RESEARCH ARTICLE 1029
Development 136, 1029-1038 (2009) doi:10.1242/dev.028415
Foxa2 regulates polarity and epithelialization in the
endoderm germ layer of the mouse embryo
Ingo Burtscher and Heiko Lickert*
In the mouse, one of the earliest events in the determination of cell fate is the segregation of cells into germ layers during
gastrulation; however, the cellular and molecular details are not well defined due to intrauterine development. We were able to
visualize a clear sequence of events occurring in the process of germ-layer formation, using immunohistochemistry and time-lapse
confocal imaging. The T-box transcription factor brachyury (T) and the Forkhead transcription factor Foxa2 specify mesoderm and
endoderm in the posterior epiblast. Fate-specified epiblast cells lose their polarity and undergo epithelial-mesenchymal transition
to invade into the primitive streak region, where these cell populations quickly separate and differentiate into morphologically and
molecularly distinct Foxa2-positive endoderm and T-positive mesoderm populations. The endoderm cells flatten and acquire apicalbasal polarity during intercalation into the outside epithelium in order to establish proper intracellular junctions with pre-existing
cells. By contrast, the mesodermal cells become spherical during migration and acquire a mesenchymal fate. Interestingly, axial
mesodermal cells are descended from Foxa2-positive epiblast cells that upregulate T protein in the anterior primitive streak region.
These cells, as well as Foxa2-positive endoderm cells, are highly polarized and epithelialized, suggesting that Foxa2 promotes an
epithelial fate and suppresses a mesenchymal fate. This observation is supported by the fact that Foxa2 mutant endodermal cells
fail to maintain polarity and do not establish proper cellular junctions, and are thus unable to functionally integrate into the
endoderm epithelium. We propose that Foxa2 regulates a molecular program that induces an epithelial cellular phenotype.
INTRODUCTION
During gastrulation the multilayered body plan of the mouse embryo
is established through differentiation and highly coordinated
morphogenetic events. By the start of gastrulation, at embryonic day
(E) 6.5, the embryonic cup-shaped epiblast is surrounded by a
single-layered epithelium of visceral endoderm (VE) that will give
rise to the endodermal component of the yolk sac (Wells and Melton,
1999). Pluripotent epiblast cells constitute the progenitor cells for
all cell lineages in the embryo proper and differentiate to form the
three principal germ layers: endoderm, mesoderm and ectoderm
(Beddington and Robertson, 1999; Tam and Loebel, 2007). Clonal
analysis of epiblast cell fate revealed that in the early-streak embryo
at E6.5, the proximal one-third of the posterior epiblast contains the
precursors of the extra-embryonic mesoderm and the primordial
germ cells. By contrast, the distal region of the epiblast contains the
precursors of the entire neural ectoderm, and the intermediate
posterior epiblast contains the precursors for the anterior mesoderm
and definitive endoderm (Lawson et al., 1991; Lawson and
Pedersen, 1992; Tam and Beddington, 1992; Lawson and Hage,
1994). Clonal descendants were not necessarily confined to a single
germ layer, indicating that these lineages are not separated at the
beginning of gastrulation. In support of this notion are embryonic
stem (ES) cell differentiation experiments (Kubo et al., 2004), as
well as conditional gene targeting results, indicating that bipotential
mesendodermal progenitor cell populations exist (Lickert et al.,
2002) (for a review, see Rodaway and Patient, 2001). At various
stages of gastrulation, the primitive streak (PS) has been shown to
contain precursor cells of different mesodermal and endodermal
Helmholtz Zentrum München, Institute of Stem Cell Research, Ingolstädter
Landstrasse 1, 85764 Neuherberg, Germany.
*Author for correspondence (e-mail: [email protected])
Accepted 15 January 2009
lineages that are destined for different parts of the body (Kinder et
al., 1999; Kinder et al., 2001). Therefore, allocation of mesoderm
and endoderm in the embryo takes place in an anteroposterior (AP)
manner determined by the timing and order of recruitment through
the PS. The majority of definitive endodermal (DE) cells ingress
through the anterior end of the primitive streak (APS) at the midstreak (MS) stage and intercalate into the overlying VE to give rise
to the foregut (Kwon et al., 2008); however, a small population of
DE cells might directly delaminate into the VE from the epiblast
(Tam and Beddington, 1992). Taken together, these studies clearly
indicate that mesoderm and endoderm are specified in a
spatiotemporal manner during gastrulation; however, it is not clear
if these cells become specified in the epiblast or PS region and when
these cells differentiate into morphological and molecular distinct
cell populations.
The T-box transcription factor brachyury (T) was shown to mark
progenitor cells for mesoderm and endoderm in ES cell
differentiation cultures, suggesting that these cells originate from a
common progenitor (Kubo et al., 2004). In the mouse embryo, T
protein is localized in the posterior epiblast at the early-streak stage
and is detected in nascent mesoderm in the PS region during
gastrulation, as well as in the node and notochord from the latestreak (LS) stage onwards (Inman and Downs, 2006). T localization
in the mesoderm and notochord suggests that abnormalities in these
cell populations are responsible for the homozygous mutant
phenotype (Wilkinson et al., 1990). By contrast, Foxa2 is also
expressed in the posterior epiblast from the early stage onwards and
is then confined to anterior definitive endoderm (ADE) and axial
mesoderm, which consists of the head process, prechordal plate,
notochord and node (Sasaki and Hogan, 1993; Monaghan et al.,
1993). Foxa2 is a member of the Forkhead transcription factor
family, which includes three related transcription factors: Foxa1,
Foxa2 and Foxa3, first identified by their ability to regulate liverspecific gene expression (Lai et al., 1990; Lai et al., 1991). A null
DEVELOPMENT
KEY WORDS: Foxa2, Brachyury, Epithelial-mesenchymal transition, Mesenchymal-epithelial transition, Morphogenesis, Cell polarity, Cell
adhesion, Epithelialization, Gastrulation, Germ-layer formation, Time-lapse imaging
1030 RESEARCH ARTICLE
MATERIALS AND METHODS
Generation of expression vectors
Genes encoding fluorescent proteins (td-Tomato, YFP) were amplified by
PCR using the following primers: Tomato fwd (5⬘-NotI-Kozak-XbaI), 5⬘GCGGCCGCAGCCACCATGTCTAGAATGGTGAGCAAGGGCGAG-
GAG; Tomato rev (5⬘-SpeI), 3⬘-NNNACTAGTTTACTTGTACAGCTCGTCCATGCCG; YFP fwd, 5⬘-GCGGCCGCATCTAGAATGGTGAGCAAGGGCGAGGAGCTGTTC; YFP rev, 3⬘-ACTAGTTTACTTGTACAGCTCGTCCATGCCGAGAG. NotI/SpeI-digested PCR products were
cloned into the pBKS vector.
For generation of Lyn-Tomato, an oligonucleotide was subcloned
between the NotI and XbaI sites in the pBKS vector in front of the
td-Tomato: Lyn-Oligo fwd, 5⬘-GGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATGCCACCATGGGATGTATTAAATCAAAAAGGAAAGACGGGGCCCGGTACT; Lyn-Oligo rev, 5⬘-CTAGAGTACCGGGCCCCGTCTTTCCTTTTTGATTTAATACATCCCATGGTGGCATAACTTCGTATAATGTATGCTATACGAAGTTATGCTTATGC. The
NotI/SpeI-digested fluorescent markers were subcloned into the NotI/NheI
sites of the eukaryotic expression vector pCAGGS (Niwa et al., 1991).
Generation of fluorescent reporter ES cell lines
The fluorescent ES cell and mouse lines used in this study were generated
by electroporation of ScaI-linearized pCAGGS vector DNA containing
dsRed, YFP or Lyn-Tomato into wild-type IDG3.2 ES cells (Hitz et al.,
2007) or Foxa2–/– R1 ES cells (Ang et al., 1994). Cells were selected with 1
μg/ml puromycin, and resistant clones were screened for uniform and
ubiquitous reporter expression in cell culture and in vivo using embryos
derived from ES cells.
