RESEARCH ARTICLE 3057
Development 137, 3057-3066 (2010) doi:10.1242/dev.046631
© 2010. Published by The Company of Biologists Ltd
Wnt signaling promotes oral but suppresses aboral structures
in Hydractinia metamorphosis and regeneration
David J. Duffy1, Günter Plickert2, Timo Kuenzel2, Wido Tilmann2 and Uri Frank1,*
SUMMARY
We studied the role of Wnt signaling in axis formation during metamorphosis and regeneration in the cnidarian Hydractinia.
Activation of Wnt downstream events during metamorphosis resulted in a complete oralization of the animals and repression of
aboral structures (i.e. stolons). The expression of Wnt3, Tcf and Brachyury was upregulated and became ubiquitous. Rescue
experiments using Tcf RNAi resulted in normal metamorphosis and quantitatively normal Wnt3 and Brachyury expression.
Isolated, decapitated polyps regenerated only heads but no stolons. Activation of Wnt downstream targets in regenerating
animals resulted in oralization of the polyps. Knocking down Tcf or Wnt3 by RNAi inhibited head regeneration and resulted in
complex phenotypes that included ectopic aboral structures. Multiple heads then grew when the RNAi effect had dissipated. Our
results provide functional evidence that Wnt promotes head formation but represses the formation of stolons, whereas
downregulation of Wnt promotes stolons and represses head formation.
INTRODUCTION
In cnidarians, components of the canonical Wnt signaling pathway
are thought to be involved in the establishment of the anteriorposterior (AP) axis (Amiel and Houliston, 2009; Broun et al., 2005;
Hobmayer et al., 2000; Kusserow et al., 2005; Lee et al., 2007;
Müller et al., 2004b; Plickert et al., 2006). The above studies, and
others, have shown that several Wnt genes are expressed
asymmetrically in the adult form, the polyp, with the highest
expression levels around the mouth area (i.e. the oral pole). Other
Wnt genes are expressed uniformly in the polyp. It has also been
demonstrated that, in Hydractinia and Clytia embryos, Wnt3, Tcf
and frizzled are maternally deposited at the pole of the oocyte that
corresponds to the future posterior pole of the larvae and the future
head, or oral pole, of the adult polyp (Momose and Houliston,
2007; Plickert et al., 2006). Nuclear -catenin was reported in the
corresponding pole of the Nematostella embryo (Wikramanayake
et al., 2003). Finally, it has been shown that misexpression of Wnt3,
frizzled (Momose et al., 2008; Momose and Houliston, 2007) and
-catenin (Gee et al., 2010), as well as blocking of GSK3 (Hassel
et al., 1993; Müller et al., 2004b), affects AP axis formation,
suggesting that a Wnt-mediated organizer acts to specify the
position of the cnidarian head (Broun et al., 2005). There is no
functional data in the literature on the effect of Wnt pathway
inhibition on aboral structures (Tanaka and Weidinger, 2008).
Hydractinia echinata is a dioecious colonial marine hydroid
common in the European North Atlantic. The Hydractinia life
cycle is depicted in Fig. S1 in the supplementary material. A
Hydractinia colony is composed of repeating genetically identical
1
School of Natural Sciences and Martin Ryan Marine Science Institute, National
University of Ireland, Galway, Galway, Ireland. 2Biozentrum Köln, University of Köln,
Zülpicher Str. 47b, 50674 Köln, Germany.
*Author for correspondence ([email protected])
Accepted 29 June 2010
polyps. Two types of polyps predominate: feeding polyps
(gastrozooids) and sexual polyps (gonozooids), which carry the
gonads (see Fig. S1 in the supplementary material). All polyps in
a colony are interconnected by a system of gastrovascular tubes
called stolons that enable distribution of food and exchange of stem
cells among remote parts of the colony (Müller, 1964; Müller et al.,
2004a). Polyps are cylinder-shaped and comprise two epithelial
layers, epidermis and gastrodermis, which are separated by a
basement membrane, the mesoglea. Polyps are polarized, with a
mouth surrounded by tentacles at one end (the oral pole, or head)
and stolons at the other end (the aboral pole). Colonies grow by
elongation of the stolons from which new polyps bud. Sexual
reproduction occurs daily by the release of eggs and sperm into the
water by female and male colonies, respectively, in a light-induced
spawning event. The embryo develops within 3 days into a planula
larva that is competent to metamorphose into a primary polyp
(Frank et al., 2001). The direction of movement of the larva is
referred to as anterior. This anterior larval pole, however, does not
correspond with the head of the polyp. After receiving an external
metamorphosing signal, the larva attaches to the substrate by its
anterior end, which becomes the aboral pole of the polyp (i.e.
stolons), whereas the posterior end of the larva transforms into a
head. Wnt3 and Tcf mRNAs are maternally deposited in the
prospective oral pole of the unfertilized egg and are later
zygotically expressed in the same pole of the embryo (Plickert et
al., 2006). In the metamorphosis-competent larva, however, the
expression of these genes is significantly downregulated.
Expression of Wnt3 and Tcf increases in the posterior end of the
larva following the induction to metamorphose and remains present
through maturation as a spot of Wnt3-expressing cells at the very
oral end of the polyp.
In order to extend our knowledge of the role of the Wnt
signaling pathway in cnidarian axis formation downstream of catenin stabilization, and to examine a possible effect on aboral
development, we have performed functional studies on the
specific role of the Wnt downstream transcription factor Tcf in
DEVELOPMENT
KEY WORDS: Wnt, Tcf, -catenin, Axis formation, Posterior patterning, Hydractinia, Cnidaria, RNAi, Metamorphosis, Regeneration,
Organizer, Invertebrate, Oocytes, Gonads, Sperm maturation, Sperm development, Oogonia
3058 RESEARCH ARTICLE
MATERIALS AND METHODS
Animals
Hydractinia echinata colonies were collected from Galway Bay by
SCUBA diving. They were cultured in natural seawater at 18°C under
14:10 light:dark regimes and were fed brine shrimp nauplii (Artemia
salina) six times a week. Sperm and eggs were collected daily about an
hour after the onset of light and embryos were kept in Petri dishes for 3
days until embryos had completed development into metamorphosiscompetent planula larvae. Metamorphosis was induced by a 3-hour pulse
treatment of 116 mM CsCl in seawater as previously described (Frank et
al., 2001; Müller and Buchal, 1973) and the animals were allowed to settle
and metamorphose on glass coverslips. For regeneration experiments,
polyps were cut near their bases from adult colonies using fine surgical
scissors and their heads removed by a transverse cut just below the
hypostome.
Azakenpaullone treatments
Stock solutions of azakenpaullone (Sigma) at 1 mM were prepared in
DMSO and added to seawater to reach a final concentration of 1 M.
Treatments were carried out in the dark at 18°C.
