#861
animal
Animal (2015), 9:9, pp 1500–1508 © The Animal Consortium 2015
doi:10.1017/S1751731115000828
Creep-feeding to stimulate metabolic imprinting in nursing
beef heifers: impacts on heifer growth, reproductive and
physiological variables
M. M. Reis1, R. F. Cooke1a†, B. I. Cappellozza1, R. S. Marques1, T. A. Guarnieri Filho1,2,
M. C. Rodrigues1,2, J. S. Bradley3, C. J. Mueller4, D. H. Keisler5, S. E. Johnson3 and
D. W. Bohnert1
Eastern Oregon Agricultural Research Center, Oregon State University, Burns, OR 97720, USA; 2Faculdade de Medicina Veterinária e Zootecnia, UNESP – Univ.
Estadual Paulista, Programa de Pós-Graduação em Zootecnia, Botucatu, SP 18618-970, Brazil; 3Department of Animal and Poultry Sciences, Virginia Tech University.
Blacksburg, VA 24061, USA; 4Eastern Oregon Agricultural Research Center, Oregon State University, Union, OR 97883, USA; 5Division of Animal Sciences, University
of Missouri, Columbia, MO 65211, USA
1
(Received 3 March 2015; Accepted 19 April 2015; First published online 20 May 2015)
This experiment compared growth, physiological, and reproductive responses of beef heifers with (MI) or without (CON) access to
a creep-feeder, as a manner to stimulate metabolic imprinting while nursing their dams. On day 0, 60 Angus × Hereford heifers
were ranked by BW and age (140 ± 3 kg and 68 ± 3 days), and assigned to pairs so all ranking criteria were similar between heifers
within each pair. On day 1, pairs were randomly assigned to MI (n = 15) or CON (n = 15). From day 1 to 51, MI pairs and their
dams were allocated to 15 drylot pens where heifers had ad libitum access to a corn-based supplement through a creep-feeder.
The CON pairs and their dams were maintained in an adjacent single drylot pen. From day 52 to 111, treatments were managed
as a single group on a semiarid range pasture. On day 111, heifers were weaned and allocated to two pastures (one pasture/
treatment), receiving hay and a corn-based concentrate until day 326. Heifer BW was recorded before and at the end of the creepfeeding period (day 1 to 51), and on days 112 and 326. On days 0, 51, 111, 187, 261, and 325, jugular blood was collected and
real-time ultrasonography for longissimus muscle depth and backfat thickness assessment was performed. Blood was also collected
every 10 days from days 113 to 323 for puberty evaluation via plasma progesterone. Liver and subcutaneous fat biopsies were
performed on days 51, 111, 261 and 325. Average daily gain was greater ( P < 0.01) for MI than CON from day 1 to 51, tended
( P = 0.09) to be greater for CON than MI from day 112 to 326, while BW on day 326 was similar between treatments. On day 51,
MI had greater ( P ⩽ 0.01) plasma IGF-I and glucose concentrations, as well as mRNA expression of hepatic pyruvate carboxylase
and adipose fatty acid synthase than CON. On days 261 and 325, plasma insulin concentrations were greater ( P ⩽ 0.03) in CON
than MI. Mean mRNA expression of hepatic IGF-I and adipose peroxisome proliferator-activated receptor gamma were greater
( P ⩽ 0.05) in MI than CON. No treatment effects were detected for puberty attainment rate. In conclusion, supplementing nursing
heifers via creep-feeding for 50 days altered physiological and biochemical variables suggestive of a metabolic imprinting effect,
but did not hasten their puberty attainment.
Keywords: growth, heifer, physiology, puberty, supplementation
Implications
Feeding a high-concentrate supplement to nursing beef
heifers for 50 days did not enhance their post-weaning
body development, physiological responses, and puberty
a
Dr Reinaldo Cooke is also affiliated as permanent professor to the Programa de
Pós-Graduação em Zootecnia/Faculdade de Medicina Veterinária e Zootecnia,
UNESP – Univ Estadual Paulista, Botucatu, SP 18618-970, Brazil.
†
E-mail: [email protected]
1500
attainment. However, supplemented heifers had long-term
increases in biochemical variables suggestive of metabolic
imprinting, which is defined as biological responses to a
nutritional intervention during early life that permanently
alters physiological outcomes later in life. Perhaps a longer
period of creep-feeding may be required to further increase
supplement intake in nursing beef heifers, and effectively
enhance body and reproductive development via metabolic
imprinting effects.
Metabolic imprinting in creep-fed beef heifers
Introduction
For optimal economic return and lifetime productivity, beef
heifers should attain puberty by 12 months of age (Lesmeister et al., 1973). Age at puberty in cattle is highly influenced
by nutritional status and body development (Schillo et al.,
1992). Hence, nutritional interventions that improve nutrient
utilization, body fat accretion, and increase circulating
concentrations of hormones that facilitate the puberty
process, such as IGF-I and leptin, are known to hasten puberty attainment in heifers (Williams et al., 2002; Cooke et al.,
2008). Metabolic imprinting, defined as biological responses
to a nutritional intervention during early life that permanently alters physiological outcomes later in life (Du et al.,
2010), has been shown to enhance nutrient metabolism and
fat accretion in cattle (Graugnard et al., 2010; Moriel et al.,
2014a). Scheffler et al. (2014) reported that feeding a highconcentrate diet to early-weaned beef steers from 100 to
205 days of age enhanced carcass marbling compared with
forage-fed steers weaned at 205 days of age. Moriel et al.
(2014b) reported earlier onset of puberty in heifers weaned
at 72 days of age and fed a concentrate-based diet for
90 days compared with forage-fed cohorts weaned at
252 days of age. Thus, management to stimulate metabolic
imprinting may accelerate puberty in heifers by enhancing
nutrient utilization and lipogenesis, although this hypothesis
needs further investigation. However, Scheffler et al. (2014)
and Moriel et al. (2014b) evaluated early-weaned beef cattle,
and research assessing metabolic imprinting events in cattle
normally weaned at 6 to 7 months of age is still warranted.
One alternative to evaluate metabolic imprinting effects
without the need for early weaning is to provide supplements
to nursing cattle via creep-feeding. Therefore, the objective
of this experiment was to compare growth, reproductive, and
physiological responses of beef heifers with or without
access to a creep-feeder while nursing their dams, as a
manner to stimulate metabolic imprinting.
Materials and methods
Animals
This experiment was conducted at the Oregon State University
– Eastern Oregon Agricultural Research Center from May 2013
to April 2014, and was divided into three phases: imprinting
phase (day 1 to 51), pre-weaning phase (day 52 to 111), and
development phase (day 112 to 326). All animals utilized in this
experiment were cared for in accordance with acceptable
practices and experimental protocols reviewed and approved
by the Oregon State University, Institutional Animal Care and
Use Committee (ACUP # 4446). Sixty nulliparous, nursing
Angus × Hereford heifers (initial age = 68 ± 3 days; initial
BW = 140 ± 3 kg) were assigned to the experiment. On day 0,
heifers were ranked by BW and age, and dam age and body
condition score (BCS; Wagner et al., 1988). Heifers were
assigned to pairs in a manner that all ranking criteria were
similar between heifers within each pair (CV ⩽ 10%).
