RESEARCH ARTICLE 3099
Development 137, 3099-3106 (2010) doi:10.1242/dev.037812
© 2010. Published by The Company of Biologists Ltd
Sall1-dependent signals affect Wnt signaling and ureter tip
fate to initiate kidney development
Susan M. Kiefer1,2, Lynn Robbins1,2, Kelly M. Stumpff2, Congxing Lin3, Liang Ma3 and Michael Rauchman1,2,*
SUMMARY
Development of the metanephric kidney depends on precise control of branching of the ureteric bud. Branching events represent
terminal bifurcations that are thought to depend on unique patterns of gene expression in the tip compared with the stalk and
are influenced by mesenchymal signals. The metanephric mesenchyme-derived signals that control gene expression at the ureteric
bud tip are not well understood. In mouse Sall1 mutants, the ureteric bud grows out and invades the metanephric mesenchyme,
but it fails to initiate branching despite tip-specific expression of Ret and Wnt11. The stalk-specific marker Wnt9b and the catenin downstream target Axin2 are ectopically expressed in the mutant ureteric bud tips, suggesting that upregulated
canonical Wnt signaling disrupts ureter branching in this mutant. In support of this hypothesis, ureter arrest is rescued by
lowering -catenin levels in the Sall1 mutant and is phenocopied by ectopic expression of a stabilized -catenin in the ureteric
bud. Furthermore, transgenic overexpression of Wnt9b in the ureteric bud causes reduced branching in multiple founder lines.
These studies indicate that Sall1-dependent signals from the metanephric mesenchyme are required to modulate ureteric bud tip
Wnt patterning in order to initiate branching.
KEY WORDS: Sall1, Spalt, Ureter, Wnt9b, Kidney development, Ureteric bud, Metanephric mesenchyme, -catenin, Wnt, Tip fate, Mouse
1
John Cochran Veterans Affairs Medical Center, St Louis, MO 63106, USA.
Department of Internal Medicine, Division of Nephrology, St Louis University,
St Louis MO 63104, USA. 3Department of Medicine, Division of Dermatology,
Washington University St Louis, St Louis, MO 63110, USA.
2
*Author for correspondence ([email protected])
Accepted 25 June 2010
Sall1 function in the mm triggers downregulation of the stalkspecific marker Wnt9b and the canonical Wnt downstream gene
Axin2 in the outgrown ub. Early ub branching is rescued by a
reduction in -catenin dose supporting the conclusion that ureter
arrest is due to altered Wnt signaling in Sall1-Zn mutants. This
theory is further strengthened by findings that ub branching is
reduced in Wnt9b transgenic lines and in a stabilized -catenin
mutant. These results demonstrate that downregulation of Wnt9b
and canonical Wnt signaling in the ureter tip is required to initiate
ub branching.
MATERIALS AND METHODS
Mouse strains
Sall1-Zn mice have been described elsewhere (Kiefer et al., 2003).
Double heterozygous Sall1-Zn;Hoxb7GFP were mated to Sall1-Zn to
create EGFP-labeled mutant Wolffian ducts and ureters (Srinivas et al.,
1999). Sprouty1 (Spry1) mice were a gift from J. Licht (Basson et al.,
2005). Reduction of -catenin activity was achieved by using a -catenin
floxed allele (Ctnnb1fl/+, Jackson Laboratories) that had been first crossed
to a -actin-cre transgenic and then to Sall1-Zn to create double
heterozygous Sall1-Zn+/–;Ctnnb1+/– males. These were mated to Sall1Zn+/–;Hoxb7GFPtg/+ females to analyze Sall1-Zn–/–;Ctnnb1+/–
embryos. The presence of -actin-cre or Hoxb7GFP transgenes had no
effect on the phenotypes observed. Activation of -catenin was achieved
by crossing Hoxb7creEGFP transgenic mice (Zhao et al., 2004) to a catenin exon 3 floxed allele (Ctnnb1 ex3fl/ex3fl, Jackson Laboratories)
(Harada et al., 1999). Conditional deletion of this exon produces a
stabilized -catenin protein in both ureter and Wolffian duct. These studies
were performed under the auspices of St Louis University and St Louis VA
Medical Center animal care guidelines. Noon on the day of the vaginal
plug detection was considered to be E0.5.
Overexpression of Wnt9b in the ub
Transgenic mice were created to conditionally overexpress Wnt9b
(ACTWnt9b). A C-terminally epitope-tagged Wnt9b (Wnt9b-FLU) was
inserted into the EcoRI site of a previously described transgenic construct
[a gift from Yiping Chen, Tulane University (Chen et al., 2004)]. In this
construct, expression of Wnt9b-FLU is prevented by an upstream loxed
DEVELOPMENT
INTRODUCTION
A crucial step in kidney development is the interaction between the
outgrown ureteric bud (ub) and the metanephric mesenchyme
(mm). Reciprocal signaling triggers the ub to initiate its first Tbranch and induces the mm to condense and proliferate. If these
tissues fail to interact properly, renal agenesis or severe hypoplasia
will occur. Despite the importance of this interaction, defining the
precise molecular events that regulate these processes has been
particularly difficult because the mm undergoes rapid apoptosis if
it is not properly invaded (Donovan et al., 1999). Here, we describe
a mouse model in which the initial invasion of the ureter has been
captured and can be studied to identify factors that are crucial for
this process.
The gene mutated in this mouse model is the transcription factor
Sall1 – a multi-zinc-finger transcriptional regulator that is
expressed in the mm (Nishinakamura et al., 2001). It is mutated in
the autosomal dominant syndrome Townes Brocks (TBS) which is
characterized by multi-organ defects (including renal hypoplasia).
In this report, we use a Sall1 mouse model that mimics TBS (Sall1Zn) and demonstrate that these mice form blind ureters with an
overlying undifferentiated cap of mm (Kiefer et al., 2003). The ub
grows out and invades the mm, but does not form the first Tbranch. The unbranched ub and mm remain associated throughout
development, thereby allowing the precise dissection of the initial
events in ub morphogenesis that depend on Sall1. We show that
stop cassette (Novak et al., 2000). Upon exposure to cre recombinase, the
stop cassette is removed and transgenic expression is driven by the chicken
-actin promoter. Ten independent founder lines were established by the
Washington University Mouse Genetics core. Five of these lines were
crossed to Hoxb7creEGFP transgenic mice to overexpress Wnt9b in the ub
lineage. Kidneys were photographed using a Leica DVC300FX camera and
a M165FC fluorescence-enabled microscope. Photographs of all littermates
were scored by at least two individuals blind to the genotype and examined
for reduced kidney size and abnormal morphology. Statistical significance
was determined by chi square analysis. The ub branch tips were also
counted and are reported with standard error and the statistical difference
determined by t-test. Expression of Wnt9b-FLU in E13.5 embryonic
kidneys was confirmed by western blotting of kidney lysates probed with
anti-FLU antibody (12CA5, Roche, Indianapolis, IN, USA) and detected
with anti-mouse HRP (Cell Signaling Technology, Danvers, MA, USA) as
described previously (Kiefer et al., 2002).
