RESEARCH ARTICLE 3557
Development 136, 3557-3566 (2009) doi:10.1242/dev.036335
BMP7 promotes proliferation of nephron progenitor cells via
a JNK-dependent mechanism
Ulrika Blank*, Aaron Brown, Derek C. Adams, Michele J. Karolak and Leif Oxburgh†
The iterative formation of nephrons during embryonic development relies on continual replenishment of progenitor cells
throughout nephrogenesis. Defining molecular mechanisms that maintain and regulate this progenitor pool is essential to
understanding nephrogenesis in developmental and regenerative contexts. Maintenance of nephron progenitors is absolutely
dependent on BMP7 signaling, and Bmp7-null mice exhibit rapid loss of progenitors. However, the signal transduction machinery
operating downstream of BMP7 as well as the precise target cell remain undefined. Using a novel primary progenitor isolation
system, we have investigated signal transduction and biological outcomes elicited by BMP7. We find that BMP7 directly and rapidly
activates JNK signaling in nephron progenitors resulting in phosphorylation of Jun and ATF2 transcription factors. This signaling
results in the accumulation of cyclin D3 and subsequent proliferation of PAX2+ progenitors, inversely correlating with the loss of
nephron progenitors seen in the Bmp7-null kidney. Activation of Jun and ATF2 is severely diminished in Bmp7-null kidneys,
providing an important in vivo correlate. BMP7 thus promotes proliferation directly in nephron progenitors by activating the JNK
signaling circuitry.
INTRODUCTION
Development of the mammalian permanent kidney, or metanephros,
is initiated at embryonic day (E) 10.5 in the mouse. Reciprocal
interactions between the ureteric bud and the metanephric
mesenchyme, both derivatives of the intermediate mesoderm, drive
and organize the process of kidney development (Dressler, 2006;
Saxén, 1987; Vainio and Lin, 2002). Nephron progenitors, known
collectively as cap mesenchyme, originate from the metanephric
mesenchyme and are induced by the ureteric bud to differentiate,
ultimately giving rise to the epithelial components of the nephron,
the functional unit of the kidney. Cap mesenchyme in turn induces
branching of the ureteric bud, which forms the collecting duct
system of the mature kidney. To sustain nephrogenesis throughout
kidney development, nephron progenitors must continually be
replenished while simultaneously allowing differentiation of new
nephrons. In the developing kidney, the formation of new nephrons
occurs exclusively in the cortical aspect of the organ where cap
mesenchyme is situated adjacent to collecting duct tips. This region,
known as the nephrogenic zone (NZ), can be considered the niche
for nephron progenitors, delicately balancing their fates until
nephrogenesis is complete.
A number of growth factors regulate this balance, including
members of the Wnt family, fibroblast growth factors (FGFs) and
bone morphogenetic proteins (BMPs) (Carroll et al., 2005;
Dudley et al., 1995; Grieshammer et al., 2005; Luo et al., 1995;
Perantoni et al., 2005). BMPs belong to the transforming growth
factor  (TGF) superfamily of cytokines that regulate an array
of cellular processes during development, including proliferation
and differentiation (Massague, 1998). BMPs signal through cell
Department of Molecular Medicine, Maine Medical Center Research Institute,
81 Research Drive, Scarborough, ME 04074, USA.
*Present address: Department of Molecular Medicine and Gene Therapy, Institute of
Laboratory Medicine, Lund University Hospital, Lund, Sweden
†
Author for correspondence ([email protected])
Accepted 26 August 2009
surface serine/threonine kinase receptors, which activate receptorassociated SMAD transcription factors (R-SMADs) through
phosphorylation. TGF and activin signal through R-SMAD2 and
R-SMAD3, whereas BMPs activate R-SMAD1, R-SMAD5 and
R-SMAD8. Upon phosphorylation, R-SMADs form a complex
with SMAD4, resulting in nuclear accumulation and modification
of target gene transcription. Although the SMAD signaling
circuitry is undoubtedly the best characterized to date,
components of the mitogen-activated protein kinase (MAPK)
pathway, most prominently Jun (also known as c-jun) N-terminal
kinases (JNKs) and p38, can be activated by both TGF and
BMPs (Derynck and Zhang, 2003; Massague and Chen, 2000;
Yamaguchi et al., 1995).
In the developing kidney, BMP7 is required for replenishment of
the nephron progenitor compartment during nephrogenesis (Dudley
et al., 1999). Despite normal initiation of metanephric development
and formation of a limited number of nephrons, progenitors are
prematurely depleted in the Bmp7-null mouse, resulting in severe
renal dysplasia (Dudley et al., 1995). Definition of the signaling
events underlying this phenotype is an essential step towards
understanding pathways regulating nephron progenitor renewal.
Surprisingly, we have found that the NZ is essentially unresponsive
to SMAD-mediated transcriptional activation (Blank et al., 2008).
This intriguing finding prompted us to investigate whether alternate
signaling pathways, activated by BMP7, regulate progenitor cell
survival and proliferation. Using a novel system to purify cells from
the NZ of developing kidneys, we have investigated both the
identities of signaling pathways activated by BMP7 in the NZ, and
the biological consequences of this pathway activation. In analogy
with findings made using an in vivo BMP reporter (Blank et al.,
2008), cells isolated from the nephrogenic zone (NZ), collectively
referred to as NZ cells, appear refractory to SMAD-mediated
transcriptional activation. However, BMP7 rapidly activates JNK
signaling, resulting in phosphorylation of both Jun and ATF2.
Furthermore, BMP7 promotes proliferation of PAX2+ nephron
progenitor cells through a mechanism involving TAK1-mediated
JNK activation. In vivo, phosphorylation of both Jun and ATF2 in
DEVELOPMENT
KEY WORDS: Kidney development, Cap mesenchyme, BMP, SMAD, JNK
3558 RESEARCH ARTICLE
MATERIALS AND METHODS
Isolation of nephrogenic zone cells
Quantitative RT-PCR
RNA was extracted using Trizol (Invitrogen) according to manufacturer’s
protocol. Samples were treated with DNase using a DNA-free kit (Ambion).
cDNA synthesis was carried out in the presence of Oligo(dT) using
Superscript II reverse transcriptase (Invitrogen) according to the
manufacturer’s protocol. Quantitative PCRs were performed on a iQ iCycler
using iQ SYBR Green Supermix (Bio-Rad). Each assay was performed in
triplicate and normalized to -actin levels. -actin forward primer,
GGCTGTATTCCCCTCCATCG; reverse primer CCAGTTGGTAACAATGCCATGT. Id1 forward primer, CCTAGCTGTTCGCTGAAGGC;
reverse primer, CTCCGACAGACCAAGTACCAC.
Kidneys from E17.5 embryos were dissected into HBSS (Gibco) and the
capsule was removed. Subsequently kidneys were incubated in PBS
containing 1% pancreatin (Sigma) and 0.25% collagenase A (Roche) for 15
minutes at 37°C on a rocking platform. Cells in suspension were removed;
5 l DNase (Invitrogen) was added together with fetal calf serum (FCS,
HyClone) to a final concentration of 5%. Remaining cell aggregates were
dissociated mechanically by pipetting a few times and then cells were
incubated for another 10 minutes at 37°C on a rocking platform. Cells were
pelleted and washed once in HBSS containing 5% FCS. Before plating cells
were filtered through a 40 m cell strainer (BD Biosciences).
