RESEARCH ARTICLE 4011
Development 136, 4011-4020 (2009) doi:10.1242/dev.041160
Conditional knockdown of Nanog induces apoptotic cell
death in mouse migrating primordial germ cells
Shinpei Yamaguchi1, Kazuki Kurimoto2, Yukihiro Yabuta2, Hiroyuki Sasaki3, Norio Nakatsuji4,5,
Mitinori Saitou2,* and Takashi Tada1,6,†,‡
The pluripotency factor Nanog is expressed in peri-implantation embryos and primordial germ cells (PGCs). Nanog-deficient mouse
embryos die soon after implantation. To explore the function of Nanog in germ cells, Nanog RNA was conditionally knocked down
in vivo by shRNA. Nanog shRNA transgenic (NRi-Tg) mice were generated through the formation of germline chimeras with NRi-Tg
embryonic stem cells. In E12.5 Cre-induced ER-Cre/NRi-Tg and TNAP-Cre/NRi-Tg double-transgenic embryos, the number of alkaline
phosphatase-positive and SSEA1-positive PGCs decreased significantly. In the E9.5 and E10.5 migrating Nanog-knockdown PGCs,
TUNEL-positive apoptotic cell death became prominent in vivo and in vitro, despite Oct4 expression. Single-cell microarray analysis
of E10.5 Nanog-knockdown PGCs revealed significant up- and downregulation of a substantial number of genes, including Tial1,
Id1 and Suz12. These data suggest that Nanog plays a key role in the proliferation and survival of migrating PGCs as a safeguard of
the PGC-specific molecular network.
INTRODUCTION
Core regulators, including Oct4 (Pou5f1 – Mouse Genome
Informatics), Sox2 and Nanog, play key roles in the
transcriptional network that maintains the pluripotent state of
human and mouse embryonic stem cells (ESCs). The
homeodomain transcription factor Nanog is expressed in the
nuclei of ESCs in vitro and of morulae, in the inner cell mass
(ICM) cells of blastocysts, in the epiblast of E6.5 and E7.5
embryos (Chambers et al., 2003; Mitsui et al., 2003; Hatano et al.,
2005), and in the primordial germ cells (PGCs) of E8.5-13.5
embryos (Hart et al., 2004; Yamaguchi et al., 2005) in vivo.
Nanog plays an essential role in the maintenance of the
pluripotency of the epiblast shortly after implantation (Mitsui et
al., 2003). Overexpression of Nanog promotes the clonal
expansion of mouse ESCs (Chambers et al., 2003) and of ESsomatic hybrid cells (Silva et al., 2006) and enhances the stable
propagation of human and monkey ESCs (Darr et al., 2006;
Yasuda et al., 2006).
Nanog is cis-regulated via Octamer and Sox elements in its
promoter region by a synergistic action induced by the binding of
Oct4 and Sox2 (Kuroda et al., 2005; Rodda et al., 2005).
Furthermore, Sall4 and FoxD3 activate Nanog transcription,
1
Stem Cell Engineering, Institute for Frontier Medical Sciences, Kyoto University, 53
Kawahara-cho, Shogoin, Sakyo-ku, Kyoto 606-8507, Japan. 2Laboratory for
Mammalian Germ Cell Biology, RIKEN Center for Developmental Biology, 2-2-3
Minatojima-Minamimachi, Chuo-ku, Kobe 650-0047, Japan. 3Department of
Integrated Genetics, National Institute of Genetics, Research Organization of
Information and Systems, 1111 Yata, Mishima-shi, Shizuoka 411-8540, Japan.
4
Development and Differentiation, Institute for Frontier Medical Sciences, Kyoto
University, 53 Kawahara-cho, Shogoin, Sakyo-ku, Kyoto 606-8507, Japan. 5Institute
for Integrated Cell-Material Sciences (iCeMS), Kyoto University, Kyoto 606-8501,
Japan. 6JST, CREST, 4-1-8 Hon-cho, Kawaguchi, Saitama 332-0012, Japan.
*Present address: Department of Anatomy and Cell Biology, Graduate School of
Medicine, Kyoto University, Yoshida-Konoe-cho, Sakyo-ku, Kyoto 606-8501, Japan
†
Present address: Laboratory of Stem Cell Engineering, Stem Cell Research Center,
Institute for Frontier Medical Sciences, Kyoto University, 53 Kawahara-cho, Shogoin,
Sakyo-ku, Kyoto 606-8507, Japan
‡
Author for correspondence ([email protected])
Accepted 29 September 2009
whereas p53 (Trp53) and Tcf3 are implicated in repressing Nanog
transcription (Wu et al., 2006; Pan and Thomson, 2007). It has been
shown that dimer formation by self-association of Nanog through
its C-terminal domain is functionally important (Mullin et al., 2008;
Wang et al., 2008), and Nanog-Oct4 protein complexes are
associated with several repressive protein complexes, including the
NuRD, Sin3A and Pm1 complexes in mouse ESCs (Liang et al.,
2008). Thus, it has been hypothesized that certain key regulators
control Nanog transcription through several independent pathways.
However, the molecular mechanism of transcriptional regulation of
Nanog in germ cells is not fully understood.
PGCs are first observed in E7.25 embryos at the base of the
allantois and in the caudal end of the primitive streak as a group
of 20-25 alkaline phosphatase (ALP)-positive cells. On
subsequent days, PGCs proliferate and migrate into the hindgut
of developing embryos and finally reach, and enter, the genital
ridge of E11.5 embryos. After a few further mitotic divisions in
the genital ridge, the developmental pathways of male and female
germ cells diverge. Thus, the developmental stages of mitotic
germ cells are roughly classified into germ cell specification,
migration in developing embryos, and sexual divergence of germ
cell behavior in gonads. In germ cell specification prior to the
initiation of high-level Nanog expression, Dppa3 (Stella),
Fragilis (Ifitm3) and Prdm1 (Blimp1) are key players in the
mechanism involved in the acquisition of germ cell competence
(Hayashi et al., 2007). In post-mitotic spermatogenesis and
oogenesis, when dramatic morphological changes occur, a large
number of differentiation-specific molecules are involved, and
loss-of-function mutagenesis through conditionally targeted
disruption by knockout or knockin of these genes often results in
impaired fertility (O’Bryan and de Kretser, 2006; Roy and
Matzuk, 2006). However, in migrating PGCs, only a few genes
have been identified as key regulators, including Nanos3 and
Dnd1 (Tsuda et al., 2003; Youngren et al., 2005). Nanog protein,
which is first detected in male and female PGCs of E7.75-8.0
embryos, is expressed throughout the migration stages and is
subsequently downregulated in the gonads in male and female
mitotic arrest and meiotic germ cells, respectively (Yamaguchi et
DEVELOPMENT
KEY WORDS: Nanog, Knockdown, Primordial germ cell, Apoptosis, Mouse
4012 RESEARCH ARTICLE
al., 2005). The predominance of Nanog expression suggests that
it plays an important role in early germ cell development.
Recently, a role for Nanog in gonadal germ cells has been
suggested by the contribution of Nanog-null germ cells of E11.5,
but not of E12.5, chimeric embryos (Chambers et al., 2007).
However, it remains unclear whether the lack of Nanog-null cells
in the gonads of E12.5 chimeric embryos indicates Nanog
function in gonadal PGCs. It also remains unclear whether these
results reflect the role of wild-type ES and embryonic cells in
germ cell development. Therefore, it is necessary to investigate
the molecular function of Nanog in germ cells by other
approaches.
Post-transcriptional gene silencing through RNA interference
(RNAi), which is mediated by degradation of RNA complimentary to
~20-nt small interfering RNAs (siRNAs) after incorporation into an
RNA-induced silencing complex, is widely used to investigate the
molecular function of a target gene in cells cultured in vitro
(Filipowicz, 2005). Cre/loxP-regulated conditional RNAi of CD8 and
p53 mediated by lentiviral vectors has been successfully demonstrated
by mating with tissue-specific Cre-expressing transgenic mice in vivo
(Ventura et al., 2004). The crucial roles of sprouty2 (Spry2) and CREB
(cAMP-responsive element binding protein; Creb1) have been
revealed by in vivo lentiviral short hairpin RNA (shRNA)-mediated
knockdown (KD) in mice (Shaw et al., 2007; Cheng et al., 2008).
