RESEARCH ARTICLE
141
Development 137, 141-150 (2010) doi:10.1242/dev.037861
Interaction between Drosophila bZIP proteins Atf3 and Jun
prevents replacement of epithelial cells during
metamorphosis
Petra Sekyrova1, Dirk Bohmann2, Marek Jindra1,* and Mirka Uhlirova3,*
SUMMARY
Epithelial sheet spreading and fusion underlie important developmental processes. Well-characterized examples of such epithelial
morphogenetic events have been provided by studies in Drosophila, and include embryonic dorsal closure, formation of the adult
thorax and wound healing. All of these processes require the basic region-leucine zipper (bZIP) transcription factors Jun and Fos.
Much less is known about morphogenesis of the fly abdomen, which involves replacement of larval epidermal cells (LECs) with adult
histoblasts that divide, migrate and finally fuse to form the adult epidermis during metamorphosis. Here, we implicate Drosophila
Activating transcription factor 3 (Atf3), the single ortholog of human ATF3 and JDP2 bZIP proteins, in abdominal morphogenesis.
During the process of the epithelial cell replacement, transcription of the atf3 gene declines. When this downregulation is
experimentally prevented, the affected LECs accumulate cell-adhesion proteins and their extrusion and replacement with
histoblasts are blocked. The abnormally adhering LECs consequently obstruct the closure of the adult abdominal epithelium. This
closure defect can be either mimicked and further enhanced by knockdown of the small GTPase Rho1 or, conversely, alleviated by
stimulating ecdysone steroid hormone signaling. Both Rho and ecdysone pathways have been previously identified as effectors of
the LEC replacement. To elicit the gain-of-function effect, Atf3 specifically requires its binding partner Jun. Our data thus identify
Atf3 as a new functional partner of Drosophila Jun during development.
INTRODUCTION
Metamorphosis of Drosophila larvae into pupae and adult flies
provides remarkable examples of morphogenetic changes that involve
replacement of entire cell populations. Epithelia that had served larval
function undergo programmed cell death while imaginal cells
proliferate and differentiate to take their position. The Drosophila
abdomen is an attractive system for studying the developmental
replacement of one epithelial cell population with another. Unlike the
adult head and thorax with appendages, all forming from prepatterned imaginal discs, the adult abdomen derives from histoblasts
that reside in each abdominal segment (Madhavan and Madhavan,
1980; Madhavan and Schneiderman, 1977). Soon after the onset of
metamorphosis, the diploid histoblasts undergo an initial phase of
synchronized cell divisions; later the histoblasts expand while
proliferating and replace the old polyploid larval epidermal cells
(LECs) that cover the surface of the abdomen (Ninov et al., 2007;
Bischoff and Cseresnyes, 2009). To free space for the histoblasts,
LECs are extruded from the epithelial monolayer. In order to maintain
integrity of the epithelia, changes in cell adhesion and cell migration
must be precisely orchestrated during this tissue remodeling.
Ninov and colleagues have demonstrated that Rho kinase
signaling, which stimulates constriction of the apical actomyosin
cytoskeleton through myosin phosphorylation, is necessary for the
1
Biology Center, Czech Academy of Sciences and Department of Molecular Biology,
University of South Bohemia, Ceske Budejovice 37005, Czech Republic.
2
Department of Biomedical Genetics, University of Rochester Medical Center,
Rochester, NY 14642, USA. 3Institute for Genetics, University of Cologne, Cologne
50674, Germany.
*Authors for correspondence ([email protected]; [email protected])
Accepted 21 October 2009
extrusion and the ensuing apoptosis of LECs (Ninov et al., 2007).
Perturbed myosin phosphorylation leaves the process of the
epithelial exchange incomplete, with residual LECs obstructing
closure of the adult abdominal epidermis at the dorsal midline. A
similar defect results from compromised function of the ecdysone
receptor (EcR), which is required for both the initial phase of
histoblast proliferation (Ninov et al., 2009) and for the removal of
LECs (Ninov et al., 2007). Other factors besides Rho signaling and
EcR that regulate the epithelial cell replacement are unknown.
We have implicated Atf3 (A3-3 – FlyBase), the single Drosophila
ortholog of the vertebrate Activating transcription factor 3 (ATF3)
and Jun dimerization protein 2 (JDP2) in abdominal development.
ATF3 and JDP2 belong among basic region-leucine zipper (bZIP)
proteins, some of which play important roles in epithelial
morphogenesis (Kockel et al., 2001; Xia and Karin, 2004).
Particularly the functions of Jun (Jra – FlyBase) and Fos (Kayak –
FlyBase) bZIP proteins in epithelial closure events during
development are well understood owing to genetic studies in
Drosophila (Hou et al., 1997; Kockel et al., 1997; Riesgo-Escovar
and Hafen, 1997; Zeitlinger and Bohmann, 1999). By contrast, no
morphogenetic function has yet been reported for Atf3 in
Drosophila.
Mammalian ATF3 and JDP2 form homodimers but preferentially
dimerize with members of the Jun subfamily (Aronheim et al., 1997;
Hai et al., 1989; Hsu et al., 1991), functioning either as
transcriptional activators (ATF3-Jun) or repressors (JDP2-Jun).
Based mainly on cell-culture studies, multiple roles in cell
proliferation, differentiation and apoptosis have been ascribed to
ATF3 (Allan et al., 2001; Ishiguro and Nagawa, 2001; Iyengar et al.,
2003; Kawauchi et al., 2002; Lu et al., 2006; Mashima et al., 2001;
Nakagomi et al., 2003; Nobori et al., 2002; Tamura et al., 2005; Yin
et al., 2008) and JDP2 (Aronheim et al., 1997; Heinrich et al., 2004;
DEVELOPMENT
KEY WORDS: Epithelial cell replacement, Cell adhesion, Epidermis, Metamorphosis, Abdomen, bZIP
RESEARCH ARTICLE
Jin et al., 2002; Ostrovsky et al., 2002; Piu et al., 2001). Atf3–/– mice
are viable (Hartman et al., 2004) but suffer from altered glucose and
immune homeostasis (Gilchrist et al., 2006; Qi et al., 2009;
Rosenberger et al., 2008). Also Jdp2–/– mice survive but produce
extra fat in their brown adipose tissue (Nakade et al., 2007). In vivo
significance of the interaction between the ATF3 or JDP2 proteins
and Jun remains unclear.
Here we show that Atf3 interacts biochemically and genetically
with Jun in Drosophila. Temporal downregulation of atf3
transcription during metamorphosis is crucial, as sustained atf3
expression alters adhesive properties of LECs, thus preventing their
extrusion and replacement by the adult epidermis. This effect of Atf3
requires the presence of Jun.
MATERIALS AND METHODS
Fly strains and preparation of atf3 mutants
Fly strains obtained from the Bloomington Drosophila Stock Center
included w1118, arm-Gal4, Eip71CD-Gal4, Cg-Gal4, Lsp2-Gal4, T155-Gal4,
P{EPgy2}A3-3EY02562, UAS-Rho1V14; UAS-p35, UAS-diap1, hsFlp; act5cFRT-y+-FRT-Gal4, UAS-EGFP and UAS-myr mRFP. Additional lines were
esg-Gal4 (National Institute of Genetics, Mishima, Japan), ppl-Gal4
(Colombani et al., 2003), sGMCA (Kiehart et al., 2000), C7-Gal4 (from B.
Edgar, Seattle, USA) and GMR-Gal4 (from M. Mlodzik, New York, USA).