Obtaining gene sequences
Degenerate -catenin primers designed against the armadillo repeat region
of the Hydra -catenin protein (GenBank accession no. AAC47137),
forward 5⬘-CAYCARGARGGIGCIAARATG-3⬘ and reverse 5⬘YTGCATICCNCCIGCYTCIAC-3⬘, were used to isolate a 301 bp
fragment from Hydractinia cDNA. To obtain full-length sequences,
SMART RACE protocol (Clontech) was used for 3⬘ RACE, and the
Hydractinia trans-spliced leader 5⬘-ACTCACACTATTTCTAAGTCCCTGAG-3⬘ was used for 5⬘ RACE. Tcf-specific primers were designed
from the published 323 bp Hydractinia Tcf sequence [GenBank accession
no. AM279679 (Plickert et al., 2006)]. The gene-specific primers used
were as follows: 3⬘ Tcf obtained with the RNAi forward primer (see
below); 5⬘ Tcf obtained with the qPCR reverse primer (see below); 3⬘
-catenin obtained with forward primer 5⬘-TGCACTGTTACATAAAACGA-3⬘; 5⬘ -catenin obtained with reverse primer 5⬘-AAAACTTTCAAGACACGACA-3⬘. Bra, Wnt3, Vasa and GAPDH primers were
designed from the GenBank accession nos. AF312733.1, AM279678,
EF467228.1 and DT622622, respectively.
Quantitative real-time PCR (qPCR)
Total RNA was extracted from samples to be analyzed by acid
guanidinium-phenol:chloroform extraction then DNase digested. RNA was
extracted about 2 hours after the end of treatment. It was reversetranscribed to cDNA using Omniscript Reverse Transcriptase (Qiagen).
qPCR was performed on a StepOne Plus (Applied Biosystems) with Power
SYBR or TaqMan reagents according to the manufacturer’s recommended
protocol. Gene expression was normalized to the expression of GAPDH.
Generated PCR products were analyzed by melt curve analysis, gel
electrophoresis and sequencing. The following primer sets were used:
GAPDH forward 5⬘-TGCTACAACTGCCACACAGAAAA-3⬘ and reverse
5⬘-CACCACGACCATCTCTCCATTT-3⬘ or forward 5⬘-CAGTTTCTGTTTGGGTCGAAGATCAC-3⬘ and reverse 5⬘-TGCACCTGTCGAGGCGGGGATAATATTTTG-3⬘; GAPDH TaqMan probe 5⬘CAGCACCACGACCATC-3⬘,
forward
5⬘-CCACACAGAAAACAGTTGATGGT-3⬘ and reverse 5⬘-ACCTTTCCAACAGCCTTTGCT-3⬘;
Wnt3 forward 5⬘-CCAACACCAACGCGAAGTATG-3⬘ and reverse 5⬘ACCTTCCCCGACACTTCTGA-3⬘; Brachyury forward 5⬘-CCAACCGGCACCACTTAAA-3⬘ and reverse 5⬘-CGAGCTAACGGCGACACTTT-3⬘; Vasa forward 5⬘-GCCCACCTTAGACCCTGACA-3⬘ and
reverse 5⬘-CTGATGGTTCTGGCGGTACA-3⬘; Tcf forward 5⬘-GCGCCATTCACATGCAGTTA-3⬘ and reverse 5⬘-GTGACGTTACTGGTGATATCGATGT-3⬘; Tcf TaqMan probe 5⬘-TCGGCTCCGTCTTCG-3⬘,
forward 5⬘-CAACTTCCAACTTCTACCCCTTCTG-3⬘ and reverse 5⬘CATTCATCTTCTTCTCTGGCATATCGT-3⬘. The 18s rRNA assay used
was the Applied Biosystems Eukaryotic 18S rRNA Endogenous Control
Assay (433760 T).
RNAi experiments
Templates for RNA synthesis were made by PCR. Two templates were
made for each dsRNA, one with a T7 promoter site on the forward primer
and a second with a T7 site on the reverse primer. Primer pairs for Tcf were
as follows: T7 forward 5⬘-GATCATAATACGACTCACTATAGGGGTGGCATGCTTTGGAGAAAT-3⬘ and reverse 5⬘-ACGGTTTGCACCATTGTTCT-3⬘ or forward 5⬘-GTGGCATGCTTTGGAGAAAT-3⬘ and
reverse 5⬘-GATCATAATACGACTCACTATAGGGACGGTTTGCACCATTGTTCT-3⬘.
Primer pairs for Wnt3 were as follows: T7 forward 5⬘GATCATAATACGACTCACTATAGGGGAGTCCGCCTTCATTAGTGG3⬘ and reverse 5⬘-TGGGCGGAGTCGTATCTATC-3⬘ or forward 5⬘GAGTCCGCCTTCATTAGTGG-3⬘ and reverse 5⬘-GATCATAATACGACTCACTATAGGGTGGGCGGAGTCGTATCTATC-3⬘.
Control RNAi unspecific to Hydractinia mRNA was constructed using
part of the backbone of pGEM-T plasmid (Promega). First, a template was
amplified from the plasmid using the non-T7 forward and reverse primers
(below). Then, to obtain templates for transcription, the primer pairs
used were as follows: T7 forward 5⬘-TGTAATACGACTCACTATAGGGGGCGCTTTCTCATAGCTCAC-3⬘ and reverse 5⬘-TACCGGGTTGGACTCAAGAC-3⬘ or forward 5⬘-GGCGCTTTCTCATAGCTCAC3⬘ and T7 reverse 5⬘-TGTAATACGACTCACTATAGGGTACCGGGTTGGACTCAAGAC-3⬘.
The resulting templates (246 bp for Tcf, 432 bp for Wnt3 and 144 bp for
pGEM-T control) were used to make single-stranded RNA using the
RiboMax T7 kit (Promega) according to manufacturer’s instructions. The
resulting complementary strands of RNA for each gene were mixed
together and heated to 70°C for 10 minutes in a water bath. The tubes were
left in the bath while the water cooled to room temperature, allowing the
complementary strands to anneal. The double-stranded RNA (dsRNA) was
then digested by DNase and RNase A and T1 before being precipitated by
ammonium acetate and ethanol and washed. The purified dsRNA was then
dissolved in water. For treatments, animals were incubated in a solution of
dsRNA in seawater at a final concentration of 80 ng/l.
In situ hybridization
In situ hybridization was performed as previously described (Gajewski et
al., 1996; Mali et al., 2006). Hybridizations were performed at 55°C. Tcf
probes were synthesized using the same templates as for the dsRNA. Bra
253 bp probes were synthesized from a PCR template from the following
primers: SP6 forward 5⬘-TAGCAATTTAGGTGACACTATAGAAAGAGGGATGCTTTGAACCAA-3⬘ and T7 reverse 5⬘-GATCATAATACGACTCACTATAGGGTCATCGGGAGAGCCATAGTT-3⬘. Wnt3
309 bp probes were synthesized from a plasmid containing a PCR fragment
from the following primers: forward 5⬘-ATGGATTGTTTCCATAAAGTTTTACTGCTG-3⬘ and reverse 5⬘-GGTCCAAAAACTGACCCTTTC-3⬘. -catenin probes of 144 bp were synthesized following templategenerating PCRs with the following primers: sense probe T7 forward 5⬘TGTAATACGACTCACTATAGGGGGCTGGTGGCTTACAGAAAA-3⬘
and reverse 5⬘-CGGATCCACCTGATGCTAAT-3⬘, anti-sense probe
forward 5⬘-GGCTGGTGGCTTACAGAAAA-3⬘ and T7 reverse 5⬘TGTAATACGACTCACTATAGGGCGGATCCACCTGATGCTAAT-3⬘.