Pairs were randomly assigned to: (1) ad libitum access
to a corn-based supplement through a creep-feeder for 50 days
(MI; n = 15); or (2) no supplementation (CON; n = 15).
The supplementation period and length (day 1 to 51;
imprinting phase) was selected to initiate metabolic imprinting
events before the allometric period of mammary growth, when
excessive average daily gain (ADG; i.e. >1.0 kg/day) may
impair heifer mammary gland development and future milk
yield (Buskirk et al., 1996).
Diets
During the imprinting phase, MI heifer pairs and their
respective dams were allocated to 15 drylot pens (two cows
and heifers/pen; 7 × 20 m). Each drylot pen had a creepfeeder (2.0 × 2.5 m) that allowed both heifers to have
simultaneous access to a pelletized corn-based supplement
(Table 1), which was offered daily in amounts to ensure
ad libitum consumption. Heifers were allocated by pairs with
similar BW within each pen to ensure fair competition to
creep-feeder access. Heifer pairs from the CON group and
their respective dams were maintained in a single adjacent
drylot pen (30 × 70 m) within the same feeding facility, with
no access to the corn-based supplement. Cows from both
treatments received (0800 h) and readily consumed 8.1 kg of
dry matter/cow daily of meadow-grass hay and 5.4 kg of dry
matter/cow daily of mixed alfalfa-grass hay during the
imprinting phase. Hay consumption by heifer calves from
both treatments was negligible given that heifer height was
insufficient to reach feed bunks containing hay, whereas milk
is still the major dietary component of calves at this age
(Ansotegui et al., 1991). Cattle from CON and MI treatments
were exposed to the same stocking rate (70 m2/cow–calf
pair), and cows from both treatment groups had the same
linear bunk space (1.0 m/cow).
During the pre-weaning phase, cows and heifers from both
treatments were managed as a single group on a 6500 ha
semiarid range pasture with no supplementation (Ganskopp
and Bohnert, 2009). On day 111, heifers were weaned and
treatment groups were maintained separately in one of two
meadow foxtail (Alopecurus pratensis L.) pastures (6 ha/
pasture) harvested for hay the previous summer, where they
remained throughout the development phase. Treatment
groups were rotated between pastures every 10 days to
account for any potential effects of pasture on the variables
evaluated herein. During the development phase, heifers
received 5.0 kg/heifer of mixed alfalfa-grass hay daily (dry
matter basis). Heifers also received a corn-based supplement
at a daily rate of (dry matter basis) 1.6 kg/heifer from day 112
to 185, 2.5 kg/heifer from day 186 to 276 and 3.4 kg/heifer
from day 277 to 325 (Table 1). Hay and supplement were
offered to both treatment groups at 1000 h. During the
development phase, pastures had no forage available for
grazing, whereas both treatment groups always received and
readily consumed the same daily amount of hay and
corn-based supplement. Throughout the experiment, water
and a commercial mineral and vitamin mix (Cattleman’s
Choice; Performix Nutrition Systems, Nampa, ID, USA)
containing 14% Ca, 10% P, 16% NaCl, 1.5% Mg, 6000 ppm
1501
Reis, Cooke, Cappellozza, Marques, Guarnieri Filho, Rodrigues, Bradley, Mueller, Keisler, Johnson and Bohnert
Table 1 Composition and nutrient profile of supplements offered during the experiment1
Development phase
Ingredients (% dry matter)
Ground corn
Soybean meal
Dehydrated alfalfa
Sugarcane molasses
Nutrient profile (dry matter basis)1
Total digestible nutrients (%)2
Net energy for maintenance (Mcal/kg)3
Net energy for gain (Mcal/kg)3
CP (%)
NDF (%)
Starch (%)
Ether extract (%)
Imprinting phase
Period 1
Period 2
Period 3
70
15
10
5
56
44
—
—
72
28
—
—
80
20
—
—
80
1.93
1.30
17.5
15.4
44.0
3.1
86
2.11
1.56
28.6
7.6
39.2
3.6
87
2.09
1.53
21.4
6.7
50.4
4.1
88
2.08
1.52
17.9
6.2
56.0
4.4
Imprinting phase = day 1 to 51; development phase, period 1 = day 112 to 185; development phase, period 2 = day 186 to 276; development phase, period 3 = day
277 to 325. Values obtained from a commercial laboratory wet chemistry analysis (Dairy One Forage Laboratory, Ithaca, NY, USA).
Calculated according to the equations described by Weiss et al. (1992).
3
Calculated with the following equations (NRC, 2000): Net energy for maintenance = 1.37 metabolizable energy –0.138 (metabolizable energy)2 + 0.0105 (metabolizable energy)3–1.12; Net energy for gain = 1.42 metabolizable energy –0.174 (metabolizable energy)2 + 0.0122 (metabolizable energy)3–0.165, given that metabolizable energy = digestible energy × 0.82, and 1 kg of total digestible nutrients = 4.4 Mcal of digestible energy.
1
2
Zn, 3200 ppm Cu, 65 ppm I, 900 ppm Mn, 140 ppm Se,
136 IU/g of vitamin A, 13 IU/g of vitamin D3, and 0.05 IU/g of
vitamin E, were offered for ad libitum consumption for cows
and heifers.
Sampling
Hay and supplement samples were collected at the beginning
of the experiment, and analyzed for nutrient content by a
commercial laboratory (Dairy One Forage Laboratory, Ithaca,
NY, USA). Samples were analyzed in triplicates by wet
chemistry procedures for ether-extractable fat content (Thiex
et al., 2003), CP (method 984.13; AOAC, 2006), ADF
(method 973.18 modified for use in an Ankom 200 fiber
analyzer, Ankom Technology Corp., Fairport, NY; AOAC,
2006), NDF (Van Soest et al., 1991; method for use in an
Ankom 200 fiber analyzer, Ankom Technology Corp.) and
starch (YSI 2700 SELECT Biochemistry Analyzer; YSI Inc.,
Yellow Springs, OH, USA). Calculations for total digestible
nutrients (TDN) used the equations proposed by Weiss et al.
