DEVELOPMENT AND DISEASE
RESEARCH ARTICLE 3347
Development 136, 3347-3356 (2009) doi:10.1242/dev.032979
Mig-6 is required for appropriate lung development and to
ensure normal adult lung homeostasis
Nili Jin1, Sung-Nam Cho1, M. Gabriela Raso2, Ignacio Wistuba2, Yvonne Smith3, Yanan Yang2,
Jonathan M. Kurie2, Rudolph Yen2, Christopher M. Evans4, Thomas Ludwig5, Jae-Wook Jeong1
and Francesco J. DeMayo1,*
Mitogen-inducible gene 6 [Mig-6; Errfi1 (ErbB receptor feedback inhibitor 1); RALT (receptor-associated late transducer); gene 33] is
a ubiquitously expressed adaptor protein containing CRIB, SH3 and 14-3-3 interacting domains and has been shown to negatively
regulate EGF signaling. Ablation of Mig-6 results in a partial lethal phenotype in which surviving mice acquire degenerative joint
diseases and tumors in multiple organs. We have determined that the early lethality in Mig-6–/– mice occurs in the perinatal period,
with mice displaying abnormal lung development. Histological examination of Mig-6–/– lungs (E15.5-P3) revealed reduced septation,
airway over-branching, alveolar type II cell hyperplasia, and disturbed vascular formation. In neonatal Mig-6–/– lungs, cell
proliferation increased in the airway epithelium but apoptosis increased in the blood vessels. Adult Mig-6–/– mice developed
features of chronic obstructive pulmonary disease (COPD); however, when Mig-6 was inducibly ablated in adult mice (Mig-6d/d), the
lungs were normal. Knockdown of MIG-6 in H441 human bronchiolar epithelial cells increased phospho-EGFR and phospho-AKT
levels as well as cell proliferation, whereas knockdown of MIG-6 in human lung microvascular endothelial (HMVEC-L) cells
promoted their apoptosis. These results demonstrate that Mig-6 is required for prenatal and perinatal lung development, in part
through the regulation of EGF signaling, as well as for maintaining proper pulmonary vascularization.
INTRODUCTION
Lung development requires the appropriate integration of
extracellular signaling and transcriptional regulation to ensure that
appropriate morphological architecture and cellular differentiation
occur to allow development of a fully functional organ (Perl and
Whitsett, 1999). Although lung development is completed during
the neonatal period, appropriate neonatal lung development is
crucial for the formation of fully functional adult lungs (Shi et al.,
2007). Dysfunctional lung development results in a higher
propensity towards adult lung diseases, including chronic
obstructive pulmonary disease (COPD), asthma and cystic fibrosis
(Shi et al., 2007). Using mouse model systems, numerous pathways
have been identified as regulating neonatal lung development.
Mouse lung development is precisely regulated by a number of
spatially and temporally expressed growth factors and transcription
factors (Warburton et al., 2000), which regulate the growth and
differentiation of all compartments of the lung including the
epithelium, stroma and vasculature. Among the essential factors,
epidermal growth factor (EGF) signaling is important for both earlyand late-stage lung development (Kramer et al., 2007; Le Cras et al.,
2004; Miettinen et al., 1997). Ablation of epidermal growth factor
receptor (EGFR) leads to reduced lung branching and altered
epithelial cell differentiation (Sibilia and Wagner, 1995).
1
Department of Molecular and Cellular Biology, Baylor College of Medicine,
Houston, TX 77030, USA. 2Department of Thoracic/Head and Neck Medical
Oncology, University of Texas, M.D. Anderson Cancer Center, Houston, TX 77030,
USA. 3Institute of Immunology, NUI Maynooth, Co. Kildare, Ireland. 4Department of
Pulmonary Medicine, The University of Texas M.D Anderson Cancer Center,
Houston, TX 77030, USA. 5Institute for Cancer Genetics, Columbia University Health
Science Division, Columbia University, New York, NY 10027, USA.
*Author for correspondence ([email protected])
Accepted 26 July 2009
Overexpression of TGFα, an EGFR ligand, in the perinatal lung
disrupts alveolarization and vascularization, leading to lung fibrosis
in the adult (Korfhagen et al., 1994; Kramer et al., 2007; Le Cras et
al., 2004; Le Cras et al., 2003). EGF can also activate the
downstream signaling pathways RAS-PI3K/AKT and RAS/MAPK
(Copland and Post, 2007; Kling et al., 2006; Uzumcu et al., 2002;
Wang et al., 2005), and can cross-talk with other growth factors,
such as TGFβ1 (Ding et al., 2007) and human growth hormone
(HGF) signaling (Chess et al., 1998), all of which are important for
lung development.
Vascularization, which is driven by growth factors and
transcription factors, occurs at all stages of lung development
(Warburton et al., 2000). Among the growth factors, VEGF plays a
central role in vasculogenesis and angiogenesis (Shibuya, 2008). In
addition, the angiopoietin-TIE system is crucial for the development
and maturation of the vascular system (Augustin et al., 2009). Lung
morphogenesis is heavily dependent on proper vascularization. Both
inhibition of neovascularization (Schwarz et al., 2000) and overvasculogenesis (Zeng et al., 1998) disrupt branching morphogenesis
of the lung. Furthermore, epithelial-endothelial interactions are
required for perinatal lung development, and loss of such cross-talk
results in the arrest of septation and alveolarization (DeLisser et al.,
2006; Yamamoto et al., 2007). Here, we have identified the adaptor
protein encoded by mitogen-inducible gene 6 [Mig-6; Errfi1 (ErbB
receptor feedback inhibitor 1); RALT (receptor-associated late
transducer); gene 33], a potential regulator of intracellular signaling,
as a crucial regulator of vascularization and lung development.
MIG-6 is a ubiquitously expressed scaffold protein found in
vertebrates but not in lower organisms (Zhang and Vande Woude,
2007). Mig-6 can be induced by a number of factors, including
growth factors (Anastasi et al., 2003; Chu et al., 1988; Fiorentino et
al., 2000; Hackel et al., 2001; Pante et al., 2005), hormones (Jeong
et al., 2009; Kent et al., 1994; Lee et al., 1985; Xu D. et al., 2005),
cytokines (Ferby et al., 2006; Zhang et al., 2005) and stress stimuli
DEVELOPMENT
KEY WORDS: Mitogen-inducible gene 6 (Mig-6), Gene ablation, Lung development, EGF signaling, Vascularization
3348 RESEARCH ARTICLE
MATERIALS AND METHODS
Animals
All animal protocols were approved by the Animal Care and Use Committee
of Baylor College of Medicine. Mig-6–/– mice were generated by crossing
Mig-6+/– mice as previously described (Jin et al., 2007). To induce the
ablation of Mig-6 in adult mice, Rosa26-Cre-ERT2 mice (de Luca et al.,
2005) were crossed with Mig-6flox/flox mice (Jin et al., 2007) and the resulting
Rosa26-Cre-ERT2; Mig-6flox/flox or Mig-6flox/flox mice (2 months old) were
injected peritoneally with 1 mg of tamoxifen for 5 days. These mice were
further maintained for 4 months before analysis. The midday of vaginal plug
identification was considered E0.5 and the day when neonates were born
was considered P1. Mice after weaning were considered as adult (AD).
Genotyping of pups or embryos by PCR was as previously described (Jin et
al., 2007).
Quantitative real-time PCR
Total RNA was isolated from frozen lung tissue or cultured cells using Trizol
reagent (Invitrogen, Carlsbad, CA, USA). The RNA samples were treated
with DNaseI (Sigma, St Louis, MO, USA) to remove any genomic DNA
contamination. One microgram of the RNA was reverse transcribed into
cDNA using M-MLV (Invitrogen) in a 20-μl volume. Quantitative real-time
PCR for quantification of mRNAs encoding MIG-6, EGF, HbEGF, AREG,
CCSP and 18S rRNA was performed using TaqMan probes and SYBR
Green Master Mix (Applied Biosystems, Foster City, CA, USA). Additional
primer and probe sequences are listed in Table 1.
Table 1. Primer sequences for real-time PCR
Gene
Sequence (5⬘ to 3⬘)
Vegfa
F: CTGTACCTCCACCATGCCAAGT
R: CTTCGCTGGTAGACATCCATGA
Vegfc
F: GCATGAACACCAGCACAGGT
R: GTGATTGGCAAAACTGATTGTGAC
Vegfd (Figf)
F: TTCAGGAGCGAACATGGACC
R: AAACTAGAAGCTGCTCGGATCTG
angiopoietin 1
F: GGCAACAAGGTACAGGGAGCTA
R: TCAGGCACTGCTCTTCCAATAC
angiopoietin 2
F: GGAGATCAAGGCCTACTGTGACA
R: CTTTCCACGTCCTCTGGAAGTC
SP-C (Sftpc)
F: ACGACGACCACGAATTCCTG
R: CCTCCCAACTACATGGTGGTG
T1α (Pdpn)
F: TCAAAGCATCTGCCTTTGGAA
R: ACTGTCTTGGCTTTGCTCCATT
Muc5ac
F: AGAATATCTTTCAGGACCCCTGCT
R: ACACCAGTGCTGAGCATACTTTT
P: CTCAGCGTGGAGAATG
F, forward; R, reverse; P, probe.