Although it is desirable to avoid genetic manipulation of the
endogenous gene when analyzing the biological role of genes
expressed in mouse germ cells, in vivo lentivirus-mediated conditional
KD of a germ cell-specific gene has yet to be reported.
Here, we made Nanog shRNA transgenic mice (NRi-Tg) for
Cre/loxP-mediated conditional KD. These mice were crossed with
estrogen receptor (ER; Esr1)-Cre or tissue non-specific alkaline
phosphatase (TNAP; Alpl)-Cre transgenic mice. Cre expression is
induced by the administration of tamoxifen (TM) to pregnant mice
with E7.5 ER-Cre/NRi-Tg embryos and upregulated in E9.0 TNAPCre/NRi-Tg embryos. In both cases, a reduction in the number of
PGCs in E12.5 male and female embryos was apparent. Oct4independent cell apoptosis was evident by TUNEL staining of E10.5
migrating PGCs. Similar to PGCs in vivo, cell death shortly after
Nanog KD was detected in PGCs cultured in vitro. A decrease in the
number of germ cells occurred transiently during germ cell
development of some adult TNAP-Cre/NRi-Tg males. Single-cell
microarray analysis of E10.5 Nanog KD PGCs demonstrated
marked changes at the transcription level in over 700 genes,
including several key factors, such as Tial1 (Tiar), Id1 and Suz12.
These data demonstrate that Nanog is functionally associated with
Development 136 (23)
the proliferation and survival of migrating PGCs as a safeguard of
the PGC-specific molecular network in mice. Nanog KD-mediated
apoptotic cell death may be triggered by the disruption of this
orchestrated molecular network.
MATERIALS AND METHODS
Constructions
Nanog target sequences were designed using pSico-Oligomaker 1.5
(http://web.mit.edu/jacks-lab/protocols/pSico.html). A random sequence
was designed as a negative control. The following target sequences were
cloned into HpaI/XhoI-digested pSico vector (Ventura et al., 2004):
shNanog, 5⬘-GTTAAGACCTGGTTTCAAA-3⬘; negative control, 5⬘GCCTTCACTCGATGCAATG-3⬘.
The silent mutant form of Nanog was constructed with pCAG-Nanog
(Hatano et al., 2004) by introduction of the mutation into the shRNA target
region through PCR-mediated nucleotide replacement. pCAG-Mut-Nanog
was co-transfected with pPgk-Neo into NRi ES cells using Lipofectamine
2000 (Invitrogen). G418 (250 g/ml)-resistant colonies were cloned and
expanded.
Lentiviral infections
The supernatant, which was collected 48 hours after co-transfection of the
SIN vector and each packaging vector into HEK 293T cells, was centrifuged
at 6000 g for 16-24 hours (Miyoshi et al., 1998). The pellet was dissolved in
Dulbecco’s modified Eagle’s medium (DMEM) (Sigma) and stored at
–80°C. Lentiviral infectivity was estimated by counting GFP-positive cells
after infection of the titrated supernatants into the 293T cells. Following
overnight culture of ESCs at 1⫻105 cells per well of a 12-well culture plate
(BD Falcon), the cells were infected with the supernatant at MOI15 and
cultured overnight. After washing out the virus several times with PBS, the
ESCs were plated on an inactivated mouse embryonic fibroblast (MEF)
feeder layer. GFP-positive cells were cloned and expanded. Expression of
shRNA was induced in vitro by treatment with adenovirus expressing Cre
recombinase (AdCre; AxCANCre) (Kanegae et al., 1995).
Culture of ESCs and MEFs
Mouse R1 ESCs were maintained in DMEM F-12 HAM (Sigma)
supplemented with 15% fetal bovine serum (FBS; BioWest), 0.1 mM 2mercaptoethanol and 400 units/ml recombinant LIF (Chemicon) (ES
medium) on MEF feeder cells inactivated with mitomycin C.
Mice
TNAP-Cre and ER-Cre mouse lines were maintained by mating them with
C57BL/6J mice. The PCR primer sets for genotyping are summarized in
Table 1. C57BL/6J blastocysts, into which the NRi-shRNA-infected ESCs
were microinjected, were transferred into the uteruses of pseudo-pregnant
ICR females. Chimeras were mated with C57BL/6J females, and germline
transmission to the next generation was checked by coat color and GFP
fluorescence. Mice homogenous for the NRi-Tg were detected by genomic
PCR with a specific primer set (Table 1). For Cre induction in embryos, 3.0
Primer set
Forward primer (5⬘ to 3⬘)
Reverse primer (5⬘ to 3⬘)
TNAP-Cre
ER-Cre
pSico excision
Inverse PCR 1st
Inverse PCR 2nd
NRi-Wt allele
NRi-Tg allele
Nanog
Id1
Tial1
Suz12
Gapdh
GGCTCTCCTCAAGCGTATTCAAC
CTCTAGAGCCTCTGCTAACC
CAAACACAGTGCACACCACGC
GCCAAGTGGGCAGTTTACCG
AATGGGCGGGGGTCGTTGGG
CGTAATGAGATCTGACGTCC
Same as Wt allele
CTTTCACCTATTAAGGTGCTTGC
CAACAGAGCCTCACCCTCTC
GGCATGCAAGGAAATGTCTC
AAGGCTAGCATTGTTTGCAC
ATGAATACGGCTACAGCAACAGG
CAAACGGACAGAAGCATTTTCCAG
CCTGGCGATCCCTGAACATGTCC
CGCACAGACTTGTGGGAGAAG
GGCTGCTCGCCTGTGTTGCC
CCAGCGGACCTTCCTTCCCGC
GGGAGTCTACACAGCAAAC
GGCTGCTCGCCTGTGTTGCC
TGGCATCGGTTCATCATGGTAC
AGAAATCCGAGAAGCACGAA
TTGGCTTTAGTTGGCCTCTC
TTGTACCATTCAAATGCTTTATCA
CTCTTGCTCAGTGTCCTTGCTG
shNanog probe
shNC probe
GTTAAGACCTGGTTTCAAA
GCCTTCACTCGATGCAATG
DEVELOPMENT
Table 1. Primers and probes for genomic PCR, qPCR and northern blot analyses
Safeguard of PGC survival by Nanog
mg TM/40 g body weight was intra-peritoneally injected into pregnant NRiTg mice 7.5 or 9.5 days after mating them with ER-Cre males. Experiments
with mice were performed according to the institutional guidelines of Kyoto
University, Japan.
Blastocyst culture
Blastocysts collected from super-ovulated NRi-Tg mice mated with ER-Cre
males were treated with acidic Tyrode’s solution (Sigma) to remove the zona
pellucida. Blastocysts attached to the bottom of a gelatin-coated 1-cm well
were cultured with ES medium for an initial 24 hours and then in the
presence of 1 M 4-hydroxytamoxifen (4OH-TM; Sigma) for 6 days. Each
expanded blastocyst that was morphologically analyzed was genotyped by
genomic PCR with specific primer sets (Table 1).
RESEARCH ARTICLE 4013
needles. PGCs were identified by their morphological characteristics and
transferred into lysis buffer by mouth pipette. PGCs were genotyped with
the remaining genital ridges. The amplified cDNA library of each PGC was
classified by qPCR-based expression analyses of Nanog, Oct4 and Dppa3
(Kurimoto et al., 2007). cDNAs were labeled by in vitro transcription
(Affymetrix). The cRNAs were hybridized with the GeneChip Mouse
Genome 430 2.0 Array (Affymetrix). Data were analyzed using Microsoft
Excel and Multiple Experimental Viewer (MeV) software.
qPCR was performed using the ABI Prism 7700 (Applied Biosystems)
and Power SYBR Green PCR Master Mix according to the manufacturer’s
instructions (Applied Biosystems), with gene-specific primer sets (Table 1).
Microarray data have been deposited in ArrayExpress (accession number
E-MEXP-2411).