Histology, immunohistochemistry and immunofluorescence
Urogenital regions were dissected at E11.0-18.5. Tissues were fixed,
sectioned and stained with Hematoxylin and Eosin as described previously
(Kiefer et al., 2003). Corresponding unstained slides were used for
immunohistochemistry with anti-uroplakin III (1:10, Fitzgerald Industries,
Concord, MA, USA) and anti-smooth muscle actin (1:100, Millipore,
Billerica, MA, USA) as described previously (Mahoney et al., 2006).
Immunofluorescence was performed on 10 m frozen sections using rabbit
anti-Pax2 antibody (1:2000, Covance, Princeton, NJ, USA) and rat antilaminin B2 chain antibody (1:2000, Chemicon, Temucula, CA, USA).
Antibody reactivity was detected using Alexa 488-labeled anti-rabbit
(1:400, Invitrogen, Carlsbad, CA, USA) and Cy3-labeled anti-rat (1:2000,
Jackson ImmunoResearch, West Grove, PA, USA), and mounted in
Mowiol (Polysciences, Warrington, PA, USA) as previously described
(Kiefer et al., 2002). Sections were incubated without primary antibody to
control for non-specific staining of secondary antibodies.
In situ hybridization
Whole-mount in situ hybridization was performed using digoxigeninlabeled antisense riboprobes for Ret (nucleotides 818-1222), Pax2 (5631248), Six2 (136-656), Cited1 (1-612), Wnt11 (61-674), Wnt9b (486-1076)
and Sall1 (421-848) (Kiefer et al., 2008). In situ hybridization was
performed as described previously (Little et al., 2007) on 20 m frozen
sections using a digoxigenin-labeled Gdnf riboprobe (nucleotides 122-781).
After incubation with digoxigenin-alkaline phosphatase antibody (1:2500),
signal was visualized using the alkaline phosphatase substrate BM purple
(Roche, Indianapolis, IN, USA).
Quantitative RT-PCR
E11.5 wild-type or Sall1Zn mutants were dissected to isolate the ureter
tips and mesenchyme from each side of the T-stage or unbranched ureter,
respectively. Ten tip regions were pooled and cDNA was synthesized as
described previously (Kiefer et al., 2008). Samples that lacked reverse
transcriptase were prepared as negative controls. Primer sets were designed
to amplify Gdnf, Pax2 and Gpc4 specifically using Primer Bank
(http://pga.mgh.harvard.edu/primerbank/). cDNA (10 ng) was used for
quantitative real-time PCR using SYBR green master mix (Applied
Biosystems, Foster City, CA, USA) and an ABI 7300 quantitative PCR
instrument (Kiefer et al., 2008). Relative levels of mRNA expression were
calculated according to the CT method and normalized to the gene
Rpl19. Transgenic copy number was estimated using primers at the C
terminus of Wnt9b-FLU (forward GGAGCTCGTGTATACCTGCAA,
reverse CCCTTTCGTCTTCAAGAATTCTC) and 10 ng of HindIII cut
genomic DNA. CT values were normalized against a Gapdh-positive
control for transgene PCR.
Organ culture
Affi-blue sepharose beads (Biorad, Hercules, CA, USA) were preincubated
with 10 mg/ml recombinant GDNF (R&D Systems, Minneapolis, MN,
USA) or BSA (Sigma, St Louis, MO, USA) for 30 minutes at 37°C.
Hoxb7GFP-expressing E11.5 wild-type and Sall1-Zn ubs and their
associated mm were cultured in Trowell-type organ culture for 48-72 hours
Development 137 (18)
with DMEM containing 10% FBS. Two or three beads were placed on each
filter near the rudiments and imaged on the day of culture and 48-72 hours
later. At least five individual cultures were tested for each treatment. For
recombination experiments, metanephric regions were digested with 0.5%
Trypsin/0.02 g/l EDTA (Hyclone, Logan, UT, USA) for 5-15 minutes on
ice to aid separation of the ub and mm. Wild-type E11.0 ubs or Sall1-Zn
E12.5 blind ureters were recombined with wild-type E12.5 mm tissue and
cultured for 48-72 hours. The ub branching was monitored by imaging the
cultures on a Leica MZ16F stereomicroscope equipped with GFP
fluorescence and a DFC300FX color camera.
RESULTS
Sall1-Zn mice exhibit blind ureters that are
morphologically normal
Sall1-Zn/ homozygous mice exhibit bilateral renal agenesis
(Kiefer et al., 2003). It has been suggested that this phenotype is due
to incomplete ureter outgrowth and to mesenchymal apoptosis in
Sall1-null mice (Nishinakamura et al., 2001). However, upon closer
investigation, we were able to discern outgrown ureters in at least 25
independent E14.5-18.5 Sall1-Zn/ embryos in which there was
no evidence of kidney formation (Fig. 1). These blind ureters had
grown away from the bladder similar to those in wild-type
littermates, despite no evidence of a morphologically distinct
metanephric mesenchyme. Blind ureters exhibited normal
histological architecture that consisted of urothelium (u) and smooth
muscle (sm) layers, as revealed by Hematoxylin and Eosin staining.
By E16.5, the smooth muscle layer should have differentiated and
begun to express smooth muscle actin; this occurred normally in the
mutant ureters (Fig. 1E,F). Both wild-type and mutant ureters also
properly expressed a marker that is exclusive to the differentiated
epithelium of the urinary tract: uroplakin III (Fig. 1G,H). Six1–/–
mutants display a very similar phenotype in which renal agenesis is
accompanied by growth and differentiation of the ureter (Bush et al.,
2006), supporting the conclusion that development of the extra-renal
ureter is independent of the proximal branching ub that forms the
intra-renal collecting system. However, unlike Six1 (Nie et al., 2010),
Sall1 is not required for proper formation of the smooth muscle layer.
Sall1 expression is not preserved in Six1–/– mutant mm and it has
been suggested that Sall1 is a direct transcriptional target of Six1
regulation (Chai et al., 2006). These findings suggest that Six1 and
Sall1 function together in a developmental pathway that regulates
initial branching of the ureter.
Blind ureters arrest before the T-stage and
maintain persistent mesenchymal cells
To verify the identity of the outgrown ureters and to visualize ureter
development at multiple stages, we crossed Sall1-Zn mice with the
Hoxb7GFP transgenic line (F. Costantini, Columbia University).