NZCs were stimulated with indicated growth factors. Total protein was
extracted as previously described (Blank et al., 2008). Antibodies against
phosphorylated SMAD1/SMAD5/SMAD8, phosphorylated JNK,
phosphorylated p38, phosphorylated Jun, phosphorylated ATF2, cleaved
caspase-3, cyclin D3 and XIAP were all from Cell Signaling Technology,
anti--tubulin was purchased from Santa Cruz, anti-TAK1 was from
Upstate, anti-TAB1 from ProSci and anti-HA from Covance.
Cell culture
Cells were pre-fixed for 15 minutes in 1% formaldehyde, 0.2%
glutaraldehyde. After brief washing cells were stained in 0.5 mg/ml X-gal
at 37°C overnight.
Nephrogenic zone cells (NZCs) were cultured under serum-free conditions
in keratinocyte SFM (Gibco) supplemented with 2 mM L-glutamine
(Invitrogen), 100 U/ml penicillin (Sigma), 100 g/ml streptomycin (Sigma).
Cells were seeded at a concentration of 0.4-0.6⫻106 cells/ml on plates precoated with fibronectin (BD Biosciences). Recombinant human BMP7
(R&D Systems) was used at a concentration of 50 ng/ml. JNK inhibitor was
purchased from Calbiochem and used at a concentration of 10 M. TAK1
inhibitor was used at a concentration of 0.5 M (Analyticon Discovery).
Dorsomorphin (Sigma) was used at 20 M.
Flow cytometry
Dead cells were excluded by staining with 7-aminoactinomycin D (7-AAD,
Sigma). Samples were collected on a FACSCalibur (BD) and data were
subsequently analyzed using FlowJo software.
Immunofluorescence
Cells were fixed in 4% paraformaldehyde directly in the cell culture well for
15 minutes at room temperature and subsequently permeabilized for 10
minutes in PBS containing 0.3% Triton X-100 (VWR International). Cells
were blocked in PBS containing 5% chicken and/or goat or donkey serum
(Jackson ImmunoResearch). Primary antibodies were diluted in blocking
solution as above at the following dilutions: phospho-SMAD1/SMAD5/
SMAD8, 1:50 (Cell Signaling Technology); phospho-Jun, 1:50 (Cell
Signaling Technology); phospho-histone-H3, 1:100 (Cell Signaling
Technology); Pax8, 1:100 (Proteintech Group); Pax2, 1:100 (Zymed); Ecadherin, 1:50 (BD Transduction Laboratories); Six2, 1:50 (Santa Cruz).
Alexa Fluor 488- and/or 568-conjugated secondary antibodies were used for
detection of labeled cells (Molecular Probes). Nuclei were stained using
DAPI (Molecular Probes).
Immunofluorescence (paraffin-embedded sections)
Paraffin-embedded sections were processed as previously described
(Blank et al., 2008). Sections were blocked in 1⫻ Tris-buffered saline
(TBS) containing 0.1% Tween (Sigma), 1% bovine serum albumin (BSA;
Jackson ImmunoResearch), 5% goat serum (Jackson ImmunoResearch)
for 30 minutes. Incubation with streptavidin-biotin blocking solutions
was carried out according to the manufacturer’s instructions (Vector
Laboratories). Subsequently, sections were incubated for 2 hours at room
temperature in the presence of primary antibodies diluted in blocking
solution as follows: phospho-Jun (1:100), phospho-ATF2 (1:100),
phospho-SMAD1/SMAD5/SMAD8 (1:50), phospho-histone-H3 (1:100),
Pax2 (1:200). Biotinylated dolichos biflorus agglutinin (DBA; Vector
Laboratories) was diluted 1:200. Secondary antibodies were used as
above and Alexa Fluor 488-conjugated streptavidin (Invitrogen) was used
at 1:200. Nuclei were stained using DAPI as above. Sections were
mounted using Vectashield (Vector Laboratories).
Western blots
X-gal staining
Adenoviral vectors and transduction
The previously described dominant-negative kinase-defective form of TAK1
(Yamaguchi et al., 1995) (kindly provided by Jun Ninomya-Tsuji) was
cloned into pENTR D/TOPO (Invitrogen). Subsequently, the Gateway
Technology System (Invitrogen) was used to produce pAd/CMV/V5dnTAK1 for production of adenovirus, according to the manufacturer’s
instructions. Transduction of NZCs was carried out for 36 hours at an MOI
of 50 in fibronectin-coated wells using serum-free medium as described.
Mouse strains
Animal care in accordance with the National Research Council Guide for
the Care and Use of Laboratory Animals was approved by the Institutional
Animal Care and Use Committee of Maine Medical Center.
Statistical analyses
Data were analyzed using Student’s t-test. P<0.05 was considered
significant.
RESULTS
Isolation and characterization of cells derived
from the nephrogenic zone niche
To study signaling pathways that regulate progenitor cell fate
decisions in the developing kidney, an in vitro system for culture
of NZ cells, in isolation from the collecting duct, or inducer, is
required. A protocol for limited enzymatic digestion was devised
to allow dissociation of E17.5 NZ cells with minimal
contamination of cells from collecting ducts and differentiating
nephrons. The identities of cells within the population of single
cells isolated from the outermost layer of the kidney was
determined using reporter mouse strains marking distinct cellular
compartments within the NZ (Fig. 1A). The contribution of
stromal cells was assessed by isolating NZ cells from the stromaspecific Foxd1+/lacZ reporter strain (Hatini et al., 1996). Foxd1+
cells represented 36.4±2.8% of total NZ cells. NZ cells isolated
from Bmp7+/lacZ mice, which specifically express -galactosidase
in cap mesenchyme and collecting duct cells revealed that Bmp7
was actively expressed in 52.7±8.7% of NZ cells. To determine
the contribution of cells either derived from Bmp7-expressing
cells, or actively expressing Bmp7, we analyzed NZ cells isolated
from the Bmp7+/Cre;R26-YFP reporter mouse by flow cytometry
(Fig. 1B). On average, the contribution of YFP was 64.8±5.34%
DEVELOPMENT
the cap mesenchyme of Bmp7-null kidneys is significantly impaired
compared with that in the wild type. We therefore propose that
BMP7 promotes proliferation of nephron progenitors by directly
activating the JNK-Jun-ATF2 signaling axis in these cells. Our
findings translate directly to the phenotype observed in the Bmp7null mouse, providing a novel explanation for the deficiency of
nephron progenitors during kidney development.
Development 136 (21)
RESEARCH ARTICLE 3559
Fig. 1. Characterization of the NZ cell population from E17.5 embryonic kidneys. (A)Schematic representation of the E17.5 mouse kidney
and the major cell populations of the NZ. Cell compartments of mouse reporter strains expressing -galactosidase are shown in blue and YFP is
shown in yellow. CM, cap mesenchyme; CD, collecting duct; NZ, nephrogenic zone. (B)Flow cytometry of NZ cells. (C)Representative flow
cytometry histogram showing 70.7% YFP+ cells among NZ cells from Bmp7+/cre;R26-YFP. (D)Representative flow cytometry revealing <0.04% YFP+
collecting duct cells among NZ cells from HoxB7-Cre;R26-YFP. (E)Intact collecting duct tips of residual kidneys from Bmp7+/lacZ embryos following
NZ cell isolation. The residual kidneys were stained in X-gal solution. LacZ+ collecting ducts are blue. (F)Representative flow cytometry of 7AADstained NZ cells showing 94.8% viable cells. (G)NZ cell purity at harvest. Numbers represent average percentage values ± s.d. YFP indicates positive
cells from Bmp7+/cre;R26-YFP (n3), Bmp7+ cells were calculated from Bmp7+/lacZ (n3), Foxd1+ cells were calculated from Foxd1+/lacZ (n3). 7AAD+
indicates percentage of dead cells (n5). (H)Immunofluorescence (IF) staining of NZ cells following 16 hours of culture. SIX2-labeled cells are shown
in red, nuclei are stained blue with DAPI. Scale bars: 50m. (I)IF staining of NZ cells after 16 hours of culture showing overlap between SIX2 (red)
and PAX2 (green) expression. Insets show individual color channels. DAPI counterstain (blue) shows nuclei. Scale bar: 50m.