UAS-a-Cat.T:GFP and ubi-p63E-shg::GFP (Oda and Tsukita, 2001) were
from the Drosophila Genetic Resource Center (Kyoto, Japan), and UASRho1RNAi (stock v12734) was from the Vienna Drosophila RNAi Center. The
UAS-junRNAi and UAS-fosRNAi (Hyun et al., 2006) lines were a gift from
C. Yanicostas (Paris, France). UAS-jun, UAS-fos, UAS-fosbZIP and UASfospanAla lines were described previously (Ciapponi et al., 2001; Eresh et al.,
1997; Zeitlinger et al., 1997).
atf3 mutants were generated by imprecise excision of a P-element
P{EPgy}A3-3EY02562 from the second intron of atf3, and deletions were
detected by nested PCR with primers flanking the original insertion site of
the P-element in crude genomic DNA extracts. Sequencing of genomic
DNA amplified from atf3 mutants with primers 5⬘-GTGCGTGTAACCGTCAACGTCG-3⬘ and 5⬘-ATGCTGCTGGTCAATCACGTTG-3⬘
within the first and the third atf3 exons, respectively, determined the exact
limits of the deletions.
atf3 misexpression
Transgenic flies were obtained by P-element mediated germline
transformation (Genetic Services, Sudbury, USA). To express the entire Atf3
protein, the atf3 open reading frame (613 codons) was amplified with
primers 5⬘-GTGGTACCGTCAACGTCGACC-3⬘ and 5⬘-GGTCTAGATCCCGCTCCCTGT-3⬘ from cDNA, and inserted into the pUAST vector. To
express the Atf3 bZIP domain (amino acids 207-261), a cDNA fragment
encoding residues 199-269 of Atf3 was subcloned using primers 5⬘GTCACAGCATATGGGACTCACC-3⬘ and 5⬘-GGTCTAGATCCCGCTCCCTGT-3⬘. We used UAS-atf3 lines carrying single P-element
insertions on the second chromosome. All crosses with Gal4 drivers were
carried out at 25°C. To induce expression of atf3 in LECs, hsFlp; act-FRTy+-FRT-Gal4, UAS-EGFP (or UAS-myr mRFP) homozygotes were crossed
with UAS-atf3 flies and kept at 22°C. The progeny were exposed for 45 or
60 minutes to 37°C as mid-third instar larvae. Resulting atf3-expressing cells
were marked with EGFP or myristoylated mRFP, respectively.
20E feeding
20-hydroxyecdysone (20E) extracted from plant material in the laboratory
of Dr P. Simek (Ceske Budejovice, Czech Republic) and purified to 99%
20E was dissolved in 10% ethanol and added to the diet of mid-third instar
larvae at a final concentration of 1 mg/ml (Gaziova et al., 2004).
mRNA expression analysis
Northern blots with 5 g of total RNA per lane were hybridized with an atf3
antisense cRNA digoxigenin-labeled probe. For RT-PCR, cDNA was
prepared with the Superscript II system (Invitrogen, Carlsbad, USA) from 2
g of total DNase-treated RNA. cDNA samples were subjected to standard
PCR reactions. Quantitative RT-PCR was performed with the iQ SYBR
Development 137 (1)
Green kit (BioRad, Hercules, USA) using the RotorGene RG 3000 cycler
(Corbett Research, Sydney, Australia). In situ hybridization of atf3 mRNA
was performed using a digoxigenin-labeled atf3 antisense probe as described
(Tautz and Pfeifle, 1989).
Immunostaining and confocal microscopy
Dorsal pupal epidermis attached to the cuticle was fixed for 30 minutes with
4% formaldehyde in PBS, blocked in 0.1% BSA, 0.3% Triton X-100 in PBS
for 1 hour, and incubated overnight at 4°C with primary antibodies against
Drosophila Dlg (4F3; 1:1000), Armadillo (N27A1; 1:100) or Rho1 (1D9;
1:100) from the Developmental Studies Hybridoma Bank (Iowa, USA). The
tissue was washed with PBS, 0.3% Triton X-100, incubated for 2 hours with
Cy3- or Alexa fluor 488-conjugated antibodies, counterstained with 4 g/ml
DAPI, and analyzed under the Olympus FV1000 confocal microscope. For
imaging of live pupae, animals were removed from the puparia, placed into
a drop of halocarbon oil and analyzed using a Leica SP2 confocal
microscope. The images were processed with IMARIS (Bitplane) and
ImageJ (NIH) software.
Electrophoresis mobility shift assay
The cDNA sequence encoding residues 199-269 encompassing the bZIP
domain of Atf3 was subcloned into the pET-28a vector (Novagen) using
NdeI and BamHI restriction sites. Using an N-terminal histidine tag, the
bZIP domains of Atf3 and of the Jun and Fos proteins were purified from
Escherichia coli and used in DNA-binding assays as described (Jindra et al.,
2004). Double-stranded oligonucleotides comprising the ATF/CRE element
(underlined) (Fawcett et al., 1999; Montminy et al., 1986), TGAGCCGCAAGTGACGTCACGCGGGGCGTGTGCAGG, or the AP-1 consensus
site (Eresh et al., 1997; Perkins et al., 1990) were used as probes.
Immunoprecipitation
The full-length atf3 open reading frame was cloned into the pMT/V5-His B
vector (Invitrogen) using XhoI and ApaI restriction sites. pMT-dATF3-HisV5 (5 g) or the empty plasmid was co-transfected with a vector expressing
a C-terminally histidine-tagged Fos protein into Drosophila S2 cells. Cells
were harvested 30 hours after induction with 0.5 mM CuSO4 and processed
as described (Jindra et al., 2004). The lysates (100 l per assay) were
incubated for 2 hours at 4°C with 20 l of Protein G-conjugated Dynabeads
(Invitrogen), combined with 1 g of the mouse anti-V5 antibody
(Invitrogen). Bound proteins were analyzed on western blots with anti-Jun
(1:1500) (Bohmann et al., 1994) and anti-Fos (1:1000) (Zeitlinger et al.,
1997) rabbit antibodies.
RESULTS
The Drosophila ortholog of ATF3/JDP2 interacts
with Jun
Among Drosophila bZIP proteins, the predicted product of the
CG11405 gene (also referred to as a3-3), located on the X
chromosome, shows the closest similarity to the mammalian ATF3
and JDP2 proteins. The DNA-binding/dimerization bZIP domains
of the human ATF3 and Drosophila Atf3 proteins are identical in
60% of their amino acids (Fig. 1A); there is 58% identity between
Atf3 and JDP2 in this region.
Dimerization between Atf3 and Jun in Drosophila has been
theoretically predicted (Fassler et al., 2002) and confirmed by results
of a yeast two-hybrid screen (Giot et al., 2003). To demonstrate
direct binding, we conducted co-immunoprecipitation experiments.
The endogenous Jun protein from Drosophila S2 cells coprecipitated with a transiently expressed Atf3 whereas Fos did not
(Fig. 1B). Next, we performed a DNA mobility-shift assay with
recombinant bZIP domains of Atf3, Jun and Fos to test for their
DNA-binding properties. We found that Atf3 specifically bound an
ATF/CRE consensus element but not the AP-1 site, which was
recognized by the Jun-Fos (AP-1) complex (Fig. 1C). Although Atf3
bound DNA by itself, presumably as a homodimer, the binding was
enhanced in the presence of Jun (compare lanes 7 and 8 in Fig. 1C).
DEVELOPMENT
142
Fig. 1. The Drosophila Atf3 protein interacts with Jun.
(A)Alignment between bZIP domains of human ATF3 and Drosophila
Atf3 shows identical (black shading) and similar (gray) amino acids.
(B)Atf3 immunoprecipitated with Jun but not with Fos. S2 cells were
transfected with Fos-His alone or together with V5-tagged Atf3; Jun
was endogenous. Proteins bound to the anti-V5 antibody were
analyzed by western blot (WB) with anti-V5, anti-Jun and anti-Fos
antibodies. Cell lysates are shown as input. (C)Electrophoresis mobility
shift assay shows binding of isolated bZIP domains of the Atf3 (A), Jun
(J) and Fos (F) proteins, single or in combination, to the AP-1 and
ATF/CRE consensus elements.
Fos did not synergize with Atf3 in DNA binding (lane 9). Excess
unlabeled DNA bearing the ATF/CRE binding site competed for the
Atf3 bandshift activity whereas the AP-1 binding element did not
(data not shown). These results have shown that, like ATF3 or JDP2
in mammals, Atf3 in Drosophila selectively dimerizes with Jun,
with which it cooperatively and specifically binds the ATF/CRE
DNA element.