(1992), whereas net energy for lactation, net energy for
maintenance, and net energy for gain were calculated with
the equations proposed by the NRC (2000). Nutritive value
(dry matter basis) of the meadow-grass and mixed alfalfagrass hay, respectively, were 56% and 63% TDN, 65% and
34% NDF, 41% and 24% ADF, 1.04 and 1.50 Mcal/kg of net
energy for lactation, 1.08 and 1.41 Mcal/kg of net energy for
maintenance, 0.53 and 0.83 Mcal/kg of net energy for gain,
and 8.2% and 20.0% CP. Composition and nutritive value of
supplements offered during the experiment are described in
Table 1.
During the imprinting phase, supplement intake was evaluated daily from each pen by collecting and weighing refusals
at 0700 h. Samples of the offered and non-consumed
1502
supplement were collected from each pen and dried for 96 h at
50°C in forced-air ovens for dry matter calculation. Supplement intake of each pen was divided by the number of heifers
within each pen, and expressed as kg per heifer/day. For ADG
calculation, heifers were weighed on two consecutive days to
determine BW before (days −1 and 0) and at the end of the
imprinting phase (days 50 and 51). Individual shrunk BW (after
16 h of feed and water restriction) was recorded on days 112
and 326. Cow BW and BCS were also recorded on day 0 of the
experiment. On days 0, 51, 111, 187, 261 and 325, heifers
were evaluated for longissimus muscle (LM) depth and backfat
thickness via real-time ultrasonography (0800 h). Ultrasound
measurements were obtained at the 12th to 13th-rib interface
by an experienced technician using an Aloka 500 V (Aloka Co.
Ltd, Wallingford, CT, USA) B-mode instrument equipped
with a 3.5-MHz, 125 mm general purpose transducer array
(UST-5011U-3.5). Images were collected by a single technician
with software from the Cattle Performance Enhancement
Company (CPEC, Oakley, KS, USA). Estimates of LM depth and
backfat thickness were based on image analysis programming
(Brethour, 1994) contained within the CPEC software.
Concurrent with each ultrasound exam, blood samples were
collected for determination of plasma glucose, insulin, IGF-1,
and leptin concentrations. In addition, blood samples were
collected on 10-day intervals during the development phase to
estimate onset of puberty by determining the first pubertal
increase in plasma progesterone concentrations. Heifers were
considered pubertal once plasma progesterone concentrations
were ⩾1.0 ng/ml, followed by a cyclic pattern of plasma progesterone < and ⩾1.0 ng/ml suggestive of normal estrous
cycles (Day et al., 1984). Puberty attainment was declared at the
first sampling that resulted in plasma progesterone ⩾1.0 ng/ml.
On days 51, 111, 261 and 325, liver and subcutaneous fat
Metabolic imprinting in creep-fed beef heifers
samples were collected via biopsy immediately after each blood
sampling. On day 51, one heifer within each pen was assigned
randomly to liver biopsy, and the remaining heifer assigned to
subcutaneous fat biopsy. On the subsequent sampling days
(days 111, 261 and 325), heifer biopsy assignment was alternated in a manner that two liver and two subcutaneous fat
samples were collected from all heifers assigned to the experiment. Liver samples (average 100 mg of tissue, wet weight)
were collected between the 11th and 12th ribs by percutaneous
needle biopsy (Arthington and Corah, 1995), and analyzed via
real-time quantitative reverse transcription (RT)-PCR for IGF-I,
pyruvate carboxylase (PC), and cyclophilin mRNA expression.
Subcutaneous fat samples (average 2 g of tissue, wet weight)
were collected from the tailhead according to the technique
described by Rule and Beitz (1986), and analyzed for adipocyte
morphometry and mRNA expression of leptin, fatty acid
synthase (FASN), peroxisome proliferator-activated receptor
gamma (PPARγ) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) via real-time quantitative RT-PCR. Liver and
subcutaneous fat samples were selected for biopsy and further
laboratorial analysis because hepatocytes and adipocytes are
the main cells responsible for IGF-I and leptin synthesis,
respectively (Houseknecht et al., 1998; Yakar et al., 1999),
which are hormones that modulate puberty attainment in
heifers (Williams et al., 2002; Cooke et al., 2008) and are
directly associated with the main hypothesis of this experiment.
Laboratory analysis
Blood samples. Blood samples were collected via jugular
venipuncture into commercial blood collection tubes (Vacutainer, 10 ml; Becton Dickinson, Franklin Lakes, NJ, USA)
containing 158 US Pharmacopeial Convention units of
freeze-dried sodium heparin for plasma collection. All blood
samples were placed immediately on ice, subsequently centrifuged (2500 × g for 30 min; 4°C) for plasma harvest, and
stored at −80°C on the same day of collection. Plasma glucose concentration was determined using a quantitative
colorimetric kit (#G7521; Pointe Scientific Inc., Canton, MI,
USA). Plasma IGF-I concentration was determined using a
human-specific commercial ELISA kit (SG100; R&D Systems
Inc., Minneapolis, MN, USA) with 100% cross-reactivity with
bovine IGF-I and previously validated for bovine samples
(Cooke et al., 2012). Plasma leptin concentration was
determined by radioimmunoassay according to procedures
described by Delavaud et al. (2000). Plasma insulin and
progesterone concentrations were analyzed using a chemiluminescent enzyme immunoassay (Immulite 1000; Siemens
Medical Solutions Diagnostics, Los Angeles, CA, USA) with
100% cross-reactivity with the respective bovine hormone.
Nevertheless, the insulin procedure was validated for bovine
samples using pools of plasma collected from yearling beef
heifers immediately before (0 h), 0.5, and 2 h following an
intravenous glucose administration (0.25 g of glucose/kg of
BW) and analyzed in triplicates. Mean insulin concentrations
were 3.73 ± 0.04, 56.80 ± 0.51 and 3.11 ± 0.02 µIU/ml for
pools collected at 0, 0.5 and 2 h relative to glucose administration. The progesterone procedure was also validated for
bovine samples using charcoal-stripped bovine serum
(Sigma-Aldrich Corp., St. Louis, MO, USA) enriched with
known concentrations of progesterone (0.0, 0.5, 1.0, 2.5, 5.0
and 10.0 ng/ml) and analyzed in triplicates. The mean
r 2 value between the expected and observed results among
samples with known progesterone concentrations was
0.971 ± 0.004, and mean progesterone concentrations were
Table 2 Primer sequences, accession number, and reference for all gene transcripts analyzed by real-time reverse trancriptase-PCR
Target gene
Primer sequence
Cyclophilin
Forward
GGTACTGGTGGCAAGTCCAT
Reverse
GCCATCCAACCACTCAGTCT
Fatty acid synthase
Forward
GCATCGCTGGCTACTCCTAC
Reverse
GTGTAGGCCATCACGAAGGT
Glyceraldehyde-3-phosphate dehydrogenase
Forward
ACCCAGAAGACTGTGGATGG
Reverse
CAACAGACACGTTGGGAGTG
IGF-I
Forward
CTCCTCGCATCTCTTCTATCT
Reverse
ACTCATCCACGATTCCTGTCT
Leptin
Forward
TCGTGACCTTCTTTGGGATTT
Reverse
CACACTGGAATACTTCCCTCT C
Peroxisome proliferator-activated receptor gamma
Forward
TGCCATCAGGTTTGGGCGCAT
Reverse
CGCCCTCGCCTTTGCTTTGG
Pyruvate carboxylase
Forward
CCAACGGGTTTCAGAGACAT
Reverse
TGAAGCTGTGGGCAACATAG
Accession no.