Generation of chimeras and mouse lines
Diploid or tetraploid chimeras were generated according to standard
protocols (Nagy, 2003). Embryos were collected from dsRed- (Vintersten et
al., 2004) and YFP- (Hadjantonakis et al., 2002) expressing mouse lines,
both maintained on mixed genetic backgrounds (CD1/129Sv/C57/Bl6). TGFP targeting construct was used to generate ES cells and a mouse line as
previously described (Fehling et al., 2003).
Time-lapse live imaging
Embryos were dissected in DMEM containing 10% FCS and 20 mM
HEPES. Embryos were cultured on glass-bottom dishes using 200 μl
embryo culture medium (50% rat serum, 40% DMEM without Phenol Red,
2 mM glutamine, 100 μM 2-mercaptoethanol and 1 mM sodium pyruvate in
a 37°C incubator with 5% CO2 and 5% O2). To avoid evaporation the
medium was covered with mineral oil. Image acquisition was performed on
a Leica DMI 6000 confocal microscope and image analysis was carried out
using Leica LAS AF software.
Statistical analysis
Cell measurements were carried out using Leica LAS AF software. Average
and standard deviation are shown in the graphs. P-values were determined
using a two-tailed Student’s t-test with unequal variance with the number of
cells and embryos stated in the figure legends.
Whole-mount in situ hybridization
Whole-mount in situ hybridization was performed as previously described
(Lickert at al., 2002). The following probes were used: Eomes (Ciruna and
Rossant, 1999), Hex (Hhex – Mouse Genome Informatics) (Thomas et al.,
1998) and claudin 4 (RZPDp981G04226D). Embryos were photographed
using a Zeiss Stereo Lumar V12 microscope.
Antibodies and immunohistochemistry
Immunofluorescence whole-mount stainings were performed as
previously described (Nakaya et al., 2005). Briefly, embryos were isolated,
fixed for 20 minutes in 2% PFA in PBS, and then permeabilized in 0.1%
Triton X-100 in 0.1 M glycine pH 8.0. After blocking in 10% FCS, 3%
goat serum, 0.1% BSA, 0.1% Tween 20 for 2 hours, embryos were
incubated with the primary antibody o/n at 4°C in blocking solution. After
several washes in PBS containing 0.1% Tween-20 (PBST) embryos were
incubated with secondary antibodies (donkey anti-mouse 594, donkey
anti-rabbit 488, donkey anti-goat 594 Alexa fluor, Molecular Probes) in
blocking solution for 3 hours. During the final washes with PBST,
embryos
were
stained
with
4⬘,6-diamidino-2-phenylindole,
dihydrochloride (DAPI), transferred into 40% glycerol and embedded
between two coverslips using 120 μm Secure-Seal spacers (Invitrogen,
S24737) and ProLong Gold antifade reagent (Invitrogen, P36930).
DEVELOPMENT
mutation of the Foxa2 gene leads to absence of ADE and axial
mesoderm (Ang and Rossant, 1994; Weinstein et al., 1994). Foxa1
and Foxa3 are expressed from E7.5 onwards in the definitive
endoderm and can compensate for the loss of Foxa2 in the null
mutants, which allows hindgut, but not fore- and midgut formation
(Sasaki and Hogan, 1993; Monaghan et al., 1993; Ang and Rossant,
1994; Weinstein et al., 1994; Dufort et al., 1998). These results
collectively demonstrate that T and Foxa2 are functionally important
for mesoderm and endoderm development; however, it is not clear
how these transcription factors regulate a molecular and cellular
program for the differentiation of these cell populations.
In addition to cellular differentiation, the gastrulating embryo also
undergoes dramatic morphological changes to form the three
principal germ layers and the basic body plan. One of the first
morphogenetic events is the formation of the PS when signals and
factors trigger epithelial-mesenchymal transition (EMT) of epiblast
cells to give rise to mesoderm and endoderm (Thiery and Sleeman,
2006). During this process, epiblast cells lose their apical-basal (AB)
epithelial polarity, downregulate the cell-cell adhesion molecule Ecadherin (cadherin 1 – Mouse Genome Informatics) and break
through the basement membrane (BM) to invade into the PS region.
The interstitial mesodermal cells acquire a mesenchymal cellular
fate and migrate over long distances between the endoderm and the
ectoderm germ layer before they re-aggregate to form distinct organs
such as the heart or kidney. By contrast, cells that are fate-specified
to become DE appear in the APS region from MS to LS stage
(Lawson et al., 1991; Tam et al., 1997; Kinder et al., 2001; Tam and
Beddington, 1992). These cells acquire an epithelial fate and
intercalate into the outside epithelium, but it is not clear if these cells
undergo EMT followed by mesenchymal-epithelial transition or
alternatively maintain epithelial polarity and just transiently
downregulate cell-cell adhesion molecules to leave the epiblast
epithelium. By the end of gastrulation the germ layers have formed
and have already acquired AP, dorsoventral (DV) and left-right (LR)
patterning information through signals from the embryonic
organizer tissues, which include anterior VE, ADE, axial mesoderm,
node, notochord and floorplate (Tam and Loebel, 2007).
Functional analysis of genes in mouse has greatly contributed to
the understanding of germ-layer formation in the mouse embryo;
however, the phenotypic analysis has been hampered by static
techniques that often only describe end points, as well as the fact
that embryogenesis in all placental mammals occurs in utero and is
not easily amenable to ex vivo observation. The establishment of
static embryo culture systems and the genetic introduction of
fluorescent marker proteins in transgenic animals has now allowed
for direct imaging of mouse embryogenesis (Yamanaka et al., 2007;
Kwon et al., 2008). In this study, we established an ex utero static
embryo culture system to continuously monitor the cellular
processes occurring during germ-layer formation. The generation
of genetic mosaics using aggregation chimera allowed us to
distinguish embryonic and extra-embryonic lineages using
fluorescent labels in order to follow mesoderm and endoderm
formation at cellular resolutions. We present evidence for a specific
role of Foxa2 in the formation of polarized and epithelialized cell
types, namely the definitive endoderm and axial mesoderm (node
and notochord).
Development 136 (6)
Foxa2 regulates mesendoderm formation
RESEARCH ARTICLE 1031
Antibodies: Foxa2 (Abcam, Ab408749), brachyury (N-19, Santa Cruz),
GFP (A11122, Invitrogen), E-cadherin (610181, BD), ZO-1 (Tjp1 –
Mouse Genome Informatics) (33-9100, Zymed).
RESULTS
Specification and differentiation in the gastrulastage embryo
Foxa2 is a Forkhead transcription factor required for anterior axial
mesoderm and definitive endoderm formation (Ang and Rossant,
1994; Weinstein et al., 1994), whereas the T-box transcription factor
brachyury (T) is necessary for posterior, but not anterior, mesoderm
formation (Wilkinson et al., 1990). As previously reported, the
mRNAs for both genes are expressed during gastrulation in the
posterior epiblast, but it was not clear whether the proteins are
synthesized in the same cells of the epiblast and epiblast-derived
mesoderm and endoderm descendants (Sasaki and Hogan, 1993;
Monaghan et al., 1993; Herrmann, 1991). To investigate the cellular
distribution of these two transcription factors during gastrulation,
we used whole-mount immunohistochemistry (IHC) with antibodies
to T and Foxa2 and laser scanning microscopy (LSM) of fixed
embryos. Surprisingly, in pre-streak-stage embryos the double
immunofluorescent antibody staining revealed that T and Foxa2
protein was synthesized in two intermingled, but mutually exclusive,
cell populations in the posterior epiblast (Fig. 1A; see Fig. S1A in
the supplementary material). At MS stage, these two cell
populations segregated into proximal and distal domains of the
posterior epiblast (Fig. 1B; see Fig. S2 in the supplementary
material). Proximal epiblast cells upregulate T protein after EMT
and show a round, mesenchymal cellular phenotype in the PS region
(Inman and Downs, 2006), whereas distal epiblast cells upregulate
Foxa2 protein after EMT and show a flattened cell morphology (see
Fig. S2 in the supplementary material). Interestingly, Foxa2expressing flattened cells appeared anterior to the anatomical end of
the PS, forming a two-cell-diameter row of polarized cells (see Fig.