Visualization of GFP fluorescence verified the existence of blind
ureters in Sall1-Zn/ mutant E16.5 embryos (Fig. 2). These ureters
had grown at the proper site on either side of the aorta and were
morphologically distinguishable from the surrounding tissue. The
distal tips appeared dilated and the lengths were often asymmetric.
At E11.5, when the wild-type ub has formed its first branch (T-stage),
mutant ubs remained unbranched (Fig. 2C,D). Both wild-type and
mutant ub emerged from the distal Wolffian duct and invaded the
metanephric mesenchyme; however, the mutant ub failed to form the
T-stage. This unbranched ub remained viable and continued to grow
in the absence of proper mesenchymal induction.
Ret was properly expressed in the mutant ub and became
restricted to the ureter tip by E12.5 (Fig. 3C,D). Analysis of Pax2
expression revealed a small cluster of mesenchyme surrounding the
DEVELOPMENT
3100 RESEARCH ARTICLE
Sall1 affects ub Wnt signaling
RESEARCH ARTICLE 3101
Fig. 1. Sall1-Zn mutants exhibit blind ureters that properly
differentiate into urothelium and smooth muscle layers.
(A,B)E18.5 urogenital tracts from wild-type and homozygous mouse
embryos demonstrate that Sall1-Zn mutants do not form kidneys (k),
but that morphologically distinct ureters are visible. Testes (t) and
bladder (bl) are formed. (C,D)Transverse sections at the level indicated
by the arrows are shown in the lower panels. Haemotoxylin and Eosin
staining reveals a proper urothelium (u) and smooth muscle (sm) layer
in cross sections of both wild-type and mutant ureters. The mutant
exhibits decreased luminal space that might be secondary to the lack of
urine flow. (E-H)Immunohistochemistry with anti-smooth muscle actin
and anti-uroplakin III appears similar in wild-type and mutant sections,
and confirms the proper differentiation of mutant ureters.
ureter tip, suggesting that blind ureter formation is associated with
a persistent cap of mesenchyme (Fig. 3E,F). The mutant
mesenchyme contained Six2-positive metanephric progenitor cells
(Fig. 3G,H). These cells did not progress beyond the progenitor
stage because a gene expressed specifically in cap mesenchyme,
Cited1, was absent (Fig. 3I,J) (Mugford et al., 2009). Consistent
with this observation, there was no evidence of formation of
pretubular aggregates in the persistent mesenchymal cells and,
similar to Sall1-null mice (Nishinakamura et al., 2001), expression
of several other mesenchymal markers, including Eya1 and Wnt4,
were reduced compared with wild-type controls (data not shown).
Together, these data show that uninduced metanephric
mesenchyme persists atop mature blind ureters and demonstrate
that Sall1 expression is required for initial T-branch formation.
Upregulation of GDNF signaling is not sufficient
to rescue branching
Our data suggest that Sall1-dependent signals from the mm to
the ub are required to initiate branching. It has been proposed
that a failure to maintain Gdnf expression probably accounts for
renal agenesis or for severe hypoplasia in Sall1 mutants (Schedl,
2007). The requirement for proper Gdnf expression in the critical
window of initial ub invasion has been shown through analysis
of nephronectin (Npnt) and integrin 8 (Itga8) mutant mice
(Linton et al., 2007). In these mutants, Gdnf expression appears
to be normal at the time of ub outgrowth, but is dramatically
reduced at E11.5 when the ub invades the mesenchyme. A
genetic reduction of Spry1 gene expression rescued the kidney
defect in Itga8 mutants confirming that decreased GDNF-Ret
signaling was responsible for renal agenesis in these mice.
Therefore, we assayed expression of Gdnf in Sall1-Zn/
mutant mesenchyme at E11.5 and found that its expression was
significantly reduced when measured using in situ hybridization
and quantitative real-time PCR (Fig. 3N, 0.22±0.05 fold change).
Mesenchymal Pax2 expression appeared similar to wild-type at
the same time point (Fig. 3K,L).
To test the hypothesis that Gdnf deficiency accounts for ub arrest
in the Sall1-Zn mutant, we next performed metanephric organ
culture with exogenous GDNF and with increased GDNF signaling
achieved by reducing the dose of the Spry1 tyrosine kinase
inhibitor in vivo. For organ culture, E11.5 Hoxb7GFP wild-type
and homozygous Sall1-Zn/ metanephric regions were cultured
with beads coated with bovine serum albumin (BSA) or
recombinant GDNF protein. Recapitulating the in vivo phenotypes,
mutant explants failed to branch, whereas wild-type explants
underwent several rounds of branching when incubated with BSAcoated beads (Fig. 3O,P). As previously described, exogenous
GDNF caused increased branching and altered patterning of the
wild-type ub, confirming that GDNF was active in our culture
system (Fig. 3Q). Addition of GDNF-coated beads resulted in only
a small single branch with abnormal morphology in eight out of 11
mutants (Fig. 3R). Interestingly, mutant ureteric buds did not swell
as dramatically as wild-type tissues when treated with exogenous
GDNF, suggesting that ampulla formation is abnormal. A similar
reduction in Gdnf expression at E11.5 was observed for Grem1deficient embryos, which arrest prior to ub outgrowth. However, in
this mutant, exogenous GDNF induced ub branching of Grem1–/–
metanephroi in organ culture that was comparable with that seen in
the wild type (Michos et al., 2007). Thus, the failure of GDNF to
rescue the Sall1-Zn/ explants is best explained by an inability
of the Sall1-Zn mutant to respond to this branch-promoting factor.
DEVELOPMENT
Fig. 2. Blind ureters are caused by failure to initiate the first
branch. (A-D)Hoxb7GFP-labeled genital tracts from wild-type and
mutant mice at E16.5 (A,B) and E11.5 (C,D) reveal that the wild-type
ureteric bud (ub) properly forms a T-branch at E11.5 and a branched
kidney at E16.5. Sall1-Zn homozygous mutant ubs properly grow out
from the Wolffian duct (wd), but fail to branch. Blind ureters persist at
E16.5 in the mutant.
3102 RESEARCH ARTICLE
Development 137 (18)
We next tested whether the deficiency in Gdnf could be
overcome by reducing Spry1 dose in vivo. Spry1 normally
functions to attenuate GDNF activation of the Ret receptor, and
loss of Spry1 in Spry1-null embryos produces multiple ectopic buds
because of increased Ret signaling (Basson et al., 2005; Basson et
al., 2006). Therefore, we postulated that increasing Ret signaling
in the presence of low levels of GDNF would allow mutant ureteric
buds to branch. In contrast to the rescue observed for Itga8-null
mice, heterozygosity of a Spry1-null allele (J. Licht, Northwestern
University) did not alter the frequency of renal agenesis and blind
ureter formation for Sall1-Zn mutants in any of the
Spry1+/–;Sall1/ mutants examined (n0/5). Together, these results
suggest that although low levels of Gdnf might contribute to ureter
arrest in the Sall1-Zn mutant, reduced signaling through this
pathway alone cannot account for this phenotype.
