
that is essential for transcriptional repression and germ line
specification in vivo (Ghosh and Seydoux, 2008). In Drosophila,
polar granule component (pgc) is essential for repressing CTD-Ser2
phosphorylation, and in pgc-null mutants pole cells eventually
degenerate before reaching the gonad (Hanyu-Nakamura et al.,
2008; Timinszky et al., 2008). Polar Granule Component was shown
DEVELOPMENT
KEY WORDS: Xenopus, Oogenesis, Germline determination, Germ plasm, Transcriptional repression, Pol II
RESEARCH ARTICLE
to directly interact with CDK9 but not CDK7, and to somehow
prevent CDK9 from being recruited to transcription sites (HanyuNakamura et al., 2008). Neither PIE-1 nor Polar Granule
Component have homologs in any other species, suggesting that
although general mechanisms are conserved between these two
systems, the effector molecules may not be (reviewed by Strome and
Lehmann, 2007).
Transcriptional repression in germ line precursor cells has also
been observed in the ascidian Halocynthia roretzi, a simple chordate
(Tomioka et al., 2002). The mammalian germline might also use
global transcriptional repression as a strategy to protect PGC identity
during migration, as has been recently documented in the mouse
(Seki et al., 2007). Here, both P-Ser5 and P-Ser2 are missing. In
Xenopus, no similar studies have been attempted, although Dziadek
and Dixon did examine RNA synthesis in endoderm and PGCs with
[3H]-uridine and found no differences (Dziadek and Dixon, 1977).
Several laboratories have examined the relationship between
transcriptional repression and histone modifications in promoting
the preservation of the germline. In C. elegans, PIE-1 activity is
replaced by histone H3 methyltransferase complexes that shift the
chromatin to a more condensed state (Schaner et al., 2003; Wang et
al., 2005). As soon as they are formed, Drosophila pole cells have
high levels of a histone H3 conserved modification (H3meK9) found
in silenced genomic regions. Thus, flies have both modes of
repression during the same developmental time period. During PGC
migration in the mouse, the germline undergoes remodeling with a
loss of repressive chromatin, but prevents inappropriate gene
expression by repressing RNAPII, as previously mentioned (Seki et
al., 2007).
In Xenopus, Palancade et al. have shown distinct cycles of
RNAPII phosphorylation that also correlate with active transcription
(Palancade et al., 2001). At fertilization, the CTD-RNAPII is almost
completely de-phosphorylated with only minor amounts of the
phosphorylated form present, as determined using the same
monoclonal antibodies (H5 and H14) that were employed in the
earlier studies (Patturajan et al., 1998; Seydoux and Dunn, 1997;
Palancade et al., 2001; Ghosh and Seydoux, 2008). Consistent with
these observations, transcription is reduced to very low levels. At
the initiation of strong zygotic transcription, twelve divisions later
at MBT, CTD-RNAPII becomes hyperphosphorylated and P-Ser2
and P-Ser5 attain maximum levels of expression.
To determine whether global transcriptional repression might be
functioning in the Xenopus germline, we isolated pure populations
of PGCs at pre- and post-MBT stages and examined the
phosphorylated state of CTD-Ser2 and CTD-Ser5. We find that
although the endoderm determinant VegT RNA is present in PGCs,
its immediate downstream targets are not expressed at MBT. We
show that whereas somatic cells gain a hyperphosphorylated form
of RNAPII at the MBT, such phosphorylation events are delayed by
ten hours in PGCs until neurula. Consistent with that finding,
suppression subtractive hybridization (SSH) also did not detect new
transcripts in PGCs until neural stages. Significant changes in
chromatin remodeling that could account for global transcriptional
repression were not detected. However, differences in histone linker
protein and DNA methylation were detected that are consistent with
preserving an undifferentiated state in PGCs during these early
stages. The mechanism of PGC transcriptional repression appears
to target the CTD of the RNAPII enzyme, as has been found in the
C. elegans and the Drosophila germline. Activation of the RNAPII
by hyperphosphorylation of the CTD appears to be a pivotal
regulatory event on which evolution has converged to maintain the
germline in both invertebrates and vertebrates.
Development 137 (4)
MATERIALS AND METHODS
Xenopus embryos and isolation of PGCs
Adult frogs were purchased from Xenopus One or Xenopus Express.
Ovulated eggs from human chorionic gonadotropin (hCG)-induced females
were fertilized in vitro for embryo production and embryos staged according
to the normal table of Nieuwkoop and Faber (Nieuwkoop and Faber, 1956).
PGCs were isolated at embryonic stages 8, 10 and 14 as described by
Venkataraman et al. (Venkataraman et al., 2004), but using a higher dose of
DiOC6(3). Briefly, stage 2 embryos were dejellied and stained at the fourcell stage with DiOC6(3) (Molecular Probes). A stock solution (2:1000,
0.1⫻MMR buffer) was made from a saturated solution of DiOC6 in DMSO.
Embryos were stained in the dark for twenty minutes with a 4:1000 dilution
of the stock, rinsed thoroughly, and kept in the dark until the appropriate
stage. At the desired stage, embryos were dissociated in a Ca2+-, Mg2+-free
medium [all buffers have been previously described by Sive et al. (Sive et
al., 2000)], the animal cap removed, and the PGCs within the endodermal
mass manually selected for further analysis (Fig. 1).
Immunofluorescence (IF) and confocal imaging
For Figs 2, 3 and Fig. 5A, dissociated cells were fixed in MEMFA for one
hour at room temperature [MEMFA: 5⫻MEM buffer, 10 mM MOPS (pH
7.0), 1 mM sodium acetate, 0.5 mM EDTA (pH 8.0), 10.0 mM EGTA, 5.0
mM MgSO4, final pH 7.5]. MEMFA fixative is freshly made from two parts
5⫻MEM buffer, one part 37% formaldehyde (Sigma) and seven parts H2O.
Cells were blocked with 500 l of PBT and 10% goat serum at 4°C for 1
hour. Cells were incubated with primary antibodies in fresh blocking
solution overnight at 4°C then with appropriate fluorescent secondary
antibodies. For confocal analysis, images were acquired on an inverted Zeiss
LSM-510 Confocal Laser Scanning Microscope equipped with Argon ion,
Helium-Neon and Green-Neon lasers.
All other samples were fixed in Dent’s solution (80% methanol/20%
DMSO) overnight at –20°C. For IF of cryostat sections, fixed samples were
embedded in OCT and sectioned at 12 microns. Sections were extracted in
PBS containing 0.25% Triton X-100 and blocked in 5% heat-inactivated
donkey serum/1% BSA in PBS containing 0.05% Triton X-100 (PBT). The
sections were incubated with primary antibody overnight at 4°C, rinsed in
PBT, and incubated at room temperature for one hour with respective
secondary antibodies. After a rinse in PBS, sections were mounted in
Fluorogel in TES buffer (Electron Microscopy Sciences).
For detection of 5-methylcytosine (5mC), Xenopus nuclei were isolated
from stage 10 dissociated embryos and treated following the procedures of
Stancheva et al. (Stancheva et al., 2002). Samples were incubated with anti5mC primary antibody for 1 hour at room temperature, and then with Alexa
488 secondary antibody for 30 minutes.
Primary and secondary antibodies
Primary antibodies were: monoclonal mouse antibody (Research
Diagnostic, catalog number RDI-RNAPOLII-H5) diluted at 1:100; H14
(Covance, catalog number MMS-134R), 1:100; G16 (Covance, catalog
number MS-126R), 1:200; anti-dimethyl-histone H3 (Lys4; Upstate, catalog
number 07-030), 1:300; anti-hyperacetylated Histone H4 (Penta; Upstate,
catalog number 06-946), 1:1000; and anti-dimethyl-histone H3 (Lys9;
Upstate catalog number 07-212), 1:250.