Source
NM_178320.2
Cooke et al. (2008)
NM_001012669.1
Welch et al. (2013)
NM_001034034
Cerri et al. (2012)
NM_001077828
Cooke et al. (2008)
NM_173928.2
Perkins et al. (2014)
NM_181024.2
Moriel et al. (2014a)
NM_177946.3
Cooke et al. (2008)
1503
Reis, Cooke, Cappellozza, Marques, Guarnieri Filho, Rodrigues, Bradley, Mueller, Keisler, Johnson and Bohnert
(ng/ml) 0.06 ± 0.01, 0.58 ± 0.02, 1.13 ± 0.08, 2.6 ± 0.04,
5.77 ± 0.09 and 11.13 ± 0.25 for, respectively, plasma enriched with 0.0, 0.5, 1.0, 2.5, 5.0 and 10.0 ng/ml of progesterone. The intra- and inter-assay CV were, respectively,
4.64% and 6.18% for glucose, 1.20% and 4.70% for insulin,
4.09% and 10.94% for IGF-I, and 6.03% and 6.15% for
progesterone. All samples were analyzed for leptin concentration within a single assay, and the intra-assay CV was
7.11%. The minimum detectable concentrations were 0.02
µIU/ml for insulin, and 0.056, 0.10 and 0.10 ng/ml for IGF-I,
leptin, and progesterone, respectively.
Tissue samples. Immediately after collection, all liver samples
and ~1 g of each fat sample were placed in RNA stabilization
solution (RNAlater, Ambion Inc., Austin, TX, USA), maintained at 4°C for 24 h, and stored at −80°C until processing
for real-time quantitative RT-PCR (Table 2) with the StepOne
Real-time PCR system (Applied Biosystems, Foster City, CA,
USA) according to procedures described by Cooke et al.
(2008).
The remaining 1 g of each fat sample was placed on ice
immediately after collection, and stored at −80°C until
processing for adipocyte morphometry evaluation. Adipose
samples were embedded in NEG50 cutting media (RichardAllan Scientific, Kalamazoo, MI, USA) and cryosections
(10 µm) were collected onto Superfrost Plus glass slides
(Thermo Fisher Scientific, Waltham, MA, USA). Slides were
stained sequentially with eosin Y (Richard-Allan Scientific)
and 4,4-difluoro-4-bora-3a,4a-diaza-s-indacene (BODIPY,
Life Technologies, Grand Island, NY, USA) for the detection
of extracellular structures and lipid, respectively. Images
were captured at 200-fold magnification with a Nikon Eclipse
Ti-E inverted microscope (Nikon, Melville, NY, USA) equipped
with epifluorescence using a CoolSnap CCD camera (Photometrics, Tucson, AZ, USA). Adipocyte size was measured
with NIS Elements (Nikon). Four cryosections from each
sample were used for all analysis, and number of adipocytes
evaluated per cryosection averaged 25.9 ± 2.1 and
27.4 ± 2.3 for CON and MI, respectively
Statistical analysis
Treatments evaluated herein were based on consumption of
the corn-based supplement during the imprinting phase.
Although the CON treatment was imposed to heifers individually (all CON heifers consumed 0 kg/day of corn-based
supplement during the imprinting phase), heifer pair was
considered the experimental unit for CON and MI to ensure
equal experimental unit structure as well as random variation
and repeated measure calculation between treatments.
Growth, body composition, and physiological data were
analyzed using the MIXED procedure of SAS (SAS Institute
Inc., Cary, NC, USA) and Satterthwaite approximation to
determine the denominator degrees of freedom for the tests
of fixed effects. The model statement used for cow BW, BCS,
days in milk, age on day 0 of the experiment, and heifer ADG
within each phase contained the fixed effect of treatment.
The model statement used for analysis of blood variables,
1504
gene expression, subcutaneous adipocyte morphometry, BW
and body composition contained the fixed effects of treatment, sampling day and the resultant interaction. Data were
analyzed using pair(treatment) and heifer(pair) as random
variables. The specified term used in the repeated statement
was sampling day, the subject was heifer(pair), and the
covariance structure used was autoregressive, which provided the best fit for these analyses according to the Akaike
information criterion. Puberty data were analyzed using the
GLIMMIX procedure of SAS (SAS Institute Inc.). The model
statement used contained the effects of treatment, sampling
day and the resultant interaction. Data were also analyzed
using pair(treatment) and heifer(pair) as random variables.
Results are reported as least square means and separated
using LSD. For all analyses, significance was set at P ⩽ 0.05,
and tendencies were determined if P > 0.05 and P ⩽ 0.10.
Results are reported according to main effects if no interactions were significant, or according to highest-order interaction detected.
Results and discussion
Heifer growth and body composition
Cow milk yield was not evaluated in the present experiment
to estimate milk consumption and its contribution to heifer
daily nutrient intake during the imprinting phase. Nevertheless, cows nursing CON and MI heifers were Angus ×
Hereford receiving the same limited-fed diet, and had similar
(P ⩾ 0.72) age (4.6 and 4.9 years, respectively; s.e.m. = 0.6),
days in milk (67.9 and 69.0 days, respectively; s.e.m. = 6.4),
BW (499 and 505 kg, respectively; s.e.m. = 13), and BCS
(4.94 and 4.95, respectively; s.e.m. = 0.05) at the beginning
of the experiment to mitigate potential differences in heifer
milk intake, given these variables are known to impact milk
production in cattle (NRC, 2000).
During the imprinting phase, average daily intake of cornbased supplement by MI heifers was 1025 ± 128 g/heifer,
which corresponded to 0.83 ± 0.09% of heifer BW based on
the average BW during the imprinting phase (Table 3). The MI
heifers had greater (P < 0.01) ADG during the imprinting
phase, which resulted in a tendency (P = 0.10) for a greater
BW on day 51 compared with CON cohorts (Table 3). During
the pre-weaning phase, ADG was similar (P = 0.80) between
treatments, whereas BW on day 112 still tended (P = 0.10) to
be greater for MI compared with CON heifers (Table 3). During
the development phase, CON tended (P = 0.09) to have
greater ADG compared with MI heifers, resulting in similar
(P = 0.87) BW among treatments on day 326 (Table 3) even
though both treatment groups received the same limit-fed
diet. Given that MI heifers were heavier and had greater
nutritional requirements (NRC, 2000) compared with CON
heifers at the beginning of the development phase (day 112;
Table 3), CON heifers likely had more dietary nutrients available for growth, resulting in differences detected for ADG
between treatments during this phase. Moriel et al. (2014b)
observed similar results when comparing early-weaned heifers
Metabolic imprinting in creep-fed beef heifers
receiving or not a high-concentrate diet for 180 days after
weaning, and subsequently maintained on pasture for
7 months. The reason why a similar outcome was not detected
on pre-weaning ADG herein (Table 3) is unclear. Perhaps MI
heifers were capable of consuming more forage when maintained under range conditions, due to their greater BW during
this phase (Table 3), compared with CON cohorts (Ansotegui
et al., 1991; NRC, 2000).