Although Sall1 is not expressed in the ub, it is expressed in the
nephric duct at E9-10, immediately prior to ub outgrowth. Thus,
Sall1 expression in the duct might be required to pattern the ub and
enable it to form an ampulla properly. To test this possibility, we
performed recombination experiments to determine whether Sall1Zn/ ub is competent to branch when recombined with wild-type
mm. As shown in Fig. 3S,T, mutant ubs underwent several rounds
of branching morphogenesis (average4.3 ub tips with four out of
six recombinations exhibiting branching) when recombined with
wild-type mesenchyme; this was comparable with that observed in
the wild type } wild type recombination (average4.8 ub tips with
four out of six recombinations exhibiting branching). Wild-type
recombinations were performed prior to the T-stage to verify that
unbranched ubs were capable of branching in organ culture.
Together, these results indicate that the Sall1-Zn/ mutant ub is
competent to respond to mesenchymal signals, and suggest that
Sall1-dependent factors in the mm, independently of GDNF, must
be involved in the regulation of ampulla formation and the
initiation of ureteric bud branching.
Wnt9b is ectopically expressed in mutant ureteric
bud tips
We next postulated that Sall1 might be affecting ureter tip fate. If
mutant ub tips are not properly specified, they could adopt a distal
ub phenotype and prohibit branching (Caruana et al., 2006; Michael
and Davies, 2004; Schmidt-Ott et al., 2005; Shakya et al., 2005;
Sweeney et al., 2008). Tip identity was specified in Sall1-Zn/
mutant ubs because both Ret (Fig. 3D) and Wnt11 (Fig. 4D) were
properly tip restricted. As the ampulla begins to bifurcate in the wild
type, Wnt11 expression is polarized to delineate the emerging tips.
However, in the mutant, Wnt11 remains restricted to the single tip,
indicating that bifurcation has not been initiated. Wnt11 expression
depends on intact GDNF-Ret signaling and is maintained by a
Wnt11-GDNF feedback loop (Majumdar et al., 2003; Schuchardt et
al., 1995; Schuchardt et al., 1996). Therefore, the preservation of
Wnt11 expression in the Sall1-Zn/ mutants is consistent with the
idea that low GDNF activity is not the principal defect in blind ureter
formation.
However, a different paradigm emerged when we analyzed
Wnt9b. Wnt9b expression is normally restricted to the ub stalk and
Wnt9b–/– embryos arrest when the ub has formed the T-stage (Carroll
et al., 2005). In Sall1-Zn/ mutant ureters, Wnt9b expression was
not downregulated and continued to be expressed at the ureter tip
(Fig. 4F). Wnt9b is thought to signal through the canonical -catenin
pathway during kidney development, as Wnt9b–/– embryos can be
rescued by expression of Wnt1 in the ub (Carroll et al., 2005).
Consistent with this interpretation, a -catenin pathway member and
target gene (Jho et al., 2002), Axin2, was also ectopically expressed
in the ub tip in the Sall1-Zn/ mutant (Fig. 4G,H). Upregulation of
Gpc4, a gene shown to be modulated by -catenin signaling in the
kidney (Schmidt-Ott et al., 2007), also occurred in mutant rudiments
(2.3±0.11 fold change). These data suggest that Sall1-dependent
signals in the mm cause the downregulation of canonical Wnt
signaling in the ub tip resulting in initiation of branching.
DEVELOPMENT
Fig. 3. Mutant cap mesenchyme persists and
expresses low Gdnf, but this does not account for
the blind ureter phenotype. (A-J)Hoxb7GFP
expression (A,B) or whole-mount in situ hybridization
(C-J) in wild-type or Sall1-Zn homozygous mutant E12.5
mouse tissues. Ret is properly tip restricted in the blind
ureter. Pax2 and Six2 expression reveal a cap of
metanephric mesenchyme (mm) atop the blind ureter
that does not express Cited1 (ureter tip is marked by an
asterisk in J). (K,L)Anti-Pax2 (green) and anti-laminin
(red) staining show that Pax2-positive mm cells encircle
the Pax2-positive ureteric bud (ub) outlined with antilaminin in both heterozygous and homozygous tissues at
E11.5. (M,N)Gdnf expression in the mutant mm is
reduced compared with wild-type mm at E11.5.
(O-R)Organ culture of Hoxb7GFP;Sall1-Zn+/ or
Hoxb7GFP;Sall1-Zn/ tissues at E11.5 with the addition
of either BSA- or GDNF-coated beads imaged at 0 and
48 hours of culture. BSA-treated explants recapitulate
the in vivo phenotypes with normal branching (O, +/)
and a blind ub (P, /). GDNF-treatment causes swollen
branch events (Q, +/) or a single branch that does not
progress (R, /). (S,T)Recombination of wild-type E12.5
mm with E11.0 ampulla-stage ubs (S, +/) or E12.5 blind
ureters (T, /) show that the mutant (/) is capable of
multiple branching events, similar to the control (+/)
ampulla, when wild-type mm is present.
Fig. 4. Blind ureters exhibit altered tip fate by ectopic Wnt9b
expression and are rescued by reducing -catenin dose.
(A,B)Hoxb7GFP expression at E11.0 (+/+) in mouse ampullas and E12.5
Sall1-Zn/ blind ureters. (C,D)Wnt11 is expressed similarly in the wildtype ampulla and mutant blind ureter and is absent from ureteric bud
(ub) stalks (outlined). (E,F)Wnt9b expression detected by whole-mount
in situ hybridization is upregulated in mutant ub tips (/) at E11.5 (not
shown) and E12.5. Wild-type ub tip is outlined. (G,H) In the wild type,
Axin2, a canonical Wnt signaling component and -catenin responsive
gene, is more strongly expressed in the Wolffian duct and ub stalk, and
is downregulated in the ub tip (outlined) similar to Wnt9b. Axin2 is
upregulated in the Sall1-Zn/ mutant ub tip. (I-O)Reduction of catenin dose rescues Sall1Zn/ blind ureter formation. Representative
Hoxb7GFP expression (I-K) or whole-mount bright-field photos (L-N) are
shown and the results are quantitated (O). Two or more rounds of
branching were seen in 50% (seven out of 14) of E12.5 Sall1Zn/;Ctnnb1+/– compared with 5% (one out of 22) of Sall1Zn/;Ctnnb1+/+ kidneys. Blind ureters were observed in 50% of
Sall1-Zn/;Ctnnb1+/– and 95% of Sall1-Zn/;Ctnnb1+/+ kidneys.