Antibodies
Rabbit anti-MIG-6, monoclonal anti-α-tubulin, peroxidase-labeled goat
anti-rabbit IgG and peroxidase-labeled rabbit anti-mouse IgG were from
Sigma. Rabbit anti-EGFR and anti-AKT antibodies were from Santa Cruz
(Santa Cruz Biotech, Santa Cruz, CA, USA). Rabbit anti-phospho-EGFR
(Tyr1173), anti-phospho-AKT (Ser473), anti-mTOR, anti-phospho-mTOR
(Ser2448) and anti-cleaved caspase 3 antibodies were from Cell Signaling
(Danvers, MA, USA). Rabbit anti-CCSP antibody was from this laboratory.
Rabbit anti-pro-SP-C antibody was from Seven Hills (Cincinnati, OH,
USA). Monoclonal anti-MAC3 antibody was from Becton Dickinson
(Franklin Lakes, NJ, USA). Monoclonal anti-PECAM1 antibody was from
Pharmingen (San Diego, CA, USA). Rabbit anti-α-SMA antibody was from
Abcam (Cambridge, MA, USA). Rabbit anti-phospho-histone H3 antibody
was from Upstate (Charlottesville, VA, USA).
Western blot
Western blot analysis was carried out using standard protocols. Lung tissue
or cultured cells were homogenized in protein lysis buffer (10 mM Tris-HCl
pH 7.5, 5 mM EDTA, 50 mM NaCl, 0.1% NP40, 1 mM PMSF, 10 μg/ml
aprotonin, 10 μg/ml leupeptin). Thirty micrograms of protein was
electrophoresed on an SDS-PAGE gel and transferred to PVDF membrane.
The membranes were blotted with ~1:1000-1:2000 rabbit anti-MIG-6, antiEGFR, anti-phospho-EGFR, anti-AKT, anti-phospho-AKT, anti-mTOR,
anti-phospho-mTOR, or monoclonal anti-α-tubulin antibodies. After
washing, the membranes were probed with peroxidase-labeled goat antirabbit IgG (1:2000) or rabbit anti-mouse IgG (1:5000). Bands were detected
using ECL Reagent (Amersham, Piscataway, NJ, USA) followed by
exposure to X-ray film.
Histology
Lungs were dissected from embryos, neonates or adult mice and
immediately fixed in buffered formalin at 4°C overnight and processed for
paraffin embedding. Histological analysis was performed on 5-μm sections.
Hematoxylin and Eosin (H&E), Periodic Acid Schiff (PAS), and Masson’s
trichrome staining were performed according to standard protocols.
Immunohistochemistry and immunofluorescent staining
Sections were de-paraffinized, rehydrated, and steamed in 1:10 Antigen
Unmasking Solution (Dako, Carpinteria, CA, USA) or in EDTA (1 mM
pH 8.0) and TE (10 mM Tris, 1 mM EDTA, pH 9.0) solutions for 20
minutes. Sections were then incubated with 3% H2O2 in methanol for 15
minutes to quench the endogenous peroxidase. After blocking the slides with
Biotin-Avidin Blocking Reagent (Dako) and 10% normal goat serum, or
DEVELOPMENT
(Kent et al., 1994; Makkinje et al., 2000; Xu et al., 2006). Five
functional regions have been identified in the MIG-6 protein and
include a threonine/serine phosphorylation region, an SH3-binding
domain, a CDC42/RAC interaction and binding (CRIB) domain, a
14-3-3-binding domain, and the EGFR-binding domain (Fiorentino
et al., 2000; Makkinje et al., 2000). MIG-6 can negatively modulate
EGF signaling (Anastasi et al., 2003; Anastasi et al., 2005; Ballaro
et al., 2005; Ferby et al., 2006; Fiorentino et al., 2000; Xu D. et al.,
2005), either by inhibiting the auto-phosphorylation of EGFR
(Ferby et al., 2006) or by binding to GRB2 (immediately upstream
of RAS) (Fiorentino et al., 2000), to dampen the downstream
pathways.
Mig-6 has been shown to be a tumor suppressor gene in the lung
(Ferby et al., 2006; Zhang et al., 2007). The MIG-6 locus
(chromosome 1p36) is frequently associated with lung cancer in
humans (Tseng et al., 2005). Downregulation of Mig-6 has been
found in lung squamous cell cancer and lung adenocarcinoma
(Amatschek et al., 2004). Mutations in Mig-6 have been identified
in primary lung cancer and in lung tumor cell lines (Ferby et al.,
2006; Korfhagen et al., 1994; Tseng et al., 2005; Zhang et al., 2007).
The mechanism of Mig-6 action in lung tumorigenesis has not been
fully elucidated, but may be attributed to the abnormal
overactivation of EGFR or HGF signaling (Ferby et al., 2006; Pante
et al., 2005). Whether Mig-6 is involved in other lung diseases
remains to be determined.
We and others recently demonstrated that genomic disruption of
the Mig-6 gene leads to degenerative joint diseases, skin and lung
cancer, and gastrointestinal tract tumors in mice (Ferby et al., 2006;
Jin et al., 2007; Zhang et al., 2007). Furthermore, 50% of the Mig6–/– mice die before adolescence, although the cause of the lethality
is not known. Here, we identify the time at which the lethality occurs
as during the neonatal period of lung development. Histological
analysis of Mig-6–/– mice revealed a phenotype similar to that of
transgenic mice with conditional expression of TGFα in the distal
lungs. Both strains show altered alveolarization and vascularization
of the lungs. Signaling pathway analysis showed that Mig-6–/– mice
have altered expression of EGF signaling and vascularization genes.
This demonstrates that Mig-6 is a crucial regulator of pulmonary
development and vascularization.
Development 136 (19)
Mig-6 function in lung development
Cell proliferation and apoptosis analysis
Proliferating and apoptotic cells were detected with rabbit anti-phosphohistone H3 (1:2000) and anti-cleaved caspase 3 (1:100). For quantification
of the proliferating cells on neonatal lungs, images (20⫻ magnification)
were taken of the entire left lung of four Mig-6+/+ and four Mig-6–/– mice.
Cells positive for phospho-histone H3 were counted from different lung
compartments, including airway epithelium, mesenchyme, blood vessels
and alveoli. The ratio of proliferating to total cells in each compartment was
then calculated.
Determination of alveolar airspace size, number of primitive
alveoli and number of alveolar septa
The size of the alveolar airspace was determined by measuring mean chord
lengths on H&E-stained lung sections (Bry et al., 2007). Images were taken
at 40⫻ from five representative non-overlapping fields of lungs from at least
eight mice. A grid consisting of six lines at 35-μm intervals was overlaid on
the image. Areas of bronchiolar airways and blood vessels were eliminated
from the analysis. The length of lines overlapping the alveoli was measured
and averaged to give the mean chord length of the alveolar space.
The number of primitive alveoli and secondary alveolar septa was
determined on H&E-stained E18.5 and P3 lung sections, respectively. Three
E18.5 Mig-6+/+ and Mig-6–/– mice and six P3 Mig-6+/+ and Mig-6–/– mice
were used and at least six images (40⫻) were taken randomly from those
lung sections. Primitive alveoli of E18.5 lungs were identified as the pouches
or sacs with flattened epithelium that radiate from the terminal airways.
Secondary septa on P3 lungs were identified as the thin membranes that
folded into the alveolar sac.
RNAi
H441 human bronchiolar epithelial cells (National Cancer Institute,
Frederick, MD, USA) were grown in RPMI 1640 medium until they
achieved 40% confluency. Human lung microvascular endothelial cells
(HMVEC-L; Lonza, Walkersville, MD, USA) were maintained in
Endothelial Cell Medium containing human EGF, hydrocortisone, GA1000, FBS, VEGF, human FGFB (FGF2), R3-IGF1 and ascorbic acid
(Lonza) until they reached 60% confluency. The cells were transfected with
50 nM control siRNA or SMARTpool of human MIG-6 siRNA
(Dharmacon, Chicago, IL, USA) in serum-free Opti-MEM (Invitrogen) for
6 hours. Opti-MEM was then removed and fresh growth medium added.
After 24 hours, the siRNA treatment was repeated and cells were cultured
for 48 hours.