H4K20me3 (Abcam, catalog number ab9053), 1:500; H3K4me3
(Abcam, catalog number ab1012), 1:100; H3K27me3 (Cell Signaling,
catalog number 9756), 1:400; H3K27me2 (Cell Signaling, catalog number
97555), 1:500; 5-methylcytosine (Abcam, catalog number ab10805), 1: 200;
affinity purified anti-Xnos1 antibody, made in goats against total
recombinant expressed Xnos1 protein (Invitrogen), 1:50 or 1:100.
Secondary antibodies were as follows: Alexa 350 (Invitrogen, catalog
number A10035), 1:1000; Alexa 488 (Invitrogen, catalog number A21206),
1:500; Alexa 555 (Molecular Probes, catalog number A21432), 1:500; and
Cy3 anti-mouse antibody (Jackson ImmunoResearch, catalog number 115165-146), used at a dilution of 1:500. To visualize nuclei, DAPI (Sigma, 1
mg/ml) was used at a dilution of 1:3000, or Hoechst (Invitrogen, H3570, 10
mg/ml) was used at a dilution of 1:10,000 for 15 minutes at room
temperature. Cells were treated with the SlowFade Antifade from Molecular
Probes (catalog number S-2828) and mounted for microscopic observations.
DEVELOPMENT
652
Transcriptional repression in Xenopus PGCs
RESEARCH ARTICLE
653
Whole-mount in situ hybridization
Whole-mount in situ hybridization (WISH) and histological procedures
were performed as detailed by Houston et al. (Houston et al., 1998). VegT
antisense digoxigenin-labeled RNA probes were generated by linearizing
the B12 clone with NotI and subsequent transcription with SP6 RNA
polymerase (Zhang and King, 1996).
Analysis of gene expression using RT-PCR
Suppression subtractive hybridization
cDNA subtraction was performed using Clontech’s PCR-Select cDNA
Subtraction Kit. The procedures were modified from O’Neill and Sinclair
(O’Neill and Sinclair, 1997), as detailed by Venkataraman et al.
(Venkataraman et al., 2004).
Virtual northern
Transcripts identified by SSH were used as probes to verify their expression
pattern. Full-length PGC cDNA from stages 8, 10 and 14 were resolved on
a 1% agarose gel and transferred to a nylon membrane. Resulting blots were
probed with clones of candidate genes in pDrive vector (Qiagen), restricted
with EcoR1 and radiolabeled by random prime labeling (Amersham DNA
Mega prime kit).
RESULTS
Primordial germ cells contain both germline and
somatic cell determinants
The vegetal cortex is a common site for a diverse population of
maternally localized RNAs that determine both germline and
somatic cell fates. Previous results from whole-mount in situ
hybridization (WISH) suggest that blastomeres arising from the
vegetal pole could inherit both germ plasm RNAs, as well as other
localized RNAs, such as the endoderm determinate, maternal VegT
(mVegT). To determine if PGCs contain determinants for both
somatic and germline fates, we asked whether VegT could be
detected in PGCs by WISH, as well as by RT-PCR analysis of
isolated PGCs.
To isolate PGCs, we took advantage of the very high content of
mitochondria in germ plasm and employed the lipophilic fluorescent
dye DiOC6 to selectively stain mitochondria in living embryos.
Using a low concentration of the dye, PGCs were easily
distinguished from somatic cells in the vegetal region of the embryo
(Fig. 1A). PGCs of DiOC6-stained embryos developed in a similar
fashion to the untreated control embryos. The correct number of
PGCs was produced and their migration into the dorsal mesentery
was normal, indicating that the DiOC6 had no adverse affects (data
not shown) (Venkataraman et al., 2004). Fluorescent PGCs were
Fig. 1. PGC isolation and gene expression analyses in Xenopus
embryos. (A)PGCs can be identified based on the distinctive
fluorescence staining of the germ plasm with DiOC6. (i)Eight-cell
embryo and (ii) corresponding image after stereofluorescence
microscopy showing DiOC6 staining of vegetal pole germ plasm.
(iii) PGCs near the floor of the blastocoel just after removal of the
animal cap (arrows). (iv)Stereofluorescence microscopy of PGCs
(arrows) and unstained somatic cells (arrowheads) from embryos
dissociated at gastrula (stage 10). (B)VegT RNA is found in PGCs. WISH
with anti-VegT probe of (i) early embryo and (ii) isolated PGC from a
blastula-stage embryo. (C)Zygotic genes are not expressed in PGCs at
MBT. Gene expression in PGCs isolated before (stage 8) and after
(stages 10 and 14) MBT was compared with that in whole embryos
(WE) by semi-quantitative RT-PCR with gene-specific primers. Xpat,
PGC-specific marker; Xbra, mesoderm marker; Bix4, Xnr1 and Xsox17,
endodermal-specific and downstream targets of maternal VegT; Xsurv
(survivin), a maternal gene. Presence of Xpat but not Xbra or zygotic
VegT at stage 10 and 14 indicates that PGCs were not contaminated
with mesoderm. Zygotic VegT, a spliced variant of maternal VegT, is
expressed at post-MBT stages in the mesoderm. Ornithine decarboxylase
(ODC) served as a control. PGCs did not express endoderm markers
(Bix4, Xnr1, Xsox17), but did contain maternal VegT RNA (asterisk).
manually selected from embryos dissociated at stage 8 that had been
raised in the dark to protect against phototoxicity. In situ
hybridization, as well as the RT-PCR results, indicated that indeed
maternal VegT RNA was present, perhaps at a lower level, in PGCs
of the eight-cell and blastula embryos (Fig. 1B,C; see VegT* lane).
VegT is also expressed zygotically (zVegT) as a splice variant of
maternal VegT, but only in the mesoderm. Therefore, an important
question is: what prevents PGCs from developing as endoderm?
Zygotic genes are not expressed in PGCs at MBT
One explanation for the failure of the transcription factor VegT to
specify endoderm fate in PGCs is that these cells are
transcriptionally repressed at the mid-blastula transition (MBT)
whereas somatic cells are not. Such a phenomenon has been
described in both the C. elegans and the Drosophila germlines
(Seydoux and Fire, 1994; Seydoux et al., 1996; Van Doren et al.,
1998), and might be true in ascidians as well (Tomioka et al., 2002).
The downstream targets of the transcription factor mVegT have
been identified and include the transcription factors Bix4 and
Xsox17 and the growth factor Xnr1 (Hudson et al., 1997; Casey et
al., 1999; Takahashi et al., 2000; Zhang et al., 2005). Bix4 and
Xsox17 are required for endoderm specification and Xnr1 is
DEVELOPMENT
Total RNA was isolated from 50-100 PGCs at the various stages by using
Stratagene’s Absolutely RNA microprep kit and following the detailed
instructions provided. Semi-quantitative RT-PCR analysis of gene
expression in PGCs was as described by Venkataraman et al. (Venkataraman
et al., 2004). The primers used are referenced and the annealing temperatures
were as noted: Xpat at 56°C (Hudson and Woodland, 1998); Xbra at 56°C
(Wilson and Melton, 1994); VegT at 55°C (Zhang and King, 1996); Xnr1
(Lustig et al., 1996); Bix-4 at 62°C and ODC at 55°C (Xanthos et al., 2001);
Xsox17 at 55°C (Hudson et al., 1997); Xsurv (BE191778) at 62°C (forward:
TAAAACCTCAGCACACTTCCAAC; reverse: TTCCTTTCCGTGACAAAGTGTGTC); Oct-25 (F: TAATGGAGAGATGCTTGATG; R:
TTCTCTATGTTCGTCCTCC); Oct-60 (F: CCATATTGTACAGCCAAACCTC; R: GTTCCAGTCAAAGGAAGCAG); Oct-91 (F:
CAGATGGCAGCGGACAG; R: CAACTGGTTGGCAGAATCC)
(Dunican et al., 2008); B4 (F: GGCTGAAGTTTTTGCTACGG; R:
CTTTTGGGTTTCCTGCTCTG); H1c (F: CCTCAAGTTGGCTCTCAAGG; R: CCTTCTTGGGCTTTTTAGGG); Xdnmt1 (F:
TTGGCTTCCTTGAAGCAGAT; R: AGGTACCATTGGTGGAGCAG).