Sall1+/+;Ctnnb1+/– kidneys (100%, 18 out of 18) had branched at least
eight times by E12.5. Statistical significance was calculated using
Fisher’s exact test (P<0.0005).
Reduction in -catenin dosage rescues early
branching
Since Wnt9b and at least two canonical Wnt-responsive genes were
upregulated in Sall1-Zn/ mutant ureters, we hypothesized that
ub branching could be rescued by lowering -catenin activity. In
contrast to reduced Spry1 dose, which had no effect on the Sall1Zn/ phenotype, lowering the dose of -catenin rescued
branching in 50% of Sall1-Zn/;Ctnnb1+/– E12.5-13.5 embryos.
Seven out of 14 mutant kidneys branched to the T-stage and
initiated at least a second round of branching from each tip,
resulting in a statistically significant rescue of the blind ureter
phenotype (Fisher’s exact test P<0.005, Fig. 4K,N,O). Sall1Zn/;Ctnnb1+/+ littermates (21 out of 22) and the remainder of
the Sall1-Zn/;Ctnnb1+/– kidneys arrested with blind ureters
(Fig. 4J,M,O). Sall1-Zn+/+;Ctnnb1+/– control kidneys branched
RESEARCH ARTICLE 3103
Fig. 5. Ectopic Wnt9b or increased -catenin signaling in the
ureteric bud (ub) is sufficient to reduce branching. (A-J)Ectopic ub
expression of Wnt9b in E12.5 Hoxb7creEGFPtg/+; ACTWnt9btg/+
transgenic mice causes reduced branching and abnormal morphology
of the ureter. Four different founders are shown [founders 8 (B,J), 7 (D),
3 (F) and 10 (H)]. Analysis of Pax2 (G,H) and Six2 expression (I,J) shows
normal mesenchymal cap formation in both wild-type and transgenic
kidneys. (K-T)GFP expression and whole-mount in situ hybridization
reveal unbranched ubs in Hoxb7creEGFP;Ctnnb1ex3fl/+ at E12.5. This
constitutively active -catenin allele would be expected to increase Wnt
signaling in the ub tip more significantly than ectopic Wnt9b alone and
produces a more dramatic ub arrest. None of the genes assayed
(Wnt9b, Wnt11, Pax2 and Sall1) was significantly altered in
Hoxb7creEGFP;Ctnnb1ex3fl/+ embryos, suggesting that Sall1 acts
upstream of -catenin signaling.
normally (Fig. 4I,L), verifying that lowered -catenin dose alone
has no effect on kidney branching. This rescue supports the idea
that increased -catenin signaling is a major component of the
Sall1-Zn/ blind ureter phenotype.
Ectopic Wnt9b or -catenin activity in the ureter
inhibits branching
Tight control of -catenin is required during nephrogenesis in both
the ureter and mesenchyme (Bridgewater et al., 2008; Carroll et al.,
2005; Iglesias et al., 2007; Kuure et al., 2007; Marose et al., 2008;
Park et al., 2007). Therefore, we next sought to understand whether
increased -catenin signaling in the ureter tip could be responsible
for defective initiation of ub branching. To test this hypothesis, we
created a new transgenic mouse to conditionally overexpress
Wnt9b (ACTWnt9b) and used an existing conditionally active
DEVELOPMENT
Sall1 affects ub Wnt signaling
Fig. 6. Model for the effect of mesenchymal Sall1 on ureter stalk
expression of Wnt9b and canonical Wnt signaling. When the
ureteric bud invades the metanephric mesenchyme (pink),
mesenchymal progenitor cells (light gray and blue) coalesce at the
ureter tip (brown). Wnt9b and -catenin signaling (yellow) are
downregulated in the ub tip, but continue to be expressed in the ub
stalk. Signaling from the mesenchyme causes the ureter tips to branch.
Reciprocal signals from the ureter to the mesenchyme induce the
mesenchyme to form condensates that differentiate into renal vesicles
near the Wnt9b-positive stalk. When Sall1 is not expressed in the
mesenchyme (dark gray and blue, below the dotted line), Wnt9b is
ectopically expressed in ureter tips and ureter branching arrests before
the T-stage.
dominant allele of -catenin [Ctnnb1ex3fl/+(Harada et al., 1999)].
When crossed to Hoxb7creEGFP (Zhao et al., 2004), the progeny
would express ectopic Wnt9b or stabilized -catenin throughout
the Wolffian duct and ureter, including the tip. The resulting
embryos were used to test the effects of overexpression of
Wnt9b or canonical Wnt signaling in the ureter tip and throughout
the ub.
For Wnt9b transgenic experiments, E12.5 kidneys were
examined by two independent individuals who were blind to
the genotype. Thirty-two out of 43 (74%) Hoxb7creEGFPtg/+;
ACTWnt9btg/+ kidneys were scored as reduced in size or as
exhibiting abnormal branching morphology such as asymmetry
(Fig. 5). Nine out of 31 (29%) Hoxb7creEGFPtg/+ littermates
appeared small with normal morphology and acted as controls for
variation in the extent of branching at this developmental stage.
These differences were observed for at least two litters from each
of five different transgenic founders and were found to be
statistically significant (Chi Square, P<0.0005). Quantification for
two independent founders showed a 36% decrease in number of ub
branch tips for Hoxb7creEGFPtg/+;ACTWnt9btg/+ when compared
with littermate controls (11.2±1.2 versus 7.2±1.0 ub branch tips,
t-test, P<0.05, n23 kidneys). Whole-mount in situ hybridization
analysis of Pax2 and Six2 revealed that normal mesenchymal caps
were formed in transgenic ub tips (similar to wild-type littermates)
but the number of caps was reduced in proportion to the reduced
ub tips (Fig. 5G-J). Wnt9b-FLU was detected by western blotting
of kidney lysates confirming its expression in transgenics (data not
shown). Furthermore, ACTWnt9b founders that were found to have
the most dramatic reduction in branching exhibited the highest
transgene copy number (data not shown). These results show that
ectopic Wnt9b expression in the ub is sufficient to alter branching
morphogenesis.