MTT cell proliferation assay
MTT assays were performed on siRNA-treated H441 and HMVEC-L cells
in 24-well plates following standard protocols. Briefly, upon siRNA
treatment, 75 μl of Dye Solution (Promega, Madison, MI, USA) were added
directly to each well. After incubation at 37°C for 4 hours, 500 μl of
Solubilization Solution (Promega) were added and mixed well, and A570
measured with a spectrometer.
Statistics
Values are expressed as mean ± s.e.m. Student’s t-test was used for
comparison of two group averages. When there were more than two groups,
one-way ANOVA followed by least significance difference (LSD) or Tukey
analysis was carried out. n≥3 and statistical significance P≤0.05.
RESULTS
Mig-6–/– mice have a high neonatal mortality
Only 12% of the mice weaned from Mig-6+/– breeding cages were
Mig-6–/– (see Table 2). This represents less than half of the expected
Mendelian ratio (Jin et al., 2007). In order to determine the time
point at which the lethality occurs in Mig-6–/– mice, we examined
the genotype of mice resulting from Mig-6+/– breedings at E15.5E18.5, P3 and P28. The results of the genotyping of these progeny,
as shown in Table 2, demonstrate that prior to birth, the frequency
of Mig-6–/– was 23%, which is consistent with the expected
Mendelian ratio. However, the frequency of Mig-6–/– mice fell to
9.3% after birth. This indicated that the loss of Mig-6–/– mice
occurred in the neonatal period.
Examination of neonatal Mig-6–/– mice showed that these animals
were smaller than normal: average birth weight was only 77% of the
average birth weight of their Mig-6+/– and Mig-6+/+ littermates (Fig.
1A,B). Most Mig-6–/– pups were less active and less capable of
feeding, as shown by the lack of milk in their stomachs (Fig. 1A,
arrows). Although their lungs inflated well with air at birth (Fig. 1C),
many Mig-6–/– mice became cyanotic shortly before death (Fig. 1A).
These results suggest that compromised lung development might be
a contributing factor to the neonatal lethality of Mig-6–/– mice.
Mig-6 is differentially expressed during lung
development
Prior to investigating the pulmonary phenotype of these mice, the
expression and distribution pattern of Mig-6 during development
was investigated (Fig. 2A). Quantitative real-time PCR results
showed that Mig-6 mRNA is expressed at relatively low levels in the
lungs during the embryonic stage (E13.5-E18.5). Mig-6 mRNA
levels were significantly higher in the wild-type than Mig-6–/– lungs,
indicating that although low, there is still detectable expression of
Mig-6 at E13.5. After birth, Mig-6 mRNA expression was
dramatically, but transiently, upregulated from P1 to P3. By P4, Mig6 mRNA expression decreased to levels equivalent to those at E18.5,
which were then maintained until the adult stage (Fig. 2A). Dual
immunofluorescence staining of MIG-6 with an alveolar type II cell
marker, surfactant protein C (SP-C; SFTPC – Mouse Genome
Informatics), and a Clara cell-specific marker, Clara cell secretory
protein (CCSP; SCGB1A1), revealed MIG-6 expression to be
ubiquitous in E18.5 and P3 lungs, being highly expressed in airway
Table 2. Mig-6–/– mice exhibit high neonatal lethality
Genotype n (%)
Age
P28
P3
E15.5-18.5
Mig6+/+
Mig6+/–
Mig6–/–
Total n
75 (32.3)
34 (39.5)
16 (30.8)
129 (55.6)
44 (51.2)
24 (46.1)
28 (12.1)
8 (9.3)
12 (23.1)
232
86
52
DEVELOPMENT
Mouse-on-Mouse Blocking Reagent (M.O.M.; Vector Laboratories,
Burlingame, CA, USA), the slides were incubated with primary antibodies
in blocking buffer at 4°C overnight. Dilutions of primary antibodies were as
follows: rabbit anti-CCSP (1:3000), goat anti-pro-SP-C (1:1200),
monoclonal anti-MAC3 (1:500), rabbit anti-α-SMA (1:500), rabbit antiAKT (1:100), rabbit anti-phospho-AKT (1:100), rabbit anti-mTOR (1:500)
and rabbit anti-phospho-mTOR (1:500). The slides were washed with PBS
containing 0.2% Triton X-100 (PBST) and then incubated with 1:200
biotinylated goat anti-rabbit IgG or biotinylated rabbit anti-mouse IgG
(Vector Laboratories). After washing, the slides were incubated with
Vectastain Elite ABC Reagent (Vector Laboratories) and developed with
DAB reagent (Vector Laboratories) followed by counterstaining with
Hematoxylin.
Immunofluorescent staining was performed on paraffin-embedded
sections using the Tyramide Signal Amplification (TSA) system
(PerkinElmer, Waltham, MA, USA). The slides were blocked with TSA
Blocking Reagent and incubated with rabbit anti-MIG-6 (1:500), antipro-SP-C (1:1200), anti-CCSP (1:3000), anti-EGFR (1:100), antiphospho-EGFR (1:100), monoclonal anti-PECAM1 (1:200), and rabbit
anti-α-SMA (1:500) at 4°C overnight. After washing with PBST, the
slides were incubated with 1:200 biotinylated goat anti-rabbit IgG or
rabbit anti-mouse IgG (Vector Laboratories). Streptavidin-HRP (1:200)
was then applied to the slides. Thereafter, tetramethylrhodamine or
Fluorescein (1:100 in TSA amplification diluents) was used to detect the
specific signals. Nuclei were stained with DAPI. For dual
immunofluorescence staining, images from the red, green and blue
channels were overlaid using Photoshop 8.0.
RESEARCH ARTICLE 3349
3350 RESEARCH ARTICLE
Development 136 (19)
multiple secondary septa (arrows), whereas few secondary septa
were found in the Mig-6–/– alveoli (Fig. 3G,H). Quantification
showed that the mean number of primitive alveoli per terminal
airway in E18.5 Mig-6+/+ lungs was 3.89±0.53, whereas in Mig-6–/–
lungs it was 1.92±0.22 (P=0.02, Fig. 3I). The mean number of
secondary septa per alveolar sac in P3 Mig-6+/+ lungs was
4.96±0.16, whereas in Mig-6–/– lungs it was 2.67±0.11 (P<0.001,
Fig. 3J).
epithelial cells (Fig. 2B-G, arrows) and alveolar type II cells (Fig.
2K-P, arrows). In P3 lungs, MIG-6 was also expressed in pericytes
surrounding blood vessels and muscle cells surrounding airways, as
indicated by dual immunofluorescence staining of MIG-6 with
smooth muscle α-actin (α-SMA) (see Fig. S1 in the supplementary
material). In adult lungs, MIG-6 was mainly expressed in the airway
epithelium and in alveolar type II cells, and less so in other structures
(Fig. 2H-J,Q-S).
Perinatal Mig-6–/– mice exhibit altered lung
architecture
Histological analysis of Mig-6+/+ and Mig-6–/– mouse lungs (E18.5
and P3) was performed to determine the impact of the ablation of
Mig-6 on lung architecture. By E18.5, Mig-6+/+ mouse lungs have
formed multiple pods that end with sac-like structures on the
terminal airways indicative of the formation of the primitive
alveoli. By contrast, Mig-6–/– lungs (E18.5) exhibited a much less
complex lung structure (Fig. 3A,B). High-magnification images
show that the representative terminal airway of the Mig-6+/+ mouse
has 6-7 well-formed primitive alveoli, whereas the Mig-6–/– airway
has only two (Fig. 3C,D, arrows). By P3, Mig-6+/+ mouse lungs
have formed well-inflated alveoli and the mesenchyme has thinned
out. However, the Mig-6–/– lungs exhibited smaller and compressed
alveoli and the mesenchyme remained thick (Fig. 3E,F). Highmagnification images show that Mig-6+/+ alveoli have developed
Mig-6–/– neonates exhibit over-branching and
airway epithelial and alveolar type II cell
hyperplasia
In order to further investigate the impact of Mig-6 ablation on
pulmonary architecture and epithelial cell differentiation, the
expression of CCSP and SP-C was assayed by
immunohistochemistry in the lungs of P3 Mig-6+/+ and Mig-6–/–
mice (Fig. 4). Staining of the large airways showed that whereas
Mig-6+/+ mice had normal airway architecture and expression of
CCSP, Mig-6–/– mice developed over-branched large airways (Fig.
4A,B). Examination of smaller airways demonstrated normal
morphology in Mig-6+/+ mice, with airways lined with CCSPexpressing cells, whereas the small airways of the Mig-6–/– mice
showed an irregular morphology with hyperplastic CCSP-positive
epithelium (Fig. 4C,D). Examination of the distal lungs by pro-SPC staining showed hyperplasia of alveolar type II cells in neonatal
Mig-6–/– mouse lungs, with multiple alveolar type II cells at the
antrum to the alveoli (Fig. 4E,F).