Amplified products were analyzed on 5% polyacrylamide/1⫻TBE gels and
exposed to PhosphorImager screens (Molecular Dynamics).
RESEARCH ARTICLE
capable of inducing mesoderm in the marginal zone. We
investigated whether these downstream targets of mVegT were
expressed in PGCs that were isolated before the mid-blastula
transition (pre-MBT; stage 8), well after zygotic transcription had
been initiated (post-MBT; stage 10), or at early neurula (stage 14).
PGCs were isolated at these stages and gene expression analyzed
by RT-PCR using specific primers for the corresponding transcripts.
As expected, the isolated PGCs expressed the PGC-specific marker
Xpat, but not the mesoderm marker Xbra, indicating that our
selection of PGCs was accurate. However, although PGCs
contained mVegT and the household enzyme ornithine
decarboxylase (ODC), they did not express zygotic VegT (zVegT),
or the targets of mVegT: Bix4, Xsox17 and Xnr1. As expected,
zVegT, Bix4, Xnr1 and Xsox17 were all strongly expressed after
MBT and declined by neurula as indicated by the sibling-matched
whole embryo controls (Fig. 1C). Maternally expressed survivin
(Xsurv), a positive regulator of cell cycle progression localized to
the mitotic spindle (Murphy et al., 2002; Yang et al., 2004), appears
prematurely downregulated in PGCs when compared with whole
embryos, possibly reflecting differences in cell cycle regulation
(Whitington and Dixon, 1975). From these results, we conclude
that PGCs do not express endodermal genes at MBT, in contrast to
their endodermal neighbors. Our results suggest that PGCs might
be transcriptionally repressed at MBT.
Transcriptional elongation but not initiation is
blocked in PGCs
In C. elegans and Drosophila, a transient global repression of
mRNA transcription protects the germ cell lineage from responding
to cues initiating somatic cell differentiation. In both of these
organisms, transcriptional repression is correlated with the failure to
phosphorylate serine 2 within the CTD of RNAPII, as previously
mentioned (Seydoux et al., 1996; Van Doren et al., 1998; Strome and
Lehmann, 2007; Timinszky et al., 2008). CTD-Ser2
phosphorylation is required for transcriptional elongation events
(Wada et al., 1998; Yamaguchi et al., 1999), whereas CTD-Ser5
phosphorylation is associated with initiation events (Pei et al., 2001;
Phatnani and Greenleaf, 2006). To test for the presence of
phosphorylated serines in the RNAPII CTD in isolated PGCs or
somatic cells, we used the monoclonal antibodies H5 and H14 to
detect P-Ser2 and P-Ser5, respectively. H5 and H14 specifically
detect these serine phospho-epitopes in a wide range of eukaryotes
including Drosophila, C. elegans and Xenopus (Bregman el al.,
1995; Kim et al., 1997; Seydoux and Dunn, 1997; Palancade et al.,
2001). As expected, the CTD-P-Ser2 epitope was not detected in
pre-MBT embryos (Fig. 2, stage 8), but was detected strongly in
somatic cells following the MBT (Fig. 3A; stage 10). In sharp
contrast, PGCs remained negative for CTD-P-Ser2 well after the
MBT (Fig. 3Aiii, arrowheads). Therefore, the absence of zygotic
transcripts in PGCs correlated with the absence of the P-Ser2
phospho-epitope. Interestingly, at all stages tested, nuclei in both
somatic cells and PGCs were strongly positive for nuclear RNAPII
and the P-Ser5 epitope (Fig. 2C,D). These results indicated that
initiation complexes were present in both PGCs and somatic cells
prior to MBT. Our findings strongly suggest a model in which
RNAPII function in PGCs is blocked at MBT at a step prior to
elongation but after initiation.
Zygotic transcription initiates at Neurula in PGCs
If PGCs are transcriptionally silenced to prevent them from
responding to maternal and zygotic somatic cell determinants, then
one might expect that PGCs would initiate their own transcriptional
Development 137 (4)
Fig. 2. Pre-MBT PGCs and somatic cells express CTD-P-Ser5, but
not CTD-P-Ser2. Immunofluorescence of dissociated cells isolated from
pre-MBT stage 8 embryos previously stained with DiOC6 (A) to identify
PGCs. Monoclonal antibodies H5 and H14 were used to detect the
expression of CTD phospho-serines 2 (B, P-Ser2) and 5 (D, P-Ser5),
respectively, in PGCs (arrowheads) and somatic cells (arrows).
Monoclonal antibody 8WG16 recognizes the unphosphorylated RNA
Pol II large subunit (C, RNAPII) and served as a positive control.
program at the conclusion of these developmental events. In
Xenopus, maternal transcripts have declined and early patterning is
essentially completed by neurula stages. Indeed, we found that
PGCs first express the CTD-P-Ser2 epitope at the neural plate stage,
some 10 hours after MBT (Fig. 3B, stage 14). These results indicate
that PGCs might be significantly delayed in initiating their genetic
program, well past the time when somatic cells become
transcriptionally active.
To look more directly at transcription in PGCs and to identify
new zygotic transcripts, we turned to a PCR-based subtractive
cloning strategy (suppression subtractive hybridization; SSH) (Ji
et al., 2002). RNA was extracted from isolated PGCs at stages 8,
10 and 14. SSH yields amplified products that are different
between two populations of RNAs. If PGCs are transcriptionally
silent at the MBT but active at neurula as the IF data suggest, then
SSH between PGC transcripts isolated at stages 8 and 10 should
not yield any amplified products, whereas SSH between stages 10
and 14 should. The efficiency of subtraction was verified by
analyzing the levels of Xnos1 [formerly known as Xcat2
(Mosquera et al., 1993)], a PGC-specific Nanos family member,
in the subtracted and unsubtracted cDNA (data not shown). As
expected, unsubtracted samples (Fig. 4A, lane U) appeared as a
heterogeneously sized smear of cDNA products. Amplified
products were first detected between gastrulation and the neural
plate stage. These data, together with the IF analyses, strongly
support our conclusion that PGCs are transcriptionally quiescent
until neurula (Fig. 4A, stage 10-stage 14).
Identification of PGC zygotic transcripts: RACK1
and Oct-91
PGC mRNAs transcribed at neurula might be expected to encode
proteins required for continued PGC development and survival.
To identify what genes might be represented in the SSH-amplified
products, bands were excised from the gel and cloned. Seven
clones that gave a strong hybridization signal when probed with
PGC cDNA were tested for their temporal expression; one was
confirmed to be zygotically expressed at neurula by virtual
northern. This clone was 99% (497/501) identical in sequence to
DEVELOPMENT
654
Fig. 3. PGC expression of CTD-P-Ser2 is delayed until neurula
stage. The phosphorylation status of the CTD RNA Pol II in PGCs and
somatic cells at two post-MBT stages, gastrulation (A, stage 10) and
neurula (B, stage 14). (A) Dissociated somatic cells show very low
DiOC6 staining (i) and strong nuclear P-Ser2 reactivity (red; ii). (iii)
Merged confocal image of P-Ser2 (red) and DiOC6 (green) staining of
dissociated somatic cells and PGCs. The P-Ser2 epitope is detected in
somatic cells, but not PGCs (arrowheads). (B)Dissociated stage 14
somatic cells and PGCs (arrowheads) labeled with DiOC6 and stained
for P-Ser2. Nuclei were stained with DAPI; note the somatic cell without
a nucleus. The last panel shows a merged confocal image of P-Ser2
(red) and DiOC6 (green) staining of isolated somatic cells and PGCs.