Development 137 (18)
As the effects of overexpression of Wnt9b alone were less severe
than the Sall1-Zn/ blind ureter phenotype, we increased Wnt
signaling more dramatically in the ub using a stabilized -catenin
allele. A significant number of E11.5-12.5 Hoxb7creEGFP;
Ctnnb1ex3fl/+ embryos (35 out of 60) exhibited unbranched ureters
that were remarkably similar to those seen in Sall1-Zn embryos
(Fig. 5L). The remaining mutants were able to form the T-branch,
but arrested shortly thereafter, and often exhibited abnormal branch
patterns (data not shown). Hoxb7creEGFP;Ctnnb1+/+ littermates
branched normally at all stages, confirming that the transgene alone
had no deleterious effects. The high frequency of renal agenesis for
this cross has recently been reported, but no detailed analysis was
provided (Karner et al., 2010). Similarly, inhibition of ureteric bud
branching was observed in organ culture when -catenin signaling
was activated using an inhibitor of GSK-3: LiCl (n8/8, data not
shown). Gene marker analysis demonstrated the presence of blind
ureters that properly express tip restricted Wnt11 (Fig. 5O,P).
Wnt11 expression was expanded in Hoxb7creEGFP;Ctnnb1ex3fl/+
kidneys compared with Sall1-Zn mutants (compare Fig. 4D with
Fig. 5P) and this pattern probably indicates sites that could initiate
abnormal branching later in development in these embryos. Wnt9b
expression was preserved in ub stalks and was properly
downregulated in wild-type and Ctnnb1ex3/+ mutant ub tips,
demonstrating that dominant -catenin has no effect on Wnt9b gene
expression (Fig. 5M,N). Pax2 was expressed in the ureter and the
overlying mm in a very similar pattern to that seen in Sall1-Zn
embryos (compare Fig. 5R with Fig. 3F). Sall1 expression in the
mesenchyme was not altered, suggesting that its role in affecting
ureter branching occurs upstream of -catenin signaling. Overall,
the strong correlation between the phenotypic consequences of loss
of Sall1 in the mm and increased Wnt9b--catenin signaling in the
ub suggests that increased -catenin signaling at ub tips is an
important mechanism for the Sall1-Zn blind ureter phenotype.
DISCUSSION
Sall1 has been implicated as a regulator of canonical Wnt
signaling, but it is not clear whether this is a direct or indirect effect
(Bohm et al., 2006; Chihara and Hayashi, 2000; Ma et al., 2006;
Onai et al., 2004; Ribeiro et al., 2004; Sato et al., 2004; Uez et al.,
2008). As Sall1 is a transcription factor expressed in the mm, it is
likely to regulate expression of membrane bound or secreted
factors that would signal to the ub to undergo initial branching.
Based on our results, Sall1 would be predicted to repress Wnt9b
expression and -catenin signaling in ureteric bud tip cells. As
Sall1 acts as a potent transcriptional repressor through binding to
a nucleosome remodeling and deactylase (NuRD) complex, an
attractive hypothesis is that Sall1 is necessary to repress a branch
inhibitor that is secreted by the mm (Kiefer et al., 2002; Lauberth
and Rauchman, 2006). Whereas branch inhibitors normally
function to restrict ub outgrowth to a single bud at the proper
location, ectopic expression of these factors could disrupt
branching. An alternative possibility is that there is a deficiency in
branch-promoting factors in the Sall1-Zn mutant. In addition to
GDNF, FGFs and other growth factors are thought to positively
regulate ub branching (Costantini, 2006). Further studies are
needed to determine which of these factors might regulate initial
branch formation by the ub via modulation of Wnt9b/-catenin
activity in ub tip cells.
Although our studies point to an important mechanism by which
Sall1-dependent signals from the mm regulate the ub, it is likely
that this transcription factor also has cell-autonomous functions in
the mm. Progenitors derived from Sall1 mutant mm can be induced
DEVELOPMENT
3104 RESEARCH ARTICLE
to differentiate into nephron precursors but form smaller colonies
than wild-type cells, suggesting that Sall1 is required for
maintenance or proliferation of metanephric progenitors (Osafune
et al., 2006). Recently, it has been suggested that Sall1 also has a
role in modulating compact adhesion of mm cells adjacent to the
ub tip through direct regulation of the kinesin family gene Kif26
(Uchiyama et al., 2010). Identification of Sall1 target genes in the
kidney will better elucidate its multiple roles in the mm.
Several key studies have addressed the role of canonical Wnt
signaling in the developing kidney using both loss- and gain-offunction approaches (Bridgewater et al., 2008; Carroll et al., 2005;
Marose et al., 2008; Park et al., 2007). A general conclusion from
these studies is that kidney development is extremely sensitive to
the level or duration of -catenin signaling both in the mm and in
the ub. This tight control of -catenin activity appears to be crucial
at the ureteric bud tip/cap mesenchyme region in order to balance
the need to induce nephrons yet maintain the pool of progenitor
cells (Park et al., 2007). Our results suggest that tight control of catenin activity in the ub tip cells is also required to initiate normal
branching morphogenesis. Genetic reduction of -catenin (Ctnnb1)
levels rescued initial branching in the Sall1-Zn mutant but failed
to rescue kidney development fully. This could suggest that Sall1Wnt signaling regulates early stages of branching but that later
stages use other pathways, as demonstrated by several recent
studies (Jain et al., 2006; Shakya et al., 2005).
We propose a model in which Wnt9b is restricted to ureter stalks
to maintain undifferentiated mesenchymal progenitors and to
promote subsequent ureter branches in the cortex (Fig. 6). Wnt9b
expression is confined to the ureter stalk to allow induction of
mesenchymal differentiation without affecting ub tip branching
morphogenesis. In the absence of Sall1, this delicate balance of tip
versus stalk Wnt signaling is disrupted, which leads to ub
branching arrest. Our studies reveal a requirement for Sall1 for the
initial interaction between mm and ub that modulates ureter catenin signaling and branching competence.
Acknowledgements
We thank Emily Royse for excellent technical assistance with genotyping, and
Jeannine Basta and Darcy Denner for constructive advice. Jim Kiefer provided
assistance with figures and F. Costantini gave valuable criticism of the data. F.
Costantini, J. Licht and Feng Chen generously provided mice, and the
Washington University St Louis Developmental Biology Morphology core
provided histology services. This work was supported by an NIH RO1 grant
(R01DK067222 to M.R.), a Veterans Affairs Merit Award (M.R.) and an
American Heart Association Established Investigator Award (0840117N, M.R.).
S.K. is supported by an American Society of Nephrology Gottschalk research
grant and L.M. is funded by NIH R01ES014482. Deposited in PMC for release
after 12 months.
Competing interests statement
The authors declare no competing financial interests.
References
Basson, M. A., Akbulut, S., Watson-Johnson, J., Simon, R., Carroll, T. J.,
Shakya, R., Gross, I., Martin, G. R., Lufkin, T., McMahon, A. P. et al. (2005).