Atf3 cooperates with Jun in vivo
To test whether Atf3 and Jun interact in vivo, we conducted
experiments in the Drosophila compound eye, the precise
structure of which sensitively reflects genetic interactions.
Overexpression of atf3 under the GMR-Gal4 driver disrupted the
ommatidial arrangement, resulting in smaller eyes with a glossy
appearance (Fig. 2). This atf3 misexpression phenotype could be
completely suppressed by simultaneous RNAi-mediated
knockdown of jun (Fig. 2) but not of fos (data not shown).
Conversely, the phenotype was exacerbated when jun was
overexpressed in the eye together with atf3 (Fig. 2), suggesting
that it is Atf3 in a complex with Jun that derails the normal eye
development. Neither RNAi nor overexpression of jun alone had
any effect on eye morphology. Interestingly, like depletion of Jun,
co-expression of fos under the GMR-Gal4 driver completely
averted the atf3 misexpression phenotype, restoring the normal
appearance of the eye (Fig. 2). Expression of fos (data not shown)
or its mutant versions (see Fig. S1 in the supplementary material)
alone had no effect. These data can be explained by the ability of
the surplus Fos to bind Jun and thus reduce its availability for
interaction with the Atf3 protein. This interpretation is further
RESEARCH ARTICLE
143
Fig. 2. Genetic interaction among Drosophila (d) atf3, jun and fos
during compound eye development. The GMR-Gal4 driver was
used to express the indicated transgenes in the eye-imaginal disc. jun
RNAi did not affect eye morphology but was able to suppress the effect
of overexpressed Atf3. Overexpression of Fos also precluded the gainof-function effect of Atf3. Conversely, co-expression of Jun with Atf3
aggravated the phenotype.
supported by experiments showing that expression of the
truncated bZIP domain of Fos was sufficient to suppress the Atf3
gain-of-function phenotype, whereas its transcription activation
domain or phosphorylation sites were dispensable (see Fig. S1 in
the supplementary material).
Taken together, our results show that Atf3 cooperates with Jun, as
Jun is specifically required for an effect caused by overexpression
of Atf3 in the developing eye. Given the capacity of both Atf3 and
Fos to bind Jun, and based on the ability of Jun to enhance and of
Fos to suppress the Atf3 gain-of-function phenotype, we suggest that
Atf3 and Fos compete for their common partner Jun in vivo.
atf3 is an essential gene with transcription
dynamically regulated during metamorphosis
To find out whether Atf3 is required for Drosophila development
and whether its absence might resemble a phenotype caused by loss
of its partner Jun, we generated atf3 mutant flies. The longest
deletion (line atf376) obtained by imprecise excision of a P element
(see Fig. S2A in the supplementary material), removed the entire
bZIP domain of Atf3, and atf376 hemizygous (male) larvae lacked
detectable atf3 mRNA (see Fig. S2B in the supplementary material).
Thus, atf376 probably represents a null allele. Most atf376 larvae died
soon after hatching and during all three larval stages. Only a few
(approximately 2%) reached the third instar but died before
metamorphosis as defective pseudopuparia (see Fig. S2C in the
supplementary material). Expression of atf3 cDNA under the
ubiquitous armadillo (arm-Gal4) driver rescued some atf376
hemizygotes to adults, confirming that loss of atf3 was the cause of
the lethal phenotype. Interestingly, the moribund atf376 larvae
DEVELOPMENT
Atf3 and Jun interact in vivo
RESEARCH ARTICLE
Fig. 3. Expression of atf3 mRNA is developmentally regulated.
(A)Northern blot of total RNA from mixed-stage embryos (E), the three
larval instars (L1-L3), wandering larvae (W), white puparia (prepupae;
PP), pupae 24 hours (P1) and 48 hours (P2) after puparium formation,
and male and female adults. Ribosomal RNA serves as loading control.
(B)Temporal profiles of atf3, jun and fos mRNAs during metamorphosis
as assessed with RT-PCR (26 cycles) in total RNA from whole animals
(for quantitative results see Fig. S3 in the supplementary material). The
atf3 profile was verified three times with two different sets of primers.
F, feeding late-third instar larvae; Wa, wandering larvae with anterior
gut clear; Wp, wandering larvae with posterior gut clear. Expression of
rp49 (23 cycles) serves for control. (C,D)At the peak of expression at 6
hours APF (see panel B), atf3 mRNA occurs in the larval epidermis as
shown by RT-PCR (C) performed on isolated integuments (Epi), fat
bodies (FB) and whole prepupae (PP). In situ hybridization (D) shows
atf3 mRNA in LECs. Scale bar: 100m.
abnormally enlarged lipid droplets in their fat body (see Fig. S2D in
the supplementary material), thus displaying a phenotype
reminiscent of that in mice lacking one of the Atf3 orthologs, JDP2
(Nakade et al., 2007). However, in contrast to viable Jdp2 or Atf3
(Hartman et al., 2004) knockout mice, atf3 is an essential gene in
Drosophila.
Fly embryos lacking the function of Jun or Fos die because of the
failed dorsal closure (Hou et al., 1997; Kockel et al., 1997; RiesgoEscovar and Hafen, 1997). However, atf376 embryos develop
normally, without the dorsal open defect, even when derived from
atf3-deficient germline clones induced in atf376/ovoD1 mothers (data
not shown). Thus, unlike its partner Jun, Atf3 is not required for
dorsal closure, suggesting that dorsal closure is regulated by Jun-Fos
dimers and that the Atf3-Jun complex has another function later in
development.
Consistent with the vital requirement for Atf3 during larval stages,
atf3 mRNA was expressed in embryos and larvae (Fig. 3A).
Expression then sharply declined by the late-third larval instar, and
no atf3 mRNA was detected by northern blot hybridization in
Development 137 (1)
Fig. 4. Misexpression of atf3 causes incomplete fusion of
abdominal epidermis. (A)ppl>atf3 pharate adults usually die inside
puparia with a dorsally open abdominal cleft in the adult cuticle. The scar
is outlined with a brown line of necrotic tissue, and it is filled with the old
pupal cuticle. Other body parts metamorphose normally and the
unaffected regions of the abdomen produce adult cuticle with sensory
bristles. (B)Few ppl>atf3 flies eclose, invariantly bearing the scar, often
with signs of bleeding. (C)Effect of atf3 expressed under the ubiquitous
(arm) driver. (D)Expression of UAS-a-Catenin::GFP in posterior abdominal
segments of a normally developing pupa at 27 hours APF shows that the
ppl-Gal4 driver is active in LECs but not in the surrounding histoblasts
that occupy the areas around and between LECs at this time. The
punctate GFP signals probably come from LECs that had already been
extruded and phagocytosed. (E)The Eip71CD driver is also expressed in
LECs (large GFP-positive cells) but not in histoblasts. DAPI staining
(magenta) shows cell nuclei. (F)Abdominal lesion in a rarely eclosing
Eip71CD>atf3 adult. (G)Flp-out induction of atf3 in the polyploid larval
cells reproduces the abdominal closure phenotype (for more severe
defects see Fig. S4 in the supplementary material). The LECs that express
atf3 and GFP persist in the adult abdomen and mainly localize to the
dorsal cleft. Scale bars: 100 m in D; 50m in E.
wandering larvae and during metamorphosis from the time of
puparium formation until the second day of pupal development.
Detailed RT-PCR analysis showed that atf3 downregulation
coincided with the cessation of feeding and the onset of
metamorphosis [0 hours after puparium formation (APF)] (Fig. 3B).
A pulse of expression occurred at 6 hours APF. RT-PCR from isolated
fat body and abdominal integuments, together with in situ
hybridization performed on puparia at this stage, showed that atf3
mRNA was primarily present in the larval epidermis (LECs) during
the expression peak at 6 hours APF (Fig. 3C,D). From the time of
head eversion (12 hours APF) the mRNA level remained low until
the second day of pupal development, and then it grew steadily
during morphogenesis of the adult (Fig. 3B). Quantitative RT-PCR
revealed a 4.3-fold difference in atf3 mRNA abundance between 0
and 72 hours APF (see Fig. S3A in the supplementary material). In
contrast to the tight regulation of atf3, the mRNAs of fos and jun
fluctuated little during the examined period (Fig. 3B). Therefore,
unlike Jun or Fos, Atf3 was dynamically regulated during
metamorphosis at the level of transcription.