Strong nuclear P-Ser2 staining is now evident in PGCs.
Xenopus Receptor for Activated C-Kinase 1 (RACK1; GenBank
accession number AF105259) (Kwon et al., 2001) (Fig. 4B).
RACK1 belongs to a family of proteins involved in anchoring
activated PKC to appropriate cellular organelles. As discussed
below, Oct-91 was also identified as a PGC transcript at neurula
(see Fig. 6C). Neither RACK1 nor Oct-91 are germline specific
but are also expressed in somatic cells. However, these results
show at a minimum that RACK1 and Oct-91 increased
significantly in neurula stage PGCs and thus they provide
additional evidence that the presence of P-Ser2 in PGCs coincides
with transcriptional activity.
RESEARCH ARTICLE
655
Fig. 4. PGCs are transcriptionally active at neurula stage. (A)New
PGC transcripts are detected at neurula stage. Suppression subtractive
hybridization (SSH, see Materials and methods) was used to identify
transcripts newly expressed in PGCs. Transcripts from stage 8 PGCs
were subtracted from those isolated from stage 10 PGCs [(stage 10) –
(stage 8)]. The amplification step failed to detect any novel transcripts
made between these two stages, consistent with PGCs being
transcriptionally silent during this time. Novel transcripts were detected
in PGCs as discrete amplified bands after the subtraction of stage 10
PGC transcripts from stage 14 [(stage 14) – (stage 10)]. U,
unsubtracted/amplified (control); S, subtracted/amplified (experimental).
(B)Rack1 is a PGC zygotic transcript. Bands were excised from the gel
shown in A in three size ranges (0.5-0.7 kb, 0.7-1.0 kb and 1.0-1.5 kb)
and cloned. Randomly selected clones were used as probes against a
blot of stage 8, 10 and 14 PGC cDNAs and zygotically expressed clones
selected. Rack1 was identified by sequencing. Maternal Xpat and
Xnos1 RNAs served as controls. Kb, size marker.
Chromatin structure in PGCs at MBT favors
transcription
In addition to regulating RNAP II activity, global silencing of
mRNA transcription could be achieved at the level of chromatin
structure. To address this point in a general way, we sought to
determine whether there was an obvious difference in the
complement of histone modifications, expression of histone linkers,
or levels of 5-methyl cytosine (5mC) between somatic cells and
PGCs around the time of the MBT. Di-methylated lysine 4 of histone
H3 (H3meK4) or hyperacetylated histone H4 (Penta) are markers of
transcriptionally active chromatin. Inactive chromatin is marked by
methylation of H3 lysine 9, 4 or 27 (H3K9, H3K4me3, H3K27me2,
H3K27me3) and histone H4 lysine 20me3 (Schaner et al., 2003; Yin
and Lin, 2007; Shilatifard, 2008; Dunican et al., 2008; Katz et al.,
2009). No significant differences were detected in staining between
the somatic cells and the PGCs at any stage (Fig. 5). All cells stained
for markers of active but not inactive chromatin (Fig. 5A,B). HeLa
cells served as a positive control for antibody staining (not shown).
Xenopus oocytes and early cleavage stages, unlike the mouse,
retain high levels of methylated DNA (5mC) that progressively
decline reaching the lowest levels at the MBT (Stancheva et al.,
DEVELOPMENT
Transcriptional repression in Xenopus PGCs
656
RESEARCH ARTICLE
Development 137 (4)
Fig. 5. Pre-neurula PGCs display permissive chromatin and
histone staining. (A)Fluorescence stereomicroscopy of PGCs (green)
and somatic cells from dissociated embryos. Cells were stained with
anti-hyperacetylated Histone H4 (Penta, red), a marker of
transcriptionally active chromatin. Stage 8 and 10 represent merged
images of Penta immunostaining and DiOC6 labeling (green). Stage 14:
(i) Penta alone, (ii) DiOC6, (iii) merged image, (iv) merged confocal
image showing Penta staining (green) and a PGC (outlined) identified
by Xnos1 (red) immunostaining. (insets show separate images).
Examples of PGCs (white arrows) and endoderm cells (green
arrowheads) with nuclear staining. Both PGCs and somatic cells express
Histone H4 Penta at every stage. (B)Cryostat sections from stages 10
and 14 showing the endodermal region immunostained for H4K20me3
or H3K4me3 (green). PGCs indicated by Xnos1 immunostaining (red);
nuclei stained with Hoechst (blue). PGCs (white arrows), other nuclei
from endoderm cells. PGC nuclei are outlined. No nuclear staining was
detected for any of the histone methylated lysines tested (see Materials
and methods). (C)Stage 10 isolated PGC and endoderm nuclei (blue)
immunostained for 5mC (green). Both cell types were demethylated on
cytosine residues. DiOC6-stained germ plasm remained associated with
PGC nuclei (arrow). 5mC staining of ectoderm nuclei served as a
positive control.
Zygotic expression of Oct-91 in PGCs
The maintenance of an undifferentiated state is preserved in
mouse PGCs and embryonic stem cells in part through the POU
domain transcription factor Oct3/4. Xenopus Oct-60, Oct-25 and
Oct-91 are in the same POU subclass as Oct3/4 (Hinkley et al.,
1992). Oct3/4 behaves as a functional homolog for Oct-60 or Oct25 in rescue type experiments (Cao et al., 2006). Oct-60 and Oct25 are expressed maternally and predominantly in the animal pole
region. Recently, Oct-25 and Oct-60 have been shown to repress
the target genes of maternal VegT and -catenin, consistent with
a role in maintaining pluripotency (Cao et al., 2007; Cao et al.,
2008). We sought to determine what the status of these Oct genes
was in Xenopus PGCs (Fig. 6). Interestingly, we found that Oct25 was expressed at low levels in the whole embryo (Fig. 6A), but
was not detected at any stage in the endoderm or in PGCs (Fig.
6B,C). In contrast to previous work (Whitfield et al., 1993), we
did detect Oct-60 in the endoderm and in PGCs at stage 8, but
expression was undetectable by the end of gastrulation. Thus,
neither maternal Oct-60 nor Oct-25 was present in PGCs postMBT at a time when PGCs were transcriptionally repressed. By
contrast, Oct-91 is zygotically expressed; expression peaks at
gastrulation and declines by stage 14 in whole embryos (Hinkley
et al., 1992) (see Fig. 6A; stage 8 consistently showed a nonspecific smear or two bands). Oct-91 was weakly expressed in the
endoderm at stages 10 and 14 but not expressed in PGCs at stage
10, consistent with our earlier data showing that PGCs were
transcriptionally repressed at this stage. Importantly, Oct-91 was
expressed in PGCs at stage 14. De novo PGC Oct-91 expression
provides additional evidence that PGCs are transcriptionally
active at neurula. Most importantly, these results identify a
transcription factor that is capable of promoting pluripotency in
the germ cell lineage, and suggest that Oct-91 is the functional
equivalent of mouse Oct3/4 in PGCs.
DEVELOPMENT
2002). We investigated whether PGC nuclei retained 5mC content
through the extended period of transcriptional repression. Isolated
nuclei from PGCs and endoderm at stage 10 were compared for
5mC by immunofluorescence microscopy (Fig. 5C). No differences
in staining were detected between the two lineages, indicating that
PGCs and endoderm had undergone demethylation of 5mC (Fig.