S2D, white arrows, in the supplementary material). From fate maps
(Tam and Beddington, 1992) and our imaging results (see Fig. 2
below), this seems to be the region in which the first DE cells appear
at the surface, suggesting that a small population of DE cells might
directly delaminate into the outside VE. At the LS stage, only
epiblast cells underlying the APS were Foxa2-positive and showed
signs of EMT (Fig. 1C; see Fig. S1B in the supplementary material).
We could clearly distinguish three cell populations in the PS region:
T-positive posterior mesoderm; Foxa2- and T-double-positive axial
mesoderm; and Foxa2-positive VE and DE populations. At the LS
stage, we could rarely detect single Foxa2-positive cells in the APS
region. This implies that Foxa2+ epiblast cells quickly upregulate T
protein after EMT, which suggests that cells for the axial mesoderm
are recruited from the APS region (Kinder et al., 2001). These results
collectively indicate that endoderm and mesoderm is specified in the
epiblast and differentiates after EMT, which can be distinguished by
morphology and marker gene expression. Interestingly, Foxa2
epiblast precursor cells gave rise to polarized and epithelialized
endoderm and axial mesoderm, including the polarized and
epithelialized cells of the node and notochord.
DEVELOPMENT
Fig. 1. Specification and differentiation in the gastrula-stage mouse embryo. Mid-sagittal confocal sections of a pre-streak (A), mid-streak
(MS) (B) or late-streak (LS) (C) stage embryo, showing whole-mount immunofluorescent staining of brachyury (T, red), Foxa2 (green) and DAPI
(blue), with bright-field images on the left. The boxed region is magnified in the panels showing the separate chanels and overlay. (A) Foxa2 and
brachyury antibodies mark mutually exclusive precursor cell populations in the posterior epiblast of a pre-streak embryo. (B) At the MS stage, two
epiblast domains (white line shows border), comprising Foxa2-positive (green asterisk) and T-positive (white asterisk) cells, are visible. These
precursor cells give rise to T-positive (red arrowhead), T- and Foxa2-positive (yellow arrowhead) and Foxa2-positive (green arrowhead) cells in the
primitive streak (PS). (C) At the LS stage, three cell populations can be distinguished: T-positive cells in the posterior PS (dotted line), Foxa2 and T
double-positive cells in the anterior primitive streak (APS), and Foxa2-positive visceral (VE) and definitive (DE) endoderm cells. Note that Foxa2positive progenitor cells are still found in the epiblast (green arrowheads in the Foxa2 panel), which undergo EMT (white arrowheads in the Foxa2
and T overlay panel) and upregulate T (red arrowhead in the Foxa2 and T overlay panel). mes, mesoderm.
1032 RESEARCH ARTICLE
Development 136 (6)
Time-lapse imaging reveals characteristic
morphogenetic behavior of mesodermal and
endodermal cell populations
To gain further insight into the morphogenetic mechanisms
underlying mesoderm and endoderm formation during gastrulation,
we developed a static embryo culture system using time-lapse
confocal imaging (Fig. 2A-D). One major difficulty in the analysis
of endoderm development is the lack of appropriate marker genes
that can distinguish the embryonic DE from the extra-embryonic VE
(Lewis and Tam, 2006). To this end, we analyzed germ-layer
formation using aggregation chimera, which allowed us to label the
embryonic and extra-embryonic lineages by means of different
fluorescent marker genes (Fig. 2A). In tetraploid (4n) or diploid (2n)
embryo } wild-type 9 (wt) ES cell aggregation chimera (hereafter
called 2n/4n } wt chimera), the ES cells can only contribute to the
embryonic epiblast, whereas the extra-embryonic lineages are
always formed by the cells of the 2n or 4n embryo (Tam and
Rossant, 2003). Therefore, using 2n and 4n chimera allowed us to
distinguish between embryonic lineages, namely ectoderm,
mesoderm and DE, and extra-embryonic lineages, specifically
trophectoderm and VE. Generating 2n chimera allowed us
additionally to generate genetic mosaics in the epiblast to study
mutant cells in an otherwise wild-type environment. For the timelapse imaging we used an inverse confocal microscope in
combination with a static embryo culture system (Fig. 2B).
Analyzing single optical sections using LSM at the mid-sagittal and
surface level of fixed 4n chimeras revealed that the epiblast was
always completely derived from the ES cells at the pre-streak stage
(E6.5) and was covered by a single-layered epithelium of VE from
the 4n embryo (Fig. 2C) (n>100). As predicted from fate map
studies of the mouse embryo (Lawson et al., 1991; Lawson and
Pedersen, 1992; Tam and Beddington, 1992), the first DE cells were
recruited from the epiblast and intercalated into the surface VE in
the APS region at MS stage (Fig. 2C). By the LS stage, the
recruitment of DE was almost finished and the VE was mostly
displaced by DE (Fig. 2C). From these results we concluded that
fluorescent-lineage tagging using aggregation chimeras generates
useful genetic mosaics to monitor cellular processes and lineage
allocation in the pre- to LS-stage embryo. Next we performed timelapse live imaging analysis using LSM of static immobilized 4n
dsRed } wt YFP chimera during gastrulation (Fig. 2D). As already
indicated by our analysis of fixed MS chimera (Fig. 2C), DE cells
formed in the APS region and intercalated into the overlying VE at
this developmental stage (Fig. 2D; see Movie 1 in the supplementary
DEVELOPMENT
Fig. 2. Time-lapse imaging of endoderm
formation. (A) Generation of diploid (2n) or tetraploid
(4n) embryo } ES cell chimeras for lineage labeling
and mosaic analysis. (B) Schematic of the static embryo
culture system. Mouse embryos are immobilized on a
glass-bottom dish in a lateral position and are imaged
with an inverted confocal microscope. (C) Monitoring
DE formation in tetraploid (4n) YFP } wt dsRed ES cell
aggregation chimera. Mid-saggital and surface
confocal sections of pre-streak (E6.5), MS (E7.0) and LS
(E7.5) stage tetraploid chimera are shown. The epiblast
and DE are derived from the dsRed-expressing ES cells.
Extra-embryonic tissues, including VE and extraembryonic ectoderm, are derived from the tetraploid
embryo. (D) Time-lapse imaging sequence of DE
formation in a 4n dsRed } wt YFP chimera at MS to LS
stage. Sagittal confocal sections are taken from Movie
1 at the indicated time points (T=hours: minutes) (see
Movie 1 in the supplementary material). YFP-positive
DE progenitor cells with a slightly elongated
morphology line the dsRed-positive VE epithelium
(black asterisks, T=0:00) and start to intercalate into
the visceral endoderm layer (blue asterisks, T=0:240:39). Mesoderm cells (red asterisks) have a round
morphology and migrate between epiblast and VE.
Note that all embryos are oriented with posterior to
the right and distal to the bottom. EPI, epiblast; ExE,
extra-embryonic ectoderm. Scale bars: 100 μm in C;
50 μm in D.