RESULTS
Gene sequences
The full coding sequence of the Hydractinia -catenin showed
84% similarity to the closely related hydroid Podocoryne carnea
-catenin and 74% to Hydra vulgaris and H. magnipapillata -
DEVELOPMENT
two axis formation events in Hydractinia development:
metamorphosis and head regeneration. We also studied the
specific role of Wnt3 in these processes and performed
quantitative gene expression analyses to reveal positive-feedback
loops among Wnt genes. Our results suggest an additional role
for Wnt in cnidarian axis formation beyond purely specifying the
site of head development.
Development 137 (18)
Wnt signaling in cnidarian development
RESEARCH ARTICLE 3059
catenin at the nucleotide level. At the protein level, it showed 94%
and 77% similarity to Podocoryne and Hydra -catenin,
respectively (see Fig. S2 in the supplementary material).
The full coding region of Tcf showed closest similarity to the
Hydra magnipapillata Tcf with 67% identity and 76% positives at
the protein level (see Fig. S2 in the supplementary material). All
new gene sequences have been deposited in GenBank under
accession nos. GU145277 for -catenin and GU145278 for Tcf.
The Hydractinia trans-spliced leader was used to obtain the 5⬘
sequences of -catenin and Tcf. This trans-spliced leader is added
to many, although not all, Hydractinia transcripts (our unpublished
results), which is similar to the situation in Hydra (Stover and
Steele, 2001), and can be used to easily obtain full 5⬘ ends of
Hydractinia mRNAs.
Abolition of aboral fate identity during
metamorphosis
To determine whether the oral-aboral (OA) axis of the primary
polyp is patterned only once, along with the larval AP axis early in
development, or is continuously maintained during embryonic
development and metamorphosis, Wnt signaling was ectopically
activated throughout the metamorphosing larvae. This was done by
Fig. 1. Expression patterns of Wnt3 and Brachyury. (A)Wnt3 is
expressed at the prospective oral pole of a 16-cell embryo.
(B)Expression continues to be polarized to the future oral pole in 1-dayold gastrulae. (C)Three-day-old planula larvae express Wnt3 at the tip
of their tail (arrowhead), corresponding to the oral pole of the polyp.
(D)Mature feeding polyp. Wnt3 is only expressed at the tip of the oral
axis. (E)Mature male sexual polyp. Wnt3 is expressed at the oral pole
(upper arrowhead) and at the tips of gonads (lower arrowhead).
(F)Brachyury expression in a mature feeding polyp. Brachyury is also
only expressed at the oral pole. Scale bars: 200m.
incubating metamorphosis-induced animals in azakenpaullone, a
specific inhibitor of GSK3 (Kunick et al., 2004; Teo et al., 2006),
thereby mimicking a global Wnt signal.
Larvae were induced to metamorphose for 3 hours (Müller,
1973), then incubated in seawater containing a final concentration
of 1 M azakenpaullone for 18 hours. These treatments resulted in
an extreme oralized phenotype in most of the treated animals
(70%), with complete absence of aboral structures (stolons) and
body columns; however, many ectopic tentacle buds developed
from the entire animal (Fig. 3B; see Fig. S3B in the supplementary
material). Stolon buds normally develop synchronously with
tentacle buds and body columns but the treated animals began
budding tentacles without having developed a body column and
stolon buds. As metamorphosis continued, these buds went on to
form fully developed tentacles. As a result, the animals appeared
as balls with tentacles, completely oralized and lacking any nonhead features, being virtually ‘floating heads’ (Fig. 3B,P; see Fig.
S3C in the supplementary material). The remaining 30% of the
animals had a less severe phenotype, with ectopic tentacles on
reduced-sized body columns and mostly completely lacking
stolons. Quantitative real-time PCR (qPCR) demonstrated that the
expression level of Wnt3, itself a target of Wnt signaling, and also
the expression of two of its classical target genes, Brachyury and
Tcf, were significantly upregulated upon azakenpaullone treatment
(Fig. 3Q-S). In situ hybridizations of Wnt3, Brachyury and Tcf
mRNA showed that on the day the treatment was ended,
azakenpaullone-treated animals expressed all three genes
ubiquitously throughout their bodies (Fig. 3M-O). Normally, Wnt3,
Brachyury and Tcf expression is restricted to the oral pole of the
animal throughout the life cycle, including at this stage (Fig. 3I-K).
During the 24 hours after the azakenpaullone treatments were
terminated, Wnt3 expression gradually resumed a normal pattern,
becoming restricted to the oral tip as in untreated metamorphosed
animals (Fig. 3P). This was followed, with a 3-4 day delay, by the
DEVELOPMENT
Expression pattern of Wnt3, -catenin and Tcf in
normal Hydractinia polyps
As previously reported (Müller et al., 2007), Hydractinia Wnt3
expression was restricted to the prospective oral poles of embryos
and larvae (Fig. 1A-C), and to the oral pole of normal polyps in
both the epidermis and the gastrodermis (Fig. 1D,E), which is very
similar to Wnt3 expression in Hydra (Hobmayer et al., 2000). This
pattern was maintained throughout the budding, growth phase and
adult life of the polyps, and there was very little variation among
different polyps within and between clones. Wnt3 expression also
occurred at the apical pole of the gonads as previously described
(Fig. 1E) (Müller et al., 2007).
Hydractinia polyps expressed -catenin ubiquitously throughout
their life cycle, with slightly higher levels of expression in the head
(Fig. 2I), similar to -catenin expression in Hydra polyps
(Hobmayer et al., 2000). -catenin was more strongly expressed in
the earliest stages of development, until the larval stage (Fig. 2E,F).
Its expression was also strongly upregulated in oocytes and during
spermatogenesis; however, it was no longer expressed in fully
developed mature sperm (Fig. 2G,H).
The peak expression of Tcf in Hydractinia polyps was around
the mouth area (Fig. 2D; Fig. 3I). This expression pattern
corresponds well with the one observed in Hydractinia embryos
(Plickert et al., 2006) and Hydra polyps (Hobmayer et al., 2000).
Like -catenin, Tcf expression was upregulated in oocytes,
initially detectable as they migrate from the germinal zone into
the developing gonads (Fig. 2A-C). Tcf is known to be a
maternal transcript (Plickert et al., 2006). Our results show that
the source of maternal Tcf and -catenin mRNAs is the oocyte
itself rather than nurse cells, as might be the case in Hydra
(Alexandrova et al., 2005).
Brachyury was expressed in a very similar way to Wnt3 but with
a slightly broader expression domain. It was restricted to just a few
cells in the oral end of the polyp, confirming previous observations
(Fig. 1F; Fig. 3J) (Müller et al., 2007). Throughout development,
Brachyury expression was weaker than that of Wnt3 and Tcf.
However, in mature feeding polyps, Brachyury mRNA levels are
closer to Wnt3 and Tcf as revealed by qPCR (our unpublished
results).
3060 RESEARCH ARTICLE
Development 137 (18)
Fig. 2. Expression patterns of Tcf and -catenin. (A-D)Tcf. (A)Female polyp. Strong expression is visible in the developing gonads with weaker
expression in the polyp head. (B)Young oocytes expressing Tcf as they enter the developing gonad. (C)Tcf expression in two oocytes located in a
newly developed gonad. mRNA is concentrated uniformly around the germinal vesicle. (D)Oral (top) view of mature feeding polyp. Tcf expression is
visible around the mouth. (E-I)-catenin. (E)Ubiquitous expression in the early stages of development (16-cell embryo and late gastrula).
(F)Expression in the larva is ubiquitous, but increased expression is also seen at the future oral pole in a similar domain as Wnt3 (arrowhead).