5C). By contrast, 5mC was detected in ectoderm. Finally, we
analyzed the expression of maternal DNA methyltransferase
(xDnmt1) and two linker histones in pre-and post-MBT endoderm
and PGCs (Fig. 6). No differences in xDnmt1 RNA expression were
detected between whole embryos, endoderm or PGCs at the
different stages. Consistent with this observation, Stancheva and
Meehan (Stancheva and Meehan, 2000) did not detect any xDnmt1
protein in the vegetal pole of early-cleaved embryos, indicating that,
at most, xDnmt1 plays a minor role in PGC or endoderm
transcriptional repression. A different story emerged from the
analysis of RNAs for the histone linker proteins B4 and H1c. By
neurula stages, oocyte-specific B4 linker protein is completely
replaced by H1 variants shown to prevent chromatin remodeling in
somatic cells (Saeki et al., 2005). As expected, B4 and H1c RNA
were detected in endoderm and PGCs through gastrulation, with B4
RNA being undetectable by neurula (Fig. 6C). Importantly, although
H1c RNA continues to be expressed at neurula in the now specified
endoderm, H1c is not expressed in PGCs as they initiate their genetic
program. We conclude that transcriptional repression in Xenopus
PGCs does not involve a dramatic alteration of chromatin
architecture and occurs in spite of a ‘permissive’ chromatin
environment.
Fig. 6. PGCs activate Oct-91 and repress H1c linker histone
expression at neurula stage. Gene expression before and after MBT
analyzed by semi-quantitative RT-PCR. (A)Whole embryo controls.
(B)Gene expression analyzed in isolated endoderm masses (pre-MBT
stages 7.5-8). (C)Gene expression in PGCs (p) and endoderm (e)
isolated pre-MBT (stage 8) and post-MBT (stages 10, 14). Oct-25 and
Oct-60, maternal genes; Oct-91, zygotic gene; histone linker proteins
maternal B4 and H1c; Xdnmt1, Xenopus DNA methyltransferase;
ornithine decarboxylase (ODC) served as a control; endoderm zygotic
markers Xsox17 and Bix4; Xpat, a PGC-specific marker. The presence of
Xpat but not Bix4 or Xsox17 at stages 10 and 14 indicates that PGCs
were not contaminated during isolation. Asterisk indicates a nonspecific
amplification product for Oct-91.
DISCUSSION
Global repression of RNAPII transcription in PGCs
Nothing intrinsically prevents PGCs from becoming somatic cells,
underscoring the crucial role repression plays in maintaining PGC
identity (Seydoux et al., 1996; Hayashi et al., 2004). Several lines of
evidence presented in this work lead to the conclusion that global
transcriptional repression of RNAPII operates in Xenopus to
preserve the germline. First, a required step for transcriptional
elongation at MBT, the phosphorylation of CTD-Ser2, fails to occur
in PGCs. Second, despite the presence of the VegT transcription
factor, endoderm gene expression is not initiated in PGCs. Third,
mRNA synthesis is detected in the germline only after the primary
germ layers are specified. Coincidentally, the expression of a
transcription factor associated with pluripotency, Oct-91, is initiated.
Dziadek and Dixon had previously shown that Xenopus PGCs and
their endodermal neighbors are identical in their ability to incorporate
[3H]-uridine into RNA (Dziadek and Dixon, 1977). However, these
studies could not distinguish the activities of RNAPI, II or III. In light
of our findings that RNAPII is inactive, these earlier observations can
now be interpreted as indicating that ribosomal RNA synthesis is not
affected in the germline, but resumes at MBT, as it does in somatic
cells. Similar observations were made in C. elegans and Drosophila
(Seydoux and Dunn, 1997). Thus, a specific mechanism operates in
RESEARCH ARTICLE
657
Fig. 7. Model for PGC molecular sequestration. During the early
cleavage stages, germ plasm (green) segregates asymmetrically into a
few vegetal pole cells, the future PGCs. Daughter cells lacking germ
plasm (yellow) are fated to become endoderm. Both PGCs and
endoderm cells contain the maternal endoderm determinant VegT. At
MBT, somatic cells become transcriptionally active (red nuclei) and
transcribe the zygotic downstream targets of VegT, Bix4 and Xnr1, thus
setting the endoderm fate. PGCs are not transcriptionally active (white
nucleus) and cannot respond to VegT. Maternal transcripts, including
VegT, decline dramatically by neurula, at which time PGCs initiate their
own program of transcription that includes Oct-91 and Rack1. We
propose that transcription is delayed in PGCs to prevent them from
entering an endodermal fate.
these germlines to repress RNAPII but not RNAPI/III activity.
Interestingly, both pre-MBT PGCs and somatic cells contain CTD-PSer5, suggesting that initiation events have occurred and that all cells
of the Xenopus blastula are primed for transcription. Palancade et al.
also detected P-Ser5 but not P-Ser2 in pre-MBT embryos (Palancade
et al., 2001). Our data do not rule out the possibility that Ser5 is less
phosphorylated in PGCs and that this somehow contributes to
blocking transcription. For example, in C. elegans reduced levels of
P-Ser5 are essential for the preservation of germ cell fate, and PIE-1
interacts with both kinases, CDK9 and CDK7, to reduce
phosphorylation (Ghosh and Seydoux, 2008).
Transient RNAPII repression might be quite common in germlines.
In the mouse where PGCs form after gastrulation and do not require
germ plasm, migrating PGCs also lack P-Ser5 and P-Ser2 (Seki et al.,
2007). Ascidians and zebrafish offer less clear but potentially
instructive examples. In Halocynthia roretzi, germline precursor cells
are transcriptionally repressed even in the presence of CTD-P-Ser2;
however, P-Ser5 was not examined leaving the question open
(Tomioka et al., 2002). Knaut et al. ruled out transcriptional repression
in the zebrafish germline (Knaut et al., 2000); however, they did report
that vasa expression in PGCs is delayed one hour past the initiation
time of general somatic transcription. Again, the status of CTD-Ser5
and whether other transcripts besides vasa were affected remains to
be investigated. The transient loss of RNAPII activity in the germline
could operate directly by inhibiting the kinase that phosphorylates PSer2 (P-TEFb: cyclinT/CDK9), or indirectly through a phosphatase
activity or perhaps by preventing association of the kinase with its
substrate; all potential mechanisms to test.
New genetic program expressed in PGCs
Subtractive cloning (SSH) confirmed that novel zygotic genes were
not transcribed in PGCs until neurula stages, coincident with the
appearance of P-Ser2. Surprisingly, few clones were recovered by
DEVELOPMENT
Transcriptional repression in Xenopus PGCs
RESEARCH ARTICLE
SSH and none represented PGC-specific genes. Because SSH would
select only for newly expressed genes, these results might indicate
that the initial gene program in PGCs is largely a zygotic reexpression of maternal genes. Alternatively, these RNAs might
simply be of low abundance and/or SSH is not an effective means
for selecting them. Rack1 expression was confirmed by blotting, but
could not be detected by WISH, which further suggests that early
PGC transcripts might be present at low copy number.
The PGC genetic program would be expected to accomplish two
goals: preserve the germline by continuing to prevent endoderm or
other somatic fates, and promote migration to the gonads. The two
genes identified as new PGC transcripts are consistent with these
goals. RACK1 has been described as a scaffolding protein capable
of integrating different signaling pathways (Nilsson et al., 2004). For
example, RACK1 bound to the IP3 receptor regulates intracellular
calcium levels, and thus could be involved in regulating migration
and adhesion events in PGCs (Sklan et al., 2006). The most
intriguing finding, however, was that Oct-91, a POU-V protein
related to mouse Oct3/4 pluripotency factor, is expressed in PGCs
at the same time that its expression is waning in committed somatic
cells. In mice, Oct3/4 is required for the maintenance of PGCs and
ES cell self-renewal (Kehler et al., 2004; Niwa et al., 2000).