Foxa2 regulates mesendoderm formation
RESEARCH ARTICLE 1033
material). The time-lapse analysis revealed that the DE and the
mesoderm populations are morphologically distinct cell populations
in the PS region, even before the DE cells intercalate into the outside
VE (Fig. 2D) (time 0:00–0:39). The DE cells showed flat
morphology and had an average length-width ratio of 4:1
(l=13.1±1.7 μm; w=3.24±0.67 μm; l/w=4.21±0.9; n=50), whereas
the mesoderm cells showed a characteristic round morphology with
an approximate length-width ratio of 1.4:1 (l=7.73±1.54 μm;
w=5.63±1.16 μm; l/w=1.41±0.36; n=50) at LS stage. Furthermore,
T-positive mesoderm cells and Foxa2-positive endoderm cells
showed distinct morphology at the MS stage (see Fig. S2 in the
supplementary material), indicating that mesoderm and endoderm
can be distinguished by marker gene expression and morphology.
This observation is consistent with results previously obtained in
zebrafish (Warga and Nüsslein-Volhard, 1999), demonstrating that
mesoderm and endoderm cell populations can also be distinguished
by morphological criteria in higher vertebrates and that these cell
populations are specified in the epiblast (Fig. 1) and differentiate and
segregate in the PS region (Fig. 2).
Foxa2 regulates epithelialization of the endoderm
germ layer
To analyze how the Foxa2 transcription factor regulates definitive
endoderm development on the cellular level, we took advantage of
the Foxa2 knockout ES cell line (Ang and Rossant, 1994) and
analyzed genetic mosaics using LSM. In 4n } wt chimeras, DE cells
intercalated into the outside VE in the APS region from MS stage
onwards and displaced and dispersed the VE by the LS stage (Fig.
3A) (n>20). In striking contrast, all 4n } Foxa2–/– chimeras showed
no sign of DE intercalation and failed to form an anatomical node at
the distal tip of the embryo even at the end of LS stage, indicating
that the node and definitive endoderm cells are either not formed or
that these cells do not reach the surface epithelial layer (Fig. 3A)
(n>30). We noticed that cells accumulated in the APS region and
frequently led to an indentation of posterior epiblast epithelium into
the amniotic cavity from E7.5 onwards (Fig. 3A; see Movie 3 in the
supplementary material; data not shown). We next performed timelapse imaging using LSM of Foxa2–/– ES 2n chimeras to analyze the
behavior of Foxa2 mutant cells in an otherwise wild-type
environment (Fig. 3B; see Movie 2 in the supplementary material)
(n=9). As shown earlier in this study, Foxa2-positive epiblast cells
reside in the APS region (Fig. 1), leave the epiblast epithelium and
form DE, which intercalates into the overlying VE (Fig. 2). Imaging
Foxa2 null cells from MS stage onwards clearly revealed that APS
cells leave the epiblast and ingress into the APS region (Fig. 3B)
(t=0:00-1:45 h, white asterisk). In contrast to wild-type DE cells,
Foxa2–/– ‘endoderm-like’ cells showed endoderm morphology (Fig.
3B) (time 0:00; l=13.3±2.6 μm; w=3.8±0.7 μm; l/w: 3.6±0.9; n=50),
made contact and partially integrated into the outside VE, but failed
to epithelialize (Fig. 3B) (time 0:00-1:15, black asterisks). We
wondered whether in 2n } wt chimeras wild-type cells had a
competitive advantage and substituted or rescued DE formation;
thus this might have been the reason that Foxa2–/– cells were not
integrated in the outside epithelium. Therefore we analyzed the
cellular behavior of mutant cells in 4n } Foxa2–/– chimeras (Fig.
3C; see Movie 3 in the supplementary material). We clearly
observed cells, which were intercalated but left the outside
epithelium (Fig. 3C) (time 0:00-0:36). This indicates that Foxa2 is
necessary for functional integration of DE cells into the VE
epithelium.
DEVELOPMENT
Fig. 3. Foxa2 mutant chimera fail to form an
anatomical characteristic node and definitive
endoderm during gastrulation. (A) Sagittal confocal
section of a 4n YFP } Lyn-Tomato wt (left panel, MS
stage) or Foxa2–/– (right panel, LS stage) chimera. Wildtype DE intercalates into the outside VE at the MS stage.
Foxa2 mutant cells accumulate in the PS region and do
not intercalate into the overlying VE epithelium. A
characteristic node is not formed at the distal tip of the
embryo. Note that the anterior epiblast and intercalated
DE cells show clear apical localization of Lyn-Tomato (red
asterisks). (B) Time-lapse imaging sequence of DE
formation in a 2n dsRed } Foxa2–/– YFP chimera at MS to
LS stage. Sagittal confocal sections are taken from Movie
2 at the indicated time points (see Movie 2 in the
supplementary material). Foxa2 mutant ‘endoderm-like’
cells with an elongated morphology (black asterisks) line
the VE, but fail to intercalate into the outside epithelium.
Note the EMT of Foxa2 mutant cells (white asterisks) in
the APS (T=0:00 to 1:45). (C) Time-lapse imaging
sequence of an endoderm-like cell leaving the VE
epithelium in a 4n dsRed } Foxa2–/– YFP chimera at MS to
LS stage. Mid-sagittal section, anterior to the left and
distal to the bottom at the indicated time points (see
Movie 3 in the supplementary material). AP, apical; BAS,
basal; EL, endoderm-like cell; EPI, epiblast.
Fig. 4. Molecular identity of Foxa2 mutant cells. (A) Whole-mount
in situ hybridization showing comparable expression of the
mesendoderm and EMT marker Eomes in wild-type embryos (n=5) and
4n } Foxa2–/– chimeras (n=3) at the LS stage. (B) At the MS stage, Hex
mRNA is highly expressed in the anterior VE (asterisks) and in the APS
region in both the wild-type (n=3) and Foxa2 mutant chimeras (n=6).
(C) Whole-mount immunostaining to detect T protein in 2n } Foxa2–/–
YFP chimeras at LS stage. Foxa2–/– endoderm-like cells (labeled with an
antibody to YFP, green) are detected in the endoderm epithelial layer
(end), but do not synthesize the mesodermal marker protein T (red
arrows). The epiblast (epi), mesoderm (mes) and endoderm (end) germ
layers are separated by the dotted lines in the DAPI channel.
Next we analyzed the identity of endoderm-like cells, which
formed and intercalated into the outside VE in the absence of Foxa2.
We performed whole-mount in situ hybridization to detect
endoderm-specific genes that regulate EMT and mesendoderm
formation [Eomes (Arnold et al., 2008)], transcription and endoderm
formation [Hex (Thomas et al., 1998; Martinez Barbera et al.,
2000)], as well as cell-matrix adhesion [integrin alpha 3 (Tamplin et
al., 2008)] and tight junction formation (claudin 4). In completely
Foxa2–/– ES-cell-derived MS-stage embryos, Eomes was expressed
at normal levels in the PS, confirming that Foxa2 mutant cells
underwent EMT and formed mesendoderm (Fig. 4A; Fig. 3).
Moreover, ADE formation was clearly induced in Foxa2 mutant
cells, as indicated by the expression of the endoderm marker gene
Hex (Fig. 4B). We previously used gene expression profiling of 4n
} wt and Foxa2–/– chimeras to identify differentially expressed
genes at the gastrulation stage (Tamplin et al., 2008). This analysis
revealed that the tight junction markers claudin 4 and the cell-matrix
adhesion molecule integrin alpha 3 (Itga3) are potential target genes
for Foxa2 in the DE. Strikingly, we found that whereas Itga3 was
strongly expressed in the APS region of 4n } Foxa2–/– chimeras at
the head-fold stage (Tamplin et al., 2008) (Fig. 2C,F), the tight
junction marker claudin 4 was not detectable in the anterior
endoderm region of 4n } Foxa2–/– chimera (Fig. 6C). To further
characterize the identity of Foxa2–/– cells on a cellular level, we
performed whole-mount IHC to detect the mesoderm marker protein
T. As expected, Foxa2–/– endoderm-like cells, which where partially
integrated into the outside VE, were negative for T protein (Fig. 4C),
indicating that Foxa2–/– endoderm cells did not switch to a
mesodermal fate, but still remained endoderm-like, expressing
Eomes, Hex and Itga3, but not the tight-junction marker claudin 4.
