RESEARCH ARTICLE 3643
Development 137, 3643-3649 (2010) doi:10.1242/dev.057521
© 2010. Published by The Company of Biologists Ltd
Schwann cells reposition a peripheral nerve to isolate it from
postembryonic remodeling of its targets
Alya R. Raphael, Julie R. Perlin and William S. Talbot*
SUMMARY
Although much is known about the initial construction of the peripheral nervous system (PNS), less well understood are the
processes that maintain the position and connections of nerves during postembryonic growth. Here, we show that the posterior
lateral line nerve in zebrafish initially grows in the epidermis and then rapidly transitions across the epidermal basement
membrane into the subepidermal space. Our experiments indicate that Schwann cells, which myelinate axons in the PNS, are
required to reposition the nerve. In mutants lacking Schwann cells, the nerve is mislocalized and the axons remain in the
epidermis. Transplanting wild-type Schwann cells into these mutants rescues the position of the nerve. Analysis of chimeric
embryos suggests that the process of nerve relocalization involves two discrete steps – the degradation and recreation of the
epidermal basement membrane. Although the outgrowth of axons is normal in mutants lacking Schwann cells, the nerve
becomes severely disorganized at later stages. In wild-type embryos, exclusion of the nerve from the epidermis isolates axons
from migration of their targets (sensory neuromasts) within the epidermis. Without Schwann cells, axons remain within the
epidermis and are dragged along with the migrating neuromasts. Our analysis of the posterior lateral line system defines a new
process in which Schwann cells relocate a nerve beneath the epidermal basement membrane to insulate axons from the
postembryonic remodeling of their targets.
INTRODUCTION
Many studies have investigated the mechanisms of axonal
pathfinding that connect neurons to their targets in the developing
embryo (Bashaw and Klein, 2010). Axonal growth cones migrate
in response to attractive and repulsive cues, such as netrins,
semaphorins, ephrins and slits, to reach targets that are often
significant distances from the neuronal cell body (Bashaw and
Klein, 2010). Once the initial architecture of the nerve is
established, it must be able to respond to changes that occur during
postembryonic development, including extensive growth of the
organism and changes in tissue morphology. Little is known about
growth and remodeling of nerves and their targets after the initial
outgrowth of axons. In addition, many cell types are present in
mature peripheral nerves, including endothelial cells, fibroblasts,
cells of the immune system and Schwann cells (Gamble and
Goldby, 1961; Jessen and Mirsky, 2005), and the roles of these
non-neuronal cells that associate with axons in postembryonic
remodeling are unclear.
Schwann cells are a significant component of peripheral nerves
and play well established roles in ensheathing and myelinating
axons (Jessen and Mirsky, 2005). Additionally, Schwann cells
provide trophic support for axons and present cues that cluster
axonal sodium channels at the node of Ranvier (Jessen and Mirsky,
2005; Poliak and Peles, 2003). Recently, new roles for Schwann
cells have emerged, including elimination of ectopic sodium
channels from the internode (Voas et al., 2009), preventing the
premature differentiation of sensory organs (Grant et al., 2005),
Department of Developmental Biology, 279 Campus Drive, Beckman Center B300,
Stanford University, Stanford, CA 94305-5329, USA
*Author for correspondence ([email protected])
Accepted 27 August 2010
fasciculating the nerve (Gilmour et al., 2002) and preventing
oligodendrocytes from exiting the spinal cord (Kucenas et al.,
2009).
The posterior lateral line nerve (PLLn) is a prominent peripheral
nerve in zebrafish that innervates sensory organs called neuromasts,
which detect changes in water currents (Ghysen and DamblyChaudiere, 2007). The components of the posterior lateral line arise
from an ectodermal placode, the posterior portion of which forms
a primordium that migrates towards the posterior end of the
embryo and deposits clusters of cells that will give rise to the
neuromasts. The anterior half of the placode becomes neurons in
the ganglion of the PLLn, which will innervate the neuromasts of
the lateral line. An interesting variation of axonal pathfinding
occurs in the PLLn, where the precursors of the targets (i.e. the
primordium) and the associated axons grow out together (Gilmour
et al., 2004). Although Schwann cells are intimately associated
with the axons from an early stage, they do not appear to play a
role in axonal pathfinding (Gilmour et al., 2002).
The posterior lateral line system (nerve and neuromasts) initially
has a simple structure with only seven to eight neuromasts
distributed in a line down the midbody of the larva, but it rapidly
becomes more complicated, containing hundreds of neuromasts
widely distributed over the body of the adult (Ghysen and DamblyChaudiere, 2007). Additionally, the fish grows considerably in size
after the initial formation of the lateral line, so the PLLn must be
able to compensate both for the increased size and complexity of
the system. Finally, while the primordium migrates within the
epidermis (Metcalfe, 1985), which is the final position of the
neuromasts, the mature nerve is embedded within the subepidermal
space at the horizontal myoseptum, directly below the basement
membrane of the epidermis (Voas et al., 2009; Winklbauer, 1989).