(G)Female polyp. -catenin is expressed in the head of the polyp, in early oocytes in the germinal zone and in oocytes in early gonads. (H)Male
sexual polyp. -catenin is expressed in the head of the polyp and during spermatogenesis, but not in mature sperm. i, immature male gonad
expressing -catenin during sperm development; m, mature gonad no longer expressing -catenin. (I)-catenin is ubiquitously expressed at low
levels throughout mature feeding polyps. Increased expression is seen just under the apical tip of the mouth. h, head (A, G and H). Scale bars:
200m in A,D-I; 20m in B,C.
For each animal, total stolon length and the length of the longest
tentacle bud were measured at 28 hours after induction of
metamorphosis. A head development to stolon development ratio
was obtained by dividing an animal’s stolon length by the length
of its longest tentacle bud, which was taken as a proxy for the level
of head development. This was not done for animals completely
lacking stolons or tentacles to avoid division by zero. The data was
then coded by assigning each ratio into one of eight groups (Table
1) and the results were graphed to show the shift in the balance
between oral and aboral development (Fig. 3H). Group 1 contains
animals with no aboral development, but with heads, whereas
Group 8 animals had no oral development but had grown stolons.
Groups 2-7 were intermediate stages between the two above
extremes. The range of stolon:tentacle ratio in control animals fell
within Groups 2-6 with the structures of both poles developing
synchronously. The data was normally distributed for control
animals with 40% in Group 4. Tcf RNAi-treated animals showed
completely abnormal development, strongly deviating from normal
distribution with only 10% in Group 4. Thirty-nine percent of the
treated animals fell into groups unique to the treatment (i.e. no
control animals in the group). Only 31% of treated animals
Table 1. Grouping of stolon:tentacle length ratios
Group
1
2
3
4
5
6
7
8
Stolon:tentacle ratio
Stolons absent; tentacles present
0.1-2
2-4
4-7
7-9
9-12
12+
Stolons present; tentacles absent
The values of the stolon:tentacle ratios are calculated from total stolon length per
length of longest tentacle. Group 1 denotes any animal that had no stolons but had
tentacles. Group 8 contains all animals that had stolons but no tentacle
development, and therefore has no numerical value.
DEVELOPMENT
acquisition of a gradually more normal phenotype, with growth of
normal body columns and stolons and loss of ectopic tentacles,
showing that AP patterning occurs continuously in Hydractinia.
In order to show that the oralized phenotype is the result of
ectopic activation of the canonical Wnt signaling, we performed
rescue experiments by downregulating the mRNA levels of the
Wnt downstream transcription factor Tcf using RNAi. For these
treatments, metamorphosing animals were co-incubated in 1 M
azakenpaullone and 80 ng/l of Tcf dsRNA. These experiments
resulted in animals that showed a normal phenotype compared with
animals treated with azakenpaullone-only. The rescued polyps had
no ectopic tentacles and their body columns and stolons appeared
normal (Fig. 3C; see Fig. S3A in the supplementary material). In
support of these results, qPCR analysis showed that the net result
of the combined azakenpaullone and Tcf RNAi was a normal
expression level of Wnt and Brachyury. Tcf expression remained
similar to the RNAi treatment level (Fig. 3Q-S).
To examine the effect of Tcf knockdown alone (i.e. without
azakenpaullone treatment), gastrulae 36 hours post-fertilization were
incubated for 15 hours in seawater containing Tcf dsRNA.
Immediately after this incubation, the now-competent larvae were
induced to metamorphose using CsCl for 3 hours. After induction,
they were subjected to a second Tcf RNAi treatment, this time lasting
24 hours. This was done to ensure a prolonged period of Tcf mRNA
depletion, given that RNAi downregulated gene expression reappears
30-60 hours after termination of the treatment (Plickert et al., 2003).
Tcf knockdown neither affected the ability of the embryos to develop
to metamorphosis-competent larvae, nor to begin metamorphosis.
The initial stages of metamorphosis, i.e. normal contraction and
settlement, also occurred normally up to stages 11-12 (Seipp et al.,
2007). However, the treated animals then failed to develop properly
patterned primary polyps. By 28 hours post-induction, 30% of the
treated animals had failed to develop either stolons or tentacles,
compared with 7% of the controls (Fig. 3D,G). A further 39% of
treated animals also failed to develop a normal primary polyp by this
time. They showed, instead, a general tendency of a shift in the OA
balance towards aboral structures (Fig. 3E,F), as described below.
Wnt signaling in cnidarian development
RESEARCH ARTICLE 3061
developed normally, whereas 27% of treated animals showed a lack
of only oral development upon Tcf knockdown (Groups 7 and 8)
compared with 0% of controls. Unexpectedly, 12% of treated
animals developed only heads (Group 1). However, despite not
forming stolons, the heads of Group 1 animals, although present,
had only developed on average to one quarter the size of the
controls (Fig. 3E).
In summary, knocking down of Tcf by RNAi disrupted the
balance between oral and aboral development. Oral development
was affected in 69% of Tcf RNAi-treated animals, of which 27%
were lacking in oral development only, 12% were lacking stolon
development but also showing severely reduced oral development,
and a final 30% failed to develop oral and aboral structures
altogether by 28 hours post-induction. The specificity of the RNAi
was demonstrated by the qPCR experiments, which were
normalized to GAPDH expression, showing also that the
expression of two unrelated genes, 18s rRNA and the stem-cell
marker Vasa (Rebscher et al., 2008), remained unchanged (Fig.
3T,U). In addition, normal phenotypes were obtained when Tcf
RNAi was done in combination with azakenpaullone (see above).
DEVELOPMENT
Fig. 3. Altered body proportioning and
gene expression after Wnt activation
and Tcf knockdown during
metamorphosis. (A-F)Primary polyps 1 day
after metamorphosis induction. (A)Control
primary polyp with both stolon (s) and
tentacle buds (t) visible. (B)Azakenpaullonetreated, oralized primary polyp. Ectopic
tentacles are visible but no aboral structures
(body column or stolons) are present.
(C)Rescued primary polyp. Treatment with
azakenpaullone and Tcf RNAi results in
normal development. (D-F)Tcf RNAi
treatment phenotypes. (D)Axial patterning
has been inhibited with no bud
development of either kind. (E)Only oral
development, 3 tentacle buds are visible.
(F)Only aboral development, 2 stolons are
visible. (G)Graph of the percentage of
control and Tcf RNAi-treated primary polyps
showing no bud development of either kind.
(H)Oral-aboral balance in control and Tcf
RNAi-treated animals. Tcf RNAi directed
animals to an aboral fate with little or no
head formation. However, some animals
showed reduced head development and no
stolons. Classes 1-8 indicate coded stolon by
tentacle values calculated in Table 1.
(I-P)Wnt3, Tcf and Brachyury expression 1
day post-metamorphosis, except L and P,
which are 2 days after metamorphosis. Top
row, control animals; bottom row,
azakenpaullone-treated animals.
(I-L)Polarized oral expression in normal
animals. (I)Tcf. (J)Brachyury (arrowhead).
(K,L)Wnt3 (arrowhead). (M-O)Depolarized,
ubiquitous expression following
azakenpaullone treatment. (M)Tcf.
(N)Brachyury. (O)Wnt3. (P)By 24 hours after
the end of treatment (48 hours after
metamorphosis induction), normal
polarization of Wnt3 mRNA has been reestablished in oralized animals (arrow).