(Fig. 1C). The slightly higher contribution of lineage-marked
YFP+ cells was not significantly different from cells actively
expressing Bmp7, but might suggest that NZCs contain a small
proportion of differentiated YFP+/Bmp7– cells. To control for
possible contamination of the NZ cell population with collecting
duct cells that also express Bmp7, we harvested NZ cells from
HoxB7-Cre;R26-YFP mice. HoxB7 is exclusively expressed in
collecting duct cells and consequently YFP is restricted to cells of
the collecting duct lineage. FACS analysis showed less than
0.04% contamination of collecting duct cells in NZ cell
preparations (Fig. 1D). Similarly, X-gal staining of residual
kidneys of Bmp7+/lacZ genotype following enzyme digestion,
DEVELOPMENT
BMP7 in the nephrogenic zone
showed exposed but intact collecting duct tips that were free of
the overlying NZ (Fig. 1E). The viability of NZ cells at harvest,
evaluated by FACS analysis of 7AAD exclusion, was 95% on
average (Fig. 1F).
This represents a novel and efficient method to purify cells of the
E17.5 NZ, essentially in isolation from cells of the collecting duct
(Fig. 1G). Using this purified cell population, we sought to establish
an in vitro model of the progenitor cell niche of the developing
kidney.
Establishing the nephrogenic zone niche in vitro
To evaluate culture conditions that best maintain nephron progenitor
cells in vitro, we evaluated the potential of a number of growth
conditions to maintain actively Bmp7-expressing cells after 24-48
hours of culture. A number of different surface coatings [gelatin
(Sigma), collagen I, collagen IV, matrigel and fibronectin (all from
BD BioSciences)] were tested in combination with different media
[knockout-DMEM 10% serum replacement (Gibco); DMEM 10%
FCS (Hyclone); keratinocyte serum-free (Gibco)]. All combinations
were tested and the combination of fibronectin with keratinocyte
serum-free medium resulted in the most robust maintenance of
Bmp7-expressing cells after 24 and 48 hours of culture. Therefore,
serum-free culture conditions in combination with fibronectin
surface coating were chosen for all subsequent experiments. To
characterize NZ cells following culture, we analyzed a variety of
markers expressed by either undifferentiated cap mesenchyme or
differentiating cells in vivo. The homeobox gene Six2 is expressed
in cap mesenchyme throughout kidney development and is required
for renewal of nephron progenitors (Kobayashi et al., 2008; Self et
al., 2006). SIX2 thus serves as a convenient marker for
undifferentiated nephron progenitors. Immunofluorescence staining
of NZ cells 16 hours after plating revealed a significant portion of
SIX2+ cells similar to the frequency of Bmp7-expressing cells (Fig.
1H), confirming that undifferentiated nephron progenitor cells are
maintained under these culture conditions. The SIX2+ population
was comprised of small rounded cells morphologically distinct from
SIX2– cells, which were flattened and larger. Furthermore, PAX2, a
transcription factor of the paired-box family that is expressed in
condensing mesenchyme in vivo (Dressler and Douglass, 1992),
was robustly expressed among NZ cells (see Fig. S1A in the
supplementary material). Importantly, SIX2+ cells showed
coexpression with PAX2 (Fig. 1I).
Pax8, another member of the paired-box transcription factor
family, is upregulated upon differentiation and tubule formation, and
is downstream of Wnt4 expression (Stark et al., 1994). Using PAX8
as a marker of nephron differentiation, we found that NZ cells
contained a population of differentiated cells with epithelial
morphology that formed scattered clusters after 16 hours of culture
(see Fig. S1B in the supplementary material). In addition, Ecadherin, which is expressed in developing tubules (Vestweber et al.,
1985) was expressed intensely by cells within the epithelial clusters,
strongly suggesting that these cells indeed represent differentiating
cells undergoing epithelialization (see Fig. S1C in the
supplementary material). Interestingly, by filtering the NZ cells at
harvest through a 40 m cell strainer, the majority of PAX8+ and Ecadherin+ cells could be eliminated (see Fig. S1B,C in the
supplementary material). To further enrich for undifferentiated
nephron progenitors we thus incorporated a filtering step before
plating NZ cells.
Taken together, we show that a large population of
undifferentiated nephron progenitors faithfully expressing SIX2 and
PAX2 are contained within the NZ niche culture. Differentiating
Development 136 (21)
cells expressing PAX8 and E-cadherin are confined to cell
aggregates, most of which can be eliminated by filtration at the time
of harvest.
NZ cells are refractory to SMAD-mediated BMP
signaling
The NZ is essentially unresponsive at the transcriptional level to
SMAD-mediated BMP signaling (Blank et al., 2008), yet
paradoxically Bmp7 is absolutely required to sustain nephrogenesis
and continued growth of the kidney during development. In organ
explant studies using BMP reporter mice, the cap mesenchyme is
refractory to exogenous administration of BMP4, whereas stromal
cells respond actively (Blank et al., 2008). To ascertain whether ex
vivo NZ cells respond in the same way to BMP stimulation, we
isolated NZ cells and stimulated them in vitro with BMP7. Western
blot
analysis
revealed
robust
phosphorylation
of
SMAD1/SMAD5/SMAD8, indicating that the SMAD signal
transduction machinery can indeed be activated in NZ cells in vitro
(Fig. 2A). This is further corroborated by immunofluorescence
staining of NZ cells, showing that both SIX2+ and SIX2–
populations exhibited nuclear accumulation of phosphoSMAD1/SMAD5/SMAD8 (Fig. 2B). Furthermore, phosphoSMAD1/SMAD5/SMAD8 could be weakly detected in the NZ by
immunofluorescence staining of wild-type kidney sections at E17.5
(Fig. 2C). To investigate whether the refractory state of the NZ
persisted in vitro at the transcriptional level, we performed
quantitative RT-PCR analysis of Id1 in NZ cells. Upon BMP7
stimulation, Id1 was only marginally upregulated (less than twofold)
in NZ cells in comparison with mouse embryonic fibroblast (MEF)
cells, which exhibited a robust sixfold induction of Id1 under the
same conditions (Fig. 2D). Similarly, NZ cells isolated from the
BMP reporter remained unresponsive to exogenous BMP7, with the
exception of a few scattered cells with stromal or epithelial
morphology, which responded robustly to BMP7 treatment, as
determined by X-gal staining (Fig. 2E). The less than twofold
induction of Id1 observed in NZ cells is therefore probably due to
the response of a minority of differentiating cells and stromal cells.
Thus, our data indicate that SMAD1/SMAD5/SMAD8 can be
activated in cap mesenchyme in vivo and in NZ cells in vitro, but
this does not lead to transcriptional activation of Id1 (or Id2 and Id3,
data not shown). We conclude that NZ cells in vitro recapitulate the
characteristics of BMP signaling in the NZ in vivo. Having verified
this, we next explored alternative signaling pathways activated
downstream of BMP7 using this primary cell culture system.