DEVELOPMENT
144
Atf3 and Jun interact in vivo
RESEARCH ARTICLE
145
Sustained expression of atf3 in LECs disrupts
abdominal development
The precise temporal control of atf3 expression (Fig. 3) suggested
that the rise and subsequent fall of Atf3 during metamorphosis might
be critical for the complex morphogenesis occurring in fly pupae.
We tested this possibility by means of sustained expression of the
full-length Atf3 protein using the UAS-Gal4 system with various
drivers. A striking, fully penetrant metamorphic defect was observed
with the pumpless (ppl) Gal4 driver. Although ppl>atf3 animals
developed normally until the pupal stage, they failed to complete
fusion of the adult abdominal epidermis (Fig. 4A). A dorsal cleft in
the abdomen remained that could not be covered with the adult
cuticle, and consequently 86% of the flies (n913) died inside the
puparium. All of the ppl>atf3 adults that did eclose showed
abdominal lesions filled with the old pupal cuticle lacking adult
pigmentation and bristles, often with a clot covering a bleeding
wound (Fig. 4B). Adults with the same abdominal cleft (but
otherwise normal) also emerged when atf3 was moderately and
ubiquitously misexpressed under the arm-Gal4 driver (Fig. 4C),
suggesting that abdominal morphogenesis was the process most
sensitive to ectopic Atf3.
The adult fly abdomen derives from histoblasts that proliferate,
replace LECs and finally differentiate, giving rise to the adult cuticle.
Therefore, the observed abdominal defect suggested a compromised
function of the epidermis, either LECs, histoblasts or both cell types.
To distinguish between these possibilities, we first examined
expression of the ppl-Gal4 driver in the epidermis. We found that pplGal4 was active in LECs but not in histoblasts (Fig. 4D). Second, we
used another driver, Eip71CD-Gal4, which was inactive in
histoblasts but strongly expressed in LECs (Fig. 4E). Eip71CD-Gal4driven misexpression of atf3 mostly produced lethal pupae lacking
adult cuticle (data not shown), but it occasionally yielded adults with
a dorsal abdominal cleft (Fig. 4F). In addition to being active in
LECs, both ppl-Gal4 (Colombani et al., 2003) (see Fig. S3B in the
supplementary material) and Eip71CD-Gal4 (data not shown) were
also expressed in the fat body. However, no abdominal defects
occurred when atf3 was misexpressed under either of three fat-bodyspecific Gal4 drivers, Lsp2, Cg or C7 (data not shown). Third, to rule
out the possibility that ectopic Atf3 affected the imaginal epidermis,
we directed its expression to histoblasts by using the escargot (esg)
and T155 Gal4 drivers (Harrison et al., 1995; Hayashi et al., 1993);
in neither case the fusion of the adult abdominal epidermis was
affected (data not shown).
To finally confirm that abdominal morphogenesis was disrupted
by sustained atf3 activity in LECs, we induced atf3 by using the flpout technique. Owing to the timing of heat-shock induction to the
mid-third instar, this method triggers expression in the polyploid
larval cells but not in the diploid histoblasts (Ninov et al., 2007) (see
Fig. S6 in the supplementary material). Misexpression of atf3 under
the actin promoter following the flp-out event invariantly led to an
abdominal cleft (Fig. 4G). The lesions were often more severe than
those observed in ppl>atf3 animals, affecting also lateral and ventral
parts of the abdomen (see Fig. S4 in the supplementary material).
Together, the above data demonstrate that the sustained expression
of atf3 prevents fusion of the adult abdominal epidermis by acting
upon LECs, suggesting that the replacement of these obsolete larval
cells by adult histoblasts requires the developmental downregulation
of atf3 expression.
DEVELOPMENT
Fig. 5. Ectopic Atf3 prevents removal and
death of LECs. (A-C)In control pupae, LECs
that still reside in the abdomen at 24 hours APF
(A) become replaced by histoblasts. By 48 hours
APF (B), histoblasts cover the entire abdomen
and differentiate sensory bristles (arrowhead).
The bristles have been formed and adult cuticle
deposited at 72 hours APF (C). (D-I)Abdominal
epidermis in ppl>atf3 pupae. Although
histoblasts spread and differentiate (bristle
formation indicated with arrowheads), many
LECs persist, posing a barrier to histoblasts
progressing from the lateral sides. The affected
LECs display warping of membranes (G, arrow)
and accumulate the cell junction components
Dlg and DE-cadherin (arrows in F and H,
respectively). (I)A large lesion affecting most of
the dorsolateral abdomen of a pharate adult fly
(96 hours APF) is populated by persisting LECs,
the membranes of which are extremely
deformed. The arrow points to a thick wall
separating the scar from the adult cuticle on the
left. DAPI (magenta) is used for staining nuclei;
cell membranes are visualized either with antiDlg antibody staining (green) or by ubiquitous
expression of DE-cadherin::GFP fusion protein in
live pupae (G-I). Anterior is to the top in all
panels. Images are z-stacks of confocal slices.
Scale bars: 20 m in A-C,F; 50m in D,E,G,H;
100 m in I.
RESEARCH ARTICLE
Fig. 6. Behavior of LECs upon atf3 misexpression. Images of LECs
with membranes marked by DE-cadherin::GFP (ubi-shg::gfp) were
captured in live pupae at indicated times. Cells expressing mRFP
(magenta, bottom row) were induced to express atf3 with the flp-out
system. Compared with their uninduced neighbors, which have smooth
membranes (blue arrowheads), the atf3-positive LECs show membrane
interdigitation (yellow arrowheads) and enrichment of DE-cadherin
(arrows) on apical junctions. By 48 hours APF only Atf3-positive LECs
survive, being completely surrounded and apparently pressured by
histoblasts. Note that junctions between atf3-expressing neighbors are
thicker compared with their boundaries with uninduced LECs or with
histoblasts. Images are z-stacks of confocal slices. Scale bar: 20 m.
Deregulated Atf3 prevents extrusion of LECs
To understand the cellular events underlying the incomplete
epithelial closure in ppl>atf3 animals, we visualized cell membranes
by antibody staining of the septate junction component, Discs large
1 (Dlg1), or used a transgenic DE-cadherin::GFP fusion protein
(shg::gfp). In wild-type animals 24 hours APF, LECs covering the
surface of the abdomen gave way to the rapidly expanding nests of
histoblasts (Fig. 5A) that began to fuse laterally and ventrally
(Bischoff and Cseresnyes, 2009; Ninov et al., 2007). In ppl>atf3
pupae the histoblast nests also spread (Fig. 5D), and at least at 16
hours APF, before their fusion, they comprised normal numbers of
histoblasts (see Fig. S5 in the supplementary material). By 48 hours
APF a control abdomen was fully covered with adult epidermis
consisting exclusively of histoblasts, now forming sensory bristles
(Fig. 5B). Histoblasts in ppl>atf3 abdomens also differentiated the
adult cuticle with sensory bristles, although polarity of the bristles
near the dorsal cleft was altered (Fig. 4A and Fig. 5H; see Fig. S4C
in the supplementary material). However, in contrast to the control,
a large population of LECs remained in the dorsal abdomen of
ppl>atf3 animals at 48 hours APF (Fig. 5E,G). The membranes of
the persisting LECs accumulated the Dlg protein (Fig. 5F), and
although these cells became severely deformed they survived
throughout metamorphosis (Fig. 5E-I) to the adult stage (Fig. 4G).
When visualized in live ppl>atf3 pupae, the apical junctions of the
remaining LECs displayed interdigitation and accumulation of DEcadherin::GFP (Fig. 5G,H). Another adherens junction component,
the Drosophila -catenin Armadillo, was also enriched in atf3expressing LECs (see Fig. S6 in the supplementary material).