(Q-U)Expression levels of Wnt target genes
and non-target controls analyzed by qPCR.
Expression levels are normalized to GAPDH.
The relative quantity (RQ) of expression of
Tcf (Q), Brachyury (R) and Wnt3 (S) in control
animals was compared with expression
levels in the three treatment groups: Tcf
RNAi, 24 hours azakenpaullone and rescue
(24 hours azakenpaullone + Tcf RNAi). Vasa
(T) and 18s rRNA (U) expression in control
and double-treated (15 hours + 24 hours)
Tcf RNAi groups. Scale bars: 200m.
3062 RESEARCH ARTICLE
Development 137 (18)
The role of Wnt in regeneration
To study the role of Wnt in polyp regeneration we used
azakenpaullone and RNAi in regenerating polyps. Polyps from
mature colonies had their heads removed just beneath the
hypostome by a transverse cut. They were then isolated from the
colony by cutting close to the stolonal mat without the inclusion of
stolonal tissue, resulting in cylinder-like body columns (Fig. 4A).
Normal regeneration in isolated, decapitated Hydractinia
polyps proceeded as follows: several hours after cutting, the
wounds on either end of the polyp body column had healed. At
this stage, no early structures, i.e. tentacle buds, hypostome
or stolons, were visible to indicate the OA polarity. A spot
of Wnt3 expression, however, became established at one end
of the body column alone, indicating that polarity was
maintained or re-established within 1 day post-cutting (Fig. 5A).
By the next day, i.e. 2 days post-cutting, new head structures
became visible, usually as tentacle buds (Fig. 4B). Complete
heads could be observed by the third day after cutting at one
end of the polyp only, whereas the other end showed no
further development after wound healing (Fig. 4F). Rarely,
DEVELOPMENT
Fig. 4. Regeneration. (A)Schematic illustration of the cutting procedure showing the source of the body column tissue used for the experiments.
(B-E)Polyp regeneration 2.5 days following decapitation. (B)Seawater control polyp has regenerated a single head. (C)pGEM-T RNAi-treated control
polyp, at the same concentration and time of incubation as Wnt3 and Tcf RNAi-treated polyps, also shows normal head regeneration. (D)Tcf RNAi
treatment inhibits head regeneration, despite wound healing occurring normally. (E)Similarly, Wnt3 RNAi-treated polyps have also failed to regenerate
heads. (F)Control body column, 3 days post-cutting. The head has regenerated at the oral pole and no development past wound healing occurs at the
aboral pole. (G-J)Tcf RNAi-treated body columns. G is 3 days post-decapitation and H-J are over 1 week post-decapitation. (G)Still no head
regeneration. (H)Double head regeneration after RNAi knockdown has faded. Heads are separated by branching of the body column. (I)Two smaller
offshoot polyps deviating from the oral-aboral axis of the original body column. (J)Phenotype showing the development of four heads and small polyps
from the original body column. (K-O)Wnt3 RNAi-treated body columns. K is 4 days post-decapitation; L-O over 1 week post-decapitation.
(K)Development of stolon bud (bottom left corner) in the absence of head regeneration. (L)Further development and branching of stolons over time.
Head regeneration failed to occur. (M)Multiple heads forming side-by-side (arrowheads) and a smaller polyp budding from the opposite end of the
body column. (N)Two small offshoot polyps formed at either end of the body column (arrowheads) with the remainder of the tissue developing into
contorted stolon-like tissue. (O)Offshoot polyp formed at a right angle to the original oral-aboral axis. The rest of the body column has lost the tissue
identity of a polyp body. (P-S)Azakenpaullone-treated body columns. (P)A body column treated for 24 hours post-cutting develops heads at both ends.
(Q)A body column treated for 48 hours lost polyp body shape, forming a ball-like structure. (R,S)Following the ball stage, the columns that had been
treated for 48 hours have been repatterned to an oralized fate. Ectopic tentacles develop while body tissue is absent. Scale bars: 200m. t, tentacles;
s, stolons.
Fig. 5. Wnt3 expression in regeneration. (A-E)Control regeneration.
(A)1 day post-decapitation. A spot of Wnt3 expression appears at the
future site of head formation. (B)36 hours post-decapitation.
Regenerated hypostome, expressing Wnt3 at the oral tip, and early
tentacle buds are visible. (C)36 hours post-decapitation. Broader Wnt3
expression domain at the oral pole. (D)2 days post-decapitation. Wnt3
expression remains restricted to around the mouth. (E)7 days postdecapitation. Fully regenerated polyp. Wnt3 expression remains
restricted to the oral pole. (F-I)Wnt3 RNAi-treated body columns. (F)1
day post-decapitation. Treated polyps fail to re-establish Wnt3
expression. (G)36 hours post-decapitation. An additional Wnt3expressing spot appears at the top and bottom of the polyp after RNAi
inhibition had dissipated. (H)2 days post-decapitation. A stolon bud
developed in the absence of a Wnt3 signal (bottom right of polyp) and
a single expression spot has later been established (top of polyp). (I)2
days post-decapitation. Multiple Wnt3 expression domains remain
established (top and bottom left of polyp). (J,K)Tcf RNAi-treated body
columns. (J)36 hours post-decapitation. Two broad expression domains
have been established (putative head regeneration sites). (K)2 days
post-decapitation. Multiple expression sites are still present although
heads have yet to regenerate. (L-O)Late-stage regenerated Wnt3 RNAi
polyps. (L)Ectopic expression in two polyps after head regeneration.
The asterisk denotes ectopic Wnt3 expression along the extended
hypostome of the first polyp. The second polyp (left) has ectopically
regenerated two heads, each showing Wnt3 expression localized
around the mouth, visible in insets 1 and 3 at higher magnification. The
left polyp also has a stolon-like outgrowth (inset 2) that does not
express Wnt3. (M)Polyp in which, after RNAi treatment, stolonal tissues
developed. Stolons do not express Wnt3. After the RNAi inhibitory
phase ended, a single head regenerated, showing normal oralized
expression (asterisk). (N)Ectopic Wnt3-expressing oral outgrowth
(asterisk). The outgrowth is located on the side of the polyp body
column, not at a pole. (O)Ectopic stolon bud formation. Stolon
budding occurred in the absence of Wnt3 expression. Scale bars:
200m in A-K; 500m in L,M; 50m in N,O.
RESEARCH ARTICLE 3063
in<5% of the cases, polyps developed a head at both ends of
the body column. Stolon regeneration occurred in <1% of the
cases.
To interfere with normal Wnt signaling during regeneration, we
used RNAi to downregulate Wnt3 and Tcf mRNA levels in isolated,
decapitated polyps. The knockdown was confirmed by in situ
hybridization and qPCR. As mentioned above, 1 day after cutting,
a spot of Wnt3 expression developed at the future site of head
regeneration in decapitated, but otherwise untreated, isolated
polyps (Fig. 5A). In polyps that were also treated with Wnt3
dsRNA, however, this spot of expression was absent (Fig. 5F).
These results were confirmed quantitatively by qPCR that not only
Wnt3, but also two of its target genes, Tcf and Brachyury, were
downregulated following incubation in Wnt3 dsRNA (Fig. 6A-C),
whereas the expression of two unrelated genes, 18s rRNA and
Vasa, were not downregulated (Fig. 6D,E). We also treated polyps
with Tcf dsRNA. These experiments gave similar results to Wnt3
RNAi, i.e. specifically downregulating not only Tcf, but also Wnt3
and Brachyury (Fig. 6A-C), while not reducing the expression of
unrelated genes (Fig. 6D,E).