Despite treatment effects detected for ADG and BW at the
end of the imprinting phase, MI and CON heifers had similar
mean backfat thickness (P = 0.68) and LM depth (P = 0.49;
Table 4). Accordingly, no treatment effects were detected for
mean subcutaneous adipocyte cell area (P = 0.48) or density
(P = 0.68; Table 4), given that backfat thickness is determined by subcutaneous adipocyte morphometry (Schoonmaker et al., 2004). Supporting our findings, Scheffler et al.
(2014) reported increased marbling, but similar backfat
thickness and LM area, upon slaughter in early-weaned
steers fed a high-concentrate diet from 100 to 205 days of
age compared with forage-fed steers weaned at 205 days of
age. Moriel et al. (2014b) also failed to demonstrate metabolic imprinting responses on backfat thickness and LM area,
estimated via real-time ultrasonography, in replacement beef
heifers. Collectively, results from this experiment indicate
that providing ad libitum creep-feeder access to nursing
heifers, as a manner to promote metabolic imprinting, did
not impact post-weaning growth and body composition
variables, including LM development and subcutaneous fat
deposition via hyperplasia (adipocyte density) or hypertrophy
(adipocyte area).
Physiological variables
Treatment × day interactions were detected for plasma glucose (P = 0.02), insulin (P = 0.05), and IGF-I (P < 0.01).
Table 3 BW and average daily gain (ADG) of nursing beef heifers
receiving (MI; n = 15) or not (CON, n = 15) a corn-based supplement
for ad libitum consumption through a creep-feeder for 50 days1,2
Item
CON
Imprinting phase (day 1 to 51)
BW on day 1 (kg)
103
BW on day 51 (kg)
127
ADG (kg/day)
0.49
Pre-weaning phase (day 51 to 112)
BW on day 112 (kg)
161
ADG (kg/day)
0.50
Development phase (day 112 to 326)
BW on day 326 (kg)
337
ADG (kg/day)
0.84
1
MI
s.e.
P-value
105
143
0.75
6
6
0.03
0.84
0.10
<0.01
175
0.49
6
0.03
0.10
0.80
339
0.79
9
0.02
0.87
0.09
Heifers received or not a corn-based supplement from day 1 to 51 (imprinting
phase) of the experiment via creep-feeding while nursing their dams. From day
52 to 111 (pre-weaning phase), cows and heifers from both treatments were
managed as a single group on a semiarid range pasture. On day 111, heifers
were weaned and allocated to two pastures according to treatment until day
325 of the experiment (development phase).
2
Values reported on days 1 and 51 are the average full BW collected on days −1
and 0, and 50 and 51, respectively. On days 112 and 326, shrunk BW was
recorded after a 16 h of feed and water restriction.
Heifers assigned to MI had greater (P < 0.01) plasma concentrations of glucose and IGF-I on day 51 compared with
CON heifers (Table 5). This outcome can be attributed to
supplement intake of MI heifers during imprinting phase,
given that plasma concentrations of glucose and IGF-I are
positively associated with nutrient intake and reflect nutritional status in beef cattle (Vizcarra et al., 1998; Hess et al.,
2005). Conversely, plasma insulin concentration was similar
(P = 0.99) among treatments on day 51, but greater for CON
heifers on days 261 and 325 (P ⩽ 0.03) compared with MI
heifers (Table 5). The lack of treatment effects on plasma
insulin on day 51 was unexpected because circulating insulin
is also positively regulated by nutrient intake and glucose
concentrations (Vizcarra et al., 1998). On the other hand, the
greater plasma insulin concentration in CON heifers on days
261 and 325 support treatment trends (P = 0.09) detected
on ADG during the development phase (Table 3), corroborating that CON heifers had more dietary nutrients available
for growth during this period (Yelich et al., 1995; Hess et al.,
2005). No treatment effects were detected (P = 0.35) on
plasma leptin concentrations (Table 5), although circulating
leptin concentration is regulated by nutrient intake and
insulin (Houseknecht et al., 1998). However, adipose tissues
are the main site of leptin synthesis in ruminants, whereas
body fat content directly regulates circulating leptin concentrations (Houseknecht et al., 1998). Hence, the lack of
treatment effects on backfat thickness and subcutaneous
adipocyte morphometry (Table 4) supports, at least in part,
the similar leptin concentrations between MI and CON heifers throughout the experiment (Table 5).
No treatment effects were detected (P = 0.78) for mRNA
expression of subcutaneous adipocyte leptin (Table 6), which
parallels the lack of treatment effect for plasma leptin
concentrations (Table 5). Treatment × day interactions were
detected for mRNA expression of hepatic PC (P < 0.01) and
subcutaneous adipocyte FASN (P = 0.08). Heifers assigned
Table 4 Mean body composition and subcutaneous adipocyte morphometry of nursing beef heifers receiving (MI; n = 15) or not (CON,
n = 15) a corn-based supplement for ad libitum consumption through
a creep-feeder for 50 days1
Item
Body composition2
Backfat thickness (mm)
LM depth (mm)
Adipocyte morphometry3
Area (µm)
Density (cells/mm)
CON
MI
s.e.
P-value
4.14
46.7
4.20
47.3
0.10
0.6
0.68
0.49
2920
253
3202
240
276
23
0.48
0.68
1
Heifers received or not a corn-based supplement from day 1 to 51 (imprinting
phase) of the experiment via creep-feeding while nursing their dams. From day
52 to 111 (pre-weaning phase), cows and heifers from both treatments were
managed as a single group on a semiarid range pasture. On day 111, heifers
were weaned and allocated to two pastures according to treatment until day
325 of the experiment (development phase).
2
Evaluated via real-time ultrasonography on days 0, 51, 111, 187, 261, and 325
as described by Cooke et al. (2012).
3
Subcutaneous fat samples were collected (Rule and Beitz, 1986) on days 51,
111, 261, and 325 of the experiment.