For collection of PGCs, the dorsal mesentery of E10.5 embryos obtained by
intercrossing NRi-Tg and ER-Cre transgenic mice was dissociated with
0.05% trypsin and 1 mM EDTA for 1 minute at 37°C (Matsui et al., 1992;
Kawase et al., 1994). The cells were cultured in PGC medium [DMEM F12 HAM with 15% FBS, 0.1 mM 2-mercaptoethanol, 400 units/ml LIF, 25
ng/ml recombinant human bFGF, and 10 M forskolin (Sigma)] on Sl4m220 feeder cells inactivated with mitomycin C. One-quarter of the cell
suspension was seeded in each well of a gelatin-coated 1-cm well or a
collagen-coated cell-culture chamber slide (BD Falcon) containing feeder
cells. After 12 hours culture, the PGCs started multiplying in PGC medium
containing 5 M 4OH-TM and were harvested at 0, 12, 36 and 60 hours.
PGCs fixed with 4% paraformaldehyde (PFA) in PBS for 15 minutes at
room temperature were used for further analyses.
Inverse PCR and sequencing
The integration site of the lentivirus in the NRi-shRNA-ESCs was detected
by inverse PCR as previously described (Li et al., 1999) with minor
modifications. ApaI-ApaI genomic DNA fragments of NRi-shRNA-ESCs
were self-circularized. Flanking genomic DNA was PCR amplified and
cloned into the pGEM-T Easy vector (Promega). DNA sequences
determined with a CEQ2000XL DNA sequencer (Beckman Coulter) were
aligned using the NCBI BLAST and EBI Ensembl databases.
Northern and western blotting
Total RNA (10 g) isolated from ESCs or embryos using TRIzol
(Invitrogen) was separated through 15% polyacrylamide/7M urea gels and
electroblotted to Hybond XL (Amersham). The membrane was hybridized
with a 32P 5⬘-end-labeled oligonucleotide probe at 42°C overnight. The
membranes were washed twice in 2⫻SSC/0.1% SDS at 65°C for 30 minutes
and twice in 0.1⫻SSC/0.1% SDS at 65°C for 15 minutes.
Whole lysate (20 g/lane) of ESCs was separated by 12% SDS-PAGE and
transferred onto a nitrocellulose membrane (Millipore). The membrane was
probed with anti-Nanog (1:1500 dilution) and anti-histone H3 (1:3000)
antibodies at 4°C overnight. The membrane was incubated with a HRP-linked
anti-mouse or rabbit IgG secondary antibody (1/3000, Amersham) for 1 hour.
Signals were visualized using the ECL Western Blotting Detection Kit
(Amersham).
Immunohistochemistry
Immunohistochemistry analyses of ESCs, PGCs and cryosections (10 m)
were performed as described previously (Yamaguchi et al., 2005). The
antibodies used were: anti-Nanog (1:1000; Cosmo Bio), anti-Oct4 (1:100;
Santa Cruz), anti-SSEA1 (MC480, 1:1000; DSHB), anti-phospho-histone
H3 (1:2000; Upstate) and TRA98 (1:500; Cosmo Bio; this antibody detects
a mouse testicular germ cell-specific antigen). For counting E12.5 PGCs,
~10-15 transverse sections taken at regular intervals throughout the entire
gonad were analyzed. For the TUNEL assay, the In Situ Cell Death
Detection Kit (Roche) was used according to the manufacturer’s
instructions. ALP signals in genital ridges and cultured PGCs were detected
using the ALP staining mixture (Ginsburg et al., 1990).
Single-cell microarray and quantitative (q) PCR
E10.5 genital ridges (TM administered at E7.5) were incubated in 0.5 mM
EDTA in PBS for 20 minutes at 37°C and then transferred to 2% BSA in
PBS. PGCs were released from the genital ridges by piercing with fine glass
RESULTS
Generation of Nanog-knockdown ESCs and
transgenic mice
A temporally and spatially controlled in vivo Nanog KD system was
constructed with a lentiviral vector for conditional Cre/loxPregulated RNAi (Ventura et al., 2004). Before Cre recombinase
expression, the GFP reporter driven by the CMV promoter is widely
expressed and Nanog shRNA is repressed, whereas after Cremediated recombination, GFP is flipped out and Nanog shRNA
expression is then driven by the U6 promoter (Fig. 1A).
The most effective shRNA was introduced by viral infection of
R1 ESCs for establishment of Nanog KD ESCs (NRi-ESCs).
Transcription of the shRNA after infection with adenovirus Cre
(AdCre) was confirmed by northern blot analysis in NRi-ESCs (Fig.
1B). Western blot analyses showed efficient reduction of Nanog
expression to a relative value of 0.14 [compared with AdCre(–) NRiESCs] 96 hours after AdCre infection (Fig. 1C). Cre-dependent
Nanog repression was verified by GFP expression and
immunostaining of Nanog 48 hours after AdCre infection (Fig. 1D).
Downregulation of Nanog was detected within the first 24 hours
(data not shown). Differentiation of ESCs was detected 96 hours
after AdCre infection with NRi shRNA, indicating that cell
differentiation was induced 72 hours after Nanog KD (Fig. 1E).
Clonal expansion of ESCs was disturbed by transcription of NRi
shRNA (see Fig. S1A,B in the supplementary material).
shRNA silences a target gene with a completely homologous
sequence through a post-transcriptional cleavage mechanism. It has
been noted that siRNA often triggers off-target effects, which could
be caused by unintended RNAi-specific toxic events or cleavage of
an unintended RNA target (Ui-Tei et al., 2008). Cre-dependent
expression of the non-specific negative control shRNA resulted in a
normal ESC phenotype (Fig. 1C-E). Disappearance of Credependent NRi shRNA-mediated repression of Nanog and
promotion of differentiation by co-transfection with the silentmutation form of Nanog (Mut-Nanog) again showed that the NRi
shRNA was highly specific to Nanog (see Fig. S1B-D in the
supplementary material). Inverse PCR and DNA sequence analyses
demonstrated that the NRi lentiviral vector was integrated between
Cdh2 and Dsc3, near to the proximal region of chromosome 18 (see
Fig. S2A in the supplementary material). No known gene was
disrupted by the lentiviral integration. Therefore, the NRi shRNAinfected ESCs were used for further in vivo experiments.
Nanog shRNA transgenic mice were made by mating a male
germline chimera carrying NRi shRNA-infected ESCs with
C57BL/6 females. NRi-Tg founder mice were detected by
expression of GFP (see Fig. S2B in the supplementary material). By
crossing mice heterozygous for NRi-Tg, homozygous NRi-Tg mice
were generated and stably maintained as a transgenic line.
DEVELOPMENT
PGC culture
Fig. 1. Effect of Nanog shRNA on the differentiation of mouse
ESCs and blastocysts. (A)Lentiviral vector for conditional Cre/loxPregulated RNAi of Nanog. (B)Transcription of NRi-shRNA in ESC
derivatives 96 hours after adenovirus Cre (AdCre) infection as assessed
by northern blotting. (C)The efficiency of NRi-shRNA in ESC derivatives
96 hours after AdCre infection as assessed by western blotting. Histone
H3 was used as a loading control. (D)Suppression of Nanog by NRishRNA 48 hours after AdCre infection. (E)Induction of ESC
differentiation by NRi-shRNA 96 hours after AdCre infection.
(F)Outgrowth of the inner cell mass cells of blastocysts cultured for 7
days with 4-hydroxytamoxifen. NC, non-specific shRNA as a negative
control.
Effect of Nanog knockdown on somatic cells
To further examine possible off-target effects in vivo, we analyzed
peri-implantation development of ER-Cre/NRi-Tg doubletransgenic embryos generated by mating females homozygous for
NRi-Tg with males heterozygous for ER-Cre driven by the CAG
promoter [C57BL/6.Cg-Tg(cre-Esr1)5Amc/J]. In the ER-Cre
transgenic embryos and mice, Cre activity is induced by the
synthetic estrogen-like agonist tamoxifen (TM), but not by
endogenous estrogens (Hayashi and McMahon, 2002). Zona
pellucida-free blastocysts were cultured in the presence of TM for 7
days. Each blastocyst that expanded on the bottom of a culture well
was genotyped by genomic PCR. The ICM cells were poorly
developed in the ER-Cre/NRi-Tg double-transgenic embryos,
similar to previous findings in Nanog-knockout embryos (Mitsui et
al., 2003), whereas ICM cells were well developed in the NRi-Tg
single-transgenic embryos (Fig. 1F). Furthermore, the normal
development of E12.5 ER-Cre/NRi-Tg double-transgenic embryos,
in which Nanog shRNA was transcribed in all tissues of the body
(Fig. 2A,C), indicates that no off-target effects were apparent,
although one cannot necessarily assume that Nanog knockout and
KD result in the same molecular consequences and embryonic
phenotypes.