Sprouty1 is a critical regulator of GDNF/RET-mediated kidney induction. Dev. Cell
8, 229-239.
Basson, M. A., Watson-Johnson, J., Shakya, R., Akbulut, S., Hyink, D.,
Costantini, F. D., Wilson, P. D., Mason, I. J. and Licht, J. D. (2006). Branching
morphogenesis of the ureteric epithelium during kidney development is
coordinated by the opposing functions of GDNF and Sprouty1. Dev. Biol. 299,
466-477.
Bohm, J., Sustmann, C., Wilhelm, C. and Kohlhase, J. (2006). SALL4 is directly
activated by TCF/LEF in the canonical Wnt signaling pathway. Biochem. Biophys.
Res. Commun. 348, 898-907.
Bridgewater, D., Cox, B., Cain, J., Lau, A., Athaide, V., Gill, P. S., Kuure, S.,
Sainio, K. and Rosenblum, N. D. (2008). Canonical WNT/beta-catenin
signaling is required for ureteric branching. Dev. Biol. 317, 83-94.
RESEARCH ARTICLE 3105
Bush, K. T., Vaughn, D. A., Li, X., Rosenfeld, M. G., Rose, D. W., Mendoza, S.
A. and Nigam, S. K. (2006). Development and differentiation of the ureteric
bud into the ureter in the absence of a kidney collecting system. Dev. Biol. 298,
571-584.
Carroll, T. J., Park, J. S., Hayashi, S., Majumdar, A. and McMahon, A. P.
(2005). Wnt9b plays a central role in the regulation of mesenchymal to epithelial
transitions underlying organogenesis of the mammalian urogenital system. Dev.
Cell 9, 283-292.
Caruana, G., Cullen-McEwen, L., Nelson, A. L., Kostoulias, X., Woods, K.,
Gardiner, B., Davis, M. J., Taylor, D. F., Teasdale, R. D., Grimmond, S. M. et
al. (2006). Spatial gene expression in the T-stage mouse metanephros. Gene
Expr. Patterns 6, 807-825.
Chai, L., Yang, J., Di, C., Cui, W., Kawakami, K., Lai, R. and Ma, Y. (2006).
Transcriptional activation of the SALL1 by the human SIX1 homeodomain during
kidney development. J. Biol. Chem. 281, 18918-18926.
Chen, Y. X., Krull, C. E. and Reneker, L. W. (2004). Targeted gene expression in
the chicken eye by in ovo electroporation. Mol. Vis. 10, 874-883.
Chihara, T. and Hayashi, S. (2000). Control of tracheal tubulogenesis by
Wingless signaling. Development 127, 4433-4442.
Costantini, F. (2006). Renal branching morphogenesis: concepts, questions, and
recent advances. Differentiation 74, 402-421.
Donovan, M. J., Natoli, T. A., Sainio, K., Amstutz, A., Jaenisch, R., Sariola, H.
and Kreidberg, J. A. (1999). Initial differentiation of the metanephric
mesenchyme is independent of WT1 and the ureteric bud. Dev. Genet. 24, 252262.
Harada, N., Tamai, Y., Ishikawa, T., Sauer, B., Takaku, K., Oshima, M. and
Taketo, M. M. (1999). Intestinal polyposis in mice with a dominant stable
mutation of the beta-catenin gene. EMBO J. 18, 5931-5942.
Iglesias, D. M., Hueber, P. A., Chu, L., Campbell, R., Patenaude, A. M.,
Dziarmaga, A. J., Quinlan, J., Mohamed, O., Dufort, D. and Goodyer, P. R.
(2007). Canonical WNT signaling during kidney development. Am. J. Physiol.
Renal Physiol. 293, F494-F500.
Jain, S., Encinas, M., Johnson, E. M., Jr and Milbrandt, J. (2006). Critical and
distinct roles for key RET tyrosine docking sites in renal development. Genes Dev.
20, 321-333.
Jho, E. H., Zhang, T., Domon, C., Joo, C. K., Freund, J. N. and Costantini, F.
(2002). Wnt/beta-catenin/Tcf signaling induces the transcription of Axin2, a
negative regulator of the signaling pathway. Mol. Cell. Biol. 22, 1172-1183.
Karner, C. M., Dietrich, M. F., Johnson, E. B., Kappesser, N., Tennert, C.,
Percin, F., Wollnik, B., Carroll, T. J. and Herz, J. (2010). Lrp4 regulates
initiation of ureteric budding and is crucial for kidney formation-a mouse model
for Cenani-Lenz syndrome. PLoS ONE 5, e10418.
Kiefer, S. M., McDill, B. W., Yang, J. and Rauchman, M. (2002). Murine Sall1
represses transcription by recruiting a histone deacetylase complex. J. Biol.
Chem. 277, 14869-14876.
Kiefer, S. M., Ohlemiller, K. K., Yang, J., McDill, B. W., Kohlhase, J. and
Rauchman, M. (2003). Expression of a truncated Sall1 transcriptional repressor
is responsible for Townes-Brocks syndrome birth defects. Hum. Mol. Genet. 12,
2221-2227.
Kiefer, S. M., Robbins, L., Barina, A., Zhang, Z. and Rauchman, M. (2008).
SALL1 truncated protein expression in Townes-Brocks syndrome leads to ectopic
expression of downstream genes. Hum. Mutat. 29, 1133-1140.
Kuure, S., Popsueva, A., Jakobson, M., Sainio, K. and Sariola, H. (2007).
Glycogen synthase kinase-3 inactivation and stabilization of beta-catenin induce
nephron differentiation in isolated mouse and rat kidney mesenchymes. J. Am.
Soc. Nephrol. 18, 1130-1139.
Lauberth, S. M. and Rauchman, M. (2006). A conserved 12-amino acid motif in
Sall1 recruits the nucleosome remodeling and deacetylase corepressor complex.
J. Biol. Chem. 281, 23922-23931.
Linton, J. M., Martin, G. R. and Reichardt, L. F. (2007). The ECM protein
nephronectin promotes kidney development via integrin 81-mediated
stimulation of Gdnf expression. Development 134, 2501-2509.
Little, M. H., Brennan, J., Georgas, K., Davies, J. A., Davidson, D. R., Baldock,
R. A., Beverdam, A., Bertram, J. F., Capel, B., Chiu, H. S. et al. (2007). A
high-resolution anatomical ontology of the developing murine genitourinary
tract. Gene Expr. Patterns 7, 680-699.
Ma, Y., Cui, W., Yang, J., Qu, J., Di, C., Amin, H. M., Lai, R., Ritz, J., Krause, D.
S. and Chai, L. (2006). SALL4, a novel oncogene, is constitutively expressed in
human acute myeloid leukemia (AML) and induces AML in transgenic mice.