How these complex changes in tissue architecture occur is not well
understood, including how the PLLn grows within the epidermis
but is ultimately excluded from it.
DEVELOPMENT
KEY WORDS: Schwann cell, Zebrafish, Posterior lateral line nerve, Basement membrane invasion, Postembryonic remodeling
3644 RESEARCH ARTICLE
Development 137 (21)
To learn more about the initial formation and remodeling of the
lateral line, we have investigated the development of the lateral line
system in embryonic and early larval stages. Ultrastructural studies
reveal that the entire nerve, including axons and Schwann cells, is
initially localized within the epidermis, superficial to the epidermal
basement membrane. Shortly after axon outgrowth, the epidermal
basement membrane is degraded and then reformed on the opposite
side of the nerve, so that the nerve is repositioned to its mature
location in the subepidermal space. The analysis of mutant and
chimeric embryos shows that Schwann cells are required for this
process of basement membrane degradation and regeneration. In
mutants lacking Schwann cells, nerves become progressively
disorganized as development proceeds, suggesting that the process
of basement membrane invasion is essential to maintain the
functional integrity of the nerve during postembryonic remodeling.
These results define a new role for Schwann cells in remodeling
tissues in the vicinity of nerves to ensure proper organization
during postembryonic growth.
MATERIALS AND METHODS
Fish strains
Zebrafish embryos were raised at 28.5°C and were staged as described
(Kimmel et al., 1995). The erbb2st61, erbb3st48 and sox10/clst3 mutants and
FoxD3:GFP(17) transgenic fish have been previously described (Gilmour et
al., 2002; Kelsh and Eisen, 2000; Lyons et al., 2005; Pogoda et al., 2006).
Genotyping
Transmission electron microscopy
Sample preparation for electron microscopy was performed as described
previously (Lyons et al., 2008) for 28 hours postfertilization (hpf), 3 days
postfertilization (dpf) and 5 dpf embryos; a minimum of three nerves from
three separate embryos were examined for each condition. Images were
collected on a Jeol TEM1230 and pseudocolored using Adobe Photoshop
software.
Immunohistochemistry and live imaging
Antibody staining for acetylated tubulin was performed following standard
methods as described previously (Lyons et al., 2005). FoxD3:GFP(17)
wild-type embryos were soaked in 1-phenyl-2-thiourea at a final
concentration of 0.2 mM following gastrulation to prevent melanization of
the pigment. For live imaging, embryos were anesthetized with 0.016%
Tricaine (w/v) and were mounted in 1.5% low melting agarose. Fluorescent
images were collected on a Zeiss Pascal LSM5 confocal microscope.
Generation of genetic chimeras
Wild-type embryos carrying the FoxD3:GFP transgene were injected with
1% Texas Red dextran. Labeled cells were transplanted at the blastula stage
into sox10/clst3 mutant hosts. Embryos were scored live at 3 dpf and 5 dpf
for GFP-positive Schwann cells along the PLLn and were imaged live as
described above. Embryos were then removed from the agarose and
processed for transmission electron microscopy (TEM).
RESULTS
The PLLn invades the subepidermal space
At 3 days postfertilization (dpf), the zebrafish PLLn is normally
localized just beneath the basement membrane that separates the
epidermis from the muscle (Voas et al., 2009). To determine the
localization of the PLLn during its initial outgrowth, we performed
transmission electron microscopy. At 28 hours postfertilization (hpf),
Fig. 1. The PLLn invades the epidermal basement membrane.
(A)28 hpf embryo with schematic of the PLLn superimposed. Schwann
cells are green, axons and the ganglion are red, and the primordium
and a pre-neuromast (asterisk) are blue. Broken lines refer to
approximate location of cross-sections shown in C and D. (B)Schematic
representation of the transition of the PLLn across the epidermal
basement membrane. Basement membrane is shown in black,
Schwann cells in green, axons in red, epidermal cells in yellow; only one
of two epidermal cell layers is shown. Broken lines correspond to crosssections in C-E. (C)At 28 hpf, the distal segments of axons and
associated Schwann cells of the PLLn are located within the epidermis
(n6). Arrowheads indicate the epidermal basement membrane. (D)At
locations more anterior to that shown in C at 28 hpf, the PLLn is found
in a transition state, with basement membrane located on both sides of
the nerve (arrowheads). Arrow indicates the end of the basement
membrane (n6). (E)By 3 dpf, the PLLn is found at its mature location,
medial to the epidermal basement membrane (arrowheads, n9). A
neuromast is present within the epidermis. (C⬘,C⬙,D⬘,D⬙,E⬘,E⬙) Higher
magnification of boxed regions in C,D,E, with and without
pseudocoloring. Scale bars: 2mm in C,D; 5mm in E; 1mm in C⬘,D⬘,E⬘.