1505
Reis, Cooke, Cappellozza, Marques, Guarnieri Filho, Rodrigues, Bradley, Mueller, Keisler, Johnson and Bohnert
Table 5 Plasma concentrations of glucose, insulin, IGF-I, and leptin of
nursing beef heifers receiving (MI; n = 15) or not (CON; n = 15) a
corn-based supplement for ad libitum consumption through a creepfeeder for 50 days1,2
Item
Plasma glucose (mg/dl)
Day 0
Day 51
Day 111
Day 187
Day 261
Day 325
Plasma insulin (µIU/ml)
Day 0
Day 51
Day 111
Day 187
Day 261
Day 325
Plasma IGF-I (ng/ml)
Day 0
Day 51
Day 111
Day 187
Day 261
Day 325
Plasma leptin (ng/ml)
CON
MI
s.e.
P-value
98.2
65.9
66.6
78.6
76.6
77.8
99.8
72.6
67.6
75.6
79.8
78.8
1.6
1.6
1.6
1.6
1.6
1.6
0.47
<0.01
0.63
0.18
0.14
0.63
2.01
2.34
6.68
5.09
9.56
4.61
2.04
2.34
5.97
4.16
6.16
2.42
0.69
0.69
0.69
0.69
0.69
0.69
0.97
0.99
0.46
0.34
<0.01
0.03
124.3
52.1
32.4
65.4
128.5
138.8
4.16
121.3
73.8
33.3
63.3
123.6
144.6
4.34
4.3
4.3
4.3
4.3
4.3
4.3
0.14
0.61
<0.01
0.88
0.73
0.42
0.34
0.35
1
Heifers received or not a corn-based supplement from day 1 to 51 (imprinting
phase) of the experiment via creep-feeding while nursing their dams. From day
52 to 111 (pre-weaning phase), cows and heifers from both treatments were
managed as a single group on a semiarid range pasture. On day 111, heifers
were weaned and allocated to two pastures according to treatment until day
325 of the experiment (development phase).
2
Blood samples were collected on days 0, 51, 111, 187, 261, and 325 of the
experiment. Treatment × day interactions were detected for plasma glucose
(P = 0.02), insulin (P = 0.05), and IGF-I (P < 0.01); therefore, means are
reported and separated within each sampling day.
to MI had greater (P < 0.01) mRNA expression of PC on day
51 compared with CON heifers (Table 6), which corroborates
with treatment effects on growth and plasma glucose on day
51 because PC mRNA expression is positively associated with
nutrient intake (Cooke et al., 2008) and glucose synthesis in
cattle (Greenfield et al., 2000). Heifers assigned to MI had
greater (P = 0.01) mRNA expression of FASN on day 51
compared with CON heifers (Table 6); an enzyme that modulates de novo lipogenesis and is up-regulated by rate of
nutrient intake (Duckett et al., 2009). Moreover, MI heifers
had greater mean mRNA expression of subcutaneous adipocyte PPARγ (P = 0.05), which regulates adipocyte development via triglyceride uptake (Rosen and MacDougald,
2006), and hepatic IGF-I (P < 0.01) compared with CON
heifers (Table 6). Hence, MI heifers had increased adipocyte
mRNA expression of FASN on day 51 and a long-term
increase in mRNA expression of PPARγ during the experimental period, despite the lack of treatment effects on
backfat thickness and subcutaneous adipocyte size and
density (Table 4). Similarly, MI heifers had a long-term
increase in mRNA expression of hepatic IGF-I, whereas
1506
plasma IGF-I concentrations only differed between treatments on day 51 (Table 5). Nevertheless, mRNA expression
can be increased without equivalent translation into the final
product (Clancy and Brown, 2008). Moriel et al. (2014a and
2014b) reported that high-concentrate diets increased
hepatic mRNA expression of hepatic IGF-I or muscle PPARγ
without concurrent changes in plasma IGF-I concentration,
carcass marbling, or backfat thickness in early-weaned cattle. Graugnard et al. (2010) also reported altered PPARγ and
FASN mRNA expression in the longissimus lumborum, but
similar carcass marbling score, in beef steers receiving highor low-starch diets for 112 days after weaning at 5 months of
age. Therefore, MI heifers had transient and permanent
increases in mRNA expression of genes associated with
nutrient metabolism and lipogenesis compared with CON
heifers, suggesting metabolic imprinting effects due to creepfeeding. However these outcomes were not translated into
enhanced growth or subcutaneous fat accretion during the
experiment. It is also important to note that subcutaneous
fat samples were only collected from the tailhead, whereas
different treatment outcomes could have been detected
if samples were collected from other adipose tissues
(Bonnet et al., 2010)
Puberty attainment
No treatment effects were detected (P = 0.76) on rate of
heifer puberty attainment (Figure 1). Hence, proportion of
heifers pubertal at the end of the experiment were similar
(P = 0.60) between CON and MI (58.9% v. 65.0% of pubertal heifers on day 323; respectively; s.e.m. = 8.3%). The
main hypothesis of the experiment was that providing a highconcentrate supplement to nursing heifers via creep-feeding
would promote metabolic imprinting events that hasten
puberty attainment compared with non-supplemented heifers. This hypothesis was developed based on two premises:
(1) puberty in cattle is highly influenced by nutritional status
and body development (Schillo et al., 1992), including growth
rate, body fat accretion, and circulating concentrations of
hormones associated with nutrient metabolism and lipogenesis such as IGF-I and leptin (Williams et al., 2002; Cooke
et al., 2008), and (2) management systems that stimulate
metabolic imprinting enhance nutrient metabolism and body
fat accretion in cattle (Graugnard et al., 2010; Scheffler et al.,
2014; Moriel et al., 2014a). Supporting our rationale, Moriel
et al. (2014b) reported reduced age and BW at puberty in
heifers weaned at 72 days of age and fed a high-concentrate
diet for 90 days compared with forage-fed cohorts weaned at
252 days of age. Gasser et al. (2006) observed that beef
heifers weaned at 112 days of age and fed a corn-based diet
for 10 week reached puberty sooner than forage-fed contemporaries. However, the similar rate of puberty attainment
between MI and CON heifers in the present experiment do not
support our hypothesis, but parallels the similar subcutaneous
fat accretion and plasma concentrations of IGF-I and
leptin between treatments during the peripubertal period
(Schillo et al., 1992; Williams et al., 2002; Cooke et al., 2008).
Hepatic genes (relative fold change)
IGF-I
62.9
83.4
PC
Day 51
13.7
21.2
Day 111
11.7
10.6
Day 261
2.6
4.5
Day 325
4.9
3.7
Adipose genes (relative fold change)
Leptin
14.0
13.0
PPARγ
1.93
2.40
FASN
Day 51
40.7
527
Day 111
64.0
219.8
Day 261
776
730
Day 325
925
977
323
313
303
293
283
273
263
253
243
233
223
213
203
<0.01
0.50
0.24
0.52
193
1.2
1.2
1.1
1.3
183
<0.01
173
4.8
163
P-value
153
s.e.