Cooperation between adherens junctions and the apical ring of
actomyosin cytoskeleton is required for basal extrusion of LECs
(Ninov et al., 2007). The altered pattern of DE-cadherin and catenin therefore suggests that excessive Atf3 might prevent LEC
Development 137 (1)
Fig. 7. LECs expressing atf3 are unable to complete extrusion.
Shown are images from live pupae with cell membranes marked with
DE-cadherin::GFP at 24 hours APF. The flp-out system was employed to
induce expression of mRFP alone (control) or together with atf3. Lines
indicate three confocal cross sections, depicted below each panel.
Arrowheads in control (left) point to extruding LECs that have apically
constricted and detached from the epidermal layer. By contrast,
although LECs expressing atf3 can apically constrict, they continue to
adhere to the epithelium (arrowheads on the right) even when
completely surrounded by histoblasts. Note that DE-cadherin colocalizes
with the mRFP signal that marks control LECs, whereas it remains
associated with the apical surface of atf3-expressing LECs that attempt
to delaminate. Arrows show atf3-expressing LECs with membranes that
interdigitate and contain more DE-cadherin compared with their
uninduced neighbors. Scale bar: 20 m.
extrusion through stabilization of the cell-cell adhesion complex. To
examine the effect of Atf3 on LECs in further detail, we employed
the flp-out technique, which allows comparisons of atf3misexpressing and control LECs within one tissue. Fig. 6 shows that
membrane interdigitation occurred between atf3-positive LECs
already at 18 and 24 hours APF, even in areas where the LECs had
no contact with histoblasts. At 48 hours APF only LECs expressing
atf3 persisted, apparently being squeezed by the expanding
histoblasts. The membrane-associated DE-cadherin::GFP signal was
stronger in adjacent atf3-positive LECs compared with non-induced
LECs (Fig. 6), and quantitative analysis of confocal images acquired
at 18 hours APF (see Fig. S7 in the supplementary material) and at
24 hours APF (data not shown) both revealed a statistically
significant 1.4-fold increase of the DE-cadherin::GFP signal
intensity upon atf3 induction. Enrichment of DE-cadherin on apical
membranes of atf3-expressing LECs was further confirmed on
confocal cross sections (Fig. 7).
Although some atf3-positive LECs began the extrusion process,
they could not detach from the apical surface even when entirely
surrounded by histoblasts, possibly being tethered to it by the
excessive adhesion protein (Fig. 7). By contrast, control LECs did
completely separate from the epithelium (Fig. 7). In addition, LECs
overexpressing atf3 displayed apical enrichment of moesin, an actinbinding protein of the ERM (ezrin, radixin, moesin) family, which
links transmembrane proteins to cortical actin filaments (see Fig. S8
in the supplementary material). Interestingly, prominent
accumulation of DE-cadherin was also observed in atf3-expressing
DEVELOPMENT
146
Atf3 and Jun interact in vivo
RESEARCH ARTICLE
147
Fig. 9. 20E suppresses the effect of ectopic Atf3. (A-C)Dorsal
abdominal cleft in ppl>atf3 adults (A) was partially (B, arrow points to a
residual narrow scar), or completely (C) repaired by supplementing midthird instar larvae with dietary 20E; control larvae received solvent
(ethanol) only (A).
clones of epithelial cells within the hinge region of wing discs that
form the adult thorax (see Fig. S9 in the supplementary material),
indicating that the effect of Atf3 on cell adhesion components may
not be limited to larval epithelia.
In summary, our results show that deregulation of atf3 expression
causes marked changes of cell membranes, including interdigitation
and accumulation of cell adhesion molecules, suggesting that LEC
adhesiveness might be increased. Although some of the affected
LECs initiate extrusion, this process stays incomplete.
Consequently, the adhering LECs present a physical barrier for the
migrating histoblasts.
Effects of Rho1 signaling and 20-hydroxyecdysone
Rho kinase (Rok)-dependent phosphorylation of myosin regulatory
light chain was shown to be required for LEC extrusion (Ninov et
al., 2007). To examine a possible relationship between the Rokdependent cytoskeletal regulation and Atf3, we interfered with the
function of the GTPase Rho1 (also called RhoA), which acts
immediately upstream of Rok. RNAi silencing of Rho1 using the
ppl-Gal4 driver produced a phenocopy of atf3 misexpression,
causing a dorsal abdominal cleft in 100% of ppl>Rho1(RNAi) adults
(n172), of which most died in the puparium and about 12% eclosed
(Fig. 8A,B), similar to ppl>atf3 animals (Fig. 4A,B). However,
when Rho1 RNAi and misexpression of atf3 in LECs were
combined, the abdominal defect became more severe (Fig. 8C), not
allowing any pharate adults to eclose (n77). Conversely, coexpression of a dominantly active Rho1V14 protein suppressed the
otherwise fully penetrant abdominal defect in some ppl-atf3 flies
(Fig. 8D). Surprisingly, we found that the endogenous Rho1 protein
was mislocalized in atf3-misexpressing LECs, showing a diffuse
cytoplasmic signal, compared with membrane localization in control
Jun is required for Atf3 effect on abdominal
morphogenesis
Atf3 interacts with Jun to form a DNA-binding complex (Fig. 1B,C)
and genetically when overexpressed in the developing compound eye
(Fig. 2). To see if this interaction is biologically relevant during
abdominal morphogenesis, we tested whether Atf3 relies on the
presence of Jun to cause the dorsal cleft phenotype. First, we
confirmed that Jun is indeed expressed in LECs during
metamorphosis (see Fig. S10 in the supplementary material). RNAimediated depletion of Jun in animals that misexpressed atf3 under
the ppl-Gal4 driver restored viability of adults from 14% (atf3 alone)
to 100% (n565). Strikingly, 87% of the ppl>atf3, jun(RNAi) adults
eclosed with a completely normal abdomen (Fig. 10A,B). By
contrast, RNAi knockdown of Fos in ppl>atf3 background did not
improve the abdominal defect (Fig. 10C). RNAi silencing of either
jun or fos alone under the ppl-Gal4 driver had no effect on the
abdomen (data not shown). These results demonstrate that Atf3
requires its partner Jun but not Fos to disrupt abdominal
morphogenesis. Similar to the situation in the compound eye (Fig. 2
and Fig. S1 in the supplementary material), the effect of misexpressed
atf3 can be neutralized by simultaneously expressing Fos or its
truncated bZIP domain under the ppl-Gal4 driver (data not shown).
Therefore, the model in which Atf3 and Fos compete for their
common partner Jun may be extended to the developing abdomen.
DISCUSSION
Functional interaction between Atf3 and the AP-1
proteins
We identified Atf3 as a new partner of Jun in Drosophila.
Previously, Jun has only been known to dimerize with itself and with
the Drosophila homolog of Fos (Perkins et al., 1988; Perkins et al.,
DEVELOPMENT
Fig. 8. Misexpression of atf3 enhances the effect of Rho1
silencing and leads to mislocalization of the Rho1 protein.
(A-C)Rho1 RNAi alone (A,B) caused abdominal defects similar in extent
to those in ppl>atf3 animals (see Fig. 4A,B), whereas combined with
misexpression of atf3 (C) it led to broader, lethal scars (compare
arrows). (D)The effect of ectopic atf3 was averted by co-expression of
active Rho1V14. All transgenes were induced under the ppl-Gal4 driver.
(E,E⬘) Rho1 is redistributed in GFP-marked LECs (28 hours APF) that
express atf3 upon flp-out induction. DAPI (magenta) is used for staining
nuclei. Scale bar: 50m.
LECs (Fig. 8E). These results suggest a genetic interaction between
Rho signaling and atf3, and support the idea that excess Atf3
prevents extrusion of LECs by altering their cell adhesion properties.
Disturbed function of the ecdysone receptor (EcR) has been
shown to prevent extrusion of LECs, causing a dorsal abdominal
cleft that closely resembles the Atf3 gain-of-function phenotype
(Ninov et al., 2007). We therefore tested whether stimulating EcRdependent signaling by addition of the natural agonist 20E might
overcome the defect caused by sustained atf3 expression. Indeed,
supplying third-instar ppl>atf3 larvae with dietary 20E increased the
number of eclosing adults (from 14 to 62%, n760), the abdominal
scars of which were in 22% of the cases partially or completely
sealed with normal adult cuticle (Fig. 9).