Schwann cells are pseudocolored green, axons are red. Abbreviations:
D, dorsal; V, ventral; A, anterior; P, posterior; L, lateral; M, medial; ep,
epidermis; m, muscle; p, pigment.
the axons and Schwann cells in the posterior segment of the nerve,
which are close to the migrating primordium, are located within the
epidermis (Fig. 1A,C). At more anterior locations farther from the
primordium, the nerve can be found in a transitional state, with
basement membrane both above and below the nerve (Fig. 1A,D).
At later developmental stages, the nerve is located completely below
the basement membrane of the epidermis (Fig. 1E). Thus, the PLLn
transitions across the basement membrane from the epidermis into
the subepidermal space during its development (Fig. 1B).
Additionally, this transition occurs in an anterior to posterior fashion,
with more anterior segments of the nerve moving across the
basement membrane prior to more posterior segments (Fig. 1A,B).
DEVELOPMENT
The erbb2st61 and erbb3st48 mutations were genotyped as described (Lyons
et al., 2005). sox10/clst3 embryos were scored for lack of pigment and then
genotyped for the presence of the t3 insertion [using primers 5⬘
TGAAGTCCGACGAGGAAGAT 3⬘ (forward) and 5⬘ CACAGCTTCCCCAGTGTTTT 3⬘ (reverse)] that do not amplify a fragment in the
mutants.
Fig. 2. PLLn outgrowth is normal in Schwann cell-deficient
mutants. (A,B)At 28 hpf, axons and Schwann cells of heterozygous
siblings (A) and axons of erbb2st61 mutants (B) are located within the
epidermis (ep) (n3 in A and n6 in B), and are associated with preneuromast cells (pn). (A⬘,B⬘) Higher magnification of the boxed regions
in A,B, respectively. Arrowheads indicate the location of the epidermal
basement membrane. Scale bars: 5mm in A,B; 1mm in A⬘,B⬘. Schwann
cells are pseudocolored green and axons in red. Abbreviations: ep,
epidermis; m, muscle; pn, pre-neuromast cell.
The PLLn does not cross the basement membrane
in Schwann cell-deficient mutants
Sox10 is essential for the development of Schwann cells and other
neural crest derivatives (Kelsh et al., 2000; Kelsh and Eisen, 2000).
In Schwann cells, ErbB2 and ErbB3 form a heteromeric receptor
that is required for glial proliferation, migration and differentiation
(Lyons et al., 2005; Monk and Talbot, 2009; Nave and Salzer,
2006). We have previously reported that in mutants lacking
Schwann cells, including erbb2st61, erbb3st48 and sox10 (clst3)
mutants, the PLLn is aberrantly localized in the epidermis at 3 dpf
(Voas et al., 2009). To learn more about the development of the
PLLn in mutants lacking Schwann cells, we examined earlier and
later stages. At 28 hpf, the PLLn axons are in the epidermis of
erbb2st61 mutants (Fig. 2B), just as in wild-type siblings (Fig. 2A),
indicating that initial outgrowth of the nerve is normal, even in the
absence of Schwann cells. At 5 dpf, the wild-type nerve is properly
located beneath the epidermal basement membrane (Fig. 3A),
whereas the nerves of erbb2st61, sox10/clst3 and erbb3st48 mutants
remain in the epidermis (Fig. 3B,C; data not shown). These results
indicate that there is a complete failure of basement membrane
invasion in the absence of Schwann cells. Finally, defasciculation
of the nerve is evident in the mutants, as individual axons and small
groups of axons separate from the main axon bundle are frequently
observed (Fig. 3C; data not shown). These results suggest that
Schwann cells are essential for the nerve to cross the basement
membrane, reach its mature position and remain fasciculated in the
larva.
RESEARCH ARTICLE 3645
Schwann cells are required for the PLLn to
relocalize across the basement membrane
To further investigate whether Schwann cells are required to shift
the PLLn from the epidermis into the subepidermal space, we
performed transplantation experiments to generate genetic chimeras
in which Schwann cell-deficient mutants contained wild-type cells,
including some Schwann cells. Cells from wild-type embryos
carrying the FoxD3:GFP(17) transgene, which expresses green
fluorescent protein (GFP) in Schwann cells and other neural crest
derivatives (Gilmour et al., 2002), were transplanted into
sox10/clst3 mutant hosts, which lack all Schwann cells in the PLLn.
Chimeric embryos were screened for the presence of GFPexpressing (wild-type) Schwann cells in the PLLn and were then
processed for electron microscopy to determine the localization of
the nerve.