Abnormal vascular formation in prenatal and
neonatal Mig-6–/– mouse lungs
In order to determine the affect of Mig-6 on pulmonary
vascularization, we examined the morphology and histology of Mig6–/– lungs at E15.5 and P3. Macroscopically, E15.5 Mig-6–/– lungs
were much smaller and of a paler color compared with Mig-6+/+
lungs. Whereas Mig-6+/+ lungs showed well-developed blood vessels
on all lobes, blood vessels were rarely discernible in Mig-6–/– lungs
(Fig. 5A,B). Immunofluorescent staining of PECAM1 at P3 showed
that Mig-6–/– lungs had much weaker staining than the wild type. The
endothelium formed a continuous layer close to the alveolar surfaces
of Mig-6+/+ lungs, whereas in Mig-6–/– lungs the endothelium was
deeply embedded in the mesenchyme and appeared discontinuous
Fig. 2. Differential expression of Mig-6 during lung development. (A) Quantitative real-time RT-PCR of Mig-6 mRNA levels (normalized to 18S
rRNA) in wild-type lungs from E13.5 through to P10 and in adult (3 months old, AD). The first lane shows the absence of Mig-6 mRNA in adult
Mig-6–/– lungs. *P<0.05 versus E18.5; #P<0.05 versus Mig-6–/–. (B-J) Dual immunofluorescence staining of MIG-6 and CCSP in E18.5 (B-D), P3.5
(E-G) and 2-month-old (H-J) mouse lungs. Clara cells are indicated by arrows. (K-S) Dual immunofluorescence staining of MIG-6 and SP-C in E18.5
(K-M), P3.5 (N-P) and 2-month-old (Q-S) mouse lungs. Type II cells are indicated by arrows. Scale bars: 50 μm in B-J; 100 μm in K-S.
DEVELOPMENT
Fig. 1. Loss of Mig-6 expression results in high neonatal
mortality. (A) Mig-6+/+ (left) and Mig-6–/– (right) newborn mice. Arrow
indicates stomach (left, with milk). (B) Relative birth weight of Mig-6+/+,
Mig-6+/– and Mig-6–/– pups (*P<0.05). (C) The floating lung assay for
Mig-6+/+ and Mig-6–/– newborns indicating that Mig-6–/– lungs inflate
well with air at birth.
Mig-6 function in lung development
RESEARCH ARTICLE 3351
Fig. 3. Perinatal Mig-6–/– mice exhibit altered lung architecture. (A-H) H&E-stained lung sections from E18.5 (A-D) and P3 (E-H) Mig-6+/+ and
Mig-6–/– mice. The boxed areas in A,B are shown at high magnification in C,D, respectively. Scale bars: 100 μm in A-D; 500 μm in E,F; 200 μm in
G,H. Primitive alveoli are indicated by arrows in A-D; alveolar septa are indicated by arrows in G,H. (I) Quantification of primitive alveoli in terminal
airways in E18.5 Mig-6+/+ and Mig-6–/– mouse lungs. *P<0.05. (J) Quantification of secondary septa in alveolar sacs in Mig-6+/+ and Mig-6–/– mouse
lungs. ***P<0.001.
Abnormal cell proliferation and apoptosis in
neonatal Mig-6–/– mouse lungs
In order to investigate the reasons for the interruption of lung
development in Mig-6–/– mice, we examined the cell proliferation
and apoptosis status of Mig-6–/– mouse lungs at P3. In Mig-6+/+
lungs, proliferating cells were commonly found in blood vessels
(Fig. 6C, arrows) but rarely in the bronchial epithelium (Fig. 6A,
arrow). However, in Mig-6–/– lungs, proliferating cells were
frequently found in the bronchial epithelium (Fig. 6B, arrows), but
less so in the blood vessels (Fig. 6D). Quantification of the
Fig. 4. Mig-6–/– neonates exhibit over-branching and airway
epithelial and alveolar type II cell hyperplasia. (A-D) CCSPimmunostaining of P3 Mig-6+/+ proximal (A) and distal (C) airways, and
of Mig-6–/– proximal (B) and distal (D) airway epithelium. (E,F) Pro-SP-C
immunostaining of P3 Mig-6+/+ (E) and Mig-6–/– (F) lungs. Boxed areas
are shown at high magnification in the insets. Scale bars: 100 μm.
proliferating cells in four compartments of the lung, comprising
airway, mesenchyme, blood vessel and alveoli, showed that the
number of proliferating cells was increased 3-fold in the airways,
but decreased by 66% in the blood vessels of Mig-6–/– as compared
with Mig-6+/+ lungs (Fig. 6E). As for cell survival, very few cells
stained for cleaved caspase 3 in the Mig-6+/+ lungs. By contrast,
apoptotic cells were frequently found in the airway epithelium,
blood vessels, mesenchyme and alveolar septa of Mig-6–/– lungs
(Fig. 6F-K, arrows).
Altered pulmonary morphology in adult Mig-6–/–
but not Mig-6d/d mice
In order to investigate whether altered lung development in Mig6–/– mice impacted adult lung structure and cell differentiation, we
examined the morphological changes in 3-month-old adult Mig6–/– lungs. Histological examination of the lungs of Mig-6–/– mice
(Fig. 7A) showed enlargement of the alveolar spaces as compared
with the Mig-6+/+ mice, which was confirmed by quantification
(Fig. 7B). Papillary hyperplastic proliferation was observed in the
airway epithelium of Mig-6–/– mice (Fig. 7C,D). Masson’s
trichrome staining showed a significant increase in extracellular
matrix deposition around the bronchi, around the blood vessels, in
the alveolar interstitia and in the plural membranes of Mig-6–/–
mice (Fig. 7E-H). Mig-6–/– lungs also showed an increase in
macrophage invasion (Fig. 7I,J) and mucous cell metaplasia (Fig.
7K,L). These phenotypes indicate the development of COPD in
adult Mig-6–/– mice, which was not asthma as there was no airway
contraction.
To determine whether this pulmonary phenotype in adult mice
was a result of the developmental defect, we conditionally ablated
Mig-6 in the adult mouse using a ubiquitously expressed CreErT2
mouse model (de Luca et al., 2005). Rosa26-Cre-ERT2/+; Mig6flox/flox (Mig-6d/d) and Mig-6flox/flox (Mig-6f/f) mice were treated with
tamoxifen and their lungs analyzed 4 months after the Mig-6
conditional ablation. Immunofluorescence staining and quantitative
real-time PCR both showed that Mig-6 expression was successfully
ablated in the adult Mig-6d/d mouse lung (Fig. 8A,B,G). In addition
to the lung, other tissues, including the liver, uterus and mammary
gland, also showed efficient ablation of Mig-6 (data not shown).
H&E staining showed that Mig-6f/f and Mig-6d/d mice both had
normal lung structure (Fig. 8C,D) and normal alveolar spaces (Fig.
8H). PAS staining did not detect mucosal cells in Mig-6f/f or Mig-6d/d
lungs (Fig. 8E,F). Quantitative real-time PCR showed that Mig-6–/–
DEVELOPMENT
with the alveolar surface (Fig. 5C,D). Immunohistochemistry for
α-SMA indicated that blood vessels were well developed in the
Mig-6+/+, but not in the Mig-6–/–, lungs (Fig. 5E,F).
3352 RESEARCH ARTICLE
Development 136 (19)
Since the lungs of the Mig-6d/d mice were normal, the COPD
phenotype in the adult Mig-6–/– mice can be attributed to the
developmental defects.
lungs exhibited altered expression of lung molecular markers
including SP-C, CCSP, T1α (PDPN) and MUC5AC, all of which
were normal in Mig-6d/d lungs (see Fig. S2 in the supplementary
material). Although there was no visible pulmonary phenotype,
these mice demonstrated the dermal papilomas and uterine
hyperplasia previously described (Jin et al., 2007). This confirmed
the efficiency of the ablation of Mig-6 (data not shown) and the
presence of a phenotype in tissues that undergo dynamic changes.
Increased epithelial cell proliferation and
endothelial cell apoptosis upon Mig-6 knockdown
To investigate the roles of Mig-6 in different lung cell types, we
performed siRNA studies on human H441 bronchiolar epithelial
cells and HMVEC-L lung microvascular endothelial cells. No
mutation was found in the MIG-6 gene of the H441 cell line by
Fig. 6. Abnormal cell proliferation and
apoptosis in neonatal Mig-6–/– mouse
lungs. (A-D) Phospho-histone H3
immunostaining of P3 Mig-6+/+ (A,C) and
Mig-6–/– (B,D) mouse lungs. The boxed
areas in A,B are shown at high
magnification in C,D, respectively.