BMP7 activates the JNK signaling pathway
Members of the TGF superfamily of ligands have previously been
reported to activate MAPK signaling pathways, including both p38
and JNK signaling branches, through a TAK1-mediated mechanism
(Yamaguchi et al., 1995). Interestingly, TAK1 is expressed in the
developing kidney (Jadrich et al., 2003) and western blot analyses
indicate that TAK1, as well as other components involved in
mediating TAK1-signals, such as XIAP and TAB1 (Yamaguchi et
al., 1999), are expressed in NZ cells (Fig. 3A). We therefore
investigated the activation of p38 and JNK pathways in response to
BMP7 in NZ cells. Whereas phosphorylation of p38 was not
significantly changed by BMP7 treatment at any of the time-points
tested (5-30 minutes), JNK isoforms of both 46 kDa and 56 kDa in
size were rapidly activated by BMP7, with signaling peaking at 510 minutes after BMP7 exposure (Fig. 3B). Importantly, activation
of JNK signaling occurred before phosphorylation of
SMAD1/SMAD5/SMAD8, which culminated 20-30 minutes after
DEVELOPMENT
3560 RESEARCH ARTICLE
BMP7 in the nephrogenic zone
RESEARCH ARTICLE 3561
BMP7 exposure, suggesting that JNK activation occurs
independently of SMAD signaling (Fig. 3C). Downstream
transcriptional targets, including both Jun and ATF2 were
phosphorylated within 15-20 minutes after addition of BMP7 (Fig.
3D). BMP7 can thus rapidly and specifically activate the JNK
signaling pathway in NZ cells, resulting in downstream activation
of both Jun and ATF2. To ascertain whether BMP7-mediated
phosphorylation of JNK in NZ cells was dependent on TAK1, we
overexpressed a dominant-negative kinase-defective form of TAK1
(Yamaguchi et al., 1995), by adenoviral transduction. Transduction
efficiency was monitored by flow cytometry using the
corresponding GFP adenoviral vector and reached 55% at 36 hours
(see Fig. S2 in the supplementary material). Following transduction,
cells were stimulated with or without BMP7 for 5-30 minutes, and
the phosphorylation status of JNK was subsequently analyzed by
western blotting. NZ cells transduced with the control GFP vector
exhibited rapid phosphorylation of JNK (Fig. 3E). However,
overexpression of dominant-negative TAK1 resulted in impaired
activation of all JNK isoforms (Fig. 3E), verifying that TAK1 is
indeed required for BMP7-mediated JNK activation in NZ cells.
SIX2+ cells are the primary targets of BMP7induced JNK activation
To further analyze which population of cells within NZ cells
responds to BMP7 by JNK activation, we performed
immunofluorescence co-staining for phosphorylated JNK and SIX2.
In unstimulated NZ cells, limited activation of JNK signaling was
found primarily in the SIX2+ population (Fig. 3F). Upon stimulation
with BMP7, SIX2+ cells exhibited a clear nuclear localization of
phosphorylated JNK. Weak signaling was also found in the
cytoplasm of SIX2– cells. This confirms that the SIX2+ population
of nephrogenic progenitors is the primary target of BMP7-activated
JNK signaling.
BMP7 mediates proliferation of PAX2+ cells
through a TAK1-JNK-dependent mechanism
BMP7 is a maintenance factor for cap mesenchyme (Dudley et al.,
1995). However, in the Bmp7-null kidney, both increased cell death
and decreased renewal of nephron progenitors can be seen (Dudley
et al., 1995; Luo et al., 1995), and a potential role for BMP7 as a
proliferative factor has never been dissociated from its role as a
DEVELOPMENT
Fig. 2. NZ cells recapitulate characteristics of BMPsignaling in the nephrogenic zone. (A)Western blot
analysis of phosphorylated SMAD1/SMAD5/SMAD8 in
NZ cells stimulated with or without 50 ng/ml BMP7 for
30 minutes. NZ cells were pre-incubated overnight with
or without 20M dorsomorphin, a BMP-specific
inhibitor, as indicated. -tubulin was used as a loading
control. (B)IF staining of NZ cells using anti-phosphoSMAD1/SMAD5/SMAD8 (red) in conjunction with antiSIX2 (green). DAPI was used as nuclear stain. NZ cells
were incubated without (i) or with 50 ng/ml BMP7 (ii)
for 30 minutes. Note extensive signaling in both SIX2+
and SIX2– populations. Scale bars: 50m. (C)IF staining
of WT kidney section at E17.5. White lines indicate the
NZ. Phospho-SMAD1/SMAD5/SMAD8 (red); phosphoHH3 (pHH3; green); DAPI (blue) stains nuclei. Note weak
nuclear phospho-SMAD1/SMAD5/SMAD8 throughout
the NZ. Scale bar: 50m. (D)Quantitative RT-PCR of Id1
expression in NZ cells and MEFs stimulated with 50
ng/ml BMP7 for 6 hours. Values are normalized to actin and represented as fold increase relative to
unstimulated cells. Average values ± s.d. (NZ cell, n5;
MEF, n1). (E)NZ cells harvested from BMP-reporter
embryos were stimulated without (i) or with 50 ng/ml
BMP7 (ii) for 16 hours. -galactosidase+ cells (blue)
indicate cells actively responding to BMP by SMADmediated transcriptional activation. Insets show
magnifications of representative fields for each
condition. Black arrows indicate responding galactosidase+ cells with epithelial- or stromal-like
morphology. White arrows denote non-responding
progenitor cells.
3562 RESEARCH ARTICLE
Development 136 (21)
Fig. 3. BMP7 activates JNK signaling in SIX2+
NZ cells. (A)Western blot analysis showing
expression of TAB1, TAK1 and XIAP in NZ cells.
HEK293 cell lysate was used as a positive control
(Blonska et al., 2005; Dan et al., 2004; Ge et al.,
2003). -tubulin shows protein loading.
(B)Western blot analyses of activated JNK and
p38 in NZ cells stimulated with 50 ng/ml BMP7
for 5-30 minutes. -tubulin was used as loading
control. (C)Western blot analysis of
phosphorylated SMAD1/5/8 in NZ cells stimulated
with 50 ng/ml BMP7 for 5-45 minutes. -tubulin
shows protein loading. (D)Western blot analyses
of phosphorylated forms of Jun and ATF2 in NZ
cells stimulated with 50 ng/ml BMP7 for 5-30
minutes. -tubulin was used as loading control.
(E)Western blot analyses of NZ cells transduced
with control GFP- or dominant-negative (dn) TAK1
adenoviral (Ad) vectors. Cells were stimulated
with 50 ng/ml BMP7 for 5-30 minutes and
subsequently analyzed for phosphorylated JNK.
Lane C, unstimulated control. HA-tagged dnTAK1
was detected using anti-HA antibody. -tubulin
was used as loading control. (F)IF staining of
unstimulated NZ cells (i) or stimulated with 50
ng/ml BMP7 for 10 minutes (ii). Phosphorylated
JNK (red), SIX2 (green), DAPI (blue). Arrows
indicate SIX2+ cells, which robustly activate the
JNK pathway upon BMP7 stimulation. Scale bars:
50m.
the protein level after 2 and 6 hours of BMP7 stimulation (Fig. 4D).