We analyzed 12 chimeras in which sox10/clst3 mutant embryos
had wild-type Schwann cells covering the entire length of the PLLn
(Fig. 4B). In these 12 chimeras, there were eight cases of complete
rescue of the nerve position (Fig. 4C), such that the chimeric nerve
occupied the mature wild-type position beneath the basement
membrane. There were also four cases of partial rescue, three of
which had nerves in the proper location deep to the basement
membrane, but with some residual basement membrane remaining
on the deep (i.e. muscle) side of the nerve (data not shown, similar
to Fig. 5C). In the fourth case of partial rescue, basement
membrane surrounded the nerve on both sides, suggesting that the
transplanted Schwann cells were unable to degrade the original
basement membrane deep to the nerve, but were nonetheless able
to initiate the formation of a new superficial membrane (Fig. 4D).
These results indicate that Schwann cells are required to correctly
position the PLLn within the subepidermal space.
We also analyzed four other chimeras in which sox10/clst3
mutant embryos had smaller clones of wild-type Schwann cells that
covered only the anterior segment of the PLLn (Fig. 5B). In the
anterior segments of the PLLn, all of these had partial rescue of the
nerve position, either with some residual deep basement membrane
(Fig. 5C; n1), equal basement membrane on both sides (data not
shown, similar to Fig. 4D; n2), or location in the epidermis but
surrounded by a circumferential basement membrane (Fig. 5E,F;
n1). The partial rescue of nerve position suggests that Schwann
cells were not present in sufficient numbers or at the correct stage
to degrade the original basement membrane completely in these
chimeras. We did not observe any evidence of rescue in the
posterior segments of these nerves, in which axons were not
associated with Schwann cells (Fig. 5D), indicating that Schwann
cells can only rescue the region of the nerve with which they are
associated. Finally, in all 16 chimeras with full or partial Schwann
cell coverage, myelination of the PLLn was rescued, indicating that
sox10 acts cell autonomously in Schwann cells to regulate
myelination (see insets in Figs 4, 5).
Movement across the epidermal basement
membrane protects the integrity of the PLL nerve
The foregoing results raise questions about the possible functions
of nerve relocalization. It has previously been reported that, by
3 dpf, the neuromasts of the PLLn begin to migrate ventrally
within the epidermis (Grant et al., 2005). Because the PLLn
remains in the epidermis with the neuromasts in mutants lacking
Schwann cells, we hypothesized that ventral migration of the
neuromasts might drag the mislocalized lateral line nerve and
cause the disorganization of the nerve that is observed in these
mutants (Gilmour et al., 2002; Lyons et al., 2005; Pogoda et al.,
DEVELOPMENT
Schwann cells reposition nerves
3646 RESEARCH ARTICLE
Development 137 (21)
2006) (Fig. 6). To test this hypothesis, we studied a time course
of wild-type and Schwann cell mutant (erbb2st61 and sox10/clst3;
erbb3st48 data not shown) nerves (Fig. 6). Consistent with
previous studies (Gilmour et al., 2002), wild-type and mutants
nerves are indistinguishable from each other at 48 hpf, a stage
before the neuromasts begin to migrate (Fig. 6A,F,K). Beginning
at 3 dpf, however, as neuromasts are migrating ventrally (Grant
et al., 2005) (Fig. 6B), the mutant nerves began to undulate and
defasciculate (Fig. 6G,L); this phenotype worsened over time
(Fig. 6G-J,L-O). In the mutants, the nerves were always the most
severely disorganized in the anterior segments, where
neuromasts first begin to migrate ventrally (Fig. 6). Additionally,
whereas the wild-type neuromasts migrate ventrally away from
the PLLn, which remains anchored at the horizontal myoseptum,
mutant neuromasts are often found close to the disorganized
nerve (arrowheads, Fig. 6). Finally, when mutant nerves at 5 dpf
were studied using transmission electron microscopy, they often
remained closely associated with neuromasts (10/19 mutant
nerves examined, data not shown, Fig. 3B,C), whereas wild-type
nerves were well separated from the neuromasts by this stage
(Fig. 6; data not shown). These results support the possibility
that moving the PLLn from the epidermis into the subepidermal
space is crucial for protecting the nerve from being pulled
ventrally along with the migrating neuromasts in the larva (Fig.
6A-E).
DISCUSSION
As development progresses, organs that are initially built in a small
embryo must grow to the adult size. The organism must be able to
adapt to these changes in size while maintaining functionality of
the organs. This is certainly true of the nervous system, where
connections are initially established in the embryo and then
maintained during extensive growth of the organism. Here, we
present a process by which the posterior lateral line nerve in
zebrafish initially forms in the epidermis and then rapidly
transitions out of the epidermis, below the epidermal basement
membrane. Our evidence suggests that repositioning the nerve
protects it from the remodeling of its targets in the epidermis and
maintains its integrity during the continued growth of the fish.