Development 136 (6)
Fig. 5. Foxa2–/– mutant cells fail to acquire apical-basal polarity
during intercalation into the outside epithelium. (A) Time-lapse
imaging sequence of a DE cell (asterisks) intercalating into the YFPpositive (green) VE in a 4n YFP } wt Lyn-Tomato chimera at LS stage.
Sagittal confocal section in the posterior PS region taken from Movie 4
at the indicated time points (see Movie 4 in the supplementary
material). During intercalation, endoderm cells extend filiopodia (dotted
line, T=0) and aquire AB polarity, as indicated by the apical fluorescent
marker protein Lyn-Tomato (white arrowheads, T=0:15-0:45). (B) (Top)
DE cells show apical localization of Lyn-Tomato in 4n YFP } wt LynTomato chimera at MS to LS stage. Arrowheads indicate polarized
(white) and non-polarized (red) cells. (Bottom) Foxa2 mutant cells fail to
localize Lyn-Tomato in 4n YFP } Foxa2–/– Lyn-Tomato chimera.
(Middle) There is a statistically significant difference (*P<0.01) in apical
Lyn-Tomato localization between wild-type DE cells (78.9±4.6%;
n=109; three embryos) and Foxa2 mutant cells (54.9±5.7%; n=111;
four embryos).
These results clearly indicate that endoderm-like cells are formed in
Foxa2 mutants, but accumulate in the APS region, fail to induce
claudin 4 and do not functionally integrate into the outside VE
(compare with Fig. 3).
Foxa2 is important to establish AB polarity and
cell-cell adhesion
To better understand the cellular and molecular defects of Foxa2
mutant endoderm cells, we analyzed the process of endoderm
intercalation in greater detail. For this purpose, we made use of a
ubiquitous Lyn-Tomato-expressing ES cell line (Fig. 5). The 10 Nterminal amino acids of the Lyn-kinase containing a consensus Nmyristoylation and S-palmitoylation sites were fused to the
N-terminus of the Tomato protein to target the fusion protein to
the plasma membrane. Surprisingly, the ubiquitously expressed
DEVELOPMENT
1034 RESEARCH ARTICLE
Foxa2 regulates mesendoderm formation
RESEARCH ARTICLE 1035
Lyn-Tomato protein accumulated on the apical membrane surface
of the epiblast and DE epithelium (Fig. 3A, red asterisks). In the PS
region, where epiblast cells lose polarity and undergo EMT, the
continuous apical localization of the Lyn-Tomato protein was
disrupted. Using Lyn-Tomato as a tool to analyze cell polarity, we
performed time-lapse live imaging of intercalating DE cells in 4n
YFP } wt Lyn-Tomato chimera (Fig. 5A; see Movie 4 in the
supplementary material). By the beginning of intercalation, DE cells
in contact with the outside VE were not polarized, but extended
filopodia processes into the outside epithelium (Fig. 5A) (time 0:00).
During intercalation, DE cells became more and more polarized
(Fig. 5A) (time 0:15–0:30) and by the end of the process clearly
showed AB cell polarity by the means of Lyn-Tomato localization
(Fig. 5A) (time 0:45).
Using Lyn-Tomato as an apical membrane marker, we compared
cellular polarization in 4n } wt or Foxa2–/– chimeras (Fig. 5B).
Analyzing MS- to LS-stage embryos revealed that Foxa2 mutant
cells were able to localize Lyn-Tomato to the apical membrane (Fig.
5B, white arrowheads). However, the analysis also showed a
statistically significant difference in the cellular polarization
between wt and Foxa2 mutant cells. To investigate the cause of the
cell polarity defects, we analyzed the formation of adherens and/or
tight junctions using whole-mount immunolocalization studies to
detect E-cadherin and ZO-1 in the endoderm epithelium. Comparing
MS to LS stage 4n } wt and Foxa2–/– chimeras clearly demonstrated
that the adherens junction protein E-cadherin was not localized at
junctions between adjacent mutant cells, but surprisingly mutant-wt
cell junctions showed a similar extent of basolateral localization as
wt-wt adherens junctions (Fig. 6A). We speculate that the correct
positioning of E-cadherin in mutant-wt cell junctions is due to
homotypic molecular interactions of the E-cadherin protein in
mutant cells with those correctly localized to the basolateral domain
in wt cells. However, these interactions may be transient, as the
mutant cells failed to functionally integrate into the outside
epithelium. Due to the fact that claudin 4 is not expressed in Foxa2
mutants (Fig. 6C), we investigated the localization of the tightjunction protein ZO-1. Comparing MS to LS stage 2n } wt and
Foxa2–/– chimeras revealed that wt cells localized ZO-1 to the
basolateral junctions in a punctate manner, whereas most mutant
cells ectopically localized ZO-1 to the apical surface (Fig. 6B). It is
well known that Claudins are the major cell-adhesion molecules of
tight junctions (Tsukita et al., 2001; Furuse and Tsukita, 2006) and
bind specifically to ZO-1, ZO-2 (Tjp2 – Mouse Genome
Informatics) and ZO-3 (Tjp3 – Mouse Genome Informatics) via an
intracellular PDZ domain (Itoh et al., 1999). Therefore, failure to
induce claudin 4 or other Claudins expressed in the endoderm
DEVELOPMENT
Fig. 6. Foxa2–/– mutant cells do not acquire apical-basal polarity and fail to localize adherens and tight-junction proteins. (A) Midsagittal section of a whole-mount LS chimeric mouse embryo (2n YFP } Lyn-Tomato). The wild type is shown in the pair of panels at the top, the
Foxa2 mutant at the bottom. Sections are stained with anti-GFP antibodies to detect Foxa2–/– cells (YFP, green; blue asterisks) or wild-type cells
(which are not stained; red asterisks), anti-E-cadherin antibodies (E-Cad, red), and DAPI (blue) to label all nuclei. Adherens junctions that stain for
E-cadherin are found at the basolateral membrane between wild-type cells (red arrow; wt-wt in bar chart) and between wild-type and Foxa2–/– cells
(green arrowheads; KO-wt), but not between two Foxa2–/– cells (yellow arrowheads; KO-KO). The bar chart illustrates the statistically significant
difference (P<0.01) between E-cadherin localization to adherens junctions in wt-wt (87.7±6.2%; n=23) or KO-wt (88.3±4.8%; n=34) versus KO-KO
(16±9.4%; n=21) cells from three different chimeric embryos. (B) Foxa2–/– mutant cells fail to localize the ZO-1 tight junction protein to the apical
surface. Mid-sagittal section of a whole-mount immunostained LS chimeric mouse embryo (2n wt } Foxa2–/– YFP) stained with anti-GFP antibodies
to detect Foxa2–/– cells (YFP, green; white asterisks), with anti-ZO-1 (yellow) and with DAPI (blue) to label all nuclei. In wild-type endoderm cells (YFP
negative) the ZO-1 protein is localized in a dot-like pattern to basolateral tight junctions (blue arrows), whereas Foxa2–/– mutant cells show
accumulation of ZO-1 at the apical surface (white arrows). Quantification reveals a statistically significant (P<0.01) difference in tight-junction ZO-1
localization between wild-type (85.4±5.1%; n=237) and Foxa2 mutant (15.4±6.7%; n=123) cells. (C) In situ hybridization of wild type (n=7) and
Foxa2–/– chimeras (n=4) illustrates that claudin 4 mRNA is strongly reduced in the anterior definitive endoderm of Foxa2–/– mutants at the headfold
stage.
(Sousa-Nunes et al., 2003; Hou et al., 2007) might explain the
ectopic localization of ZO-1 at the apical membrane of Foxa2
mutant endoderm-like cells. Alternatively, Foxa2 might regulate a
molecular program of cell polarity important to establish functional
tight and adherens junctions.