148
RESEARCH ARTICLE
Development 137 (1)
Fig. 10. Jun is specifically required for Atf3 to disrupt abdominal
development. (A-C)The severe abdominal cleft caused by
misexpression of atf3 (A) was completely suppressed by Jun RNAi
knockdown (B), whereas depletion of Fos had no such effect (C). Males
on the left, females on the right.
1990). Functional analysis of Atf3 has not yet been reported. Our
biochemical data show that, similar to mammalian ATF3 and JDP2
(Aronheim et al., 1997; Chu et al., 1994; Hai and Curran, 1991; Hsu
et al., 1991), the Atf3 protein selectively binds Jun but not Fos. Also
consistent with the properties of ATF3 and JDP2 is the ability of
Atf3 to bind the ATF/CRE response element alone or synergistically
with Jun (Aronheim et al., 1997; Hsu et al., 1991). In contrast to its
mammalian counterparts, however, neither Atf3 alone nor in
complex with Jun bound to the AP-1 element under the same
conditions. The selective interactions of Atf3 point to distinct
biological roles for the Atf3-Jun and the Fos-Jun dimers,
respectively.
Using the Drosophila model, we show a genetic interaction
between Atf3 and Jun. The evidence is based on the ability of
ectopic Atf3 to disturb morphogenesis of the adult abdomen and the
compound eye, which strictly depends on the availability of Jun.
Importantly, none of the Atf3 gain-of-function phenotypes could be
induced by misexpression of the truncated bZIP domain of Atf3
(data not shown), suggesting that the functional Atf3 protein in
complex with Jun is required. Based on the selectivity of Atf3 in our
DNA-binding assay, we predict that the Atf3-Jun complex regulates
specific target genes distinct from those targeted by Fos-Jun dimers.
Our data also reflect a relationship between the AP-1 and Atf3Jun complexes. Although Fos does not dimerize or bind DNA with
Atf3, its ability to suppress the Atf3 misexpression phenotype in the
eye suggests that Fos and Atf3 compete in vivo for their common
partner Jun. The fact that the same suppression can be achieved by
overexpressing either the truncated Fos bZIP domain or Fos lacking
phosphorylation sites indicates that the suppression does not rely on
a transcriptional function of Fos but probably occurs through
Deregulated Atf3 increases adhesiveness of LECs
Removal of LECs is normally complete by 36 hours APF, at which
time the sheets of histoblasts reach the dorsal midline (Bischoff and
Cseresnyes, 2009; Ninov et al., 2007). Our data strongly support the
argument that the temporal downregulation of atf3 expression
during abdominal morphogenesis is necessary for LECs to be
replaced by the adult epidermis. When experimentally sustained,
atf3 activity in LECs interfered with this exchange by blocking
extrusion and death of the LECs. This was evident as the atf3expressing LECs survived within the epithelial layer for days after
their scheduled destruction.
Interdigitation of cell membranes and accumulation of adherens
junction proteins in LECs suggested that ectopic Atf3 caused
adjacent LECs to reinforce their mutual contacts. This probably
resulted from altered distribution of the proteins, as levels of the shg
(DE-cadherin) mRNA remained unchanged in LECs of ppl>atf3
animals (data not shown). By contrast, junctions between atf3expressing LECs and their normal neighbors or histoblasts were
smooth and presumably less rigid. DE-cadherin was similarly
enriched in clones of imaginal disc cells (see Fig. S9 in the
supplementary material). These observations suggested that
differential adhesion of atf3-expressing cells might have led to their
sorting out from the surrounding epithelium. Even modest
differences in cadherin levels have been shown to cause segregation
of cells within a population by altering their adhesiveness (Duguay
et al., 2003).
Recent live imaging data (Bischoff and Cseresnyes, 2009) have
revealed that migrating histoblasts push the LECs ahead of
themselves towards the dorsal midline, where histoblasts fuse last.
The atf3-expressing LECs that adhered to each other were probably
moved and pressed by the expanding histoblasts to the dorsal side,
whereas non-induced LECs were eliminated. This explains why the
abdominal lesions primarily occurred at the dorsal midline,
although our flp-out experiments showed that atf3 misexpression
could affect LECs in other areas as well (see Fig. S4 in the
supplementary material). Strengthened contacts among persisting
LECs probably blocked invasion of histoblasts in between them and
inhibited LEC extrusion, eventually causing gaps in the adult
epidermis.
In accord with the notion that extrusion from the epithelium is a
prerequisite for LECs to undergo apoptosis (Ninov et al., 2007), we
assume that sustained presence of Atf3 primarily enhanced
adhesiveness of LECs, which only consequently prevented their
death. This view is supported by the observation that membranes of
atf3-expressing LECs interdigitated and accumulated DE-cadherin
as early as 18-24 hours APF, even in areas of the larval epidermis
that were far from histoblasts and where control LECs did not yet
extrude (Fig. 6 and Fig. S7 in the supplementary material). In
addition, the Atf3 gain-of-function phenotype was stronger than
abdominal closure defects caused by caspase mutation or inhibition
(Muro et al., 2006; Ninov et al., 2007). When we misexpressed the
anti-apoptotic proteins p35 or DIAP1 (Thread – FlyBase) under the
ppl-Gal4 driver, the resulting dorsal lesions were not lethal and were
clearly milder than the broad, mostly fatal scars in ppl>atf3 animals
(see Fig. S11A in the supplementary material). Compared with the
DEVELOPMENT
sequestering of Jun, even by a transcriptionally inactive Fos protein.
Early in vitro studies have proposed a competition model for the AP1 and Atf3 proteins to explain a temporal regulation of gene
expression in the regenerating liver (Hsu et al., 1992). However, to
date such a relationship among Fos, Jun and Atf3 has not been
supported with direct genetic evidence.
large contiguous populations of persisting LECs in ppl>atf3 pupae
(Fig. 5), inhibiting apoptosis with p35 only allowed small islands of
LECs to survive (see Fig. S11B in the supplementary material).
Ecdysone signaling promotes replacement of the abdominal
epithelia by stimulating both the early histoblast proliferation and
the extrusion of LECs (Ninov et al., 2007; Ninov et al., 2009). As
atf3 misexpression affected LECs but did not impair early histoblast
proliferation (see Fig. S5 in the supplementary material), we are left
with the latter possibility that added 20E counteracted the effect of
ectopic Atf3 by facilitating the extrusion process. As we detected
normal 20E titers in ppl>atf3 larvae or prepupae (data not shown),
the failure of LEC extrusion was not a result of steroid deficiency.
Also, 20E had no effect on atf3 mRNA levels, at least in Drosophila
S2 cells or third-instar larvae (data not shown). Atf3 and ecdysone
signaling therefore probably influence LEC extrusion by acting
independently.
Although the mechanism through which ecdysone contributes to
LEC removal is unknown, one attractive possibility is that it might
cooperate with Rho signaling, which is required for LEC extrusion
as well (Ninov et al., 2007). It has been demonstrated that genetic
interaction between the 20E-response gene broad and components
of the Rho pathway including RhoGEF2, Rho1 and myosin II is
important for ecdysone-dependent epithelial cell elongation during
Drosophila leg morphogenesis (Bayer et al., 2003; Ward et al.,
2003). Our data show that Rho1 becomes mislocalized in LECs
upon atf3 misexpression and that Rho1 silencing enhances the
abdominal gain-of-function phenotype of atf3. The exact
relationship between Atf3, Rho1 and ecdysone remains to be
determined. However, Atf3 clearly represents a new intrinsic
regulator of epithelial cell replacement during Drosophila
metamorphosis.
Acknowledgements
We appreciate receiving fly stocks from C. Yanicostas, M. Mlodzik, B. Edgar, C.