Importantly, Xenopus Oct-91 can maintain self-renewal in Oct-4deficient ES cells and does so more effectively than either Oct-60 or
Oct-25 (Morrison and Brickman, 2006). Conversely, Xenopus
embryos deficient in Oct-91 prematurely express differentiation
genes and the resulting abnormal phenotype can be rescued by
mouse Oct-4 expression. Our findings rule out Oct-25 and Oct-60
as players in maintaining Xenopus PGC pluripotency, as neither one
is present at the correct time or place for this function (Cao et al.,
2007; Cao et al., 2008). Surprisingly, Xenopus embryos deficient
in all three Oct genes apparently exhibit normal germ cell
development, thus leaving open the question of what role Oct-91
might play in PGCs (Morrison and Brickman, 2006).
PGC chromatin structure is permissive not
repressive
Nascent mouse PGCs display a characteristic ‘signature’ of inactive
chromatin that includes H3K27me3, H3K4me3 and 5mC (Hajkova
et al., 2008). Drosophila germ cells lag behind somatic cells in
expressing active chromatin (Schaner et al., 2003). By contrast, we
found that both PGCs and somatic cells display robust staining for
histones characteristic of active chromatin regardless of their
transcriptional state. At the same time, none of the six histone marks
for inactive chromatin or 5mC were detected, although H3K4me3
and H4K20me3 were detected in whole embryos by neurula
(Dunican et al., 2008). Unlike the mouse, there is no global
demethylation or imprinting in Xenopus. Any such modifications
are likely to exist in a subset of inactive genes and thus were not
detectable by our histological approach.
Our data are consistent with transcriptional silencing being
extended in PGCs some 10 hours past MBT. xDnmt functions to
preserve gene inactivity in somatic cells prior to the MBT by direct
action as a transcription repressor, not as a methyltransferase
(Dunican et al., 2008). No differences in xDnmt1 RNA expression
were noted in PGCs or endoderm, and xDnmt1 seems to account for
specific rather than global gene repression. Interestingly, xDnmt1
represses Oct-91 and Xsox17 pre-MBT. Future studies will
determine how repression of Oct-91 is released at neurula while
Xsox17 remains repressed in PGCs. Another component in
chromatin repression occurs at the level of histone linker proteins.
The replacement of oocyte B4 with the more restrictive H1c variant
Development 137 (4)
is complete by neurula and is required for specific gene repression
and normal somatic cell development (Steinbach et al., 1997; Smith
et al., 1988; Saeki et al., 2005). PGCs contain maternal H1c RNA,
but this is completely lost by neurula when gene transcription
initiates. Thus, a linker protein that restricts chromatin remodeling
is repressed in PGCs but expressed in somatic cells. It will be
important to discover what histone linker variant replaces B4 in
PGCs.
Model: molecular sequestration of the germline
Our findings are most consistent with a model (Fig. 7) in which PGCs
fail to activate transcription at the MBT, and thus cannot respond to
the maternal molecular cues for endoderm specification. By neurula
(stage 14), both the maternal determinant VegT and its downstream
targets are no longer detected (Fig. 1), and the opportunity to induce
endoderm fates in PGCs is missed. We propose that sequestration
through the repression of gene expression while maintaining a
permissive chromatin structure accounts for the preservation of an
uncommitted state in Xenopus PGCs. By presenting this model, we
do not preclude other mechanisms that might be working in concert
to preserve PGC totipotency, including RNA degradation and
translational repression. On the contrary, mechanisms in addition to
transcriptional repression are likely to be operating in PGCs to ensure
maternal determinants like VegT do not function.
Germ plasm must contain the components required to cause
global transcriptional repression in PGCs and we are currently
searching for these components. Neither PIE-1 nor Polar Granule
Component is found outside their taxon, yet other germline
repressors, such as Nanos, are conserved from hydra to humans
(Torras and González-Crespo, 2005). It will be important to
determine whether Xenopus Nanos1 plays a similar role repressing
somatic gene expression (Hayashi et al., 2004; Tsuda et al., 2003;
Wang et al., 2005; Köprunner et al., 2001; Asaoka et al., 1998;
Asaoka-Taguchi et al., 1999; Deshpande et al., 1999; Deshpande et
al., 2005). Regardless of the mediators, our findings further support
molecular sequestration through transcriptional repression as a
mechanism used repeatedly during evolution for preserving PGC
totipotency.
Acknowledgements
The authors acknowledge the outstanding technical assistance of Elio
Dancausse; the encouragement and advice from Drs G. Seydoux and R.
Lehmann, and the services rendered by the DRI Imaging Center at UMSM. We
thank Michael Danilchik for the WISH shown in Fig. 1 and Hugh Woodland for
the Xpat and Xsox17 plasmids used in this study. This work was supported by
NIH grant GM33932 to M.L.K. Deposited in PMC for release after 12 months.
Competing interests statement
The authors declare no competing financial interests.
References
Asaoka, M., Sano, H., Obara, Y. and Kobayashi, S. (1998). Maternal Nanos
regulates zygotic gene expression in germline progenitors of Drosophila
melanogaster. Mech. Dev. 78, 153-158.
Asaoka-Taguchi, M., Yamada, M., Nakamura, A., Hanyu, K. and Kobayashi,
S. (1999). Maternal Pumilio acts together with Nanos in germline development
in Drosophila embryos. Nat. Cell Biol. 1, 431-437.
Bensaude, O., Bonnet, F., Cassé, C., Dubois, M. F., Nguyen, V. T. and
Palancade, B. (1999). Regulated phosphorylation of the RNA polymerase II
C-terminal domain (CTD). Biochem. Cell Biol. 77, 249-255.
Bregman, D. B., Du, L., van der Zee, S. and Warren, S. L. (1995). Transcription
dependent redistribution of the large subunit of RNA polymerase II to discrete
nuclear domains. J. Cell Biol. 129, 287-298.
Cao, Y., Siegel, D. and Knochel, W. (2006). Xenopus POU factors of subclass V
inhibit activin/nodal signaling during gastrulation. Mech. Dev. 123, 614-625.
Cao, Y., Siegel, D., Donow, C., Knochel, S., Yuan, L. and Knochel, W. (2007).
POU-V factors antagonize maternal Veg T activity and -Catenin signaling in
Xenopus embryos. EMBO J. 26, 2942-2954.
DEVELOPMENT
658
Cao, Y., Siegel, D., Oswald, F. and Knöchel, W. (2008). Oct25 represses
transcription of nodal/activin target genes by interaction with signal transducers
during Xenopus gastrulation. J. Biol. Chem. 283, 34168-34177.
Casey, E. S., Tada, M., Fairclough, L., Wylie, C. L., Heasman, J. and Smith, J.
C. (1999). Bix4 is activated directly by VegT and mediates endoderm formation
in Xenopus development. Development 126, 4193- 4200.
Cho, H., Kim, T. K., Mancebo, H., Lane, W. S., Flores, O. and Reinberg, D.
(1999). A protein phosphatase functions to recycle RNA polymerase II. Genes
Dev. 13, 1540-1552.
Deshpande, G., Calhoun, G., Yanowitz, J. L. and Schedl, P. D. (1999). Novel
functions of nanos in down-regulating mitosis and transcription during the
development of the Drosophila germline. Cell 99, 271-281.
Deshpande, G., Calhoun, G., Jinks, T. M., Polydorides, A. D. and Schedl, P.