Our analysis defines a new role for Schwann cells in breaching
and reforming the epidermal basement membrane to properly
position the lateral line nerve. We find that the wild-type PLLn,
including Schwann cells and axons, initially grows within the
epidermis but then crosses the epidermal basement membrane to
invade the subepidermal space (Fig. 1). This transition occurs early
in development, while the distal region of the nerve is still growing.
Additionally, in mutants lacking Schwann cells, including erbb2st61,
erbb3st48 and sox10/clst3, the nerve is aberrantly located within the
epidermis, and this results in significant disorganization of the
nerve (Figs 3, 6). The phenotypic similarity of these mutants
suggests that the abnormal nerve localization results from the loss
of Schwann cells, rather than a specific function of any of these
genes in the process of basement membrane remodeling itself.
Transplantation of wild-type Schwann cells into sox10/clst3 mutants
restores the nerve to its normal position beneath the epidermal
basement membrane (Figs 4, 5). Therefore, Schwann cells are
required for the local degradation and immediate reformation of the
basement membrane on the opposite side of the nerve.
Basement membrane invasion defines a mode of axon
localization that is distinct from axonal growth cone pathfinding.
In the PLLn, the axons grow out along with the primordia of their
final targets (Gilmour et al., 2004), the neuromasts, in the
epidermis and then are moved along their entire length by the
Schwann cells associated with the nerve. In addition, the segments
of the axon farthest from the growth cone are the first to be moved
across the basement membrane. It appears that interactions between
Schwann cells and their local environment regulate the transition
of the PLLn across the epidermal basement membrane. This most
likely occurs through short-range or contact-dependent signaling,
because Schwann cells are only competent to move segments of
the nerve with which they are associated (Fig. 5C,D). In addition,
it appears that this mode of nerve localization is distinct from the
DEVELOPMENT
Fig. 3. The PLLn is
mislocalized in mutants
lacking Schwann cells. (A)At 5
dpf, the PLLn of wild-type
siblings has migrated from the
epidermis (ep), across the
basement membrane
(arrowheads) into the muscle (m)
(n28). (B,C)By contrast, at 5
dpf in the Schwann cell-deficient
mutants erbb2st61 (B) and
sox10/clst3 (C), the PLLn remains
in the epidermis, outside of the
basement membrane
(arrowheads, n7 in B and n6
in C). Defasciculation of the
mutant nerves is also observed
(asterisk, C). (A⬘,B⬘,C⬘) Higher
magnification of boxed regions
in A,B,C, respectively. Scale bars:
2mm in A,B,C; 1mm in A’,B’,C’.
Schwann cells are pseudocolored
green and axons red.
Abbreviations: ep, epidermis; m,
muscle; p, pigment; n,
neuromast cell.
Fig. 4. Full-length clones of transplanted wild-type Schwann cells
can rescue nerve position in sox10/clst3 mutants. (A)Wild-type 3
dpf embryo carrying the FoxD3:GFP(17) transgene, labeling the PLLn,
motor nerves and some pigment cells. (B)FoxD3:GFP(17) cells have
been transplanted into a sox10/clst3 mutant host, creating a clone of
wild-type Schwann cells that traverse the entire length of the PLLn (3
dpf). (C)Transplanted wild-type Schwann cells can reposition the
mutant nerve in the subepidermal space, below the basement
membrane (arrowheads). (D)Transplanted wild-type Schwann cells
partially rescue the mutant nerve, positioning it within the epidermal
basement membrane (arrowheads). Insets show the presence of
myelinated axons in C,D. Scale bars: 200mm for A,B; 2mm for C,D.
Schwann cells are pseudocolored green and axons red in C,D.
Abbreviations: ep, epidermis; m, muscle.
delamination of newborn neurons from ectodermal placodes to
form sensory ganglia, including the PLLn ganglia (Schlosser,
2002). In ganglion formation, neurons delaminate from the
ectoderm and migrate into the mesenchyme to coalesce with neural
crest cells (Baker and Bronner-Fraser, 2001; Shiau et al., 2008),
whereas in the transition of the PLLn, Schwann cells, which are
neural crest derivatives, are present in the epidermis and move with
the axons into the subepidermal space.
Our results demonstrate that localization of the lateral line nerve
occurs in two key phases. First, axons grow with precursors of their
target neuromasts, ensuring proper connectivity and function at early
stages (Gilmour et al., 2004). Next, associated Schwann cells
relocalize the axons across the epidermal basement membrane. The
postembryonic remodeling of the lateral line sensory organs begins
with migration of neuromasts and interneuromast cells ventrally
within the epidermis by 72 hpf (Grant et al., 2005) (Fig. 6). By this
time in wild type, the nerve has crossed the basement membrane and
is therefore compartmentalized from neuromast migration. In
mutants lacking Schwann cells, however, the nerve remains in the
epidermis and is towed along with ventrally migrating neuromasts,
resulting in progressive defasciculation and mislocalization from the
horizontal myoseptum. Our data suggest that the transition of the
PLLn from the epidermis into the subepidermal space insulates the
nerve from the extensive postembryonic remodeling of the lateral
line neuromasts by anchoring the nerve at the horizontal myoseptum.