Mirth and from the Bloomington (USA), the NIG (Mishima, Japan), the DGRC
(Kyoto, Japan) and the VDRC (Vienna, Austria) Drosophila stock centers and
antibodies from the DSHB (Iowa, USA). We thank C. Sommers for technical
assistance, A. Trojanova for fly maintenance, A. Pospech for photographing
pupae, P. Simek for 20E and A. Schauss for advice on quantitative image
analysis. This work was supported by the Sofja Kovalevskaja Award and CRC
832 to M.U., projects 2B06129 and 600766580 from the Czech Ministry of
Education to M.J., and by NIH grant R03-CA123591 to D.B. Deposited in PMC
for release after 12 months.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/lookup/suppl/doi:10.1242/dev.037861/-/DC1
References
Allan, A. L., Albanese, C., Pestell, R. G. and LaMarre, J. (2001). Activating
transcription factor 3 induces DNA synthesis and expression of cyclin D1 in
hepatocytes. J. Biol. Chem. 276, 27272-27280.
Aronheim, A., Zandi, E., Hennemann, H., Elledge, S. J. and Karin, M. (1997).
Isolation of an AP-1 repressor by a novel method for detecting protein-protein
interactions. Mol. Cell. Biol. 17, 3094-3102.
Bayer, C. A., Halsell, S. R., Fristrom, J. W., Kiehart, D. P. and von Kalm, L.
(2003). Genetic interactions between the RhoA and Stubble-stubbloid loci
suggest a role for a type II transmembrane serine protease in intracellular
signaling during Drosophila imaginal disc morphogenesis. Genetics 165, 14171432.
Bischoff, M. and Cseresnyes, Z. (2009). Cell rearrangements, cell divisions and
cell death in a migrating epithelial sheet in the abdomen of Drosophila.
Development 136, 2403-2411.
Bohmann, D., Ellis, M. C., Staszewski, L. M. and Mlodzik, M. (1994)..
Drosophila Jun mediates Ras-dependent photoreceptor determination. Cell 78,
973-986.
Chu, H. M., Tan, Y., Kobierski, L. A., Balsam, L. B. and Comb, M. J. (1994).
Activating transcription factor-3 stimulates 3⬘,5⬘-cyclic adenosine
monophosphate-dependent gene expression. Mol. Endocrinol. 8, 59-68.
RESEARCH ARTICLE
149
Ciapponi, L., Jackson, D. B., Mlodzik, M. and Bohmann, D. (2001). Drosophila
Fos mediates ERK and JNK signals via distinct phosphorylation sites. Genes Dev.
15, 1540-1553.
Colombani, J., Raisin, S., Pantalacci, S., Radimerski, T., Montagne, J. and
Leopold, P. (2003). A nutrient sensor mechanism controls Drosophila growth.
Cell 114, 739-749.
Duguay, D., Foty, R. A. and Steinberg, M. S. (2003). Cadherin-mediated cell
adhesion and tissue segregation: qualitative and quantitative determinants. Dev.
Biol. 253, 309-323.
Eresh, S., Riese, J., Jackson, D. B., Bohmann, D. and Bienz, M. (1997). A
CREB-binding site as a target for decapentaplegic signalling during Drosophila
endoderm induction. EMBO J. 16, 2014-2022.
Fassler, J., Landsman, D., Acharya, A., Moll, J. R., Bonovich, M. and Vinson,
C. (2002). B-ZIP proteins encoded by the Drosophila genome: evaluation of
potential dimerization partners. Genome Res. 12, 1190-1200.
Fawcett, T. W., Martindale, J. L., Guyton, K. Z., Hai, T. and Holbrook, N. J.
(1999). Complexes containing activating transcription factor (ATF)/cAMPresponsive-element-binding protein (CREB) interact with the CCAAT/enhancerbinding protein (C/EBP)-ATF composite site to regulate Gadd153 expression
during the stress response. Biochem. J. 339, 135-141.
Gaziova, I., Bonnette, P. C., Henrich, V. C. and Jindra, M. (2004). Cellautonomous roles of the ecdysoneless gene in Drosophila development and
oogenesis. Development 131, 2715-2725.
Gilchrist, M., Thorsson, V., Li, B., Rust, A. G., Korb, M., Roach, J. C., Kennedy,
K., Hai, T., Bolouri, H. and Aderem, A. (2006). Systems biology approaches
identify ATF3 as a negative regulator of Toll-like receptor 4. Nature 441, 173178.
Giot, L., Bader, J. S., Brouwer, C., Chaudhuri, A., Kuang, B., Li, Y., Hao, Y. L.,
Ooi, C. E., Godwin, B., Vitols, E. et al. (2003). A protein interaction map of
Drosophila melanogaster. Science 302, 1727-1736.
Hai, T. and Curran, T. (1991). Cross-family dimerization of transcription factors
Fos/Jun and ATF/CREB alters DNA binding specificity. Proc. Natl. Acad. Sci. USA
88, 3720-3724.
Hai, T. W., Liu, F., Coukos, W. J. and Green, M. R. (1989). Transcription factor
ATF cDNA clones: an extensive family of leucine zipper proteins able to
selectively form DNA-binding heterodimers. Genes Dev. 3, 2083-2090.
Harrison, D. A., Binari, R., Nahreini, T. S., Gilman, M. and Perrimon, N.
(1995). Activation of a Drosophila Janus kinase (JAK) causes hematopoietic
neoplasia and developmental defects. EMBO J. 14, 2857-2865.
Hartman, M. G., Lu, D., Kim, M. L., Kociba, G. J., Shukri, T., Buteau, J., Wang,
X., Frankel, W. L., Guttridge, D., Prentki, M. et al. (2004). Role for activating
transcription factor 3 in stress-induced beta-cell apoptosis. Mol. Cell. Biol. 24,
5721-5732.
Hayashi, S., Hirose, S., Metcalfe, T. and Shirras, A. D. (1993). Control of
imaginal cell development by the escargot gene of Drosophila. Development
118, 105-115.
Heinrich, R., Livne, E., Ben-Izhak, O. and Aronheim, A. (2004). The c-Jun
dimerization protein 2 inhibits cell transformation and acts as a tumor
suppressor gene. J. Biol. Chem. 279, 5708-5715.
Hou, X. S., Goldstein, E. S. and Perrimon, N. (1997). Drosophila Jun relays the
Jun amino-terminal kinase signal transduction pathway to the Decapentaplegic
signal transduction pathway in regulating epithelial cell sheet movement. Genes
Dev. 11, 1728-1737.
Hsu, J. C., Laz, T., Mohn, K. L. and Taub, R. (1991). Identification of LRF-1, a
leucine-zipper protein that is rapidly and highly induced in regenerating liver.
Proc. Natl. Acad. Sci. USA 88, 3511-3515.
Hsu, J. C., Bravo, R. and Taub, R. (1992). Interactions among LRF-1, JunB, c-Jun,
and c-Fos define a regulatory program in the G1 phase of liver regeneration.
Mol. Cell. Biol. 12, 4654-4665.
Hyun, J., Becam, I., Yanicostas, C. and Bohmann, D. (2006). Control of G2/M
transition by Drosophila Fos. Mol. Cell. Biol. 26, 8293-8302.
Ishiguro, T. and Nagawa, H. (2001). ATF3 gene regulates cell form and migration
potential of HT29 colon cancer cells. Oncol. Res. 12, 343-346.
Iyengar, P., Combs, T. P., Shah, S. J., Gouon-Evans, V., Pollard, J. W.,
Albanese, C., Flanagan, L., Tenniswood, M. P., Guha, C., Lisanti, M. P. et al.
(2003). Adipocyte-secreted factors synergistically promote mammary
tumorigenesis through induction of anti-apoptotic transcriptional programs and
proto-oncogene stabilization. Oncogene 22, 6408-6423.
Jin, C., Li, H., Murata, T., Sun, K., Horikoshi, M., Chiu, R. and Yokoyama, K.
K. (2002). JDP2, a repressor of AP-1, recruits a histone deacetylase 3 complex to
inhibit the retinoic acid-induced differentiation of F9 cells. Mol. Cell. Biol. 22,
4815-4826.