Proliferating cells are indicated by arrows in
A-D. (E) Percentage of proliferating cells in
different lung compartments. *P<0.05.
(F-K) Cleaved caspase 3 immunostaining of
P3 Mig-6+/+ (F,H,J) and Mig-6–/– (G,I,K)
mouse lungs in the upper airways (F,G),
blood vessels (H,I) and alveoli (J,K; arrows
indicate alveolar septa). Scale bars: 50 μm.
DEVELOPMENT
Fig. 5. Abnormal vascular formation in prenatal and neonatal
Mig-6–/– mouse lungs. (A,B) Whole lungs from E15.5 Mig-6+/+ (A) and
Mig-6–/– (B) mice. Arrows indicate blood vessels. (C,D) PECAM1
immunostaining (red) of P3 Mig-6+/+ (C) and Mig-6–/– (D) lungs. Nuclei
are stained with DAPI (blue). (E,F) α-SMA immunostaining of P3 Mig6+/+ (E) and Mig-6–/– (F) lungs. Blood vessels are indicated by arrows.
Scale bars: 2 mm in A,B; 50 μm in C-F.
Increased EGF signaling but decreased expression
of angiogenetic genes in neonatal Mig-6–/– mouse
lungs
The morphological changes of the Mig-6–/– mouse lungs are highly
consistent with those exhibited by transgenic mice in which TGFα
is overexpressed perinatally (Korfhagen et al., 1994; Kramer et al.,
2007; Le Cras et al., 2004; Le Cras et al., 2003). Therefore, we
examined whether Mig-6 regulates lung development through the
modulation of EGF signaling. As shown in Fig. 9, there was no
major difference in the expression of total EGFR, AKT and mTOR
between the Mig-6+/+ and Mig-6–/– mouse lungs. However, phosphoEGFR (Fig. 9D), phospho-AKT (Fig. 9H) and phospho-mTOR (Fig.
9L) were all increased in the airway epithelium and alveoli of Mig6–/– as compared with Mig-6+/+ lungs. Western blot analysis
confirmed the increase in phospho-AKT and phospho-mTOR in the
Mig-6–/– lungs (Fig. 9M). Quantitative real-time PCR revealed that
expression of the genes encoding EGF, AREG and HbEGF, which
are all ligands for EGFR, was significantly increased in Mig-6–/– as
compared with Mig-6+/+ lungs (Fig. 9N). These results suggest that
Mig-6 might regulate lung morphogenesis through the regulation of
EGF signaling, probably through an autocrine/paracrine mechanism.
Because Mig-6–/– mouse lungs also exhibited reduced
vascularization, we examined the expression of angiogenetic genes,
including those that encode VEGF-A, VEGF-C, VEGF-D (FIGF),
angiopoietin 1 and angiopoietin 2, by quantitative real-time PCR.
All these angiogenetic genes were downregulated in the Mig-6–/– as
compared with Mig-6+/+ lungs (Fig. 9N).
Mig-6 function in lung development
RESEARCH ARTICLE 3353
Fig. 7. Altered pulmonary morphology
in adult Mig-6–/– mice. (A) Alveolar
morphology of 3-month-old Mig-6+/+ and
Mig-6–/– lungs by H&E staining. (B) Mean
alveolar chord length (μm) of 3-month-old
Mig-6+/+ (n=13) and Mig-6–/– (n=12) lungs.
*P<0.05. (C,D) H&E-stained lungs from
1-month-old Mig-6+/+ (C) and Mig-6–/– (D)
lungs. (E-H) Masson’s trichrome staining of
proximal airways (E,F) and alveoli (G,H) of
3-month-old Mig-6+/+ (E,G) and Mig-6–/–
(F,H) lungs. (I,J) MAC3 (LAMP2)
immunostaining of 3-month-old Mig-6+/+ (I)
and Mig-6–/– (J) lungs. Arrow in J, crystal
secreted by macrophage (K,L) PAS staining
of 3-month-old Mig-6+/+ (K) and Mig-6–/– (L)
lungs. Br, bronchiol; Vs, blood vessels; Is,
interstitium; Pl, plural membrane. Scale bars:
100 μm in A,E-L; 50 μm in C,D.
Fig. 8. Normal pulnomary morphology in adult Mig-6d/d mice.
(A,B) Immunofluorescent staining of MIG-6 (green) in Mig-6f/f and Mig6d/d lungs. Nuclei were stained with DAPI (blue). (C,D) H&E staining of
Mig-6f/f and Mig-6d/d lungs. (E,F) PAS staining of Mig-6f/f and Mig-6d/d
lungs. (G) Mig-6 mRNA levels in Mig-6+/+, Mig-6–/–, Mig-6f/f and Mig6d/d lungs as determined by quantitative real-time PCR. **P<0.01 and
***P<0.001 versus Mig-6+/+ lungs. (H) Mean alveolar chord length (μm)
of Mig-6f/f and Mig-6d/d lungs. Scale bars: 50 μm.
in apoptosis in the MIG-6 siRNA-treated HMVEC-L cells (Fig.
10E). No difference was found in the number of phospho-histone
H3-stained HMVEC-L cells or cleaved caspase 3-stained H441 cells
upon MIG-6 knockdown (data not shown). Therefore, knocking
down MIG-6 expression increased EGF signaling and cell
proliferation in epithelial cells, but elevated apoptosis in endothelial
cells.
DISCUSSION
Over the last 10 years, Mig-6 has drawn increased attention for its
role in stress responses and tumorigenesis (Anastasi et al., 2005;
Ferby et al., 2006; Jeong et al., 2009; Makkinje et al., 2000; Xu et
al., 2006; Zhang et al., 2005). As of yet, however, there is no
evidence, either from tissue culture or animal models, to show a
contribution of Mig-6 to organogenesis. In this report, we
demonstrate that Mig-6 is constitutively expressed throughout lung
development and is highly upregulated after birth. Mig-6–/– mice
developed abnormal branching, alveolarization and vascularization
in the embryonic and neonatal lungs, as well as COPD features in
the adult. Further, there was epithelial hyperplasia accompanied by
elevated EGF signaling and disrupted vascularization in the neonatal
Mig-6–/– lungs. Our results provide the first evidence that, by
controlling EGF signaling and vascularization, Mig-6 regulates lung
development.
It is not surprising that disruption of Mig-6 in the mouse genome
influenced all aspects of lung development and resulted in a
bronchial pulmonary dysplasia (BPD) phenotype in neonates, as
Mig-6 was widely expressed in lung cells throughout most, if not all,
developmental stages. Furthermore, Mig-6 has been shown to
actively regulate cell proliferation, transformation (Anastasi et al.,
2003; Fiorentino et al., 2000), differentiation, cell migration and
neurite growth (Pante et al., 2005; Wick et al., 1995), processes that
are all crucial for lung development. Neonatal Mig-6–/– mice also
had a lower birth weight, suggesting that Mig-6 might have a broad
impact on development, in addition to lung morphogenesis.
That Mig-6–/– mice still formed the correct number of lung lobes,
together with the fact that 50% of the Mig-6–/– mice survived until
adulthood, suggest that Mig-6 might not be a master gene that
DEVELOPMENT
sequencing (data not shown). When MIG-6 was knocked down in
H441 cells (1 in Fig. 10A), there was an increase in phospho-EGFR
and phospho-AKT as compared with the no siRNA and control
siRNA cells (2 and 3 in Fig. 10A). The MTT assay showed that the
population of living cells increased significantly in MIG-6 siRNAtreated H441 cells as compared with the no siRNA and control
siRNA cells (Fig. 10B). By contrast, when MIG-6 was knocked
down in HMVEC-L cells (Fig. 10C), the population of living cells
decreased by ~50% as compared with cells with no siRNA or control
siRNA (Fig. 10D). Cleaved caspase 3 staining showed an increase
3354 RESEARCH ARTICLE
Development 136 (19)
Fig. 9. Increased EGF signaling but decreased
angiogenetic gene expression in neonatal Mig-6–/– mouse
lungs. (A-D) Immunofluorescent staining of EGFR (A,B, green)
and phospho-EGFR (C,D, green) in P3 Mig-6+/+ and Mig-6–/–
lungs. Nuclei were stained with DAPI (blue).
(E-L) Immunohistochemistry of AKT (E,F), phospho-AKT (G,H),
mTOR (I,J) and phospho-mTOR (K,L) in P3 Mig-6+/+ and Mig-6–/–
lungs. (M) Western blot of AKT, phospho-AKT, mTOR, phosphomTOR and α-tubulin in P3 Mig-6+/+ and Mig-6–/– lungs. Asterisk
indicates mTOR bands. (N) The mRNA expression levels of EGF,
AREG, HbEGF, VEGF-A, VEGF-C, VEGF-D, angiopoietin 1
(ANG1) and angiopoietin 2 (ANG2) in P3 Mig-6–/– relative to
Mig-6+/+ lungs as determined by quantitative real-time PCR.