In polyp body columns treated with Wnt3 RNAi, head
regeneration was inhibited. The earliest head structures (tentacle
buds) became visible only 3 or 4 days after cutting (2 or 3 days after
the end of treatment) when the effect of the RNAi had dissipated,
compared with 2 days after cutting for controls. Interestingly, in
contrast to normal regeneration where stolons did not develop, in
RNAi-treated animals, stolon buds appeared in 30% of the cases
from 2 or 3 days after cutting (1 and 2 days after the end of
treatment). Stolons, which were identified by their ability to attach
to the substratum (see Fig. S3G-I in the supplementary material),
only developed in animals in which no head regeneration was
present (Fig. 4K). Another common phenotype only seen in Wnt3
RNAi-treated polyps (15%) was the formation of two abnormally
small heads side by side, on the same pole of the polyp, a
phenomenon which was never seen in controls but often observed
in cut polyps treated with LiCl (Fig. 4M; see Fig. S3E,F in the
supplementary material). Five days after cutting (4 days after the
end of the treatment), 20% of the treated animals had developed
small ectopic polyps protruding from the original body column (Fig.
4M-O). By 13 days after the end of treatment, 15% of RNAi-treated
body columns had developed into non-headed, multi-branched
stolon-like structures, or small offshoot polyps coming from an
intertwined mass of tissue. Rarely (5%) did such tissue knots bud
small offshoot polyps at either end (Fig. 4L,N). Downregulation of
Tcf resulted in similar phenotypes (Fig. 4G-J). The specificity of
Wnt3 and Tcf RNAi treatments was further demonstrated by
incubating decapitated polyps in dsRNA corresponding to the
backbone of pGEM-T vector. Such treatments resulted in single
head formation occurring with the same timing as in polyps allowed
to regenerate in the absence of dsRNA (Fig. 4B,C). None of the
phenotypes resulting from Wnt3 or Tcf RNAi treatments occurred
in the pGEM-T control RNAi treatments. The Wnt3 and Tcf RNAi
prevented the re-establishment of a Wnt3 expressing spot, thereby
delaying head regeneration. During the absence of normal Wnt3
expression, some polyps formed stolon buds. Once the RNAi had
dissipated, multiple Wnt3 expression sites were established in many
polyps (Fig. 5). In polyps that went on to develop multiple heads,
each head contained a Wnt3-expressing spot (Fig. 5L). Conversely,
stolon buds showed no Wnt3 expression (Fig. 5H,M,O).
To study the effect of global Wnt activation on regeneration, we
treated isolated decapitated polyps with azakenpaullone. A 24-hour
treatment resulted in the polyps developing two heads, one of them
DEVELOPMENT
Wnt signaling in cnidarian development
3064 RESEARCH ARTICLE
Development 137 (18)
ectopically at the original aboral pole, instead of only the single
head regenerated in the controls. This result occurred in 85% of
cases (Fig. 4P) compared with <5% of the controls. No aboral
structures such as stolons developed in regenerating animals treated
by azakenpaullone. In decapitated isolated polyps treated with
azakenpaullone for 48 hours, the body columns degenerated into
spherical bodies (Fig. 4Q). This was followed 5-6 days later by the
development of tentacles from all sides of the animals but without
any aboral structures (body columns and stolons) in 56% of the
cases (Fig. 4R,S). The remaining 44% did not progress past the
‘ball’ stage. Hypostomes and mouths failed to develop in half of
the post-ball animals; some merely comprised tentacles joined
together without any other tissue (see Fig. S3D in the
supplementary material). These 48-hour treated polyps resemble
the effects of the azakenpaullone treatment during metamorphosis,
i.e. fully oralized animals.
When azakenpaullone treatments were performed in conjunction
with Tcf RNAi, the cut polyps failed to develop the double heads
characteristic of the azakenpaullone phenotype. However, such
treatments produced animals more similar to polyps treated with
only Tcf RNAi than to controls. This might be due to physical
removal of the Tcf protein (decapitation), which prevented (or
reduced) the azakenpaullone-mediated Wnt downstream events
activation. By contrast, during metamorphosis, the Tcf protein
stock was not removed and RNAi experiments there showed
complete rescue. Four days after cutting (3 days after treatment
ended), 70% of the joint azakenpaullone and Tcf RNAi-treated cut
polyps failed to regenerate heads, in contrast to none of the control
and 10% of the azakenpaullone-only treated polyps, both of which
had heads (single or double, respectively) that were fully
regenerated by this time.
DISCUSSION
Ectopic activation of the Wnt pathway by blocking GSK3 shifted
the polarity of the entire metamorphosing animals towards the
head, resulting in completely oralized phenotypes that comprised
heads alone without any other structures. qPCR experiments
showed that the mRNA levels of Wnt3, Tcf and Brachyury were
upregulated significantly (and downregulated in the corresponding
RNAi experiments). The spatial expression of Wnt3, Brachyury
and Tcf became ubiquitous (Fig. 3M-O) in contrast to a polarized
expression at the oral ends of untreated polyps (Fig. 3I-K). As
global Wnt activation completely abolished the development of
aboral structures, the azakenpaullone-treated animals appeared
‘delayed’ because they remained ball-like as normal animals appear
during early metamorphosis. Tentacle budding, however, occurred
simultaneously with the control animals, showing that no genuine
delay resulted from the azakenpaullone treatment.
Rescue experiments of the azakenpaullone-treated animals by
downregulating Tcf with RNAi provided direct evidence for the
function of Tcf and, therefore, the entire canonical Wnt pathway in
axial patterning. The RNAi rescue experiments restored normal
metamorphosis in terms of timescale, morphology and quantitative
Wnt3 and Brachyury expression (Fig. 3), showing that deregulation
of the canonical Wnt signaling alone is sufficient to generate
aberrant phenotypes not only in the oral pole, as previously
thought, but also in the aboral pole.
In metamorphosing animals treated only with RNAi for Tcf,
there was a general shift in roughly half of the affected animals
towards aboral (i.e. body columns and stolons) development at the
expense of head structures, as would be expected (Broun et al.,
2005; Lengfeld et al., 2009). In the second half of affected animals,
development of both poles was inhibited. In these animals, heads
were one quarter the size of controls, indicating that head formation
in this group was also affected by the treatment.
Wnt3 was expressed in the oral tip of normal polyps. However,
if the head was removed, a new Wnt3-expressing tip formed within
24 hours (Fig. 5A), followed by regeneration of new head
structures about 2 days later. Wnt3 RNAi downregulated the
expression of Wnt3 and prevented head regeneration until the
RNAi effect dissipated (shown by both in situ hybridization and
qPCR). Downregulation of Wnt3 in regenerating Hydra also
prevented regeneration, but the treated animals died within 3 days
(Chera et al., 2009). qPCR on Tcf and Brachyury, both classical
Wnt target genes in other animals (Hovanes et al., 2001;
Yamaguchi et al., 1999), showed that their expression also went
DEVELOPMENT
Fig. 6. Expression levels of Wnt target
genes and non-target controls, analyzed
by qPCR. Expression levels are normalized to
GAPDH in all experiments. (A-C)The relative
quantity (RQ) of expression of Tcf (A),
Brachyury (B) and Wnt3 (C) in control animals
were compared with expression levels in the
four treatment groups: Wnt3 RNAi, Tcf RNAi,
24 hours azakenpaullone and rescue (24
hours azakenpaullone + Tcf RNAi). (D,E)Vasa
(D) and 18s rRNA (E) expression between
control and RNAi treatment groups was also
performed to reconfirm the specificity of the
knockdown.
down and, thus, that these genes are also Wnt3 targets in
Hydractinia. Complementary experiments in which Tcf mRNA
levels were downregulated by RNAi showed matching results, i.e.
downregulation of Wnt3 and Brachyury in addition to Tcf itself.