This effect was abrogated upon addition of JNK inhibitor (Fig. 4D),
further substantiating a role for BMP7 in promoting proliferation
through the JNK signaling pathway. Addition of BMP7 or JNK
inhibitors did not alter the overall survival of NZ cells, because no
difference in 7AAD uptake was observed upon FACS analyses of
NZ cells (Fig. 4E). Similarly, the abundance of cleaved caspase-3
was not significantly different between treatment groups, although
untreated cells exhibited slightly less cleaved caspase-3 (Fig. 4F). In
summary, these data demonstrate that BMP7, via a JNK-dependent
mechanism, mediates a proliferative signal rather than a survival
signal in SIX2+ NZ cells. Additionally, our data suggest that the
kidney phenotype observed in the Bmp7-null mouse derives from a
JNK-dependent mechanism ultimately leading to a failure of SIX2+
nephron progenitors to proliferate.
Activated Jun and ATF2 localize to cap
mesenchyme in vivo
To investigate the spatial distribution of phosphorylated Jun and
ATF2 within the NZ in vivo, we performed immunofluorescence costaining with DBA lectin, marking collecting ducts, on E17.5 wildtype kidney sections. Cap mesenchyme was identified by costaining adjacent sections with PAX2 and DBA lectin (Fig. 5A,A⬘).
Phosphorylated Jun and ATF2 were both localized in nuclei of cap
mesenchyme cells (Fig. 5B-C⬘). Other cell types, including
collecting ducts and differentiating nephrons, also displayed nuclear
distribution of phosphorylated Jun and ATF2. This is in agreement
with the in vitro data showing activation of JNK signaling in SIX2+
cells upon BMP7 exposure.
DEVELOPMENT
possible survival factor. JNK signaling has previously been
implicated in proliferation, because MEFs deficient in both Jnk1 and
Jnk2 exhibit reduced proliferation (Tournier et al., 2000).
Furthermore, the JNK pathway has previously been reported to
regulate the size of colonies derived from SALL1+ renal progenitors
in vitro (Osafune et al., 2006). To investigate the relationship
between BMP7 and proliferation and to ascertain the role of TAK1mediated JNK activation in mediating this process, we examined the
proliferative response of NZ cells to BMP7. Wild-type NZ cells
were cultured with or without BMP7 in the presence or absence of
a JNK inhibitor or a TAK1 inhibitor for 16-18 hours. Subsequently,
phosphorylated histone H3 (phospho-HH3)-positive mitotic cells
were counted, and numbers were normalized to the total number of
cells in each treatment group. NZ cells cultured in the presence of
BMP7 exhibited a significant increase in the number of proliferating
cells compared with untreated controls (P0.002, Fig. 4A). This
effect was completely abrogated upon addition of either JNK
inhibitor or TAK1 inhibitor, with numbers returning to baseline (Fig.
4A). To determine whether the proliferative effect of BMP7 was
taking place in the progenitor population, PAX2+ phospho-HH3+
cells were quantified (Fig. 4B). Among PAX2+ cells, addition of
BMP7 resulted in an even larger increase of phospho-HH3+ cells,
compared with the total NZ cell population. Addition of inhibitors
of either JNK or TAK1 completely eliminated this effect (Fig. 4B).
Furthermore, immunofluorescence staining of phospho-HH3 in
conjunction with SIX2 revealed that the majority of phospho-HH3+
cells resided within the SIX2+ compartment of NZ cells (Fig. 4C),
although a smaller fraction of SIX2– cells was also proliferative
(data not shown). In addition, cyclin D3 (CCND3) was increased at
BMP7 in the nephrogenic zone
RESEARCH ARTICLE 3563
Fig. 4. BMP7 promotes
proliferation of PAX2+ NZ cells.
(A)Number of mitotic phosphohistone H3 (phospho-HH3)-positive
cells are shown normalized to total
number of cells in each treatment
group. Values represent averages ±
s.e.m. (n3). Analysis was carried
out after 16-18 hours of
stimulation. *P0.002 for control
versus BMP7-treated samples.
**P0.005 for BMP7 treated versus
BMP7+JNK inhibitor or BMP7+TAK1
inhibitor treated samples.
(B)Number of phospho-HH3+
PAX2+ cells normalized to total cell
numbers in each treatment group.
Values represent averages ± s.e.m.
(n3). Analysis was carried out after
16-18 hours of stimulation.
*P0.03 for control versus BMP7treated samples. **P0.006 for
BMP7-treated versus BMP7+JNK
inhibitor-treated samples.
***P0.04 for BMP7-treated versus
BMP7+TAK1 inhibitor-treated
samples. (C)Representative images
of stained NZ cells, revealing that
SIX2+ (red) cells proliferate
(phospho-HH3+, green) after 16-18
hours of BMP7 stimulation. DAPI
stained nuclei are blue. Scale bar:
10m. (D)Western blot analysis of
NZ cells reveals upregulation of
cyclin D3 after 2 and 6 hours of
BMP7 exposure. Addition of JNK
inhibitor eliminates the increase in
cyclin D3 in response to BMP7.
-tubulin was used as loading control. (E)Representative FACS analyses of 7AAD-stained NZ cells following 16-18 hours of stimulation, as
indicated. No significant difference in the contribution of 7AAD+ dead cells could be detected between treatment groups. (F)Western blot
analysis of cleaved caspase-3 in NZ cells following 16-18 hours of stimulation as indicated. -tubulin was used as loading control.
observed in collecting ducts of both wild-type and Bmp7-null
kidneys (Fig. 7A-D), suggesting that other growth factors activate
JNK signaling in cells of the collecting duct lineage. Collectively,
these data confirm that BMP7 is required for proliferation and
proper activation of Jun and ATF2 in cap mesenchyme, whereas
phosphorylation of SMAD1/SMAD5/SMAD8 remains independent
of BMP7.
DISCUSSION
To date, the signaling mechanisms through which BMP7 acts to
maintain nephron progenitors have not been elucidated in detail, and
the precise target cell of BMP7 has furthermore remained undefined.
Using a BMP-reporter mouse, we recently demonstrated that the NZ
is essentially unresponsive to SMAD-mediated transcription in vivo
(Blank et al., 2008). Owing to the strong effect of Bmp7 inactivation
on nephron progenitor maintenance, this surprising finding prompted
us to investigate whether BMP7 acts through a SMAD-independent
signaling mechanism in the NZ. The most extensively described
alternative pathway downstream of TGF and BMP is activation of
MAPK signaling through TGF-activated kinase 1 (TAK1)
(Yamaguchi et al., 1995). Activation of p38 and JNK pathways have
both been reported downstream of TAK1 (Hanafusa et al., 1999;
Shirakabe et al., 1997; Yamaguchi et al., 1995), and immortalized
DEVELOPMENT
Reduced proliferation and decreased activation of
Jun and ATF2 in Bmp7-null kidneys
The phenotype of Bmp7-null mice manifests at or around E14,
before which induction and development proceeds relatively
normally (Dudley et al., 1995; Luo et al., 1995). Furthermore, there
is no detectable difference in apoptosis between wild-type and
Bmp7-null kidneys before E13.5 (Dudley and Robertson, 1997). To
study a potential role for BMP7 as a proliferative factor in vivo
before the onset of the overt phenotype, we compared the number of
mitotic cells per kidney section from three separate individuals of
each wild-type and Bmp7-null genotype at E12.5. The number of
mitotic cells within metanephric mesenchyme was significantly
reduced in Bmp7-null kidneys, supporting the in vitro findings that
BMP7 functions as a proliferative growth factor (Fig. 6A).