DISCUSSION
In this study we analyzed germ-layer formation in wild-type and
Foxa2 mutant embryos and chimera by immunohistochemistry and
time-lapse live imaging. We showed that T-positive mesoderm and
Foxa2-positive axial mesoderm and endoderm cell populations are
already specified in the epiblast. These cells undergo EMT and
ingress into the PS region, where they differentiate and segregate
into molecularly and morphologically distinct populations of
mesoderm and endoderm. Flat endoderm cells polarize and integrate
into the overlying epithelium by formation of adherens and tight
junctions. We showed that Foxa2 is translated in epiblast precursor
cells of polarized and epithelialized cell types: namely endoderm
and axial mesoderm (node and notochord). Axial mesodermal cells
upregulate T protein after EMT, which suggests that Foxa2 is
upstream of T in this cell population. In Foxa2 mutants, an
anatomically characteristic node structure is not formed at the distal
tip of the embryo, and although endoderm-like cells are formed and
accumulate in the anterior PS region, they do not functionally
integrate into the outside epithelium. These cells fail to polarize and
epithelialize, implicating that Foxa2 regulates a molecular program
important for these processes.
Epiblast cells are specified and differentiate in the
PS region
An important question in embryology and stem cell biology is when
and how precursor cells are specified and differentiate. To our
surprise, the T-box transcription factor brachyury (T) and the
Forkhead box transcription factor Foxa2 are specifically synthesized
in specified mesoderm and endoderm precursor cells in the posterior
epiblast during gastrulation. Using time-lapse imaging and
immunohistochemistry, we have shown that mesodermal and
endodermal cells quickly segregate and differentiate after EMT. Tpositive epiblast cells differentiate into T-positive mesenchymal
cells in the PS, whereas Foxa2-positive epiblast cells differentiate
into Foxa2-positive epithelial endodermal cells that integrate into
the overlying epithelium and Foxa2-positive, T-positive axial
mesodermal cells. Fate map analyses have revealed that the cells in
the anterior end of the PS of the MS-stage embryo, which we have
shown are Foxa2-positive, will give rise to anterior mesoderm and
endoderm (Kinder et al., 2001), whereas cells in the posterior region
of the PS, which we have shown are T-positive, will give rise to
posterior as well as extra-embryonic mesoderm (Kinder et al., 1999).
This is consistent with the gene functional analysis of either of these
genes. T null mutants lack posterior mesoderm and notochord
(Wilkinson et al., 1990; Kispert and Herrmann, 1994), whereas
Foxa2 null mutants lack anterior mesoderm and endoderm, as well
as the node and notochord (Ang and Rossant, 1994; Weinstein et al.,
1994). Using a T-Cre and Foxa2-Cre genetic lineage tracing
approach, we and others have recently shown that Foxa2 epiblast
precursor cells give rise to anterior mesoderm and endoderm,
whereas T epiblast precursors give rise to posterior mesoderm and
endoderm (Uetzmann et al., 2008; Park et al., 2008; Kumar et al.,
2007; Verheyden et al., 2005). These results are consistent with the
idea that a bipotential mesendodermal progenitor cell population
exists in mammals (Rodaway and Patient, 2001; Lickert et al., 2002;
Kubo et al., 2004). Taken together, these results suggest that the
Development 136 (6)
posterior epiblast can be divided into a distal Foxa2-positive and
proximal T-positive precursor cell population, giving rise to anterior
and posterior mesendodermal cell populations, respectively.
Foxa2 is upstream of T and initiates axial
mesoderm development
How does axial mesoderm, namely the head process, prechordal
plate, notochord and node, develop? It was previously suggested that
Foxa2 is on top of a developmental program for axial mesoderm
formation (Yamanaka et al., 2007). At the MS stage we detected an
APS population, which was Foxa2-positive and was fate-mapped to
give rise to the axial mesoderm and endoderm (Kinder et al., 2001).
At the LS stage, the epiblast cells generated three distinct cell
populations by morphology and marker gene expression: a Tpositive posterior mesoderm population, a Foxa2-positive endoderm
population and an anterior Foxa2-positive and T-positive axial
mesoderm population. We noticed that Foxa2-positive epiblast cells
at MS to LS stage upregulated T protein after EMT, indicating that
Foxa2 epiblast cells give rise to axial mesoderm. From knockout
studies it is known that Foxa2 mutants do not form axial mesoderm
at all, whereas the T mutants initially form but fail to maintain
posterior notochord. We also showed in this study that no anatomical
node structure is formed at the distal tip of Foxa2 mutant chimera.
This suggests that Foxa2 is on top of the axial mesoderm hierarchy
(Yamanaka et al., 2007) and is consistent with loss of brachyury
expression, specifically in the node and AME, but not PS, of
tetraploid-derived Foxa2 null embryos at E7.5 (Dufort et al., 1998).
Interestingly, axial mesodermal cells (node and notochord) did not
acquire a mesenchymal fate along with the rest of the T-positive
mesoderm population in the posterior PS, but rather constituted a
population of cells that were highly polarized and connected through
cell-cell adhesion. For example, node cells formed a characteristic
anatomical structure in the surface endoderm layer at the distal tip
of the embryo. The cells showed clear AB polarity, were
monociliated and interconnected through E-cadherin-mediated cellcell adhesion (Yamanaka et al., 2007). Also the notochord
descendents of the node cells were highly polarized and formed a
solid rod-like structure through cell-cell adhesion, between the
endoderm and the ectoderm epithelium. This suggests that Foxa2
progenitor cells in general give rise to polarized, interconnected cell
types and that Foxa2 promotes an epithelial fate and suppresses a
mesenchymal fate.
Foxa2 induces an epithelial cellular phenotype
In this study, we have shown that Foxa2 mutant progenitor cells
leave the epiblast, but fail to integrate into the outside epithelium,
which leads to an accumulation of mesenchymal cells in the APS
region. This is consistent with the idea that Foxa2 regulates a
program necessary to acquire an epithelial cellular phenotype. This
is also accordant with the lack of polarized and epithelialized cell
types in the Foxa2 mutant embryos, i.e. node, notochord and anterior
definitive endoderm (Ang and Rossant, 1994; Weinstein et al.,
1994), but how does Foxa2 regulate cell-cell polarity and
epithelialization in the endoderm germ layer? In our attempts to
identify novel Foxa2 target genes at the gastrulation stage (Tamplin
et al., 2008), we have identified many potential target genes,
including the homeobox transcription factors Hex and Otx2
(Kimura-Yoshida et al., 2007), the signaling molecules Cer1 and
Shh (Epstein et al., 1999; Jeong and Epstein, 2003), the SRY-related
HMG box transcription factor Sox17 and the Forkhead box
transcription factor Foxa1 (Duncan et al., 1998). Most of these
endoderm-specific patterning factors are expressed in the endoderm
DEVELOPMENT
1036 RESEARCH ARTICLE
germ layer, but not in Foxa2-positive epiblast precursor cells. This
is consistent with the idea that Foxa2 is a pioneer factor, which opens
compact chromatin and acts in higher-order gene regulation to allow
mesendoderm and endoderm specific transcription factors to specify
cell fate (Cirillo et al., 2002). But how does this molecular program
translate into cellular changes that lead to the mesoderm or
endoderm lineage decisions? In this respect it was interesting to find
proteins involved in cell adhesion, such as the tight junction protein
claudin 4, the homotypic cell-cell adhesion molecules Flrt2, Flrt3
and Pcdh19, as well as the cell-matrix adhesion molecule Itga3, as
potential Foxa2 endoderm target genes (Tamplin et al., 2008). It was
recently shown that hepatocyte nuclear factor 4a (HNF4a; Hnf1a –
Mouse Genome Informatics), an important nuclear receptor for
endoderm development (Lemaigre and Zaret, 2004), triggers
formation of functional tight junctions and establishment of
polarized epithelial morphology by specifically inducing Claudin
expression (Chiba et al., 2003; Satohisa et al., 2005). ZO-1 has been
proposed to be a scaffolding protein between transmembrane and
cytoplasmatic proteins, and possibly forms a link between the
adherens and tight junctions, e.g. formation of the adherens junction
through E-cadherin is associated with the formation and localization
of tight junction proteins, particularly ZO-1 (Rajasekaran et al.,
1996; Siliciano and Goodenough, 1988). Taken together, we suggest
that Foxa2 mutant endoderm-like cells fail to initiate an endodermal
molecular program regulated by Foxa2 and different endodermspecific patterning factors, which results in a change of cellular
morphology dictated by cell-cell, cell-matrix adhesion and cell
polarity molecules.