Downregulation of Wnt3 and Tcf by RNAi prevented head
regeneration. This result was expected if Wnt signaling was
essential for head formation. The inhibition of the canonical Wnt
signaling by either Wnt3 or Tcf RNAi, however, had no effect on
wound healing, which continued without forming a head. Many
body columns elongated and were transformed to stolon-like
tissue. Heads only developed after the effect of dsRNA
weakened, about 2-3 days after the end of treatment.
Surprisingly, extra head structures appeared ectopically. This
might be seen as a paradox because ectopic heads also appeared
following global activation of Wnt. Our interpretation for this
phenomenon is that the absence of a dominant head organizer,
known from experiments in Hydra to emit head-inhibiting
signals (MacWilliams, 1983), prevented the production of such
inhibitory signals. Numerous head organizing spots were thereby
able to establish themselves once the effect of RNAi was weak
enough. Consistent with this view, multiple Wnt3-expressing
spots were observed in RNAi-treated polyps and each ectopic
head expressed the gene (Fig. 5). These results indicate that head
inhibitory signals are generated downstream of Wnt. The overall
effect was similar in both Wnt3 and Tcf downregulation,
indicating complete functional conservation of the canonical Wnt
pathway in Hydractinia. Our data show that the polarity of the
polyp is only maintained in the presence of a Wnt signal at one
pole. After the removal of the Wnt3-expressing head, the polarity
is maintained by a newly established Wnt3-expressing organizer
within 24 hours. If, however, Wnt signaling is downregulated
(by RNAi) for a longer period, the polyp will completely lose its
polarity and the tissue is capable of adopting any positional
value in a stochastic fashion, and this explains the various
phenotypes resulting from both Wnt3 and Tcf RNAi (Fig. 4).
Stolon regeneration did not occur in normal polyps,
confirming earlier findings that stolon regeneration occurs only
in young polyps of Hydractinia (Müller et al., 1986) or when
animals are incubated in the uncharacterized stolon-inducing
factor (Müller et al., 2004b). However, stolon buds appeared in
RNAi-treated regenerating animals (both Wnt3 and Tcf), whereas
head regeneration was inhibited. Furthermore, the ‘floating head’
phenotype, from azakenpaullone treatment, demonstrated that
Wnt signaling was sufficient to prevent stolon formation. We
propose that colonial hydroid heads emit, in addition to the headinhibiting signal mentioned above, a stolon-inhibiting signal.
This would allow stolon development only at the aboral end,
away from the inhibitor source (i.e. the head), where the signal
concentration is low enough. This is consistent with Meinhardt’s
model on the long-range inhibitory effect of the Wnt-expressing
pole (Meinhardt, 2009). Disrupting Wnt signaling by RNAi
might thus remove the stolon inhibitory source and allow ectopic
stolon development.
Wnt signaling is involved in axial patterning throughout the
Metazoa. It controls formation of posterior structures in most
bilaterians (Niehrs, 2010; Petersen and Reddien, 2009). In
planarians, Wnt directs regenerating tissue to a posterior fate,
whereas inhibition of Wnt directs regenerating tissue to develop
anterior structures (Gurley et al., 2008; Iglesias et al., 2008;
Petersen and Reddien, 2008). Although such Wnt-mediated control
of posterior formation initially appears to be the opposite of its
oralizing role in cnidarians, this is not the case. The cnidarian oral
RESEARCH ARTICLE 3065
pole is thought to be equivalent to the bilaterian posterior pole
(Meinhardt, 2002). Indeed, Fig. 1C clearly shows that the Wnt3mediated organizer is located at the posterior tip of Hydractinia
larvae, the future location of the oral pole.
Taken together, our results show functionally that: (1) Tcfdependent Wnt signaling is essential and sufficient to induce oral
(i.e. posterior) patterning and the subsequent development of oral
structures; and (2) that the axial patterning of the entire animal is
mediated by Wnt, through a graded stolon (i.e. anterior) inhibitory
effect of the head organizer. This study reinforces the results
obtained by others, indicating that Wnt-mediated axis formation is
a basal character in eumetazoans.
Acknowledgements
We warmly thank R. Cathriona Millane for assistance, discussions and for
providing RACE cDNA, Jenny Whilde for assistance with data analysis,
Reinhard Heiermann and Werner A. Müller for advice and discussions, and
John Galvin and Albert Lawless for technical assistance. Funds were provided
by Science Foundation Ireland (SFI) to U.F.
Competing interests statement
The authors declare no competing financial interests.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/lookup/suppl/doi:10.1242/dev.046631/-/DC1
References
Alexandrova, O., Schade, M., Bottger, A. and David, C. N. (2005). Oogenesis
in Hydra: nurse cells transfer cytoplasm directly to the growing oocyte. Dev. Biol.
281, 91-101.
Amiel, A. and Houliston, E. (2009). Three distinct RNA localization mechanisms
contribute to oocyte polarity establishment in the cnidarian Clytia
hemisphaerica. Dev. Biol. 327, 191-203.
Broun, M., Gee, L., Reinhardt, B. and Bode, H. R. (2005). Formation of the
head organizer in hydra involves the canonical Wnt pathway. Development 132,
2907-2916.
Chera, S., Ghila, L., Dobretz, K., Wenger, Y., Bauer, C., Buzgariu, W.,
Martinou, J.-C. and Galliot, B. (2009). Apoptotic cells provide an unexpected
source of Wnt3 signaling to drive Hydra head regeneration. Dev. Cell 17, 279289.
Frank, U., Leitz, T. and Müller, W. A. (2001). The hydroid Hydractinia: a versatile,
informative cnidarian representative. BioEssays 23, 963-971.
Gajewski, M., Leitz, T., Schloessherr, J. and Plickert, G. (1996). LWamides from
Cnidaria constitute a novel family of neuropeptides with morphogenetic activity.
Roux’s Arch. Dev. Biol. 205, 232-242.
Gee, L., Hartig, J., Law, L., Wittlieb, J., Khalturin, K., Bosch, T. C. G. and
Bode, H. R. (2010). ß-catenin plays a central role in setting up the head
organizer in hydra. Dev. Biol. 340, 116-124.
Gurley, K. A., Rink, J. C. and Alvarado, A. S. (2008). -catenin defines head
versus tail identity during planarian regeneration and homeostasis. Science 319,
323-327.
Hassel, M., Albert, K. and Hofheinz, S. (1993). Pattern formation in Hydra
vulgaris is controlled by lithium-sensitive processes. Dev. Biol. 156, 362-371.
Hobmayer, B., Rentzsch, F., Kuhn, K., Happel, C. M., von Laue, C. C.,
Snyder, P., Rothbächer, U. and Holstein, T. W. (2000). WNT signaling
molecules act in axis formation in the diploblastic metazoan Hydra. Nature 407,
186-189.