Development 136 (23)
Decrease in PGCs in E12.5 ER-Cre/NRi-Tg embryos
To examine the effect of Nanog KD on early PGC development,
NRi-Tg females were mated with ER-Cre males, and then TM (3
mg/40 g body weight) was intra-peritoneally administered to
pregnant mice at 7.5 days post-coitum (dpc) for Cre-dependent
transcription of Nanog shRNA. Normal development, without any
retardation, was observed in the gross external morphology of the
E12.5 single ER-Cre and NRi-Tg embryos, and even in the ERCre/NRi-Tg double-transgenic embryos (Fig. 2A), in which
transcription of Nanog shRNA was detected (see Fig. S2C in the
supplementary material).
A striking decrease in the number of ALP+ PGCs was evident by
the sparsity of red-stained cells in the gonads of E12.5 ER-Cre/NRiTg double-transgenic embryos, in contrast to the high number of
red-stained cells in the gonads of single-transgenic NRi-Tg embryos
collected from the same littermates (Fig. 2A). Cre activity (excision
as assessed by genomic PCR) was nearly 100% in the liver and
~75% in the gonads, although in PGCs it was difficult to determine
the Cre activity precisely.
To calculate the number of PGCs, cells positive for SSEA1
(stage-specific embryonic antigen 1; Fut4 – Mouse Genome
Informatics) were counted in transverse sections of E12.5 gonads.
In single-transgenic gonads, 43 SSEA1+ PGCs were detected on
average per section, versus only 14 in the double-transgenic gonads
(Fig. 2B). Nanog KD resulted in a ~70% reduction in PGCs in male
and female ER-Cre/NRi-Tg embryos. The majority of SSEA1+
PGCs were negative for Nanog (Fig. 2E). Similarly, in E11.5 ERCre/NRi-Tg embryos, the number of ALP+ gonadal PGCs was
markedly reduced (see Fig. S3A-C in the supplementary material).
Next, to determine whether Nanog KD induces detrimental effects
on early gonadal PGCs, TM was administered at 9.5 dpc to pregnant
NRi-Tg mice that had been mated with ER-Cre Tg males.
Interestingly, no decrease in ER-Cre/NRi-Tg PGCs was observed at
E12.5 by ALP staining (Fig. 2C,D), irrespective of the repression of
Nanog in SSEA1+ PGCs (Fig. 2E). These data indicate that Nanog
mainly plays a role in migrating PGCs, but not in gonadal PGCs.
Decrease in PGCs in TNAP-Cre/NRi-Tg embryos
To verify the function of Nanog in migrating PGCs, NRi-Tg mice
were mated with the PGC-specific Cre recombinase transgenic mouse
line TNAP-Cre, which was generated by knockin of Cre into the
TNAP (Alpl) locus. Cre excision was first detected in early PGCs at
E9.0, and Cre activity in PGCs was detected in ~50% of E13.5 PGCs
(Lomeli et al., 2000). E12.5 TNAP-Cre/NRi-Tg, NRi-Tg, TNAP-Cre
and wild-type embryos developed normally (Fig. 2F). When E12.5
TNAP-Cre/NRi-Tg double- and single-transgenic embryos were
compared, the intensity of staining of ALP+ cells was drastically
reduced in the TNAP-Cre/NRi-Tg gonads (Fig. 2F). To estimate the
number of PGCs, SSEA1+ cells were counted in each transverse
section of the E12.5 gonads. The number of PGCs in the TNAPCre/NRi-Tg gonads was half that in the control gonads (Fig. 2G).
Immunohistochemical analysis demonstrated that SSEA1+ PGCs
were frequently Nanog– in the TNAP-Cre/NRi-Tg gonads, whereas
the majority of SSEA1+ PGCs were Nanog+ in the controls (Fig.
2H), indicating that Nanog KD resulted in a reduction in PGCs, as
seen in ER-Cre/NR1-Tg transgenic mice.
Decrease in proliferation and increase in cell
death in PGCs in vivo
To examine the sequential expression of PGC markers, cell
proliferation and apoptosis during migration, immunohistochemical
analyses and TUNEL assays were performed in E9.5 and E10.5 ER-
DEVELOPMENT
4014 RESEARCH ARTICLE
Safeguard of PGC survival by Nanog
RESEARCH ARTICLE 4015
Fig. 2. Reduction in the number of PGCs in E12.5 ER-Cre/NRi-Tg and TNAP-Cre/NRi-Tg embryos. (A)Reduction in the number of alkaline
phosphatase (ALP)-positive PGCs in E12.5 ER-Cre/NRi-Tg genital ridges. Tamoxifen was injected into pregnant mice at 7.5 dpc (TM7.5). (B)The
number of SSEA1+ PGCs in E12.5 ER-Cre/NRi-Tg and single-transgenic embryos from TM7.5. (C)There was no reduction in ALP+ PGCs in E12.5 ERCre/NRi-Tg genital ridges. TM was injected into pregnant mice at 9.5 dpc (TM9.5). (D)There was no difference in the number of SSEA1+ PGCs in
E12.5 ER-Cre/NRi-Tg and single-transgenic embryos from TM9.5. (E)Expression of Nanog in SSEA1+ PGCs of E12.5 ER-Cre/NRi-Tg embryos.
Transverse sections of E12.5 genital ridges were immunostained. The circles delineate genital ridges. No GFP signal was detected in the
cryosections. (F)Reduction in ALP+ PGCs in E12.5 TNAP-Cre/NRi-Tg genital ridges. (G)The number of SSEA1+ PGCs in E12.5 TNAP-Cre/NRi-Tg and
single-transgenic embryos. (H) Expression of Nanog in SSEA1+ PGCs of E12.5 TNAP-Cre/NRi-Tg embryos. The circles delineate genital ridges. No GFP
signal was detected in the cryosections. *P<0.01, **P<0.05. Error bars, s.e.m.
mediated recombination within the first day after TM injection at
E7.5, Nanog–/Oct4+/SSEA1+/TUNEL– PGCs had appeared by the
second day. Within the next 24 hours, apoptosis occurred in PGCs
marked as Nanog–/SSEA1+/TUNEL+ (Fig. 4A,B). Oct4 expression
was observed in all Nanog–/SSEA1+ PGCs, but not TUNEL+ PGCs
(data not shown). Following TM injection at E9.5, Nanog KD did
not occur sufficiently in E10.5 migrating PGCs, while induced
markedly with no significant reduction in the number of E12.5
gonadal PGCs (Fig. 5A-C), suggesting that Nanog function is
dispensable for the survival of gonadal PGCs (Fig. 2C-E). The
effects on PGC development of Nanog KD induced by TM injection
at E7.5 and E9.5 are summarized in Fig. 5D.
Decrease in proliferation and increase in cell
death in PGCs in vitro
To examine whether the reduction in PGCs was caused by the death
or differentiation of PGCs, dissociated gonads of E10.5 embryos
were cultured on inactivated Sl4-m220 cells expressing the
membrane-associated form of steel factor (kit ligand) with culture
medium containing leukemia inhibitory factor (LIF), basic fibroblast
growth factor (bFGF) and forskolin (Koshimizu et al., 1996). The
proliferation of PGCs was clearly repressed in the ER-Cre/NRi-Tg
double-transgenic PGCs as compared with control PGCs after 12
hours of culture in the presence of TM (Fig. 6A). Although a gradual
decrease in the number of ALP+ PGCs was observed even in the
control embryos from 12 to 60 hours after TM administration, ERCre/NRi-Tg PGCs were significantly less abundant than control
DEVELOPMENT
Cre/NRi-Tg double-transgenic embryos and their littermates. At
E9.5 and E10.5, the gross morphology of the ER-Cre/NRi-Tg
double-transgenic embryos was normal. No sex-specific differences
were detected.