The transition of the nerve across the basement membrane
involves two distinct processes: the basement membrane deep to
the nerve is degraded while a new basement membrane
RESEARCH ARTICLE 3647
Fig. 5. Shorter length clones of transplanted wild-type Schwann
cells can partially rescue the position of sox10/clst3 mutant
nerves. (A)Wild-type 5 dpf embryo carrying the FoxD3:GFP(17)
transgene, labeling the PLLn [dorsal (d) and midbody (mb, tracts],
motor nerves and some pigment cells. (B)A clone of wild-type,
FoxD3:GFP(17) cells that are present on the dorsal and anterior regions
of the midbody tract of the PLLn. (C,D)Micrographs of the anterior (C)
and posterior (D) regions of a partial length clone of rescued Schwann
cells, as shown in B. (C)Wild-type Schwann cells rescue the position of
the mutant nerve, but a part of the old basement membrane remains
(arrows). Inset in C shows the presence of myelinated axons. (D)The
posterior region of the nerve lacks Schwann cells and is not rescued,
remaining within the epidermis. (E,F)In this chimera, wild-type
Schwann cells failed to rescue the position of the PLLn, but induced the
formation of an ectopic basement membrane surrounding the nerve in
the epidermis (arrows). (F)Higher magnification of boxed area in E.
Arrowheads indicate the epidermal basement membrane; arrows
indicate ectopic basement membrane. Scale bars: 200mm for A,B; 2mm
for C,D,F; 5mm for E. Schwann cells are pseudocolored green and
axons red in C-E. Abbreviations: d, dorsal tract; mb, midbody tract; ep,
epidermis; m, muscle.
superficial to the nerve forms. Schwann cells appear to play an
active role in both processes, as Schwann cells are required for
the degradation of the basement membrane and can induce the
formation of a new basement membrane even when the old one
has not been degraded or when the nerve is improperly localized
(Fig. 3; Fig. 4D; Fig. 5E,F). Because Schwann cells can express
matrix metalloproteases (MMPs) (Ferguson and Muir, 2000; La
Fleur et al., 1996; Lehmann et al., 2009; Mantuano et al., 2008),
which cleave extracellular matrix components (Page-McCaw et
al., 2007), and can secrete a basement membrane that surrounds
DEVELOPMENT
Schwann cells reposition nerves
3648 RESEARCH ARTICLE
Development 137 (21)
Fig. 6. Nerves become disorganized during development in mutants lacking Schwann cells. (A-O)Antibody staining for acetylated tubulin
shows the position of the PLLn. (A-E)Wild-type nerves remain anchored at the horizontal myoseptum and run straight along the length of the
embryo at all times examined (48 hpf, 3-6 dpf), but the neuromasts migrate ventrally over time (arrowheads). Some axons branch from the main
bundle to innervate individual neuromasts. (F-O)Nerves in erbb2st61 (F-J) and sox10/clst3 (K-O) mutants appear normal at 48 hpf but become
progressively disorganized (3-6 dpf) and often track with migrating neuromasts (arrowheads). Excess neuromasts are present in nerves lacking
Schwann cells (F-O). Asterisks indicate the presence of pigment cells. Scale bar: 50mm.
individual neurons). Thus, as we show here in the lateral line nerve,
Schwann cells may be important for positioning nerves in other
sensory organs.
Acknowledgements
We thank members of our laboratory, David Kingsley and Alex Schier for
helpful discussion; Tuky Reyes for excellent fish care; and John Perrino for TEM
support. A.R.R. is supported by a Stanford Graduate Fellowship and by an NIH
training grant. J.R.P. is supported by the Stanford Genome Training Program
and a Stanford Graduate Fellowship. This work was supported by NIH grant
NS050223 to W.S.T. Deposited in PMC for release after 12 months.
Competing interests statement
The authors declare no competing financial interests.
References
Baker, C. V. and Bronner-Fraser, M. (2001). Vertebrate cranial placodes. I.
Embryonic induction. Dev. Biol. 232, 1-61.
Bashaw, G. J. and Klein, R. (2010). Signaling from axon guidance receptors. Cold
Spring Harbor Perspect. Biol. 2, a001941.
Boulais, N. and Misery, L. (2008). The epidermis: a sensory tissue. Eur. J.
Dermatol. 18, 119-127.
Ferguson, T. A. and Muir, D. (2000). MMP-2 and MMP-9 increase the neuritepromoting potential of Schwann cell basal laminae and are upregulated in
degenerated nerve. Mol. Cell. Neurosci. 16, 157-167.
Fernandez, C., Goldberg, J. M. and Baird, R. A. (1990). The vestibular nerve of
the chinchilla. III. Peripheral innervation patterns in the utricular macula. J.