We thank Wenke Barkey, Patrizia Giallonardo, Susanne Weidemann and
Adrianne Tasdemir for technical support; Roger Y. Tsien for generously
providing Tomato and Cherry fluorescent proteins; Christina Vintersten, Andras
Nagy and Marina Gerstenstein for YVI and dsRed ES cell lines; Neil Copeland
for generously providing plasmids and bacterial strains for homologous
recombination in bacteria; and Perry Liao for valuable comments to the
manuscript. This work was supported by the Helmholtz Society and an EmmyNoether fellowship from the German Research Foundation (DFG) awarded to
H.L.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/136/6/1029/DC1
References
Ang, S. L. and Rossant, J. (1994). HNF-3 beta is essential for node and notochord
formation in mouse development. Cell 78, 561-574.
Ang, S. L., Wierda, A., Wong, D., Stevens, K. A., Cascio, S., Rossant, J. and
Zaret, K. S. (1993). The formation and maintenance of the definitive endoderm
lineage in the mouse: involvement of HNF3/forkhead proteins. Development
119, 1301-1315.
Arnold, S. J., Hofmann, U. K., Bikoff, E. K. and Robertson, E. J. (2008). Pivotal
roles for eomesodermin during axis formation, epithelium-to-mesenchyme
transition and endoderm specification in the mouse. Development 135, 501511.
Beddington, R. S. and Robertson, E. J. (1999). Axis development and early
asymmetry in mammals. Cell 96, 195-209.
Chiba, H., Gotoh, T., Kojima, T., Satohisa, S., Kikuchi, K., Osanai, M. and
Sawada, N. (2003). Hepatocyte nuclear factor (HNF)-4alpha triggers formation
of functional tight junctions and establishment of polarized epithelial
morphology in F9 embryonal carcinoma cells. Exp. Cell Res. 286, 288-297.
Cirillo, L. A., Lin, F. R., Cuesta, I., Friedman, D., Jarnik, M. and Zaret, K. S.
(2002). Opening of compacted chromatin by early developmental transcription
factors HNF3 (FoxA) and GATA-4. Mol. Cell 9, 279-289.
Ciruna, B. G. and Rossant, J. (1999). Expression of the T-box gene Eomesodermin
during early mouse development. Mech. Dev. 81, 199-203.
Dufort, D., Schwartz, L., Harpal, K. and Rossant, J. (1998). The transcription
factor HNF3beta is required in visceral endoderm for normal primitive streak
morphogenesis. Development 125, 3015-3025.
Duncan, S. A., Navas, M. A., Dufort, D., Rossant, J. and Stoffel, M. (1998).
Regulation of a transcription factor network required for differentiation and
metabolism. Science 281, 692-695.
RESEARCH ARTICLE 1037
Epstein, D. J., McMahon, A. P. and Joyner, A. L. (1999). Regionalization of
Sonic hedgehog transcription along the anteroposterior axis of the mouse
central nervous system is regulated by Hnf3-dependent and -independent
mechanisms. Development 126, 281-292.
Fehling, H. J., Lacaud, G., Kubo, A., Kennedy, M., Robertson, S., Keller, G.
and Kouskoff, V. (2003). Tracking mesoderm induction and its specification to
the hemangioblast during embryonic stem cell differentiation. Development
130, 4217-4227.
Furuse, M. and Tsukita, S. (2006). Claudins in occluding junctions of humans and
flies. Trends Cell Biol. 16, 181-188.
Hadjantonakis, A. K., Macmaster, S. and Nagy, A. (2002). Embryonic stem cells
and mice expressing different GFP variants for multiple non-invasive reporter
usage within a single animal. BMC Biotechnol. 2, 11.
Herrmann, B. G. (1991). Expression pattern of the Brachyury gene in wholemount TWis/TWis mutant embryos. Development 113, 913-917.
Hitz, C., Wurst, W. and Kuhn, R. (2007). Conditional brain-specific knockdown
of MAPK using Cre/loxP regulated RNA interference. Nucleic Acids Res. 35, e90.
Hou, J., Charters, A. M., Lee, S. C., Zhao, Y., Wu, M. K., Jones, S. J., Marra,
M. A. and Hoodless, P. A. (2007). A systematic screen for genes expressed in
definitive endoderm by Serial Analysis of Gene Expression (SAGE). BMC Dev.
Biol. 7, 92.
Inman, K. E. and Downs, K. M. (2006). Brachyury is required for elongation and
vasculogenesis in the murine allantois. Development 133, 2947-2959.
Itoh, M., Furuse, M., Morita, K., Kubota, K., Saitou, M. and Tsukita, S.
(1999). Direct binding of three tight junction-associated MAGUKs, ZO-1, ZO-2,
and ZO-3, with the COOH termini of claudins. J. Cell Biol. 147, 1351-1363.
Jeong, Y. and Epstein, D. J. (2003). Distinct regulators of Shh transcription in the
floor plate and notochord indicate separate origins for these tissues in the
mouse node. Development 130, 3891-3902.
Kimura-Yoshida, C., Tian, E., Nakano, H., Amazaki, S., Shimokawa, K.,
Rossant, J., Aizawa, S. and Matsuo, I. (2007). Crucial roles of Foxa2 in mouse
anterior-posterior axis polarization via regulation of anterior visceral endodermspecific genes. Proc. Natl. Acad. Sci. USA 104, 5919-5924.
Kinder, S. J., Tsang, T. E., Quinlan, G. A., Hadjantonakis, A. K., Nagy, A. and
Tam, P. P. (1999). The orderly allocation of mesodermal cells to the
extraembryonic structures and the anteroposterior axis during gastrulation of the
mouse embryo. Development 126, 4691-4701.
Kinder, S. J., Tsang, T. E., Wakamiya, M., Sasaki, H., Behringer, R. R., Nagy, A.
and Tam, P. P. (2001). The organizer of the mouse gastrula is composed of a
dynamic population of progenitor cells for the axial mesoderm. Development
128, 3623-3634.
Kispert, A. and Herrmann, B. G. (1994). Immunohistochemical analysis of the
Brachyury protein in wild-type and mutant mouse embryos. Dev. Biol. 161, 179193.
Kubo, A., Shinozaki, K., Shannon, J. M., Kouskoff, V., Kennedy, M., Woo, S.,
Fehling, H. J. and Keller, G. (2004). Development of definitive endoderm from
embryonic stem cells in culture. Development 131, 1651-1662.
Kumar, A., Yamaguchi, T., Sharma, P. and Kuehn, M. R. (2007). Transgenic
mouse lines expressing Cre recombinase specifically in posterior notochord and
notochord. Genesis 45, 729-736.
Kwon, G. S., Viotti, M. and Hadjantonakis, A. K. (2008). The endoderm of the
mouse embryo arises by dynamic widespread intercalation of embryonic and
extraembryonic lineages. Dev. Cell 15, 509-520.
Lai, E., Prezioso, V. R., Smith, E., Litvin, O., Costa, R. H. and Darnell, J. E., Jr
(1990). HNF-3A, a hepatocyte-enriched transcription factor of novel structure is
regulated transcriptionally. Genes Dev. 4, 1427-1436.
Lai, E., Prezioso, V. R., Tao, W. F., Chen, W. S. and Darnell, J. E., Jr (1991).