At E9.5 (2 days after TM administration), Nanog–/SSEA1+
migrating PGCs were detected in the ER-Cre/NRi-Tg doubletransgenic, but not NRi-Tg, embryos (Fig. 3A). The number of
Nanog+/SSEA1+ PGCs was significantly reduced (to ~70%; Fig.
3B). At E10.5 (3 days after TM administration), Nanog–/SSEA+
PGCs were more abundant in the ER-Cre/NRi-Tg embryos as
compared with the control embryos (Fig. 3C). Nanog+/SSEA1+
PGCs were markedly decreased (to ~40%; Fig. 3D). An important
finding was that the number of TUNEL+ PGCs noticeably increased
in the ER-Cre/NRi-Tg embryos. TUNEL+/SSEA1+ PGCs were first
detected in E9.5 PGCs (Fig. 4A,B), and at E10.5 their abundance
was about three times that in the control PGCs (Fig. 4C,D). The
number of PGCs positive for the mitotic marker phosphorylatedhistone H3 was significantly lower in ER-Cre/NRi-Tg than in
control embryos (Fig. 4E). Notably, the majority of SSEA1+/Oct4+
PGCs were positive for Nanog in the control embryos, whereas
almost half were negative for Nanog in the ER-Cre/NRi-Tg embryos
(Fig. 4F). Thus, the majority of E7.5 TM-treated Nanog–/TUNEL+
apoptotic PGCs stopped migrating before entry into the genital
ridges.
Cre-mediated recombination is detectable in embryos within 24
hours of TM administration to pregnant mice (Hayashi and
McMahon, 2002). Taking this into consideration, following Cre-
4016 RESEARCH ARTICLE
Development 136 (23)
Fig. 3. Expression of Nanog in migrating PGCs in E9.5 and E10.5
ER-Cre/NRi-Tg embryos. (A)Expression of Nanog in SSEA1+ PGCs of
E9.5 ER-Cre/NRi-Tg mouse embryos. (B)The proportion of Nanog+
PGCs in SSEA1+ PGCs in E9.5 ER-Cre/NRi-Tg embryos. (C)Expression of
Nanog in SSEA1+ PGCs of E10.5 ER-Cre/NRi-Tg embryos. (D)The
proportion of Nanog+ PGCs in SSEA1+ PGCs in E10.5 ER-Cre/NRi-Tg
embryos. The arrowheads indicate SSEA1+ PGCs. The circles indicate
SSEA1+/Nanog– PGCs. *P<0.01, **P<0.05. Error bars, s.e.m.
Effect of Nanog knockdown on adult gonads
After injection of TM at 3 mg/40 g body weight to 7.5 dpc pregnant
females, embryos developed normally until E13.5 but died in the
second semester of pregnancy, although most embryos were viable
and developed normally until E13.5. Thus, the testes or ovaries of
6-week-old TNAP-Cre ⫻ NRi-Tg F1 mice were analyzed
morphologically and immunohistochemically. The testes, but not the
ovaries, tended to be smaller in the TNAP-Cre/NRi-Tg double-
transgenic embryos than in the control embryos, although both the
testes and ovaries varied in size (see Fig. S5A,B in the
supplementary material).
In two out of six testes examined from 6-week-old TNAPCre/NRi-Tg adults, spermatogonia, marked as TRA98+ germ cells,
were dissociated from the tubule wall and scattered in the empty
tubules (see Fig. S5C in the supplementary material). These features
are observed in germ cells undergoing mitotic division in prepubescent newborn mice, demonstrating that developmental
retardation of the seminiferous tubule in some regions of adult testes
may be caused by the loss of Nanog– germ cells during the perigonadal stage. Consistently, the number of TRA98+ germ cells in
TNAP-Cre/NRi-Tg newborn (P1) testes was reduced (see Fig.
S5D,E in the supplementary material).
No significant difference in the number of oocytes was detected
in 6-week-old TNAP-Cre/NRi-Tg versus control mice by
immunostaining of cryosections with anti-Oct4 antibody (data not
shown).
DEVELOPMENT
PGCs. Notably, immunocytochemical analyses revealed that Nanog
expression was repressed in the ER-Cre/NRi-Tg, but not in the NRiTg. PGCs 12 and 36 hours after TM administration (Fig. 6B). From
12 to 36 hours after TM administration, TUNEL+ cells were
prominent in the ER-Cre/NRi-Tg embryos but not in the control
embryos (Fig. 6C). The number of SSEA1+/TUNEL+ PGCs in the
ER-Cre/NRi-Tg embryos was about twice that in the NRi-Tg control
embryos (Fig. 6D). Nanog–/Oct4+ PGCs were often detected in the
ER-Cre/NRi-Tg culture, but not in the control, 12 and 36 hours after
TM administration (see Fig. S4A in the supplementary material).
The number of PGCs positive for the mitotic marker phosphorylated
histone H3 was significantly reduced in ER-Cre/NRi-Tg PGCs (see
Fig. S4B,C in the supplementary material). Cre-mediated
recombination was efficiently induced in more than 50% and nearly
100% of MEFs 12 and 24 hours after culture in the presence of TM,
respectively (see Fig. S4D in the supplementary material).
Differentiation of ESCs was induced 72 hours after Nanog
repression (Fig. 1E), suggesting that apoptotic cell death prior to cell
differentiation was induced within 24 hours of Nanog repression in
PGCs.
Fig. 4. Apoptosis and proliferation of Nanog-negative migrating
PGCs in E9.5 and E10.5 ER-Cre/NRi-Tg embryos after E7.5
tamoxifen administration. (A)TUNEL assay in E9.5 ER-Cre/NRi-Tg
mouse embryos. The arrowheads indicate SSEA1+/TUNEL+ PGCs. (B)The
proportion of TUNEL+ cells in SSEA1+ PGCs in E9.5 ER-Cre/NRi-Tg
embryos. (C)TUNEL assay in E10.5 ER-Cre/NRi-Tg embryos. The
arrowheads indicate SSEA1+/TUNEL+ PGCs. (D)The proportion of TUNEL+
cells in SSEA1+ PGCs in E10.5 ER-Cre/NRi-Tg embryos. (E)The proportion
of phosphorylated histone H3+ cells in SSEA1+ PGCs of E10.5 ER-Cre/NRiTg embryos. (F)Expression of Oct4 in Nanog– PGCs of E10.5 ER-Cre/NRiTg embryos. Arrowheads indicate Oct4+/SSEA1+ PGCs. Circles indicate
Nanog– PGCs. *P<0.01, **P<0.05. Error bars, s.e.m.
Fig. 5. Effects of E9.5 tamoxifen administration on ER-Cre/NRi-Tg
PGCs. (A) The efficiency of Cre-mediated recombination in the genital
ridges of E10.5 and E12.5 ER-Cre/NRi-Tg mouse embryos after E7.5
and E9.5 tamoxifen administration. Pre, pre- recombination; Post, postrecombination. (B) Nanog expression in SSEA1+ PGCs of E10.5 ERCre/NRi-Tg embryos after TM9.5. The arrowhead indicates a Nanog–
PGC. (C) The proportion of Nanog+ cells in SSEA1+ PGCs in E10.5 ERCre/NRi-Tg embryos. *P<0.01. Error bars, s.e.m. (D)Induction of Nanog
knockdown and apoptosis by TM7.5 and TM9.5.
Changes in gene expression profile upon Nanog
knockdown in each PGC
To explore the molecular mechanism involved in apoptotic cell
death by Nanog KD, the global gene expression profile of each
E10.5 PGC was analyzed by a single-cell microarray assay
(Kurimoto et al., 2007). A PGC-specific cDNA library was
identified by RT-PCR of Oct4 and Dppa3 (Fig. 7A). The libraries
were classified into Nanog low [Nanog (L)] and Nanog high
[Nanog (H)] by qPCR. Hybridization with the amplified cDNAs
to the Affymetrix GeneChip Mouse Genome 430 2.0 Array
(Affymetrix) demonstrated that 759 out of 45,101 probes were
significantly different between Nanog (L) and (H) in their relative
expression level (P<0.05; greater than 2-fold change) (Fig. 7B).