*P<0.05, **P<0.01 and ***P<0.001 versus Mig-6+/+
littermates. Scale bars: 50 μm.
BPD and in injured lungs, suggesting that the autocrine/paracrine
regulation of EGF signaling might contribute to the pathogenesis of
Mig-6–/– lungs (Singh and Harris, 2005; Stahlman et al., 1989;
Strandjord et al., 1995).
Fig. 10. Knockdown of Mig-6 expression leads to increased
epithelial cell proliferation and endothelial cell apoptosis.
(A) Western blot of MIG-6, EGFR, phospho-EGFR, AKT, phospho-AKT
and α-tubulin in human H441 cells with no siRNA (1), control siRNA (2)
and MIG-6 siRNA (3). (B-D) MTT assay in H441 cells (B) and HMVEC-L
cells (D), and relative MIG-6 mRNA levels in HMVEC-L cells as
determined by quantitative real-time PCR (C) with no siRNA, control
siRNA and MIG-6 siRNA. ***P<0.001 versus control siRNA.
(E) Immunofluorescent staining of cleaved caspase 3 on HMVEC-L cells
with no siRNA, control siRNA and MIG-6 siRNA. Scale bars: 50 μm.
DEVELOPMENT
regulates the early stages of lung development (Warburton et al.,
2000). Instead, Mig-6 might play a more important role during the
mid-to-late stages of lung development. In support of this, the main
lung phenotypes of Mig-6–/– mice, such as alveolar type II cell
hyperplasia, arrested alveolarization and vascularization defects, all
emerge at the terminal saccular stage (Costa et al., 2001; Inselman
and Mellins, 1981). Mig-6 functions might closely associate with
cellular activities. Other phenotypes of Mig-6–/– mice, including
penetrant skin, skin cancer and degenerate joint diseases, all
developed in highly dynamic organs (Ferby et al., 2006; Jin et al.,
2007; Zhang et al., 2007).
Delaying the ablation of Mig-6 until the adult results in no overt
pulmonary phenotype. One explanation for this is that the adult
lungs are relatively static and the impact of Mig-6 might only be
manifested during dynamic stages, such as during development or
injury repair (Warburton et al., 2001). Challenging the Mig-6d/d mice
with pulmonary injury would be necessary to test this hypothesis.
However, the COPD phenotype of adult Mig-6–/– mice is the result
of recurrent inflammation and scaring in the lung, a process similar
to BPD developing into COPD when BPD is not properly controlled
at the neonatal stage (Bhandari and Panitch, 2006; Coalson, 2003).
Similar to previous reports, Mig-6–/– lungs showed increased
phospho-EGFR and downstream EGF signaling (Ferby et al., 2006),
suggesting the direct interaction of Mig-6 with EGFR (Anastasi et
al., 2003; Anastasi et al., 2005; Ferby et al., 2006; Fiorentino et al.,
2000; Xu D. et al., 2005). Activation of the AKT/mTOR pathway
might be a cause of the increased cell proliferation in the Mig-6–/–
lungs because knockdown of Mig-6 in H441 cells led to elevated cell
proliferation accompanied with increased phospho-EGFR and
phospho-AKT. In addition, overactivation of the AKT/mTOR
pathway has been reported in bronchial epithelium with conditional
deletion of phosphatase and tensin homolog (PTEN), which brings
about papillary epithelial hyperplasia analogous to that observed in
Mig-6–/– lungs (Dave et al., 2007; Yanagi et al., 2007). An increase
in EGFR ligands, such as EGF, HbEGF and AREG in Mig-6–/–
lungs, has also been observed in human fetal and neonatal lungs with
The mechanisms by which Mig-6 regulates lung vascularization
might be complex. We detected a decrease in numerous angiogenetic
factor genes in the Mig-6–/– lungs, which might directly contribute
to their under-vascularization. Vascular hypoplasia, together with a
decrease in angiogenetic factors and their receptors, have been
observed in human infants with BPD (Bhatt et al., 2001; Lassus et
al., 2001) and in prematurely delivered baboons (Maniscalco et al.,
2002). The under-vascularization of the Mig-6–/– lungs was detected
as early as E15.5, suggesting that the vascularization defect is not a
secondary change that occurs with a lung defect in newborns. In
addition to the effect of angiogenetic factors, increased EGF
signaling might partially contribute to the pulmonary vascular
defects, as was concluded for transgenic mice expressing TGFα
from the SP-C promoter (Le Cras et al., 2003). EGF signaling
normally promotes angiogenesis in tumors (Goldman et al., 1993;
Salomon et al., 1995); however, in developing organs, EGF might
act differently given that EGF/TGFα treatment has been shown to
abrogate the angiopoietic and hemangiopoietic potentials of the
splanchnopleural mesoderm of avian embryos (Pardanaud and
Dieterlen-Lievre, 1999). We are not sure why ablation of Mig-6
leads to the downregulation of angiogenetic factors in Mig-6–/–
lungs. As a scaffold protein that is ubiquitously expressed in E18.5
and P3 lungs, Mig-6 might directly influence the expression of
VEGF, angiopoietin 1 and angiopoietin 2, which are mainly
produced by peri-endothelial mural cells, fibroblasts and endothelial
cells (Davis et al., 1996; Leung et al., 1989; Stratmann et al., 1998;
Tischer et al., 1991). Furthermore, Mig-6 might be crucial for the
survival of endothelial cells because knocking down Mig-6 in
HMVEC-L cells promoted their apoptosis. It is not clear whether
Mig-6 regulates endothelial cell apoptosis by a mechanism similar
to that in breast cancer cells (Xu J. et al., 2005); however, Mig-6
possesses the functional domain to bind 14-3-3 proteins (Makkinje
et al., 2000), which may block apoptosis via differential regulation
of MAPK pathways (Xing et al., 2000; Zhang et al., 2003). The loss
of endothelial cells in the Mig-6–/– lungs might further disrupt the
epithelial-endothelial interaction, which leads to septation defects in
neonatal lungs (DeLisser et al., 2006; Yamamoto et al., 2007).
In summary, this study has revealed that Mig-6 is required for
lung morphogenesis and homeostasis. The function of Mig-6 in the
lung is programmed at the prenatal and perinatal stages, such that
when Mig-6 is ablated in the adult no lung phenotype develops. Mig6 may negatively regulate EGFR intracellular signaling in epithelial
cells and modulate vascularization systems through different
mechanisms, which might include the regulation of angiogenetic
factors and the control of endothelial cell apoptosis. This study may
open a new field for the functional study of Mig-6, both in the lung
and in the development of other organs.
Acknowledgements
We thank Jinghua Li, Jie Yang and Janet DeMayo, M.S. for technical
assistance; Janet DeMayo, M.S. and Heather L. Franco for manuscript
preparation; and John Lydon, PhD for important comments. This work was
supported by American Heart Association postdoctoral fellowship 0825135F
(to N.J.) and National Cancer Institute grants U01CA105352 (to F.J.D.) and
NIH R01HD057873 (to J.-W.J.). Deposited in PMC for release after 12
months.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/136/19/3347/DC1
References
Amatschek, S., Koenig, U., Auer, H., Steinlein, P., Pacher, M., Gruenfelder,
A., Dekan, G., Vogl, S., Kubista, E., Heider, K. H. et al. (2004). Tissue-wide
expression profiling using cDNA subtraction and microarrays to identify tumorspecific genes. Cancer Res. 64, 844-856.
RESEARCH ARTICLE 3355
Anastasi, S., Fiorentino, L., Fiorini, M., Fraioli, R., Sala, G., Castellani, L.,
Alema, S., Alimandi, M. and Segatto, O. (2003). Feedback inhibition by RALT
controls signal output by the ErbB network. Oncogene 22, 4221-4234.
Anastasi, S., Sala, G., Huiping, C., Caprini, E., Russo, G., Iacovelli, S., Lucini,
F., Ingvarsson, S. and Segatto, O. (2005). Loss of RALT/MIG-6 expression in
ERBB2-amplified breast carcinomas enhances ErbB-2 oncogenic potency and
favors resistance to Herceptin. Oncogene 24, 4540-4548.
Augustin, H. G., Koh, G. Y., Thurston, G. and Alitalo, K. (2009). Control of
vascular morphogenesis and homeostasis through the angiopoietin-Tie system.
Nat. Rev. Mol. Cell Biol. 10, 165-177.