(2005). Nanos down-regulates transcription and modulates CTD
phosphorylation in the soma of early Drosophila embryos. Mech. Dev. 122, 645657.
Dunican, D. S., Ruzov, A., Hackett, J. A. and Meehan, R. R. (2008). xDnmt1
regulates transcriptional silencing in pre-MBT Xenopus embryos independently
of its catalytic function. Development 135, 1295-1302.
Dziadek, M. and Dixon, K. E. (1977). An autoradiographic analysis of nucleic
acid synthesis in the presumptive primordial germ cells of Xenopus laevis. J.
Embryol. Exp. Morphol. 37, 13-31.
Ghosh, D. and Seydoux, G. (2008). Inhibition of transcription by the
Caenorhabditis elegans germline protein PIE-1: genetic evidence for distinct
mechanisms targeting initiation and elongation. Genetics 178, 235-243.
Guven-Ozkan, T., Nishi, Y., Robertson, S. M. and Lin, R. (2008). Global
transcriptional repression in C. elegans germline precursors by regulated
sequestration of TAF-4. Cell 135, 149-160.
Hajkova, P., Ancelin, K., Waldmann, T., Lacoste, N., Lange, U. C., Cesari, F.,
Lee, C., Almouzni, G., Schneider, R. and Surani, M. A. (2008). Chromatin
dynamics during epigenetic reprogramming in the mouse germ line. Nature 452,
877-881.
Hanyu-Nakamura, K., Sonobe-Nojima, H., Tanigawa, A., Lasko, P. and
Nakamura, A. (2008). Drosophila Pgc protein inhibits P-TEFb recruitment to
chromatin in primordial germ cells. Nature 451, 730-733.
Hayashi, Y., Hayashi, M. and Kobayashi, S. (2004). Nanos suppresses somatic
cell fate in Drosophila germ line. Proc. Natl. Acad. Sci. USA 101, 10338-10342.
Hinkley, C. S., Martin, J. F., Leibham, D. and Perry, M. (1992). Sequential
expression of multiple POU proteins during amphibian early development. Mol.
Cell. Biol. 12, 638-649.
Houston, D. W. and King, M. L. (2000). Germ plasm and molecular determinants
of germ cell fate. Curr. Top. Dev. Biol. 50, 155-181.
Houston, D. W., Zhang, J., Maines, J. Z., Wasserman, S. A. and King, M. L.
(1998). A Xenopus DAZ-like gene encodes an RNA component of germ plasm
and is a functional homologue of Drosophila boule. Development 125, 171-180.
Hudson, C. and Woodland, R. (1998). Xpat, a gene expressed specifically in
germ plasm and primordial germ cells of Xenopus laevis. Mech. Dev. 73, 159168.
Hudson, C., Clements, D., Friday, R. V., Stott, D. and Woodland, H. R. (1997).
Xsox17 alpha and beta mediate endoderm formation in Xenopus. Cell 91, 397405.
Ji, W., Wright, M. B., Cai, L., Flament, A. and Lindpaintner, K. (2002). Efficacy
of SSH PCR in isolating differentially expressed genes. BMC Genomics 3, 12-18.
Katz, D. J., Edwards, T. M., Reinke, V. and Kelly, W. G. (2009). A C. elegans
LSD1 demethylase contributes to germline immortality by reprogramming
epigenetic memory. Cell 137, 308-320.
Kehler, J., Tolkunova, E., Koschorz, B., Pesce, M., Gentile, L., Boiani, M.,
Lomeli, H., Nagy, A., McLaughlin, K. J., Scholer, H. R. et al. (2004). Oct4 is
required for primordial germ cell survival. EMBO Rep. 5, 1078-1083.
Kim, E., Du, L., Bregman, D. B. and Warren, S. L. (1997). Splicing factors
associate with hyperphosphorylated RNA polymerase II in the absence of premRNA. J. Cell Biol. 136, 19-28.
Knaut, H., Pelegri, F., Bohmann, K., Schwarz, H. and Nüsslein-Volhard, C.
(2000). Zebrafish vasa RNA but not its protein is a component of the germ
plasm and segregates asymmetrically before germline specification. J. Cell Biol.
149, 875-888.
Köprunner, M., Thisse, C., Thisse, B. and Raz, E. (2001). A zebrafish nanosrelated gene is essential for the development of primordial germ cells. Genes
Dev. 15, 2877-2885.
Kwon, H. J., Bae, S., Son, Y. H. and Chung, H. M. (2001).Expression of the
Xenopus homologue of the receptor for activated C-kinase 1 (RACK1) in the
Xenopus embryo. Dev. Genes Evol. 211, 195-197.
Lustig, K. D., Kroll, K., Sun, E. E. and Kirschner, M. W. (1996). Expression
cloning of a Xenopus T-related gene (Xombi) involved in mesodernal patterning
and blastopore lip formation. Development 122, 4001-4012.
Morrison, G. M. and Brickman, J. M. (2006). Conserved roles for Oct4
homologues in maintaining multipotency during early vertebrate development.
Development 133, 2011-2022.
RESEARCH ARTICLE
659
Mosquera, L., Forristall, C., Zhou, Y. and King, M. L. (1993). A mRNA localized
to the vegetal cortex of Xenopus oocytes encodes a protein with a nanos-like
zinc finger domain. Development 117, 377-386.
Murphy, C. R., Sabel, J. L., Sandler, A. D. and Dagle, J. M. (2002). Survivin
mRNA is down-regulated during early Xenopus laevis embryogenesis. Dev. Dyn.
225, 597-601.
Nieuwkoop, P. D. and Faber, J. (1956). Normal Table of Xenopus laevis (Daudin),
1st edn. Amsterdam: North-Holland Publishing Company.
Nilsson, J., Sengupta, J., Frank, J. and Nissen, P. (2004). Regulation of
eukaryotic translation by the RACK1 protein: a platform for signaling molecules
on the ribosome. EMBO Rep. 5, 1137-1141.
Niwa, H., Miyazaki, J. and Smith, A. G. (2000). Quantitative expression of Oct3/4 defines differentiation, dedifferentiation or self-renewal of ES cells. Nat.
Genet. 24, 372-376.
O’Neill, M. J. and Sinclair, A. H. (1997). Isolation of rare transcripts by
representational difference analysis. Nucleic Acids Res. 25, 2681-2682.
Palancade, B., Bellier, S., Almouzni, G. and Bensaude, O. (2001). Incomplete
RNA polymerase II phosphorylation in Xenopus laevis early embryos. J. Cell Sci.
114, 2483-2489.
Patturajan, M., Schulte, R. J., Sefton, B. M., Berezney, R., Vincent, M.,
Bensaude, O., Warren, S. L. and Corden, J. L. (1998). Growth-related
changes in phosphorylation of yeast RNA polymerase II. J. Biol. Chem. 273,
4689-4694.
Pei, Y., Hausmann, S., Ho, C. K., Schwer, B. and Shuman, S. (2001). The
length, phosphorylation state, and primary structure of the RNA polymerase II
carboxyl-terminal domain dictate interactions with mRNA capping enzymes.
J. Biol. Chem. 276, 28075-28082.
Phatnani, H. P. and Greenleaf, A. L. (2006). Phosphorylation and functions of
the RNA polymerase II CTD. Genes Dev. 20, 2922-2936.
Price, D. H. (2000). P-TEFb, a cyclin-dependent kinase controlling elongation by
RNA polymerase II. Mol. Cell. Biol. 20, 2629-2634.
Saeki, H., Ohsumi, K., Aihara, H., Ito, T., Hirose, S., Ura, K. and Kaneda, Y.
(2005). Linker histone variants control chromatin dynamics during early
embryogenesis. Proc. Natl. Acad. Sci. USA 102, 5697-5702.