No change was detected in the Oct4 expression level between
Nanog (L) and (H), in agreement with immunostaining (Fig. 4F).
Furthermore, Sox2, Dppa3, Sll4, Kit, Dnd1, Zfp42 (Rex1), Prdm1,
Utf1 and Klf5 were highly transcribed even in Nanog (L) PGCs,
similar to in control PGCs. The expression of a few genes in the
development and lineage-annotated sequences in the gene
ontology list (Affymetrix) had changed in the Nanog (L) PGCs
(see Fig. S6A in the supplementary material). These data suggest
that Nanog KD leads PGCs to apoptotic cell death and not to
differentiation. Notably, the expression level of some genes was
significantly up- or downregulated (Fig. 7C; see Table S1 in the
supplementary material). For example, those encoding the RNAbinding protein Tial1 (Beck et al., 1998), helix-loop-helix (HLH)
family protein Id1 (Norton et al., 1998) and Polycomb repressive
complex 2 (PRC2) subunit Suz12 (Lee et al., 2006), were
markedly repressed in Nanog (L) PGCs. Disruption of the PGCspecific molecular network, at least that due to downregulation of
these key genes, might trigger prompt mitotic arrest and cell death
(Fig. 7D).
RESEARCH ARTICLE 4017
Fig. 6. Effects of Nanog knockdown on PGC development in
culture in vitro. (A)The relative number of ER-Cre/NRi-Tg doubletransgenic to single-transgenic PGCs after 12, 36 and 60 hours of
culture with TM. PGCs were detected by ALP staining. (B)Repression of
Nanog 12 hours after TM treatment. (C)TUNEL staining of PGCs after
36 hours of culture with TM. Arrowheads indicate TUNEL+ PGCs.
(D)The proportion of TUNEL+ cells in SSEA1+ PGCs after 36 hours of
culture with TM. *P<0.01. Error bars, s.e.m.
Some genes downstream of Nanog (Kim et al., 2008) were upor downregulated in Nanog (L) PGCs (see Fig. S6B in the
supplementary material). The significant decrease in Id1
transcription was verified by qPCR with a single-cell cDNA
library (see Fig. S7A in the supplementary material). Although the
mechanism of transcriptional regulation of Id1, which bypasses
the BMP/phosphorylated Smad pathway (Dudley et al., 2007), is
unclear, Id1 might be directly downstream of Nanog in PGCs,
as shown by the binding of Nanog to Id1 in ESCs (Kim et al.,
2008).
DISCUSSION
Nanog is expressed not only in the pluripotential cells of periimplantation embryos, but also in the migrating and early gonadal
PGCs of post-implantation embryos (Yamaguchi et al., 2005). A key
function of Nanog at the peri-implantation stage is to maintain the
pluripotency of early embryonic cells, as revealed in Nanogdeficient embryos produced by genetic disruption of Nanog (Mitsui
et al., 2003). Here, to investigate the function and mechanism of
Nanog in PGCs, we constructed the NRi-Tg transgenic line, in
which Nanog activity is controlled in vivo through inducible
transcription of Nanog-specific shRNA with a pSico lentiviral vector
(Ventura et al., 2004). In combination with two independent Creexpressing transgenic lines, ER-Cre and TNAP-Cre, Cre expression
beginning at ~E8.5-9.0 resulted in a significant reduction in the
DEVELOPMENT
Safeguard of PGC survival by Nanog
Fig. 7. Single-cell microarray analysis of E10.5 ER-Cre/NRi-Tg
PGCs. (A)Scheme of the single-cell microarray analysis. (B)Comparison
of global gene expression profiles, shown as a heat map. Genes that
show a greater than 2-fold change in Nanog (L) versus Nanog (H) PGCs
are represented. (C)Changes in the expression of selected genes
between Nanog (L) and Nanog (H) PGCs. The ontology of the genes is
summarized in Table S1 in the supplementary material. (D)A model of
the molecular network involved in PGC survival and apoptosis induced
by Nanog knockdown.
gonadal PGCs of E12.5 male and female embryos.
Immunohistochemical analyses of the migrating PGCs of E9.5 and
E10.5 TM-administered ER-Cre/NRi-Tg embryos demonstrated
that Nanog–/Oct4+ PGCs were first detected at E9.5, and then
Nanog–/TUNEL+ PGCs appeared at E10.5. The immediate
induction of cell apoptosis following Nanog repression in PGCs
cultured in vitro suggests that cell death, but not cell differentiation,
is the key reason for the decrease in PGC numbers. The adult TNAPCre/NRi-Tg males and females were fertile. Notably, some male
TNAP-Cre/NRi-Tg adult mice showed partially retarded
development of the seminiferous tubule. A single-cell microarray
analysis revealed that changes in gene expression, including
downregulation of Tail1, Id1 and Suz12, were associated with
apoptotic cell death of Nanog KD PGCs. Our data provide
conclusive evidence that (1) Nanog is required for the survival of
Development 136 (23)
migrating PGCs, (2) a deficiency in Nanog triggers apoptosis but not
cell differentiation in PGCs, and (3) Nanog is involved in
safeguarding the PGC molecular network.
The use of an inducible KD system without genetic alteration of
the endogenous gene is a powerful tool for analyzing the molecular
function of a possibly heteroinsufficient germ cell-specific gene.
This is the first report of a successful conditional KD of a germ cellspecific gene in vivo. A conditional KD system is quicker to build
than a conventional conditional knockout system, although possible
off-target effects have to be carefully examined in order to avoid an
overestimation of gene function resulting from non-specific gene
silencing.
In migrating germ cells, only a few genes have been identified as
key regulators. Following germ cell specification, Nanog, Kit, Tial1,
Nanos3 and Dnd1 are known to be highly transcribed in migrating
PGCs (Beck et al., 1998; Tsuda et al., 2003; Youngren et al., 2005;
Yamaguchi et al., 2005). Kit plays a crucial role in the survival of
migrating PGCs (Loveland and Schlatt, 1997). Tial1-deficient mice
are sterile owing to the loss of PGCs at ~E11.5 (Beck et al., 1998).
Knockout of Nanos3 results in the complete loss of PGCs in both
sexes in E12.5 embryos (Tsuda et al., 2003). A similar phenomenon
was detected after germ cell-specific knockout of Oct4. Oct4deficient PGCs undergo apoptosis, and a marked reduction in PGCs
is detected in E10.5-12.5 embryos (Kehler et al., 2004). Importantly,
a common consequence of the loss of gene expression is apoptotic
cell death, not cell differentiation. Single-cell microarray analysis
demonstrated that abnormal transcription of various types of core
regulators, including the RNA-binding protein Tial1, differentiation
inhibitor Id1, and PRC2 subunit Suz12, occurred within 24 hours of
Nanog downregulation in E10.5 PGCs. Notably, the absence of any
significant change in the expression level of genes downstream of
Id1 and Suz12 suggests that the prompt cell death response might be
induced by abrupt disruption of the PGC molecular network prior to
the disordered expression of peripheral genes. Thus, we speculate
that the apoptotic cell death of PGCs is triggered by ‘disharmony’ in
the gene regulation network. The molecular mechanism involved in
monitoring ‘harmony’ in the PGC molecular network is unclear. It
is also unknown whether the apoptosis of Nanog (L) PGCs depends
on the Bax pathway, as reported in Steel (Kitl)-deficient (Runyan et
al., 2006) and Nanos3-deficient (Suzuki et al., 2008) PGCs.
Apoptotic cell death triggered by a deficiency in any core gene,
including Nanog, might play an important role in preventing the
transmission of abnormal genetic information to the next generation.