CON
143
MI
133
CON
MI
123
Item
100
90
80
70
60
50
40
30
20
10
0
113
Table 6 Expression of hepatic and adipose genes associated with
nutrient metabolism (IGF-I, pyruvate carboxylase [PC], and leptin) and
lipogenesis (peroxisome proliferator-activated receptor gamma
[PPARγ] and fatty acid synthase [FASN]) in nursing beef heifers
receiving (MI; n = 15) or not (CON, n = 15) a corn-based supplement
for ad libitum consumption through a creep-feeder for 50 days1,2,3
Proportion of pubertal
heifers (%)
Metabolic imprinting in creep-fed beef heifers
Day of the experiment
2.6
0.16
0.78
0.05
131
210
126
138
0.01
0.61
0.79
0.79
1
Heifers received or not a corn-based supplement from day 1 to 51 (imprinting
phase) of the experiment via creep-feeding while nursing their dams. From day
52 to 111 (pre-weaning phase), cows and heifers from both treatments were
managed as a single group on a semiarid range pasture. On day 111, heifers
were weaned and allocated to two pastures according to treatment until day
325 of the experiment (development phase).
2
Liver (according to Arthington and Corah, 1995) and adipose (according to Rule and
Beitz, 1986) samples were collected on days 51, 111, 261, and 325 of the experiment.
3
Values are expressed as relative fold change (Cooke et al., 2008). Treatment × day
interactions were detected for mRNA expression of PC (P < 0.01) and FASN
(P = 0.08); therefore, means are reported and separated within each sampling day.
Figure 1 Puberty attainment of nursing beef heifers receiving (MI;
n = 15) or not (CON, n = 15) a corn-based supplement from day 1 to 51
of the experiment via creep-feeding while nursing their dams. From day
52 to 111, cows and heifers from both treatments were managed as a
single group on a semiarid range pasture. On day 111, heifers were
weaned and allocated to two pastures according to treatment until day
325. Puberty was estimated based from blood samples collected every
10 days from day 113 to 323. Heifers were considered pubertal once
plasma progesterone concentrations were ⩾1.0 ng/ml, followed by a
cyclic pattern of plasma progesterone < and ⩾1.0 ng/ml indicative of
normal estrous cycles. Puberty attainment was declared at the first
sampling that resulted in plasma progesterone ⩾1.0 ng/ml. No treatment
effects were detected (P = 0.76).
Acknowledgments
The Eastern Oregon Agricultural Research Center, including the
Burns and Union Stations, is jointly funded by the Oregon
Agricultural Experiment Station and USDA-ARS. Financial support for this research was provided by the Agricultural Research
Foundation. Appreciation is expressed to F. Cooke, A. Nyman,
T. Runnels, L. Carlon, J. Ranches, C. Ramos, I. Bueno, and
W. Freitas (Oregon State University) for their assistance.
References
Overall conclusions
This experiment found no evidence that providing a
high-concentrate supplement to nursing heifers via creepfeeding benefits post-weaning growth, subcutaneous fat
accretion, plasma hormones that regulate puberty attainment such as IGF-I and leptin, as well as heifer age and BW at
puberty. Perhaps the length and rate of supplementation
utilized herein were insufficient to impact the aforementioned variables, despite the long-term increase in hepatic
IGF-I and adipose PPARγ mRNA expression that suggests a
metabolic imprinting effect (Du et al., 2010). Heifers utilized
by Gasser et al. (2006) and Moriel et al. (2014b) consumed a
corn-based diet for, respectively, 10 week at 2.5% to 3.0% of
heifer BW or 90 days at 3.5% of heifer BW. In the present
experiment, MI heifers consumed a free-choice corn-based
supplement for 50 days at 0.83% of heifer BW. This
supplementation length was selected to prevent detrimental
effects on heifer mammary gland development (Buskirk
et al., 1996), and voluntary supplement intake was limited
because milk was still the major component of heifer
diets (Ansotegui et al., 1991). Therefore, a longer period
of creep-feeding for nursing beef heifers may be required
to further increase their concentrate intake, and effectively
enhance body and reproductive development via metabolic
imprinting effects.
Ansotegui RP, Havstad KM, Wallace JD and Hallford DM 1991. Effects of milk
intake on forage intake and performance of suckling range calves. Journal of
Animal Science 69, 899–904.
AOAC 2006. Official methods of analysis, 18th edition. Association of Official
Analytical Chemsts, Arlington, VA, USA.
Arthington JD and Corah LR 1995. Liver biopsy procedures for determining the
trace mineral status in beef cows. Part II. (Video, AI 9134). Kansas State University, Manhattan, KS, USA.
Bonnet M, Cassar-Malek I, Chilliard Y and Picard B 2010. Ontogenesis of muscle
and adipose tissues and their interactions in ruminants and other species. Animal 4, 1093–1109.
Brethour JR 1994. Estimating marbling score in live cattle from ultrasound
images using pattern recognition and neural network procedures. Journal of
Animal Science 72, 1425–1432.
Buskirk DD, Faulkner DB, Hurley WL, Kesler DJ, Ireland FA, Nash TG, Castree JC and
Vicini JL 1996. Growth, reproductive performance, mammary development,
and milk production of beef heifers as influenced by prepubertal dietary energy and
administration of bovine somatotropin. Journal of Animal Science 74, 2649–2662.
Cerri RLA, Thompson IM, Kim IH, Ealy AD, Hansen PJ, Staples CR, Li JL, Santos
JEP and Thatcher WW 2012. Effects of lactation and pregnancy on gene
expression of endometrium of Holstein cows at day 17 of the estrous cycle or
pregnancy. Journal of Dairy Science 95, 5657–5675.
Clancy S and Brown W 2008. Translation: DNA to mRNA to protein. Nature
Education 1, 101.
Cooke RF, Arthington JD, Araujo DB, Lamb GC and Ealy AD 2008. Effects of
supplementation frequency on performance, reproductive, and metabolic responses
of Brahman-crossbred females. Journal of Animal Science 86, 2296–2309.
Cooke RF, Cappellozza BI, Reis MM, Bohnert DW and Vasconcelos JLM 2012.
Plasma progesterone concentration in beef heifers receiving exogenous glucose,
insulin, or bovine somatotropin. Journal of Animal Science 90, 3266–3273.
1507
Reis, Cooke, Cappellozza, Marques, Guarnieri Filho, Rodrigues, Bradley, Mueller, Keisler, Johnson and Bohnert
Day ML, Imakawa K, Garcia-Winder M, Zalesky DD, Schanbacher BD, Kittok RJ
and Kinder JE 1984. Endocrine mechanisms of puberty in heifers: estradiol
negative feedback regulation of luteinizing hormone secretion. Biology of
Reproduction 31, 332–341.