Hepatocyte nuclear factor 3 alpha belongs to a gene family in mammals that is
homologous to the Drosophila homeotic gene fork head. Genes Dev. 5, 416427.
Lawson, K. A. and Pedersen, R. A. (1992). Clonal analysis of cell fate during
gastrulation and early neurulation in the mouse. Ciba Found. Symp. 165, 3-21;
discussion 21-26.
Lawson, K. A. and Hage, W. J. (1994). Clonal analysis of the origin of primordial
germ cells in the mouse. Ciba Found. Symp. 182, 68-84; discussion 84-91.
Lawson, K. A., Meneses, J. J. and Pedersen, R. A. (1991). Clonal analysis of
epiblast fate during germ layer formation in the mouse embryo. Development
113, 891-911.
Lemaigre, F. and Zaret, K. S. (2004). Liver development update: new embryo
models, cell lineage control, and morphogenesis. Curr. Opin. Genet. Dev. 14,
582-590.
Lewis, S. L. and Tam, P. P. (2006). Definitive endoderm of the mouse embryo:
formation, cell fates, and morphogenetic function. Dev. Dyn. 235, 2315-2329.
Lickert, H., Kutsch, S., Kanzler, B., Tamai, Y., Taketo, M. M. and Kemler, R.
(2002). Formation of multiple hearts in mice following deletion of beta-catenin
in the embryonic endoderm. Dev. Cell 3, 171-181.
Martinez Barbera, J. P., Clements, M., Thomas, P., Rodriguez, T., Meloy, D.,
Kioussis, D. and Beddington, R. S. (2000). The homeobox gene Hex is
required in definitive endodermal tissues for normal forebrain, liver and thyroid
formation. Development 127, 2433-2445.
DEVELOPMENT
Foxa2 regulates mesendoderm formation
Monaghan, A. P., Kaestner, K. H., Grau, E. and Schutz, G. (1993).
Postimplantation expression patterns indicate a role for the mouse
forkhead/HNF-3 alpha, beta and gamma genes in determination of the definitive
endoderm, chordamesoderm and neuroectoderm. Development 119, 567-578.
Nagy, A. (2003). Manipulating The Mouse Embryo: A Laboratory Manual. Cold
Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
Nakaya, M. A., Biris, K., Tsukiyama, T., Jaime, S., Rawls, J. A. and
Yamaguchi, T. P. (2005). Wnt3a links left-right determination with
segmentation and anteroposterior axis elongation. Development 132, 54255436.
Niwa, H., Yamamura, K. and Miyazaki, J. (1991). Efficient selection for highexpression transfectants with a novel eukaryotic vector. Gene 108, 193-199.
Park, E. J., Sun, X., Nichol, P., Saijoh, Y., Martin, J. F. and Moon, A. M. (2008).
System for tamoxifen-inducible expression of cre-recombinase from the Foxa2
locus in mice. Dev. Dyn. 237, 447-453.
Rajasekaran, A. K., Hojo, M., Huima, T. and Rodriguez-Boulan, E. (1996).
Catenins and zonula occludens-1 form a complex during early stages in the
assembly of tight junctions. J. Cell Biol. 132, 451-463.
Rodaway, A. and Patient, R. (2001). Mesendoderm: an ancient germ layer? Cell
105, 169-172.
Sasaki, H. and Hogan, B. L. (1993). Differential expression of multiple fork head
related genes during gastrulation and axial pattern formation in the mouse
embryo. Development 118, 47-59.
Satohisa, S., Chiba, H., Osanai, M., Ohno, S., Kojima, T., Saito, T. and
Sawada, N. (2005). Behavior of tight-junction, adherens-junction and cell
polarity proteins during HNF-4alpha-induced epithelial polarization. Exp. Cell
Res. 310, 66-78.
Siliciano, J. D. and Goodenough, D. A. (1988). Localization of the tight junction
protein, ZO-1, is modulated by extracellular calcium and cell-cell contact in
Madin-Darby canine kidney epithelial cells. J. Cell Biol. 107, 2389-2399.
Sousa-Nunes, R., Rana, A. A., Kettleborough, R., Brickman, J. M., Clements,
M., Forrest, A., Grimmond, S., Avner, P., Smith, J. C., Dunwoodie, S. L. et
al. (2003). Characterizing embryonic gene expression patterns in the mouse
using nonredundant sequence-based selection. Genome Res. 13, 2609-2620.
Tam, P. P. and Beddington, R. S. (1992). Establishment and organization of germ
layers in the gastrulating mouse embryo. Ciba Found. Symp. 165, 27-41;
discussion 42-49.
Tam, P. P. and Rossant, J. (2003). Mouse embryonic chimeras: tools for studying
mammalian development. Development 130, 6155-6163.
Development 136 (6)
Tam, P. P. and Loebel, D. A. (2007). Gene function in mouse embryogenesis: get
set for gastrulation. Nat. Rev. Genet. 8, 368-381.
Tam, P. P., Parameswaran, M., Kinder, S. J. and Weinberger, R. P. (1997). The
allocation of epiblast cells to the embryonic heart and other mesodermal
lineages: the role of ingression and tissue movement during gastrulation.
Development 124, 1631-1642.
Tamplin, O. J., Kinzel, D., Cox, B. J., Bell, C. E., Rossant, J. and Lickert, H.
(2008). Microarray analysis of Foxa2 mutant mouse embryos reveals novel gene
expression and inductive roles for the gastrula organizer and its derivatives. BMC
Genomics 9, 511.
Thiery, J. P. and Sleeman, J. P. (2006). Complex networks orchestrate epithelialmesenchymal transitions. Nat. Rev. Mol. Cell Biol. 7, 131-142.
Thomas, P. Q., Brown, A. and Beddington, R. S. (1998). Hex: a homeobox gene
revealing peri-implantation asymmetry in the mouse embryo and an early
transient marker of endothelial cell precursors. Development 125, 85-94.
Tsukita, S., Furuse, M. and Itoh, M. (2001). Multifunctional strands in tight
junctions. Nat. Rev. Mol. Cell Biol. 2, 285-293.
Uetzmann, L., Burtscher, I. and Lickert, H. (2008). A mouse line expressing
Foxa2-driven Cre recombinase in node, notochord, floorplate and endoderm.
Genesis 46, 515-522.
Verheyden, J. M., Lewandoski, M., Deng, C., Harfe, B. D. and Sun, X. (2005).
Conditional inactivation of Fgfr1 in mouse defines its role in limb bud
establishment, outgrowth and digit patterning. Development 132, 4235-4245.
Vintersten, K., Monetti, C., Gertsenstein, M., Zhang, P., Laszlo, L., Biechele,
S. and Nagy, A. (2004). Mouse in red: red fluorescent protein expression in
mouse ES cells, embryos, and adult animals. Genesis 40, 241-246.
Warga, R. M. and Nusslein-Volhard, C. (1999). Origin and development of the
zebrafish endoderm. Development 126, 827-838.
Weinstein, D. C., Ruiz i Altaba, A., Chen, W. S., Hoodless, P., Prezioso, V. R.,
Jessell, T. M. and Darnell, J. E., Jr (1994). The winged-helix transcription factor
HNF-3 beta is required for notochord development in the mouse embryo. Cell
78, 575-588.
Wells, J. M. and Melton, D. A. (1999). Vertebrate endoderm development.
Annu. Rev. Cell Dev. Biol. 15, 393-410.
Wilkinson, D. G., Bhatt, S. and Herrmann, B. G. (1990). Expression pattern of
the mouse T gene and its role in mesoderm formation. Nature 343, 657-659.
Yamanaka, Y., Tamplin, O. J., Beckers, A., Gossler, A. and Rossant, J. (2007).
Live imaging and genetic analysis of mouse notochord formation reveals
regional morphogenetic mechanisms. Dev. Cell 13, 884-896.
DEVELOPMENT
1038 RESEARCH ARTICLE