Neurophysiol. 63, 767-780.
Fuchs, E. and Horsley, V. (2008). More than one way to skin. Genes Dev. 22,
976-985.
Gamble, H. J. and Goldby, S. (1961). Mast cells in peripheral nerve trunks.
Nature 189, 766-767.
Ghysen, A. and Dambly-Chaudiere, C. (2007). The lateral line microcosmos.
Genes Dev. 21, 2118-2130.
Gilmour, D. T., Maischein, H. M. and Nusslein-Volhard, C. (2002). Migration
and function of a glial subtype in the vertebrate peripheral nervous system.
Neuron 34, 577-588.
Gilmour, D., Knaut, H., Maischein, H. M. and Nusslein-Volhard, C. (2004).
Towing of sensory axons by their migrating target cells in vivo. Nat. Neurosci. 7,
491-492.
Grant, K. A., Raible, D. W. and Piotrowski, T. (2005). Regulation of latent
sensory hair cell precursors by glia in the zebrafish lateral line. Neuron 45, 69-80.
DEVELOPMENT
mature nerves (Prockop and Kivirikko, 1995), the simplest
possibility is that Schwann cells directly secrete a new basement
membrane superficial to the PLLn while degrading the deep
basement membrane.
MMPs mediate basement membrane invasion in many contexts,
including leukocyte invasion and anchor cell invasion in C. elegans
(Madsen and Sahai, 2010; Page-McCaw et al., 2007; Sherwood et
al., 2005; Yadav et al., 2003). Additionally, Schwann cells activate
MMP expression following nerve injury, and MMPs have been
implicated in Schwann cell myelination (Ferguson and Muir, 2000;
La Fleur et al., 1996; Lehmann et al., 2009; Mantuano et al., 2008).
Intriguingly, MMP2 was recently shown to have a role in
degrading the basement membrane to allow dendrite remodeling in
Drosophila sensory neurons (Yasunaga et al., 2010). Future
experiments will determine whether MMPs or other enzymes are
involved in basement membrane remodeling.
The process of localizing a nerve below a basement membrane
to protect it from the remodeling of its targets is likely to be a
common feature of sensory epithelia. In many sensory structures,
including the tongue, epidermis, nose, vestibular organ and lateral
line, innervated receptive organs or free nerve endings are located
within the epithelium, whereas the main nerve plexus is located
below the epithelial basement membrane (Boulais and Misery,
2008; Fernandez et al., 1990; Nedelec et al., 2005; Northcutt, 2004;
Oakley and Witt, 2004; Purcell and Perachio, 1997; Si et al., 2003;
Winklbauer, 1989). These are tissues, with the exception of the
inner ear hair cells in mammals, where there is frequent turnover
of the epithelium or the sensory cells themselves. For example,
taste receptors and olfactory neurons are constantly reborn and
replaced throughout life, and the epidermis is continually being
sloughed off and replaced (Fuchs and Horsley, 2008; Nedelec et al.,
2005; Oakley and Witt, 2004). Perhaps separating innervating
axons from their targets protects the nerve from the turnover of its
targets (or, in the case of the nasal epithelium, the turnover of
Jessen, K. R. and Mirsky, R. (2005). The origin and development of glial cells in
peripheral nerves. Nat. Rev. Neurosci. 6, 671-682.
Kelsh, R. N. and Eisen, J. S. (2000). The zebrafish colourless gene regulates
development of non-ectomesenchymal neural crest derivatives. Development
127, 515-525.
Kelsh, R. N., Dutton, K., Medlin, J. and Eisen, J. S. (2000). Expression of
zebrafish fkd6 in neural crest-derived glia. Mech. Dev. 93, 161-164.
Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B. and Schilling, T. F.
(1995). Stages of embryonic development of the zebrafish. Dev. Dyn. 203, 253310.
Kucenas, S., Wang, W. D., Knapik, E. W. and Appel, B. (2009). A selective glial
barrier at motor axon exit points prevents oligodendrocyte migration from the
spinal cord. J. Neurosci. 29, 15187-15194.
La Fleur, M., Underwood, J. L., Rappolee, D. A. and Werb, Z. (1996).
Basement membrane and repair of injury to peripheral nerve: defining a
potential role for macrophages, matrix metalloproteinases, and tissue inhibitor
of metalloproteinases-1. J. Exp. Med. 184, 2311-2326.
Lehmann, H. C., Kohne, A., Bernal, F., Jangouk, P., Meyer Zu Horste, G.,
Dehmel, T., Hartung, H. P., Previtali, S. C. and Kieseier, B. C. (2009). Matrix
metalloproteinase-2 is involved in myelination of dorsal root ganglia neurons.
Glia 57, 479-489.