Furthermore, immunofluorescence co-staining with anti-phosphoSMAD1/SMAD5/SMAD8 revealed a significant amount of nuclear
phospho-SMAD1/SMAD5/SMAD8 in both wild-type and Bmp7null kidneys (Fig. 6B), suggesting that a failure to activate SMADmediated signaling is not the causative factor behind the
proliferative defect of cap mesenchyme in the Bmp7-null kidney. By
contrast, phosphorylation of Jun and ATF2 was severely impaired
specifically in cap mesenchyme adjacent to collecting duct tips of
Bmp7-null kidneys (Fig. 7A-D). Activation of Jun and ATF2 was
Fig. 5. Activated Jun and ATF2 localize to cap mesenchyme in the
E17.5 kidney. Representative IF staining of E17.5 WT kidneys. DAPI
counterstain shows nuclei (blue). (A,A’) Pax2 (red), DBA lectin (green).
PAX2+ DBA– cells indicate cap mesenchyme (CM) adjacent to DBA+
collecting duct (CD) tips. (B,B’) Phosphorylated Jun (red); DBA lectin
(green). (C,C’) Phosphorylated ATF2 (red); DBA lectin (green). Nuclear
staining of both activated Jun and ATF2 is present in cap mesenchyme
adjacent to collecting duct tips. NZ, nephrogenic zone; RV, renal vesicle.
Scale bars: 50m.
Tak1 mutant embryonic fibroblasts exhibited impaired
phosphorylation of JNK (Shim et al., 2005). Mice deficient in Tak1
die at mid-gestation (Jadrich et al., 2006; Shim et al., 2005),
precluding analysis of TAK1-mediated signaling in metanephric
kidney development. However, TAK1 is expressed in the NZ of the
developing kidney, suggesting that activation of MAPK signaling
downstream of BMPs might occur in this region of the kidney
(Jadrich et al., 2003) (and this study). Previous work by Hu and
colleagues indicate that BMP7 can activate p38 signaling in
collecting duct cells in vitro (Hu et al., 2004). Similarly, conditional
deletion of Bmp7 using a podocyte-specific Cre, resulted in defective
p38 signaling, but no effect on phosphorylation of
SMAD1/SMAD5/SMAD8 was observed (Kazama et al., 2008).
Using our primary cell purification system, we found no evidence
that BMP7 activates p38 in the NZ. Instead, several JNK isoforms
were rapidly phosphorylated in response to BMP7, resulting in
downstream phosphorylation of both Jun and ATF2. Importantly, we
show that TAK1 is required for efficient activation of JNK in
response to BMP7. SIX2 immunostaining shows that JNK activation
takes place directly in the nephron progenitor compartment,
indicating that these cells indeed do respond directly to BMP7.
Interestingly, phosphorylated forms of the JNK-activated
transcription factors Jun and ATF2 are both localized to cap
mesenchyme in the developing E17.5 kidney. Furthermore, E12.5
Bmp7-null kidneys displayed sharply reduced JNK-Jun-ATF2
signaling in metanephric mesenchyme compared with the wild type,
demonstrating that Bmp7 is required for activation of this signaling
axis in nephron progenitors in vivo. Interestingly, phosphorylation of
Jun or ATF2 does not appear to be significantly reduced in collecting
duct cells of Bmp7-deficient embryos, suggesting that other growth
factors function to activate the pathway in this cellular compartment.
JNK protein kinases are encoded by three genes: Jnk1, Jnk2 and
Jnk3. Mice lacking genes encoding individual JNK family members
are viable, but compound mutants of Jnk1 and Jnk2 exhibit defects
in neural tube closure and brain abnormalities and die at midgestation (Kuan et al., 1999; Sabapathy et al., 1999). Interestingly,
Development 136 (21)
Fig. 6. Decreased proliferation but maintained phosphorylation
of SMAD1/SMAD5/SMAD8 in Bmp7-null kidneys. (A)Number of
mitotic phospho-HH3+ cells per kidney section at E12.5 (n3). Values
are shown as average ± s.d. Phospho-HH3+ cells in collecting ducts
were excluded. Bmp7-null kidneys exhibit a significant reduction in
phospho-HH3+ cells compared with WT littermates (P0.005).
(B)Representative IF staining of E12.5 WT (i) and Bmp7-null (ii) kidneys.
Phospho-HH3+ (green); phospho-SMAD1/SMAD5/SMAD8 (red); DAPI
stained nuclei (blue). Kidneys are outlined with a dashed line.
Arrowheads indicate mitotic phospho-HH3+/phospho-SMAD1/SMAD5/
SMAD8+ cells. Note the absence of phospho-HH3+ cells in the Bmp7null kidney. Scale bars: 50m.
Jnk1–/– Jnk2+/– mutants develop to term but exhibit a number of
developmental defects, including deformed renal epithelial cells and
nephrons (Weston et al., 2003). The majority of mutant animals die
within 48 hours of birth, presumably because of kidney defects.
There is thus a clear precedent for the role of JNK in kidney
development, and further analysis of JNK compound mutants
conditionally deleted within cap mesenchyme comprises an
interesting area for future research.
A role for BMP7 as a proliferative factor and as a survival factor
have both been proposed, but never distinguished from each other.
Our data indicate that BMP7 promotes proliferation of NZ cells in
culture through a signaling mechanism dependent on both TAK1
and JNK. Importantly, the majority of proliferating cells reside
within the SIX2+ compartment, confirming that BMP7-induced JNK
activation directly promotes proliferation of nephron progenitors. A
role for JNK signaling in proliferation is well established in vitro:
MEF cells deficient in both Jnk1 and Jnk2 exhibit decreased
proliferative capacity (Tournier et al., 2000). Similarly, primary
embryonic fibroblasts derived from Jun-null embryos display
greatly reduced growth in vitro, indicating that Jun might mediate
the proliferative signal downstream of JNK1 and JNK2 (Johnson et
al., 1993). In vivo, Jun deficiency results in mid-gestation lethality
before formation of the NZ (Hilberg et al., 1993; Johnson et al.,
1993), and the role of this transcription factor in nephron progenitor
maintenance has not been studied. However, conditional deletion of
Jun in the liver results in impaired hepatocyte proliferation and
decreased liver regeneration upon partial hepatectomy (Behrens et
DEVELOPMENT
3564 RESEARCH ARTICLE
BMP7 in the nephrogenic zone
RESEARCH ARTICLE 3565
Fig. 7. Impaired activation of Jun and ATF2 in Bmp7 null kidneys.
Representative IF staining of E12.5 (A,A’,C,C’) WT and (B,B’,D,D’)
Bmp7-null kidneys. (A-B’) Phospho-Jun (red). (C-D’) Phospho-ATF2
(red). Arrows indicate regions of intense nuclear staining. Asterisks
indicate collecting duct tips. MM, metanephric mesenchyme. DAPI
stained nuclei are blue. Scale bars: 50m.
al., 2002). Interestingly, conditional deletion of Smad4 specifically
in Bmp7-expressing cells does not lead to impaired proliferation in
the developing kidney (Oxburgh et al., 2004), implying that BMP7mediated SMAD signaling is unlikely to be responsible for the
proliferative defect observed in the Bmp7-null kidney. Furthermore,
podocyte-specific deletion of Bmp7 results in a growth defect of
nephrons and a reduction in Ki67+ proliferating cells in proximal
tubules (Kazama et al., 2008). BMP7 thus appears to promote
proliferation in several cell types during kidney development. An
interesting avenue for future studies will be conditional deletion of
Tak1 and Jun in the SIX2+ compartment.