Hovanes, K., Li, T. W., Munguia, J. E., Truong, T., Milovanovic, T., Lawrence
Marsh, J., Holcombe, R. F. and Waterman, M. L. (2001). -catenin-sensitive
isoforms of lymphoid enhancer factor-1 are selectively expressed in colon cancer.
Nat. Genet. 28, 53-57.
Iglesias, M., Gomez-Skarmeta, J. L., Saló, E. and Adell, T. (2008). Silencing of
Smed-catenin1 generates radial-like hypercephalized planarians. Development
135, 1215-1221.
Kunick, C., Lauenroth, K., Leost, M., Meijer, L. and Lemcke, T. (2004). 1Azakenpaullone is a selective inhibitor of glycogen synthase kinase-3beta.
Bioorg. Med. Chem. Lett. 14, 413-416.
Kusserow, A., Pang, K., Sturm, C., Hrouda, M., Lentfer, J., Schmidt, H. A.,
Technau, U., Haeseler, A. V., Hobmayer, B., Martindale, M. Q. et al. (2005).
Unexpected complexity of the Wnt gene family in a sea anemone. Nature 433,
156-160.
Lee, P. N., Kumburegama, S., Marlow, H. Q., Martindale, M. Q. and
Wikramanayake, A. H. (2007). Asymmetric developmental potential along the
animal-vegetal axis in the anthozoan cnidarian, Nematostella vectensis, is
mediated by Dishevelled. Dev. Biol. 310, 169-186.
DEVELOPMENT
Wnt signaling in cnidarian development
Lengfeld, T., Watanabe, H., Simakov, O., Lindgens, D., Gee, L., Law, L.,
Schmidt, H. A., Özbek, S., Bode, H. and Holstein, T. W. (2009). Multiple
Wnts are involved in Hydra organizer formation and regeneration. Dev. Biol.
330, 186-199.
MacWilliams, H. K. (1983). Hydra transplantation phenomena and the
mechanism of Hydra head regeneration: I. properties of the head inhibition. Dev.
Biol. 96, 217-238.
Mali, B., Soza-Ried, J., Frohme, M. and Frank, U. (2006). Structural but not
functional conservation of an immune molecule: a tachylectin-like gene in
Hydractinia. Dev. Comp. Immunol. 30, 275.
Meinhardt, H. (2002). The radial-symmetric hydra and the evolution of the
bilateral body plan: an old body became a young brain. BioEssays 24, 185-191.
Meinhardt, H. (2009). Beta-catenin and axis formation in planarians. BioEssays
31, 5-9.
Momose, T. and Houliston, E. (2007). Two oppositely localised frizzled RNAs as
axis determinants in a cnidarian embryo. PLoS Biol. 5, e70.
Momose, T., Derelle, R. and Houliston, E. (2008). A maternally localised Wnt
ligand required for axial patterning in the cnidarian Clytia hemisphaerica.
Development 135, 2105-2113.
Müller, W. A. (1964). Experimentele Untersuchungen über Stockentwicklung,
Polypendifferenzierung und Sexualchimären bei Hydractinia echinata. Roux’s
Arch. für Entwicklungsmechanik 155, 181-268.
Müller, W. A. (1973). Induction of metamorphosis by bacteria and ions in the
planulae of Hydractinia echinata; an approach to the mode of action. Publ. Seto.
Mar. Biol. Lab. 20 (Proc. 2nd Int. Symp. Cnidaria), 195-208.
Müller, W. A. and Buchal, G. (1973). Metamorphoseinduktion bei Planulalarven.
II. Induktion durch monovalente Kationen: Die Bedeutung des Gibbs-Donnan
Verhältnisses und der Ka+Na+-ATPase. Roux’s Arch. für Entwicklungsmechanik
173, 122-135.
Müller, W. A., Plickert, G. and Berking, S. (1986). Regeneration in Hydrozoa:
distal versus proximal transformation in Hydractinia. Roux’s Arch. Dev. Biol. 195,
513-518.
Müller, W. A., Teo, R. and Frank, U. (2004a). Totipotent migratory stem cells in a
hydroid. Dev. Biol. 275, 215-224.
Müller, W. A., Teo, R. and Möhrlen, F. (2004b). Patterning a multi-headed
mutant in Hydractinia: enhancement of head formation and its phenotypic
normalization. Int. J. Dev. Biol. 48, 9-15.
Development 137 (18)
Müller, W. A., Frank, U., Teo, R., Mokady, O., Gütte, C. and Plickert, G.
(2007). Wnt signaling in hydroid development: ectopic heads and giant buds
induced by GSK-3 inhibitors. Int. J. Dev. Biol. 51, 211-220.
Niehrs, C. (2010). On growth and form: a Cartesian coordinate system of Wnt and
BMP signaling specifies bilaterian body axes. Development 137, 845-857.
Petersen, C. P. and Reddien, P. W. (2008). Smed-betacatenin-1 is required for
anteroposterior blastema polarity in planarian regeneration. Science 319, 327330.
Petersen, C. P. and Reddien, P. W. (2009). Wnt signaling and the polarity of the
primary body axis. Cell 139, 1056-1068.
Plickert, G., Schetter, E., Verhey-van-Wijk, N., Schlossherr, J., Steinbüchel,
M. and Gajewski, M. (2003). The role of a-amidated neuropeptides in hydroid
development-LWamides and metamorphosis in Hydractinia echinata. Int. J. Dev.
Biol. 47, 439-450.
Plickert, G., Jacoby, V., Frank, U., Müller, W. A. and Mokady, O. (2006). Wnt
signaling in hydroid development: formation of the primary body axis in
embryogenesis and its subsequent patterning. Dev. Biol. 298, 368-378.
Rebscher, N., Volk, C., Teo, R. and Plickert, G. (2008). The germ plasm
component Vasa allows tracing of the interstitial stem cells in the cnidarian
Hydractinia echinata. Dev. Dyn. 237, 1736-1745.
Seipp, S., Schmich, J., Kehrwald, T. and Leitz, T. (2007). Metamorphosis of
Hydractinia echinata – natural versus artificial induction and developmental
plasticity. Dev. Genes Evol. 217, 385-394.
Stover, N. A. and Steele, R. E. (2001). Trans-spliced leader addition to mRNAs in
a cnidarian. Proc. Natl. Acad. Sci. USA 98, 5693-5698.
Tanaka, E. M. and Weidinger, G. (2008). Heads or tails: can Wnt tell which one
is up? Nat. Cell Biol. 10, 122-124.
Teo, R., Möhrlen, F., Plickert, G., Müller, W. A. and Frank, U. (2006). An
evolutionary conserved role of Wnt-signaling in stem cell fate decision. Dev. Biol.
289, 91-99.
Wikramanayake, A. H., Hong, M., Lee, P. N., Pang, K., Byrum, C. A., Bince, J.
M., Xu, R. and Martindale, M. Q. (2003). An ancient role for nuclear betacatenin in the evolution of axial polarity and germ layer segregation. Nature
426, 446-450.
Yamaguchi, T. P., Takada, S., Yoshikawa, Y., Wu, N. and McMahon, A. P.
(1999). T (Brachyury) is a direct target of Wnt3a during paraxial mesoderm
specification. Genes Dev. 13, 3185-3190.
DEVELOPMENT
3066 RESEARCH ARTICLE