Schaner, C. E., Deshpande, G., Schedl, P. and Kelly, W. G. (2003). A conserved
chromatin architecture marks and maintains the restricted germ cell lineage in
worms and flies. Dev. Cell 5, 747-757.
Seki, Y., Yamaji, M., Yabuta, Y., Sano, M., Shigeta, M., Matsui, Y., Saga, Y.,
Tachibana, M., Shinkai, Y. and Saitou, M. (2007). Cellular dynamics
associated with the genome-wide epigenetic reprogramming in migrating
primordial germ cells in mice. Development 134, 2627-2638.
Seydoux, G. and Fire, A. (1994). Soma-germline asymmetry in the distributions
of embryonic RNAs in Caenorhabditis elegans. Development 120, 2823-2834.
Seydoux, G. and Dunn, M. A. (1997). Transcriptionally repressed germ cells lack
a subpopulation of phosphorylated RNA polymerase II in early embryos of
Caenorhabditis elegans and Drosophila melanogaster. Development 124, 21912201.
Seydoux, G., Mello, C. C., Pettitt, J., Wood, W. B., Priess, J. R. and Fire, A.
(1996). Repression of gene expression in the embryonic germ lineage of C.
elegans. Nature 382, 713-716.
Shilatifard, A. (2008). Molecular implementation and physiological roles for
histone H3 lysine 4 (H3K4) methylation. Curr. Opin. Cell Biol. 20, 341-348.
Sive, H., Grainger, R. and Harland, R. (2000). Early Development of Xenopus
laevis: A Laboratory Manual. Cold Spring Harbor, New York: Cold Spring Harbor
Laboratory Press.
Sklan, E. H., Podoly, E. and Soreq, H. (2006). RACK1 has the nerve to act:
structure meets function in the nervous system. Prog. Neurobiol. 78, 117-134.
Smith, R. C., Dworkin-Rastl, E. and Dworkin, M. B. (1988). Expression of a
histone H1-like protein is restricted to early Xenopus development. Genes Dev.
2, 1284-1295.
Stancheva, I. and Meehan, R. R. (2000). Transient depletion of xDnmt1 leads to
premature gene activation in Xenopus embryos. Genes Dev. 14, 313-327.
Stancheva, I., El-Maarri, O., Walter, J., Niveleau, A. and Meehan, R. R.
(2002). DNA methylation at promoter regions regulates the timing of gene
activation in Xenopus laevis embryos. Dev. Biol. 243, 155-165.
Steinbach, O. C., Wolffe, A. P. and Rupp, R. A. (1997). Somatic linker histones
cause loss of mesodermal competence in Xenopus. Nature 389, 395-399.
Strome, S. and Lehmann, R. (2007). Germ versus soma decisions, lessons from
flies and worms. Science 316, 392-393.
Takahashi, S., Yokota, C., Takano, K., Tanegashima, K., Onuma, Y., Goto, J.
and Asashima, M. (2000). Two novel nodal-related genes initiate early
inductive events in Xenopus Nieuwkoop center. Development 127, 5319-5329.
Timinszky, G., Bortfeld, M. and Ladurner, A. G. (2008). Repression of RNA
polymerase II transcription by a Drosophila oligopeptide. PLoS ONE 3, e2506.
Tomioka, M., Miya, T. and Nishida, H. (2002). Repression of zygotic gene
expression in the putative germline cells in ascidian embryos. Zool. Sci. 19, 4955.
Torras, R. and González-Crespo, S. (2005). Posterior expression of nanos
orthologs during embryonic and larval development of the anthozoan
Nematostella vectensis. Int. J. Dev. Biol. 49, 895-899.
DEVELOPMENT
Transcriptional repression in Xenopus PGCs
RESEARCH ARTICLE
Tsuda, M., Sasaoka, Y., Kiso, M., Abe, K., Haraguchi, S., Kobayashi, S. and
Saga, Y. (2003). Conserved role of nanos proteins in germ cell development.
Science 301, 1239-1241.
Van Doren, M., Williamson, A. L. and Lehmann, R. (1998). Regulation of zygotic
gene transcription in Drosophila primordial germ cells. Curr. Biol. 8, 243-246.
Venkataraman, T., Dancausse, E. and King, M. L. (2004). PCR-based Cloning
and Differential Screening of RNAs from Xenopus Primordial Germ Cells,
Cloning Uniquely Expressed RNAs from Rare Cells. In Methods in Molecular
Biology: Germ Cell Protocols (Molecular Embryo Analysis, Live Imaging,
Transgenesis and Cloning), Vol. 2 (ed. H. Schatten), pp. 67-78. Totowa: Humana
Press.
Wada, T., Takagi, T., Yamaguchi, Y., Watanabe, D. and Handa, H. (1998).
Evidence that P-TEFb alleviates the negative effect of DSIF on RNA polymerase IIdependent transcription in vitro. EMBO J. 17, 7395-7403.
Wang, D., Kennedy, S., Conte, D., Jr, Kim, J. K., Gabel, H. W., Kamath, R. S.,
Mello, C. C. and Ruvkun, G. (2005). Somatic misexpression of germline P
granules and enhanced RNA interference in retinoblastoma pathway mutants.
Nature 436, 593-597.
Whitfield, T., Heasman, J. and Wylie, C. (1993). XLPOU-60, a Xenopus POUdomain mRNA, is oocyte-specific from very early stages of oogenesis, and
localized to presumptive mesoderm and ectoderm in the blastula. Dev. Biol. 155,
361-370.
Whitington, P. M. and Dixon, K. E. (1975). Quantitative studies of germ plasm
and germ cells during early embryogenesis of Xenopus laevis. J. Embryol. Exp.
Morphol. 33, 57-74.
Development 137 (4)
Wilson, P. and Melton, D. (1994). Mesodermal patterning by an inducer gradient
depends on secondary cell-cell communication. Curr. Biol. 4, 676-686.
Wylie, C., Snape, A., Heasman, J. and Smith, J. C. (1987). Vegetal pole cells
and commitment to form endoderm in Xenopus laevis. Dev. Biol. 119, 496502.
Xanthos, J. B., Kofron, M., Wylie, C. and Heasman, J. (2001). Maternal VegT is
the initiator of a molecular network specifying endoderm in Xenopus laevis.
Development 128, 167-180.
Yamaguchi, Y., Takagi, T., Wada, T., Yano, K., Furuya, A., Sugimoto, S.,
Hasegawa, J. and Handa, H. (1999). NELF, a multisubunit complex containing
RD, cooperates with DSIF to repress RNA polymerase II elongation. Cell 97, 4151.
Yang, D., Welm, A. and Bishop, J. M. (2004). Cell division and cell survival in the
absence of survivin. Proc. Natl. Acad. Sci. USA 101, 15100-15105.
Yin, H. and Lin, H. (2007). An epigenetic activation role of Piwi and a Piwiassociated piRNA in Drosophila melanogaster. Nature 450, 304-308.
Zhang, C., Basta, T., Fawcett, S. R. and Klymkowsky, M. W. (2005). SOX7 is an
immediate-early target of VegT and regulates Nodal-related gene expression in
Xenopus. Dev. Biol. 278, 526-541.
Zhang, J. and King, M. L. (1996). Xenopus VegT RNA is localized to the vegetal
cortex during oogenesis and encodes a novel T-box transcription factor involved
in mesoderm patterning. Development 122, 4119-4129.
Zhang, J., Houston, D. W., King, M. L., Payne, C., Wylie, C. and Heasman, J.
(1998). The role of maternal VegT in establishing the primary germ layers in
Xenopus embryos. Cell 94, 515-524.
DEVELOPMENT
660