D-type cyclins function to couple extracellular signals to the cell
cycle machinery, and are induced by growth factor stimulation in
early G1 (Sherr, 1995). Our data show that cyclin D3 is upregulated
at the protein level by BMP7 through a JNK-dependent mechanism
in vitro. Interestingly, Jun has previously been linked to regulation
of cyclin D1 expression (Bakiri et al., 2000). JNK-dependent
accumulation of cyclin D3 upon BMP7 stimulation is therefore
probably dependent on Jun, although the exact mechanism for this
remains to be determined.
Recently, Brunskill and colleagues published a comprehensive
atlas of gene expression within the developing mouse kidney
(Brunskill et al., 2008). We compared expression of components of
the BMP signaling pathway between cap mesenchyme and renal
vesicle, the first morphologically distinct stage of nephron
differentiation. Interestingly, Jnk2 was downregulated as cap
mesenchyme progressed through the renal vesicle stage. By contrast,
expression of Id4 and Bambi, known SMAD-responsive BMP target
genes, increased as cells advanced to the renal vesicle stage. This
corroborates our findings, and indicates that there might be a
qualitative switch in the response to BMP stimulation from JNKmediated signaling to SMAD-mediated signaling in the transition
from nephron progenitor to differentiated renal vesicle (Fig. 8). This
is furthermore reflected in in vivo BMP reporter activation: SMADdependent transcription is silent in cap mesenchyme, but increases
in strength from the renal vesicle stage onwards (Blank et al., 2008).
Although we could not detect a robust transcriptional response of
Id1 upon BMP7 stimulation, our data does not exclude alternative
functions of SMAD proteins within the progenitor compartment. We
found that SMAD1/SMAD5/SMAD8 could be activated in NZ cells
in vitro following BMP7 stimulation, but that this did not lead to
transcriptional activation. This data is in agreement with
immunostaining of E17.5 kidneys showing weak activation of
SMAD1/SMAD5/SMAD8 in the NZ but no downstream
transcriptional response as analyzed in the BMP reporter mouse.
Whether SMAD and JNK signaling pathways cooperate or
negatively regulate each other remains to be investigated, but such
a mechanism has been shown for SMAD2 (Pessah et al., 2001) and
it is conceivable that a similar mechanism is in place for
SMAD1/SMAD5/SMAD8.
In summary, we have analyzed the signaling mechanism, target
cells and functional significance of BMP7 during kidney
development. We show that BMP7 functions to activate the JNKJun-ATF2 signaling axis directly in SIX2+ cap mesenchyme, leading
to a proliferative signal through upregulation of cyclin D3.
DEVELOPMENT
Fig. 8. Model of BMP7 signaling in the NZ. BMP7 preferentially
functions through the JNK signaling pathway to promote proliferation
in the nephron progenitor compartment. The SMAD machinery is silent
at the transcriptional level in cap mesenchyme, but becomes
increasingly activated as cells progress to the renal vesicle stage and
beyond.
Acknowledgements
This work was supported by R01 DK078161 from NIDDK (L.O.), a Norman S.
Coplon extramural grant from Satellite Healthcare (L.O.), and postdoctoral
fellowships from the Wenner-Gren Foundations of Sweden and Kungliga
Fysiografiska Sällskapet, Lund, Sweden (U.B.). Additional support was provided
by Maine Medical Center Research Institute core facilities for Histopathology,
Bioinformatics and FACS (supported by 2P20RR18789-06) and the MMCRI
Animal Facility. Deposited in PMC for release after 12 months.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/136/21/3557/DC1
References
Bakiri, L., Lallemand, D., Bossy-Wetzel, E. and Yaniv, M. (2000). Cell cycledependent variations in c-Jun and JunB phosphorylation: a role in the control of
cyclin D1 expression. EMBO J. 19, 2056-2068.
Behrens, A., Sibilia, M., David, J. P., Mohle-Steinlein, U., Tronche, F., Schutz,
G. and Wagner, E. F. (2002). Impaired postnatal hepatocyte proliferation and
liver regeneration in mice lacking c-jun in the liver. EMBO J. 21, 1782-1790.
Blank, U., Seto, M. L., Adams, D. C., Wojchowski, D. M., Karolak, M. J. and
Oxburgh, L. (2008). An in vivo reporter of BMP signaling in organogenesis
reveals targets in the developing kidney. BMC Dev. Biol. 8, 86.
Blonska, M., Shambharkar, P. B., Kobayashi, M., Zhang, D., Sakurai, H., Su,
B. and Lin, X. (2005). TAK1 is recruited to the tumor necrosis factor-alpha (TNFalpha) receptor 1 complex in a receptor-interacting protein (RIP)-dependent
manner and cooperates with MEKK3 leading to NF-kappaB activation. J. Biol.
Chem. 280, 43056-43063.
Brunskill, E. W., Aronow, B. J., Georgas, K., Rumballe, B., Valerius, M. T.,
Aronow, J., Kaimal, V., Jegga, A. G., Grimmond, S., McMahon, A. P. et al.
(2008). Atlas of gene expression in the developing kidney at microanatomic
resolution. Dev. Cell 15, 781-791.
Carroll, T. J., Park, J. S., Hayashi, S., Majumdar, A. and McMahon, A. P.
(2005). Wnt9b plays a central role in the regulation of mesenchymal to epithelial
transitions underlying organogenesis of the mammalian urogenital system. Dev.
Cell 9, 283-292.
Dan, H. C., Sun, M., Kaneko, S., Feldman, R. I., Nicosia, S. V., Wang, H. G.,
Tsang, B. K. and Cheng, J. Q. (2004). Akt phosphorylation and stabilization of
X-linked inhibitor of apoptosis protein (XIAP). J. Biol. Chem. 279, 5405-5412.
Derynck, R. and Zhang, Y. E. (2003). Smad-dependent and Smad-independent
pathways in TGF-beta family signalling. Nature 425, 577-584.
Dressler, G. R. (2006). The cellular basis of kidney development. Annu. Rev. Cell
Dev. Biol. 22, 509-529.
Dressler, G. R. and Douglass, E. C. (1992). Pax-2 is a DNA-binding protein
expressed in embryonic kidney and Wilms tumor. Proc. Natl. Acad. Sci. USA 89,
1179-1183.
Dudley, A. T. and Robertson, E. J. (1997). Overlapping expression domains of
bone morphogenetic protein family members potentially account for limited
tissue defects in BMP7 deficient embryos. Dev. Dyn. 208, 349-362.
Dudley, A. T., Lyons, K. M. and Robertson, E. J. (1995). A requirement for bone
morphogenetic protein-7 during development of the mammalian kidney and
eye. Genes Dev. 9, 2795-2807.
Dudley, A. T., Godin, R. E. and Robertson, E. J. (1999). Interaction between FGF
and BMP signaling pathways regulates development of metanephric
mesenchyme. Genes Dev. 13, 1601-1613.
Ge, B., Xiong, X., Jing, Q., Mosley, J. L., Filose, A., Bian, D., Huang, S. and
Han, J. (2003). TAB1beta (transforming growth factor-beta-activated protein
kinase 1-binding protein 1beta), a novel splicing variant of TAB1 that interacts
with p38alpha but not TAK1. J. Biol. Chem. 278, 2286-2293.
Grieshammer, U., Cebrian, C., Ilagan, R., Meyers, E., Herzlinger, D. and
Martin, G. R. (2005). FGF8 is required for cell survival at distinct stages of
nephrogenesis and for regulation of gene expression in nascent nephrons.
Development 132, 3847-3857.