An interesting point is that Oct4 and Nanog exhibit similar dual
physiological roles, which are essential for maintaining pluripotency
in early embryonic cells and for supporting survival in migrating
PGCs. It is still unclear why a deficiency in Nanog and Oct4 induces
a distinctive phenotype in early embryonic cells and PGCs. A
possible explanation is that the molecular network supporting the
properties of pluripotent embryonic cells differs from that of
unipotent PGCs (Kato et al., 1999). In pluripotent embryonic cells,
differentiation-associated genes may be ready to be transcribed
quickly following the downregulation of pluripotent guardian genes
including Nanog and Oct4, whereas in unipotent PGCs, which are
specialized toward generating germ cells through tight epigenetic
regulation of gene activation and silencing, a defect in the PGCspecific molecular network triggered by a lack of Nanog or Oct4
may cause apoptosis without the alternative option of trans-lineage
differentiation. We found no evidence that Nanog– PGCs
differentiated into another type of somatic cell instead of undergoing
apoptosis, although apoptosis and differentiation are induced in the
ICM cells of Nanog-deficient blastocysts (Silva et al., 2009). In this
DEVELOPMENT
4018 RESEARCH ARTICLE
context, the fate of migrating PGCs may be strictly determined by
the fixed transcriptional circuitry regulated by stable epigenetic
modifications that is inappropriate for trans-differentiation to
somatic cells.
Id1 is downstream of the BMP/phosphorylated Smad pathway
and functions as a dominant-negative binding factor for HLH genes
(Norton et al., 1998). However, phosphorylated Smad1, 5 and 8 are
not detected in migrating PGCs (Dudley et al., 2007). Thus, Id1 has
to be upregulated by another pathway. Considering that Nanog binds
to the upstream sequence of Id1 in ESCs, as determined by ChIPon-chip analysis (Kim et al., 2008), and that Id1 is downregulated in
Nanog (L) PGCs, as revealed by single-cell microarray analysis (see
Fig. S7B in the supplementary material), one may suggest that
Nanog is involved in the regulation of Id1 in PGCs.
Oct4 and Sox2 activate Nanog expression through binding to the
Octamer/Sox elements upstream of the transcription start site
(Kuroda et al., 2005; Rodda et al., 2005), although full
transcriptional regulation of Nanog is complicated by its association
with many other regulatory factors. In Oct4-deficient PGCs, it is not
evident whether Nanog and Sox2 are expressed appropriately
(Kehler et al., 2004). It is possible that apoptosis of the Oct4deficient PGCs might be detected as a consequence of the prompt
repression of Nanog, which is downstream of Oct4. Apoptosis of
Nanog–/Oct4+ PGCs in our KD analyses clearly demonstrated that
Oct4 expression is insufficient to prevent apoptosis in Nanogdeficient PGCs.
Interestingly, Nanog-null ESCs can self-renew indefinitely with
an undifferentiated status, although they are prone to differentiation,
suggesting that Nanog stabilizes ESCs in culture by resisting or
reversing alternative gene expression programs (Chambers et al.,
2007). Nanog-null ESCs have the potential to generate chimeric
fetuses and adults through multi-lineage differentiation in somatic
cells, indicating that Nanog expression is not required for the
development and maturation of somatic tissues. In germ cells, the
colonization of Nanog-null cells was detected in the PGCs of the
genital ridges of E11.5, but not E12.5, chimeric embryos (Chambers
et al., 2007). This finding differs from our present observation that
Nanog-deficient PGCs start dying due to apoptosis within 48 hours
of Nanog KD during the migrating stages. Survival of the Nanognull PGCs in E11.5 chimeras could be a consequence of
compensation by other transcriptional circuitries acquired in ESC
culture (Chambers et al., 2007). This would explain the discrepancy
that Nanog KD in normal ESC lines induces cell differentiation (Fig.
1E) (Hough et al., 2006), whereas selected Nanog-null ESCs
maintain a capability for self-renewal and pluripotency. Notably,
Nanog is specifically required for the proliferation and survival of
migrating PGCs of wild-type embryos.
Acknowledgements
We thank Dr Tyler Jacks for the pSico vector, Dr Hideki Enomoto for the ER-Cre
transgenic mouse, Dr Masakazu Hattori for the AdCre adenovirus, and Drs
Yoshio Koyanagi and Jun Aoki for instructions for lentivirus manipulation. This
work was partly funded by grants from the Japan Society for the Promotion of
Science, the Ministry of Education, Culture, Sports, Science and Technology
and the Core Research for Evolutional Science and Technology (Japan Science
and Technology Agency) to T.T.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/136/22/4011/DC1
References
Beck, A. R., Miller, I. J., Anderson, P. and Streuli, M. (1998). RNA-binding
protein TIAR is essential for primordial germ cell development. Proc. Natl. Acad.
Sci. USA 95, 2331-2336.
RESEARCH ARTICLE 4019
Chambers, I., Colby, D., Robertson, M., Nichols, J., Lee, S., Tweedie, S. and
Smith, A. (2003). Functional expression cloning of nanog, a pluripotency
sustaining factor in embryonic stem cells. Cell 113, 643-655.
Chambers, I., Silva, J., Colby, D., Nichols, J., Nijmeijer, B., Robertson, M.,
Vrana, J., Jones, K., Grotewold, L. and Smith, A. (2007). Nanog safeguards
pluripotency and mediates germline development. Nature 450, 1230-1234.
Cheng, J. C., Kinjo, K., Judelson, D. R., Chang, J., Wu, W. S., Schmid, I.,
Shankar, D. B., Kasahara, N., Stripecke, R., Bhatia, R. et al. (2008). CREB is
a critical regulator of normal hematopoiesis and leukemogenesis. Blood 111,
1182-1192.
Darr, H., Mayshar, Y. and Benvenisty, N. (2006). Overexpression of NANOG in
human ESCs enables feeder-free growth while inducing primitive ectoderm
features. Development 133, 1193-1201.
Dudley, B. M., Runyan, C., Takeuchi, Y., Schaible, K. and Molyneaux, K.
(2007). BMP signaling regulates PGC numbers and motility in organ culture.
Mech. Dev. 124, 68-77.
Filipowicz, W. (2005). RNAi: the nuts and bolts of the RISC machine. Cell 122, 1720.
Ginsburg, M., Snow, M. H. and McLaren, A. (1990). Primordial germ cells in the
mouse embryo during gastrulation. Development 110, 521-528.
Hart, A. H., Hartley, L., Ibrahim, M. and Robb, L. (2004). Identification, cloning
and expression analysis of the pluripotency promoting Nanog genes in mouse
and human. Dev. Dyn. 230, 187-198.
Hatano, S. Y., Tada, M., Kimura, H., Yamaguchi, S., Kono, T., Nakano, T.,
Suemori, H., Nakatsuji, N. and Tada, T. (2005). Pluripotential competence of
cells associated with Nanog activity. Mech. Dev. 122, 67-79.
Hayashi, K., de Sousa Lopes, S. M. and Surani, M. A. (2007). Germ cell
specification in mice. Science 316, 394-396.
Hayashi, S. and McMahon, A. P. (2002). Efficient recombination in diverse
tissues by a tamoxifen-inducible form of Cre: a tool for temporally regulated
gene activation/inactivation in the mouse. Dev. Biol. 244, 305-318.
Hough, S. R., Clements, I., Welch, P. J. and Wiederholt, K. A. (2006).
Differentiation of mouse embryonic stem cells after RNA interference-mediated
silencing of OCT4 and Nanog. Stem Cells 24, 1467-1475.
Kanegae, Y., Lee, G., Sato, Y., Tanaka, M., Nakai, M., Sakaki, T., Sugano, S.
and Saito, I. (1995). Efficient gene activation in mammalian cells by using
recombinant adenovirus expressing site-specific Cre recombinase. Nucleic Acids
Res. 23, 3816-3821.
Kato, Y., Rideout, W. M., Hilton, K., Barton, S. C., Tsunoda, Y. and Surani, M.
A. (1999). Developmental potential of mouse primordial germ cells.
Development 126, 1823-1832.
Kawase, E., Yamamoto, H., Hashimoto, K. and Nakatsuji, N. (1994). Tumor
necrosis factor-alpha (TNF-alpha) stimulates proliferation of mouse primordial
germ cells in culture. Dev. Biol. 161, 91-95.
Kehler, J., Tolkunova, E., Koschorz, B., Pesce, M., Gentile, L., Boiani, M.,
Lomeli, H., Nagy, A., McLaughlin, K. J., Scholer, H. R. et al. (2004). Oct4 is
required for primordial germ cell survival. EMBO Rep. 5, 1078-1083.
Kim, J., Chu, J., Shen, X., Wang, J. and Orkin, S. H. (2008). An extended
transcriptional network for pluripotency of embryonic stem cells. Cell 132, 10491061.