Blood 108, 2726-2735.
Mahoney, Z. X., Sammut, B., Xavier, R. J., Cunningham, J., Go, G., Brim, K.
L., Stappenbeck, T. S., Miner, J. H. and Swat, W. (2006). Discs-large homolog
1 regulates smooth muscle orientation in the mouse ureter. Proc. Natl. Acad. Sci.
USA 103, 19872-19877.
Majumdar, A., Vainio, S., Kispert, A., McMahon, J. and McMahon, A. P.
(2003). Wnt11 and Ret/Gdnf pathways cooperate in regulating ureteric
branching during metanephric kidney development. Development 130, 31753185.
DEVELOPMENT
Sall1 affects ub Wnt signaling
Marose, T. D., Merkel, C. E., McMahon, A. P. and Carroll, T. J. (2008). Betacatenin is necessary to keep cells of ureteric bud/Wolffian duct epithelium in a
precursor state. Dev. Biol. 314, 112-126.
Michael, L. and Davies, J. A. (2004). Pattern and regulation of cell proliferation
during murine ureteric bud development. J. Anat. 204, 241-255.
Michos, O., Goncalves, A., Lopez-Rios, J., Tiecke, E., Naillat, F., Beier, K., Galli,
A., Vainio, S. and Zeller, R. (2007). Reduction of BMP4 activity by gremlin 1
enables ureteric bud outgrowth and GDNF/WNT11 feedback signalling during
kidney branching morphogenesis. Development 134, 2397-2405.
Mugford, J. W., Yu, J., Kobayashi, A. and McMahon, A. P. (2009). Highresolution gene expression analysis of the developing mouse kidney defines
novel cellular compartments within the nephron progenitor population. Dev.
Biol. 333, 312-323.
Nie, X., Sun, J., Gordon, R. E., Cai, C. L. and Xu, P. X. (2010). SIX1 acts
synergistically with TBX18 in mediating ureteral smooth muscle formation.
Development 137, 755-765.
Nishinakamura, R., Matsumoto, Y., Nakao, K., Nakamura, K., Sato, A.,
Copeland, N. G., Gilbert, D. J., Jenkins, N. A., Scully, S., Lacey, D. L. et al.
(2001). Murine homolog of SALL1 is essential for ureteric bud invasion in kidney
development. Development 128, 3105-3115.
Novak, A., Guo, C., Yang, W., Nagy, A. and Lobe, C. G. (2000). Z/EG, a double
reporter mouse line that expresses enhanced green fluorescent protein upon
Cre-mediated excision. Genesis 28, 147-155.
Onai, T., Sasai, N., Matsui, M. and Sasai, Y. (2004). Xenopus XsalF: anterior
neuroectodermal specification by attenuating cellular responsiveness to Wnt
signaling. Dev. Cell 7, 95-106.
Osafune, K., Takasato, M., Kispert, A., Asashima, M. and Nishinakamura, R.
(2006). Identification of multipotent progenitors in the embryonic mouse kidney
by a novel colony-forming assay. Development 133, 151-161.
Park, J. S., Valerius, M. T. and McMahon, A. P. (2007). Wnt/-catenin signaling
regulates nephron induction during mouse kidney development. Development
134, 2533-2539.
Ribeiro, C., Neumann, M. and Affolter, M. (2004). Genetic control of cell
intercalation during tracheal morphogenesis in Drosophila. Curr. Biol. 14, 21972207.
Sato, A., Kishida, S., Tanaka, T., Kikuchi, A., Kodama, T., Asashima, M. and
Nishinakamura, R. (2004). Sall1, a causative gene for Townes-Brocks
Development 137 (18)
syndrome, enhances the canonical Wnt signaling by localizing to
heterochromatin. Biochem. Biophys. Res. Commun. 319, 103-113.
Schedl, A. (2007). Renal abnormalities and their developmental origin. Nat. Rev.
Genet. 8, 791-802.
Schmidt-Ott, K. M., Yang, J., Chen, X., Wang, H., Paragas, N., Mori, K., Li, J.
Y., Lu, B., Costantini, F., Schiffer, M. et al. (2005). Novel regulators of kidney
development from the tips of the ureteric bud. J. Am. Soc. Nephrol. 16, 19932002.
Schmidt-Ott, K. M., Masckauchan, T. N., Chen, X., Hirsh, B. J., Sarkar, A.,
Yang, J., Paragas, N., Wallace, V. A., Dufort, D., Pavlidis, P. et al. (2007). catenin/TCF/Lef controls a differentiation-associated transcriptional program in
renal epithelial progenitors. Development 134, 3177-3190.
Schuchardt, A., D’Agati, V., Larsson-Blomberg, L., Costantini, F. and Pachnis,
V. (1995). RET-deficient mice: an animal model for Hirschsprung’s disease and
renal agenesis. J. Intern. Med. 238, 327-332.
Schuchardt, A., D’Agati, V., Pachnis, V. and Costantini, F. (1996). Renal
agenesis and hypodysplasia in ret-k- mutant mice result from defects in ureteric
bud development. Development 122, 1919-1929.
Shakya, R., Watanabe, T. and Costantini, F. (2005). The role of GDNF/Ret
signaling in ureteric bud cell fate and branching morphogenesis. Dev. Cell 8, 6574.
Srinivas, S., Wu, Z., Chen, C. M., D’Agati, V. and Costantini, F. (1999).
Dominant effects of RET receptor misexpression and ligand-independent RET
signaling on ureteric bud development. Development 126, 1375-1386.
Sweeney, D., Lindstrom, N. and Davies, J. A. (2008). Developmental plasticity
and regenerative capacity in the renal ureteric bud/collecting duct system.
Development 135, 2505-2510.
Uchiyama, Y., Sakaguchi, M., Terabayashi, T., Inenaga, T., Inoue, S.,
Kobayashi, C., Oshima, N., Kiyonari, H., Nakagata, N., Sato, Y. et al.
(2010). Kif26b, a kinesin family gene, regulates adhesion of the embryonic
kidney mesenchyme. Proc. Natl. Acad. Sci. USA 107, 9240-9245.
Uez, N., Lickert, H., Kohlhase, J., de Angelis, M. H., Kuhn, R., Wurst, W. and
Floss, T. (2008). Sall4 isoforms act during proximal-distal and anterior-posterior
axis formation in the mouse embryo. Genesis 46, 463-477.
Zhao, H., Kegg, H., Grady, S., Truong, H. T., Robinson, M. L., Baum, M. and
Bates, C. M. (2004). Role of fibroblast growth factor receptors 1 and 2 in the
ureteric bud. Dev. Biol. 276, 403-415.
DEVELOPMENT
3106 RESEARCH ARTICLE