Hanafusa, H., Ninomiya-Tsuji, J., Masuyama, N., Nishita, M., Fujisawa, J.,
Shibuya, H., Matsumoto, K. and Nishida, E. (1999). Involvement of the p38
mitogen-activated protein kinase pathway in transforming growth factor-betainduced gene expression. J. Biol. Chem. 274, 27161-27167.
Hatini, V., Huh, S. O., Herzlinger, D., Soares, V. C. and Lai, E. (1996). Essential
role of stromal mesenchyme in kidney morphogenesis revealed by targeted
disruption of Winged Helix transcription factor BF-2. Genes Dev. 10, 1467-1478.
Hilberg, F., Aguzzi, A., Howells, N. and Wagner, E. F. (1993). c-jun is essential
for normal mouse development and hepatogenesis. Nature 365, 179-181.
Hu, M. C., Wasserman, D., Hartwig, S. and Rosenblum, N. D. (2004).
p38MAPK acts in the BMP7-dependent stimulatory pathway during epithelial
cell morphogenesis and is regulated by Smad1. J. Biol. Chem. 279, 1205112059.
Jadrich, J. L., O’Connor, M. B. and Coucouvanis, E. (2003). Expression of TAK1,
a mediator of TGF-beta and BMP signaling, during mouse embryonic
development. Gene Expr. Patterns 3, 131-134.
Development 136 (21)
Jadrich, J. L., O’Connor, M. B. and Coucouvanis, E. (2006). The TGF beta
activated kinase TAK1 regulates vascular development in vivo. Development
133, 1529-1541.
Johnson, R. S., van Lingen, B., Papaioannou, V. E. and Spiegelman, B. M.
(1993). A null mutation at the c-jun locus causes embryonic lethality and
retarded cell growth in culture. Genes Dev. 7, 1309-1317.
Kazama, I., Mahoney, Z., Miner, J. H., Graf, D., Economides, A. N. and
Kreidberg, J. A. (2008). Podocyte-derived BMP7 is critical for nephron
development. J. Am. Soc. Nephrol. 19, 2181-2191.
Kobayashi, A., Valerius, M. T., Mugford, J. W., Carroll, T. J., Self, M., Oliver,
G. and McMahon, A. P. (2008). Six2 defines and regulates a multipotent selfrenewing nephron progenitor population throughout mammalian kidney
development. Cell Stem Cell 3, 169-181.
Kuan, C. Y., Yang, D. D., Samanta Roy, D. R., Davis, R. J., Rakic, P. and Flavell,
R. A. (1999). The Jnk1 and Jnk2 protein kinases are required for regional specific
apoptosis during early brain development. Neuron 22, 667-676.
Luo, G., Hofmann, C., Bronckers, A. L., Sohocki, M., Bradley, A. and
Karsenty, G. (1995). BMP-7 is an inducer of nephrogenesis, and is also required
for eye development and skeletal patterning. Genes Dev. 9, 2808-2820.
Massague, J. (1998). TGF-beta signal transduction. Annu. Rev. Biochem. 67, 753791.
Massague, J. and Chen, Y. G. (2000). Controlling TGF-beta signaling. Genes Dev.
14, 627-644.
Osafune, K., Takasato, M., Kispert, A., Asashima, M. and Nishinakamura, R.
(2006). Identification of multipotent progenitors in the embryonic mouse kidney
by a novel colony-forming assay. Development 133, 151-161.
Oxburgh, L., Chu, G. C., Michael, S. K. and Robertson, E. J. (2004). TGFbeta
superfamily signals are required for morphogenesis of the kidney mesenchyme
progenitor population. Development 131, 4593-4605.
Perantoni, A. O., Timofeeva, O., Naillat, F., Richman, C., Pajni-Underwood,
S., Wilson, C., Vainio, S., Dove, L. F. and Lewandoski, M. (2005).
Inactivation of FGF8 in early mesoderm reveals an essential role in kidney
development. Development 132, 3859-3871.
Pessah, M., Prunier, C., Marais, J., Ferrand, N., Mazars, A., Lallemand, F.,
Gauthier, J. M. and Atfi, A. (2001). c-Jun interacts with the corepressor TGinteracting factor (TGIF) to suppress Smad2 transcriptional activity. Proc. Natl.
Acad. Sci. USA 98, 6198-6203.
Sabapathy, K., Jochum, W., Hochedlinger, K., Chang, L., Karin, M. and
Wagner, E. F. (1999). Defective neural tube morphogenesis and altered
apoptosis in the absence of both JNK1 and JNK2. Mech. Dev. 89, 115-124.
Saxén, L. (1987). Organogenesis of the Kidney. Cambridge: Cambridge University
Press.
Self, M., Lagutin, O. V., Bowling, B., Hendrix, J., Cai, Y., Dressler, G. R. and
Oliver, G. (2006). Six2 is required for suppression of nephrogenesis and
progenitor renewal in the developing kidney. EMBO J. 25, 5214-5228.
Sherr, C. J. (1995). D-type cyclins. Trends Biochem. Sci. 20, 187-190.
Shim, J. H., Xiao, C., Paschal, A. E., Bailey, S. T., Rao, P., Hayden, M. S., Lee,
K. Y., Bussey, C., Steckel, M., Tanaka, N. et al. (2005). TAK1, but not TAB1 or
TAB2, plays an essential role in multiple signaling pathways in vivo. Genes Dev.
19, 2668-2681.
Shirakabe, K., Yamaguchi, K., Shibuya, H., Irie, K., Matsuda, S., Moriguchi,
T., Gotoh, Y., Matsumoto, K. and Nishida, E. (1997). TAK1 mediates the
ceramide signaling to stress-activated protein kinase/c-Jun N-terminal kinase. J.
Biol. Chem. 272, 8141-8144.
Stark, K., Vainio, S., Vassileva, G. and McMahon, A. P. (1994). Epithelial
transformation of metanephric mesenchyme in the developing kidney regulated
by Wnt-4. Nature 372, 679-683.
Tournier, C., Hess, P., Yang, D. D., Xu, J., Turner, T. K., Nimnual, A., Bar-Sagi,
D., Jones, S. N., Flavell, R. A. and Davis, R. J. (2000). Requirement of JNK for
stress-induced activation of the cytochrome c-mediated death pathway. Science
288, 870-874.
Vainio, S. and Lin, Y. (2002). Coordinating early kidney development: lessons
from gene targeting. Nat. Rev. Genet. 3, 533-543.
Vestweber, D., Kemler, R. and Ekblom, P. (1985). Cell-adhesion molecule
uvomorulin during kidney development. Dev. Biol. 112, 213-221.
Weston, C. R., Wong, A., Hall, J. P., Goad, M. E., Flavell, R. A. and Davis, R. J.
(2003). JNK initiates a cytokine cascade that causes Pax2 expression and closure
of the optic fissure. Genes Dev. 17, 1271-1280.
Yamaguchi, K., Shirakabe, K., Shibuya, H., Irie, K., Oishi, I., Ueno, N.,
Taniguchi, T., Nishida, E. and Matsumoto, K. (1995). Identification of a
member of the MAPKKK family as a potential mediator of TGF-beta signal
transduction. Science 270, 2008-2011.
Yamaguchi, K., Nagai, S., Ninomiya-Tsuji, J., Nishita, M., Tamai, K., Irie, K.,
Ueno, N., Nishida, E., Shibuya, H. and Matsumoto, K. (1999). XIAP, a
cellular member of the inhibitor of apoptosis protein family, links the receptors
to TAB1-TAK1 in the BMP signaling pathway. EMBO J. 18, 179-187.
DEVELOPMENT
3566 RESEARCH ARTICLE