Ballaro, C., Ceccarelli, S., Tiveron, C., Tatangelo, L., Salvatore, A. M.,
Segatto, O. and Alema, S. (2005). Targeted expression of RALT in mouse skin
inhibits epidermal growth factor receptor signalling and generates a Waved-like
phenotype. EMBO Rep. 6, 755-761.
Bhandari, A. and Panitch, H. B. (2006). Pulmonary outcomes in
bronchopulmonary dysplasia. Semin. Perinatol. 30, 219-226.
Bhatt, A. J., Pryhuber, G. S., Huyck, H., Watkins, R. H., Metlay, L. A. and
Maniscalco, W. M. (2001). Disrupted pulmonary vasculature and decreased
vascular endothelial growth factor, Flt-1, and TIE-2 in human infants dying with
bronchopulmonary dysplasia. Am. J. Respir. Crit. Care Med. 164, 1971-1980.
Bry, K., Whitsett, J. A. and Lappalainen, U. (2007). IL-1beta disrupts postnatal
lung morphogenesis in the mouse. Am. J. Respir. Cell Mol. Biol. 36, 32-42.
Chess, P. R., Ryan, R. M. and Finkelstein, J. N. (1998). H441 pulmonary
epithelial cell mitogenic effects and signaling pathways in response to HGF and
TGF-alpha. Exp. Lung Res. 24, 27-39.
Chu, D. T., Davis, C. M., Chrapkiewicz, N. B. and Granner, D. K. (1988).
Reciprocal regulation of gene transcription by insulin. Inhibition of the
phosphoenolpyruvate carboxykinase gene and stimulation of gene 33 in a single
cell type. J. Biol. Chem. 263, 13007-13011.
Coalson, J. J. (2003). Pathology of new bronchopulmonary dysplasia. Semin.
Neonatol. 8, 73-81.
Copland, I. B. and Post, M. (2007). Stretch-activated signaling pathways
responsible for early response gene expression in fetal lung epithelial cells. J.
Cell. Physiol. 210, 133-143.
Costa, R. H., Kalinichenko, V. V. and Lim, L. (2001). Transcription factors in
mouse lung development and function. Am. J. Physiol. Lung Cell Mol. Physiol.
280, L823-L838.
Dave, V., Wert, S. E., Tanner, T., Thitoff, A. R., Loudy, D. E. and Whitsett, J. A.
(2007). Conditional deletion of Pten causes bronchiolar hyperplasia. Am. J.
Respir. Cell Mol. Biol. 38, 337-345.
Davis, S., Aldrich, T. H., Jones, P. F., Acheson, A., Compton, D. L., Jain, V.,
Ryan, T. E., Bruno, J., Radziejewski, C., Maisonpierre, P. C. et al. (1996).
Isolation of angiopoietin-1, a ligand for the TIE2 receptor, by secretion-trap
expression cloning. Cell 87, 1161-1169.
DeLisser, H. M., Helmke, B. P., Cao, G., Egan, P. M., Taichman, D.,
Fehrenbach, M., Zaman, A., Cui, Z., Mohan, G. S., Baldwin, H. S. et al.
(2006). Loss of PECAM-1 function impairs alveolarization. J. Biol. Chem. 281,
8724-8731.
de Luca, C., Kowalski, T. J., Zhang, Y., Elmquist, J. K., Lee, C., Kilimann, M.
W., Ludwig, T., Liu, S. M. and Chua, S. C., Jr (2005). Complete rescue of
obesity, diabetes, and infertility in db/db mice by neuron-specific LEPR-B
transgenes. J. Clin. Invest. 115, 3484-3493.
Ding, W., Shi, W., Bellusci, S., Groffen, J., Heisterkamp, N., Minoo, P. and
Warburton, D. (2007). Sprouty2 downregulation plays a pivotal role in
mediating crosstalk between TGF-beta1 signaling and EGF as well as FGF
receptor tyrosine kinase-ERK pathways in mesenchymal cells. J. Cell. Physiol.
212, 796-806.
Ferby, I., Reschke, M., Kudlacek, O., Knyazev, P., Pante, G., Amann, K.,
Sommergruber, W., Kraut, N., Ullrich, A., Fassler, R. et al. (2006). Mig6 is a
negative regulator of EGF receptor-mediated skin morphogenesis and tumor
formation. Nat. Med. 12, 568-573.
Fiorentino, L., Pertica, C., Fiorini, M., Talora, C., Crescenzi, M., Castellani, L.,
Alema, S., Benedetti, P. and Segatto, O. (2000). Inhibition of ErbB-2
mitogenic and transforming activity by RALT, a mitogen-induced signal
transducer which binds to the ErbB-2 kinase domain. Mol. Cell. Biol. 20, 77357750.
Goldman, C. K., Kim, J., Wong, W. L., King, V., Brock, T. and Gillespie, G. Y.
(1993). Epidermal growth factor stimulates vascular endothelial growth factor
production by human malignant glioma cells: a model of glioblastoma
multiforme pathophysiology. Mol. Biol. Cell 4, 121-133.
Hackel, P. O., Gishizky, M. and Ullrich, A. (2001). Mig-6 is a negative regulator
of the epidermal growth factor receptor signal. Biol. Chem. 382, 1649-1662.
Inselman, L. S. and Mellins, R. B. (1981). Growth and development of the lung.
J. Pediatr. 98, 1-15.
Jeong, J. W., Lee, H. S., Lee, K. Y., White, L. D., Broaddus, R. R., Zhang, Y. W.,
Vande Woude, G. F., Giudice, L. C., Young, S. L., Lessey, B. A. et al. (2009).
Mig-6 modulates uterine steroid hormone responsiveness and exhibits altered
expression in endometrial disease. Proc. Natl. Acad. Sci. USA 106, 8677-8682.
Jin, N., Gilbert, J. L., Broaddus, R. R., Demayo, F. J. and Jeong, J. W. (2007).
Generation of a Mig-6 conditional null allele. Genesis 45, 716-721.
DEVELOPMENT
Mig-6 function in lung development
Kent, T. A., Messina, J. L., Weinstock, R. S. and Stein, J. P. (1994). Synergistic
induction of gene 33 expression by retinoic acid and insulin. Endocrinology 134,
2237-2244.
Kling, D. E., Brandon, K. L., Sollinger, C. A., Cavicchio, A. J., Ge, Q., Kinane,
T. B., Donahoe, P. K. and Schnitzer, J. J. (2006). Distribution of ERK1/2 and
ERK3 during normal rat fetal lung development. Anat. Embryol. (Berl.) 211, 139153.
Korfhagen, T. R., Swantz, R. J., Wert, S. E., McCarty, J. M., Kerlakian, C. B.,
Glasser, S. W. and Whitsett, J. A. (1994). Respiratory epithelial cell expression
of human transforming growth factor-alpha induces lung fibrosis in transgenic
mice. J. Clin. Invest. 93, 1691-1699.
Kramer, E. L., Deutsch, G. H., Sartor, M. A., Hardie, W. D., Ikegami, M.,
Korfhagen, T. R. and Le Cras, T. D. (2007). Perinatal increases in TGF-{alpha}
disrupt the saccular phase of lung morphogenesis and cause remodeling:
microarray analysis. Am. J. Physiol. Lung Cell Mol. Physiol. 293, L314-L327.
Lassus, P., Turanlahti, M., Heikkila, P., Andersson, L. C., Nupponen, I.,
Sarnesto, A. and Andersson, S. (2001). Pulmonary vascular endothelial
growth factor and Flt-1 in fetuses, in acute and chronic lung disease, and in
persistent pulmonary hypertension of the newborn. Am. J. Respir. Crit. Care
Med. 164, 1981-1987.
Le Cras, T. D., Hardie, W. D., Fagan, K., Whitsett, J. A. and Korfhagen, T. R.
(2003). Disrupted pulmonary vascular development and pulmonary hypertension
in transgenic mice overexpressing transforming growth factor-alpha. Am. J.
Physiol. Lung Cell Mol. Physiol. 285, L1046-L1054.
Le Cras, T. D., Hardie, W. D., Deutsch, G. H., Albertine, K. H., Ikegami, M.,
Whitsett, J. A. and Korfhagen, T. R. (2004). Transient induction of TGF-alpha
disrupts lung morphogenesis, causing pulmonary disease in adulthood. Am. J.
Physiol. Lung Cell Mol. Physiol. 287, L718-L729.
Lee, K. L., Isham, K. R., Stringfellow, L., Rothrock, R. and Kenney, F. T. (1985).
Molecular cloning of cDNAs cognate to genes sensitive to hormonal control in
rat liver. J. Biol. Chem. 260, 16433-16438.
Leung, D. W., Cachianes, G., Kuang, W. J., Goeddel, D. V. and Ferrara, N.
(1989). Vascular endothelial growth factor is a secreted angiogenic mitogen.