Lyons, D. A., Pogoda, H. M., Voas, M. G., Woods, I. G., Diamond, B., Nix, R.,
Arana, N., Jacobs, J. and Talbot, W. S. (2005). erbb3 and erbb2 are essential
for Schwann cell migration and myelination in zebrafish. Curr. Biol. 15, 513-524.
Lyons, D. A., Naylor, S. G., Mercurio, S., Dominguez, C. and Talbot, W. S.
(2008). KBP is essential for axonal structure, outgrowth and maintenance in
zebrafish, providing insight into the cellular basis of Goldberg-Shprintzen
syndrome. Development 135, 599-608.
Madsen, C. D. and Sahai, E. (2010). Cancer dissemination-lessons from
leukocytes. Dev. Cell 19, 13-26.
Mantuano, E., Inoue, G., Li, X., Takahashi, K., Gaultier, A., Gonias, S. L. and
Campana, W. M. (2008). The hemopexin domain of matrix metalloproteinase-9
activates cell signaling and promotes migration of Schwann cells by binding to
low-density lipoprotein receptor-related protein. J. Neurosci. 28, 11571-11582.
Metcalfe, W. K. (1985). Sensory neuron growth cones comigrate with posterior
lateral line primordial cells in zebrafish. J. Comp. Neurol. 238, 218-224.
Monk, K. R. and Talbot, W. S. (2009). Genetic dissection of myelinated axons in
zebrafish. Curr. Opin. Neurobiol. 19, 486-490.
Nave, K. A. and Salzer, J. L. (2006). Axonal regulation of myelination by
neuregulin 1. Curr. Opin. Neurobiol. 16, 492-500.
RESEARCH ARTICLE 3649
Nedelec, S., Dubacq, C. and Trembleau, A. (2005). Morphological and
molecular features of the mammalian olfactory sensory neuron axons: what
makes these axons so special? J. Neurocytol. 34, 49-64.
Northcutt, R. G. (2004). Taste buds: development and evolution. Brain Behav.
Evol. 64, 198-206.
Oakley, B. and Witt, M. (2004). Building sensory receptors on the tongue. J.
Neurocytol. 33, 631-646.
Page-McCaw, A., Ewald, A. J. and Werb, Z. (2007). Matrix metalloproteinases
and the regulation of tissue remodelling. Nat. Rev. Mol. Cell Biol. 8, 221-233.
Pogoda, H. M., Sternheim, N., Lyons, D. A., Diamond, B., Hawkins, T. A.,
Woods, I. G., Bhatt, D. H., Franzini-Armstrong, C., Dominguez, C., Arana,
N. et al. (2006). A genetic screen identifies genes essential for development of
myelinated axons in zebrafish. Dev. Biol. 298, 118-131.
Poliak, S. and Peles, E. (2003). The local differentiation of myelinated axons at
nodes of Ranvier. Nat. Rev. Neurosci. 4, 968-980.
Prockop, D. J. and Kivirikko, K. I. (1995). Collagens: molecular biology, diseases,
and potentials for therapy. Annu. Rev. Biochem. 64, 403-434.
Purcell, I. M. and Perachio, A. A. (1997). Three-dimensional analysis of vestibular
efferent neurons innervating semicircular canals of the gerbil. J. Neurophysiol.
78, 3234-3248.
Schlosser, G. (2002). Development and evolution of lateral line placodes in
amphibians. I. Development. Zoology 105, 119-146.
Sherwood, D. R., Butler, J. A., Kramer, J. M. and Sternberg, P. W. (2005). FOS1 promotes basement-membrane removal during anchor-cell invasion in C.
elegans. Cell 121, 951-962.
Shiau, C. E., Lwigale, P. Y., Das, R. M., Wilson, S. A. and Bronner-Fraser, M.
(2008). Robo2-Slit1 dependent cell-cell interactions mediate assembly of the
trigeminal ganglion. Nat. Neurosci. 11, 269-276.
Si, X., Zakir, M. M. and Dickman, J. D. (2003). Afferent innervation of the
utricular macula in pigeons. J. Neurophysiol. 89, 1660-1677.
Voas, M. G., Glenn, T. D., Raphael, A. R. and Talbot, W. S. (2009). Schwann
cells inhibit ectopic clustering of axonal sodium channels. J. Neurosci. 29,
14408-14414.
Winklbauer, R. (1989). Development of the lateral line system in Xenopus. Prog.
Neurobiol. 32, 181-206.
Yadav, R., Larbi, K. Y., Young, R. E. and Nourshargh, S. (2003). Migration of
leukocytes through the vessel wall and beyond. Thromb. Haemost. 90, 598-606.
Yasunaga, K., Kanamori, T., Morikawa, R., Suzuki, E. and Emoto, K. (2010).
Dendrite reshaping of adult Drosophila sensory neurons requires matrix
metalloproteinase-mediated modification of the basement membranes. Dev. Cell
18, 621-632.
DEVELOPMENT
Schwann cells reposition nerves