Koshimizu, U., Taga, T., Watanabe, M., Saito, M., Shirayoshi, Y., Kishimoto,
T. and Nakatsuji, N. (1996). Functional requirement of gp130-mediated
signaling for growth and survival of mouse primordial germ cells in vitro and
derivation of embryonic germ (EG) cells. Development 122, 1235-1242.
Kurimoto, K., Yabuta, Y., Ohinata, Y. and Saitou, M. (2007). Global single-cell
cDNA amplification to provide a template for representative high-density
oligonucleotide microarray analysis. Nat. Protocol 2, 739-752.
Kuroda, T., Tada, M., Kubota, H., Kimura, H., Hatano, S. Y., Suemori, H.,
Nakatsuji, N. and Tada, T. (2005). Octamer and Sox elements are required for
transcriptional cis regulation of Nanog gene expression. Mol. Cell. Biol. 25,
2475-2485.
Lee, T. I., Jenner, R. G., Boyer, L. A., Guenther, M. G., Levine, S. S., Kumar, R.
M., Chevalier, B., Johnstone, S. E., Cole, M. F., Isono, K. et al. (2006).
Control of developmental regulators by Polycomb in human embryonic stem
cells. Cell 125, 301-313.
Li, J., Shen, H., Himmel, K. L., Dupuy, A. J., Largaespada, D. A., Nakamura,
T., Shaughnessy, J. D., Jr, Jenkins, N. A. and Copeland, N. G. (1999).
Leukaemia disease genes: large-scale cloning and pathway predictions. Nat.
Genet. 23, 348-353.
Liang, J., Wan, M., Zhang, Y., Gu, P., Xin, H., Jung, S. Y., Qin, J., Wong, J.,
Cooney, A. J., Liu, D. and Songyang, Z. (2008). Nanog and Oct4 associate
with unique transcriptional repression complexes in embryonic stem cells. Nat.
Cell Biol. 10, 731-739.
Lomeli, H., Ramos-Mejia, V., Gertsenstein, M., Lobe, C. G. and Nagy, A.
(2000). Targeted insertion of Cre recombinase into the TNAP gene: excision in
primordial germ cells. Genesis 26, 116-117.
Loveland, K. L. and Schlatt, S. (1997). Stem cell factor and c-kit in the
mammalian testis: lessons originating from Mother Nature’s gene knockouts. J.
Endocrinol. 153, 337-344.
DEVELOPMENT
Safeguard of PGC survival by Nanog
Matsui, Y., Zsebo, K. and Hogan, B. L. (1992). Derivation of pluripotential
embryonic stem cells from murine primordial germ cells in culture. Cell 70, 841847.
Mitsui, K., Tokuzawa, Y., Itoh, H., Segawa, K., Murakami, M., Takahashi, K.,
Maruyama, M., Maeda, M. and Yamanaka, S. (2003). The homeoprotein
nanog is required for maintenance of pluripotency in mouse epiblast and ES
cells. Cell 113, 631-642.
Miyoshi, H., Blomer, U., Takahashi, M., Gage, F. H. and Verma, I. M. (1998).
Development of a self-inactivating lentivirus vector. J. Virol. 72, 8150-8157.
Mullin, N. P., Yates, A., Rowe, A. J., Nijmeijer, B., Colby, D., Barlow, P. N.,
Walkinshaw, M. D. and Chambers, I. (2008). The pluripotency rheostat
Nanog functions as a dimer. Biochem. J. 411, 227-231.
Norton, J. D., Deed, R. W., Craggs, G. and Sablitzky, F. (1998). Id helix-loophelix proteins in cell growth and differentiation. Trends Cell Biol. 8, 58-65.
O’Bryan, M. K. and de Kretser, D. (2006). Mouse models for genes involved in
impaired spermatogenesis. Int. J. Androl. 29, 76-89; discussion 105-108.
Pan, G. and Thomson, J. A. (2007). Nanog and transcriptional networks in
embryonic stem cell pluripotency. Cell Res. 17, 42-49.
Rodda, D. J., Chew, J. L., Lim, L. H., Loh, Y. H., Wang, B., Ng, H. H. and
Robson, P. (2005). Transcriptional regulation of nanog by OCT4 and SOX2. J.
Biol. Chem. 280, 24731-24737.
Roy, A. and Matzuk, M. M. (2006). Deconstructing mammalian reproduction:
using knockouts to define fertility pathways. Reproduction 131, 207-219.
Runyan, C., Schaible, K., Molyneaux, K., Wang, Z., Levin, L. and Wylie, C.
(2006). Steel factor controls midline cell death of primordial germ cells and is
essential for their normal proliferation and migration. Development 133, 48614869.
Shaw, A. T., Meissner, A., Dowdle, J. A., Crowley, D., Magendantz, M.,
Ouyang, C., Parisi, T., Rajagopal, J., Blank, L. J., Bronson, R. T. et al. (2007).
Sprouty-2 regulates oncogenic K-ras in lung development and tumorigenesis.
Genes Dev. 21, 694-707.
Silva, J., Chambers, I., Pollard, S. and Smith, A. (2006). Nanog promotes
transfer of pluripotency after cell fusion. Nature 441, 997-1001.
Development 136 (23)
Silva, J., Nichols, J., Theunissen, T. W., Guo, G., van Oosten, A. L.,
Barrandon, O., Wray, J., Yamanaka, S., Chambers, I. and Smith, A. (2009).
Nanog is the gateway to the pluripotent ground state. Cell 138, 722-737.
Suzuki, H., Tsuda, M., Kiso, M. and Saga, Y. (2008). Nanos3 maintains the germ
cell lineage in the mouse by suppressing both Bax-dependent and -independent
apoptotic pathways. Dev. Biol. 318, 133-142.
Tsuda, M., Sasaoka, Y., Kiso, M., Abe, K., Haraguchi, S., Kobayashi, S. and
Saga, Y. (2003). Conserved role of nanos proteins in germ cell development.
Science 301, 1239-1241.
Ui-Tei, K., Naito, Y., Zenno, S., Nishi, K., Yamato, K., Takahashi, F., Juni, A.
and Saigo, K. (2008). Functional dissection of siRNA sequence by systematic
DNA substitution: modified siRNA with a DNA seed arm is a powerful tool for
mammalian gene silencing with significantly reduced off-target effect. Nucleic
Acids Res. 36, 2136-2151.
Ventura, A., Meissner, A., Dillon, C. P., McManus, M., Sharp, P. A., Van Parijs,
L., Jaenisch, R. and Jacks, T. (2004). Cre-lox-regulated conditional RNA
interference from transgenes. Proc. Natl. Acad. Sci. USA 101, 10380-10385.
Wang, J., Levasseur, D. N. and Orkin, S. H. (2008). Requirement of Nanog
dimerization for stem cell self-renewal and pluripotency. Proc. Natl. Acad. Sci.
USA 105, 6326-6331.
Wu, Q., Chen, X., Zhang, J., Loh, Y. H., Low, T. Y., Zhang, W., Zhang, W.,
Sze, S. K., Lim, B. and Ng, H. H. (2006). Sall4 interacts with Nanog and cooccupies Nanog genomic sites in embryonic stem cells. J. Biol. Chem. 281,
24090-24094.
Yamaguchi, S., Kimura, H., Tada, M., Nakatsuji, N. and Tada, T. (2005). Nanog
expression in mouse germ cell development. Gene Expr. Patterns 5, 639-646.
Yasuda, S., Tsuneyoshi, N., Sumi, T., Hasegawa, K., Tada, T., Nakatsuji, N.
and Suemori, H. (2006). NANOG maintains self-renewal of primate ES cells in
the absence of a feeder layer. Genes Cells 11, 1115-1123.
Youngren, K. K., Coveney, D., Peng, X., Bhattacharya, C., Schmidt, L. S.,
Nickerson, M. L., Lamb, B. T., Deng, J. M., Behringer, R. R., Capel, B. et al.
(2005). The Ter mutation in the dead end gene causes germ cell loss and
testicular germ cell tumours. Nature 435, 360-364.
DEVELOPMENT
4020 RESEARCH ARTICLE