Jindra, M., Gaziova, I., Uhlirova, M., Okabe, M., Hiromi, Y. and Hirose, S.
(2004). Coactivator MBF1 preserves the redox-dependent AP-1 activity during
oxidative stress in Drosophila. EMBO J. 23, 3538-3547.
Kawauchi, J., Zhang, C., Nobori, K., Hashimoto, Y., Adachi, M. T., Noda, A.,
Sunamori, M. and Kitajima, S. (2002). Transcriptional repressor activating
transcription factor 3 protects human umbilical vein endothelial cells from tumor
necrosis factor-alpha-induced apoptosis through down-regulation of p53
transcription. J. Biol. Chem. 277, 39025-39034.
DEVELOPMENT
Atf3 and Jun interact in vivo
RESEARCH ARTICLE
Kiehart, D. P., Galbraith, C. G., Edwards, K. A., Rickoll, W. L. and Montague,
R. A. (2000). Multiple forces contribute to cell sheet morphogenesis for dorsal
closure in Drosophila. J. Cell Biol. 149, 471-490.
Kockel, L., Zeitlinger, J., Staszewski, L. M., Mlodzik, M. and Bohmann, D.
(1997). Jun in Drosophila development: redundant and non-redundant
functions, and regulation by two MAPK signal transduction pathways. Genes
Dev. 11, 1748-1758.
Kockel, L., Homsy, J. G. and Bohmann, D. (2001). Drosophila AP-1: lessons from
an invertebrate. Oncogene 20, 2347-2364.
Lu, D., Wolfgang, C. D. and Hai, T. (2006). Activating transcription factor 3, a
stress-inducible gene, suppresses Ras-stimulated tumorigenesis. J. Biol. Chem.
281, 10473-10481.
Madhavan, M. M. and Madhavan, K. (1980). Morphogenesis of the epidermis
of adult abdomen of Drosophila. J. Embryol. Exp. Morphol. 60, 1-31.
Madhavan, M. M. and Schneiderman, H. A. (1977). Histological analysis of the
dynamics of growth of imaginal discs and histoblast nests during the larval
development of Drosophila melanogaster. Wilhem Roux’ Arch. Dev. Biol. 183,
269-305.
Mashima, T., Udagawa, S. and Tsuruo, T. (2001). Involvement of transcriptional
repressor ATF3 in acceleration of caspase protease activation during DNA
damaging agent-induced apoptosis. J. Cell. Physiol. 188, 352-358.
Montminy, M. R., Sevarino, K. A., Wagner, J. A., Mandel, G. and Goodman,
R. H. (1986). Identification of a cyclic-AMP-responsive element within the rat
somatostatin gene. Proc. Natl. Acad. Sci. USA 83, 6682-6686.
Muro, I., Berry, D. L., Huh, J. R., Chen, C. H., Huang, H., Yoo, S. J., Guo, M.,
Baehrecke, E. H. and Hay, B. A. (2006). The Drosophila caspase Ice is
important for many apoptotic cell deaths and for spermatid individualization, a
nonapoptotic process. Development 133, 3305-3315.
Nakade, K., Pan, J., Yoshiki, A., Ugai, H., Kimura, M., Liu, B., Li, H., Obata,
Y., Iwama, M., Itohara, S. et al. (2007). JDP2 suppresses adipocyte
differentiation by regulating histone acetylation. Cell Death Differ. 14, 13981405.
Nakagomi, S., Suzuki, Y., Namikawa, K., Kiryu-Seo, S. and Kiyama, H.
(2003). Expression of the activating transcription factor 3 prevents c-Jun Nterminal kinase-induced neuronal death by promoting heat shock protein 27
expression and Akt activation. J. Neurosci. 23, 5187-5196.
Ninov, N., Chiarelli, D. A. and Martin-Blanco, E. (2007). Extrinsic and intrinsic
mechanisms directing epithelial cell sheet replacement during Drosophila
metamorphosis. Development 134, 367-379.
Ninov, N., Manjon, C. and Martin-Blanco, E. (2009). Dynamic control of cell
cycle and growth coupling by ecdysone, EGFR, and PI3K signaling in Drosophila
histoblasts. PLoS Biol. 7, E1000079.
Nobori, K., Ito, H., Tamamori-Adachi, M., Adachi, S., Ono, Y., Kawauchi, J.,
Kitajima, S., Marumo, F. and Isobe, M. (2002). ATF3 inhibits doxorubicin-
Development 137 (1)
induced apoptosis in cardiac myocytes: a novel cardioprotective role of ATF3. J.
Mol. Cell. Cardiol. 34, 1387-1397.
Oda, H. and Tsukita, S. (2001). Real-time imaging of cell-cell adherens junctions
reveals that Drosophila mesoderm invagination begins with two phases of apical
constriction of cells. J. Cell Sci. 114, 493-501.
Ostrovsky, O., Bengal, E. and Aronheim, A. (2002). Induction of terminal
differentiation by the c-Jun dimerization protein JDP2 in C2 myoblasts and
rhabdomyosarcoma cells. J. Biol. Chem. 277, 40043-40054.
Perkins, K. K., Admon, A., Patel, N. and Tjian, R. (1990). The Drosophila Fosrelated AP-1 protein is a developmentally regulated transcription factor. Genes
Dev. 4, 822-834.
Perkins, K. K., Dailey, G. M. and Tjian, R. (1988). Novel Jun- and Fos-related
proteins in Drosophila are functionally homologous to enhancer factor AP-1.
EMBO J. 7, 4265-4273.
Piu, F., Aronheim, A., Katz, S. and Karin, M. (2001). AP-1 repressor protein JDP2: inhibition of UV-mediated apoptosis through p53 down-regulation. Mol. Cell.
Biol. 21, 3012-3024.
Qi, L., Saberi, M., Zmuda, E., Wang, Y., Altarejos, J., Zhang, X., Dentin, R.,
Hedrick, S., Bandyopadhyay, G., Hai, T. et al. (2009). Adipocyte CREB
promotes insulin resistance in obesity. Cell Metab. 9, 277-286.
Riesgo-Escovar, J. R. and Hafen, E. (1997). Common and distinct roles of DFos
and DJun during Drosophila development. Science 278, 669-672.
Rosenberger, C. M., Clark, A. E., Treuting, P. M., Johnson, C. D. and Aderem,
A. (2008). ATF3 regulates MCMV infection in mice by modulating IFN-gamma
expression in natural killer cells. Proc. Natl. Acad. Sci. USA 105, 2544-2549.
Tamura, K., Hua, B., Adachi, S., Guney, I., Kawauchi, J., Morioka, M.,
Tamamori-Adachi, M., Tanaka, Y., Nakabeppu, Y., Sunamori, M. et al.
(2005). Stress response gene ATF3 is a target of c-myc in serum-induced cell
proliferation. EMBO J. 24, 2590-2601.
Tautz, D. and Pfeifle, C. (1989). A non-radioactive in situ hybridization method
for the localization of specific RNAs in Drosophila embryos reveals translational
control of the segmentation gene hunchback. Chromosoma 98, 81-85.
Ward, R. E., Evans, J. and Thummel, C. S. (2003). Genetic modifier screens in
Drosophila demonstrate a role for Rho1 signaling in ecdysone-triggered imaginal
disc morphogenesis. Genetics 165, 1397-1415.
Xia, Y. and Karin, M. (2004). The control of cell motility and epithelial
morphogenesis by Jun kinases. Trends Cell Biol. 14, 94-101.
Yin, X., Dewille, J. W. and Hai, T. (2008). A potential dichotomous role of ATF3,
an adaptive-response gene, in cancer development. Oncogene 27, 2118-2127.
Zeitlinger, J. and Bohmann, D. (1999). Thorax closure in Drosophila: involvement
of Fos and the JNK pathway. Development 126, 3947-3956.
Zeitlinger, J., Kockel, L., Peverali, F. A., Jackson, D. B., Mlodzik, M. and
Bohmann, D. (1997). Defective dorsal closure and loss of epidermal
decapentaplegic expression in Drosophila fos mutants. EMBO J. 16, 7393-7401.
DEVELOPMENT
150