Delavaud C, Bocquier F, Chilliard Y, Keisler DH, Gertler A and Kann G 2000.
Plasma leptin determination in ruminants: effect of nutritional status and body
fatness on plasma leptin concentration assessed by a specific RIA in sheep.
Journal of Endocrinology 165, 519–526.
Du M, Tong J, Zhao J, Underwood KR, Zhu M, Ford SP and Nathanielsz PW 2010.
Fetal programming of skeletal muscle development in ruminant animals. Journal
of Animal Science 88, E51–E60.
Duckett SK, Pratt SL and Pavan E 2009. Corn oil or corn grain supplementation
to steers grazing endophyte-free tall fescue. II. Effects on subcutaneous fatty
acid content and lipogenic gene expression. Journal of Animal Science 87,
1120–1128.
Ganskopp DC and Bohnert DW 2009. Landscape nutritional patterns and cattle
distribution in rangeland pastures. Applied Animal Behavior Science 116,
110–119.
Gasser CL, Behlke EJ, Grum DE and Day ML 2006. Effect of timing of feeding a
high-concentrate diet on growth and attainment of puberty in early-weaned
heifers. Journal of Animal Science 84, 3118–3122.
Graugnard DE, Berger LL, Faulkner DB and Loor JJ 2010. High-starch diets induce
precocious adipogenic gene network up-regulation in longissimus lumborum of
early-weaned Angus cattle. British Journal of Nutrition 103, 953–963.
Greenfield RB, Cecava MJ and Donkin SS 2000. Changes in mRNA expression for
gluconeogenic enzymes in liver of dairy cattle during the transition to lactation.
Journal of Dairy Science 83, 1228–1236.
Hess BW, Lake SL, Scholljegerdes EJ, Weston TR, Nayigihugu V, Molle JDC and
Moss GE 2005. Nutritional controls of beef cow reproduction. Journal of Animal
Science 83, E90–E106.
Houseknecht KL, Baile CA, Matteri RL and Spurlock ME 1998. The biology of
leptin: a review. Journal of Animal Science 76, 1405–1420.
Lesmeister JL, Burfening PJ and Blackwell RL 1973. Date of first calving in beef
cows and subsequent calf production. Journal of Animal Science 36, 1–6.
Moriel P, Johnson SE, Vendramini JMB, McCann MA, Gerrard DE, Mercadante
VRG, Hersom MJ and Arthington JD 2014a. Effects of calf weaning age and
subsequent management systems on growth. Journal of Animal Science 92,
3598–3609.
Moriel P, Johnson SE, Vendramini JMB, Mercadante VRG, Hersom MJ and
Arthington JD 2014b. Effects of calf weaning age and subsequent management
system on growth and reproductive performance of beef heifers. Journal of
Animal Science 92, 3096–3107.
Rosen ED and MacDougald OA 2006. Adipocyte differentiation from the
inside out. Nature Reviews Molecular Cell Biology 7, 885–896.
Rule DC and Beitz DC 1986. Fatty acids of adipose tissue, plasma, muscle and
duodenal ingesta of steers fed extruded soybeans. Journal of the American Oil
Chemists’ Society 63, 1429–1435.
Scheffler JM, McCann MA, Greiner SP, Jiang H, Hanigan MD, Bridges GA, Lake
SL and Gerrard DE 2014. Early metabolic imprinting events increase marbling
scores in fed cattle. Journal of Animal Science 92, 320–324.
Schillo KK, Hall JB and Hileman SM 1992. Effects of nutrition and season on the
onset of puberty in the beef heifer. Journal of Animal Science 70, 3994–4005.
Schoonmaker JP, Fluharty FL and Loerch SC 2004. Effect of source and amount
of energy and rate of growth in the growing phase on adipocyte cellularity and
lipogenic enzyme activity in the intramuscular and subcutaneous fat depots of
Holstein steers. Journal of Animal Science 82, 137–148.
Thiex NJ, Anderson S and Gildemeister B 2003. Crude fat extraction in
feed, cereal grain and forage (Randall/Soxtec/Submersion method):
a collaborative study. Journal Association of Official Analytical Chemists 86,
888–908.
Van Soest PJ, Robertson JB and Lewis BA 1991. Methods for dietary fiber,
neutral detergent fiber, and nonstarch polysaccharides in relation to
nutrition animal. Journal of Dairy Science 74, 3583–3597.
Vizcarra JA, Wettemann RP, Spitzer JC and Morrison DG 1998. Body condition at
parturition and postpartum weight gain influence luteal activity and concentrations of glucose, insulin, and nonesterified fatty acids in plasma of primiparous beef cows. Journal of Animal Science 76, 927–936.
Wagner JJ, Lusby KS, Oltjen JW, Rakestraw J, Wettemann RP and Walters LW
1988. Carcass composition in mature Hereford cows: estimation and effect on
daily metabolizable energy requirement during winter. Journal of Animal Science 66, 603–612.
Weiss WP, Conrad HR and St. Pierre NR 1992. A theoretically-based model for
predicting total digestible nutrient values of forages and concentrates. Animal
Feed Science and Technology 39, 95–110.
Welch CM, Thornton KJ, Murdoch GK, Chapalamadugu KC, Schneider CS, Ahola
JK, Hall JB, Price WJ and Hill RA 2013. An examination of the association of
serum IGF-I concentration, potential candidate genes, and fiber type composition with variation in residual feed intake in progeny of Red Angus sires divergent for maintenance energy EPD. Journal of Animal Science 91, 5626–5636.
Williams GL, Amstalden M, Garcia MR, Stanko RL, Nizielski SE, Morrison CD and
Keisler DH 2002. Leptin and its role in the central regulation of reproduction
in cattle. Domestic Animal Endocrinology 23, 339–349.
NRC 2000. Nutrient requirements of beef cattle, 7th revised edition. National
Academic Press, Washington, DC, USA.
Yakar S, Liu JL, Stannard B, Butler A, Accili D, Sauer B and LeRoith D 1999.
Normal growth and development in the absence of hepatic insulin-like growth
factor I. Proceedings of the National Academy of Sciences of the United States of
America 96, 7324–7329.
Perkins SD, Key CN, Marvin MN, Garrett CF, Foradori CD, Bratcher CL, KrieseAnderson LA and Brandebourg TD 2014. Effect of residual feed intake on
hypothalamic gene expression and meat quality in Angus-sired cattle grown
during the hot season. Journal of Animal Science 92, 1451–1461.
Yelich JV, Wettemann RP, Dolezal HG, Lusby KS, Bishop DK and Spicer LJ 1995.
Effects of growth rate on carcass composition and lipid partitioning at puberty
and growth hormone, insulin-like growth factor I, insulin, and metabolites
before puberty in beef heifers. Journal of Animal Science 73, 2390–2405.
1508