Science 246, 1306-1309.
Makkinje, A., Quinn, D. A., Chen, A., Cadilla, C. L., Force, T., Bonventre, J. V.
and Kyriakis, J. M. (2000). Gene 33/Mig-6, a transcriptionally inducible adapter
protein that binds GTP-Cdc42 and activates SAPK/JNK. A potential marker
transcript for chronic pathologic conditions, such as diabetic nephropathy.
Possible role in the response to persistent stress. J. Biol. Chem. 275, 1783817847.
Maniscalco, W. M., Watkins, R. H., Pryhuber, G. S., Bhatt, A., Shea, C. and
Huyck, H. (2002). Angiogenic factors and alveolar vasculature: development
and alterations by injury in very premature baboons. Am. J. Physiol. Lung Cell
Mol. Physiol. 282, L811-L823.
Miettinen, P. J., Warburton, D., Bu, D., Zhao, J. S., Berger, J. E., Minoo, P.,
Koivisto, T., Allen, L., Dobbs, L., Werb, Z. et al. (1997). Impaired lung
branching morphogenesis in the absence of functional EGF receptor. Dev. Biol.
186, 224-236.
Pante, G., Thompson, J., Lamballe, F., Iwata, T., Ferby, I., Barr, F. A., Davies,
A. M., Maina, F. and Klein, R. (2005). Mitogen-inducible gene 6 is an
endogenous inhibitor of HGF/Met-induced cell migration and neurite growth. J.
Cell Biol. 171, 337-348.
Pardanaud, L. and Dieterlen-Lievre, F. (1999). Manipulation of the
angiopoietic/hemangiopoietic commitment in the avian embryo. Development
126, 617-627.
Perl, A. K. and Whitsett, J. A. (1999). Molecular mechanisms controlling lung
morphogenesis. Clin. Genet. 56, 14-27.
Salomon, D. S., Brandt, R., Ciardiello, F. and Normanno, N. (1995). Epidermal
growth factor-related peptides and their receptors in human malignancies. Crit.
Rev. Oncol. Hematol. 19, 183-232.
Schwarz, M. A., Zhang, F., Gebb, S., Starnes, V. and Warburton, D. (2000).
Endothelial monocyte activating polypeptide II inhibits lung
neovascularization and airway epithelial morphogenesis. Mech. Dev. 95, 123132.
Shi, W., Bellusci, S. and Warburton, D. (2007). Lung development and adult
lung diseases. Chest 132, 651-656.
Shibuya, M. (2008). Vascular endothelial growth factor-dependent and
-independent regulation of angiogenesis. BMB Rep. 41, 278-286.
Sibilia, M. and Wagner, E. F. (1995). Strain-dependent epithelial defects in mice
lacking the EGF receptor. Science 269, 234-238.
Singh, A. B. and Harris, R. C. (2005). Autocrine, paracrine and juxtacrine
signaling by EGFR ligands. Cell Signal. 17, 1183-1193.
Development 136 (19)
Stahlman, M. T., Orth, D. N. and Gray, M. E. (1989). Immunocytochemical
localization of epidermal growth factor in the developing human respiratory
system and in acute and chronic lung disease in the neonate. Lab. Invest. 60,
539-547.
Strandjord, T. P., Clark, J. G., Guralnick, D. E. and Madtes, D. K. (1995).
Immunolocalization of transforming growth factor-alpha, epidermal growth
factor (EGF), and EGF-receptor in normal and injured developing human lung.
Pediatr. Res. 38, 851-856.
Stratmann, A., Risau, W. and Plate, K. H. (1998). Cell type-specific expression of
angiopoietin-1 and angiopoietin-2 suggests a role in glioblastoma angiogenesis.
Am. J. Pathol. 153, 1459-1466.
Tischer, E., Mitchell, R., Hartman, T., Silva, M., Gospodarowicz, D., Fiddes, J.
C. and Abraham, J. A. (1991). The human gene for vascular endothelial
growth factor. Multiple protein forms are encoded through alternative exon
splicing. J. Biol. Chem. 266, 11947-11954.
Tseng, R. C., Chang, J. W., Hsien, F. J., Chang, Y. H., Hsiao, C. F., Chen, J. T.,
Chen, C. Y., Jou, Y. S. and Wang, Y. C. (2005). Genomewide loss of
heterozygosity and its clinical associations in non small cell lung cancer. Int. J.
Cancer 117, 241-247.
Uzumcu, M., Westfall, S. D., Dirks, K. A. and Skinner, M. K. (2002). Embryonic
testis cord formation and mesonephric cell migration requires the
phosphotidylinositol 3-kinase signaling pathway. Biol. Reprod. 67, 1927-1935.
Wang, J., Ito, T., Udaka, N., Okudela, K., Yazawa, T. and Kitamura, H. (2005).
PI3K-AKT pathway mediates growth and survival signals during development of
fetal mouse lung. Tissue Cell 37, 25-35.
Warburton, D., Schwarz, M., Tefft, D., Flores-Delgado, G., Anderson, K. D.
and Cardoso, W. V. (2000). The molecular basis of lung morphogenesis. Mech.
Dev. 92, 55-81.
Warburton, D., Tefft, D., Mailleux, A., Bellusci, S., Thiery, J. P., Zhao, J.,
Buckley, S., Shi, W. and Driscoll, B. (2001). Do lung remodeling, repair, and
regeneration recapitulate respiratory ontogeny? Am. J. Respir. Crit. Care Med.
164, S59-S62.
Wick, M., Burger, C., Funk, M. and Muller, R. (1995). Identification of a novel
mitogen-inducible gene (mig-6): regulation during G1 progression and
differentiation. Exp. Cell Res. 219, 527-535.
Xing, H., Zhang, S., Weinheimer, C., Kovacs, A. and Muslin, A. J. (2000). 143-3 proteins block apoptosis and differentially regulate MAPK cascades. EMBO J.
19, 349-358.
Xu, D., Makkinje, A. and Kyriakis, J. M. (2005). Gene 33 is an endogenous
inhibitor of epidermal growth factor (EGF) receptor signaling and mediates
dexamethasone-induced suppression of EGF function. J. Biol. Chem. 280, 29242933.
Xu, D., Patten, R. D., Force, T. and Kyriakis, J. M. (2006). Gene 33/RALT is
induced by hypoxia in cardiomyocytes, where it promotes cell death by
suppressing phosphatidylinositol 3-kinase and extracellular signal-regulated
kinase survival signaling. Mol. Cell. Biol. 26, 5043-5054.
Xu, J., Keeton, A. B., Wu, L., Franklin, J. L., Cao, X. and Messina, J. L. (2005).
Gene 33 inhibits apoptosis of breast cancer cells and increases poly(ADP-ribose)
polymerase expression. Breast Cancer Res. Treat. 91, 207-215.
Yamamoto, H., Yun, E. J., Gerber, H. P., Ferrara, N., Whitsett, J. A. and Vu, T.
H. (2007). Epithelial-vascular cross talk mediated by VEGF-A and HGF signaling
directs primary septae formation during distal lung morphogenesis. Dev. Biol.
308, 44-53.
Yanagi, S., Kishimoto, H., Kawahara, K., Sasaki, T., Sasaki, M., Nishio, M.,
Yajima, N., Hamada, K., Horie, Y., Kubo, H. et al. (2007). Pten controls lung
morphogenesis, bronchioalveolar stem cells, and onset of lung adenocarcinomas
in mice. J. Clin. Invest. 117, 2929-2940.
Zeng, X., Wert, S. E., Federici, R., Peters, K. G. and Whitsett, J. A. (1998).
VEGF enhances pulmonary vasculogenesis and disrupts lung morphogenesis in
vivo. Dev. Dyn. 211, 215-227.
Zhang, S., Ren, J., Zhang, C. E., Treskov, I., Wang, Y. and Muslin, A. J. (2003).
Role of 14-3-3-mediated p38 mitogen-activated protein kinase inhibition in
cardiac myocyte survival. Circ. Res. 93, 1026-1028.
Zhang, Y. W. and Vande Woude, G. F. (2007). Mig-6, signal transduction, stress
response and cancer. Cell Cycle 6, 507-513.
Zhang, Y. W., Su, Y., Lanning, N., Swiatek, P. J., Bronson, R. T., Sigler, R.,
Martin, R. W. and Vande Woude, G. F. (2005). Targeted disruption of Mig-6
in the mouse genome leads to early onset degenerative joint disease. Proc. Natl.
Acad. Sci. USA 102, 11740-11745.
Zhang, Y. W., Staal, B., Su, Y., Swiatek, P., Zhao, P., Cao, B., Resau, J., Sigler,
R., Bronson, R. and Vande Woude, G. F. (2007). Evidence that MIG-6 is a
tumor-suppressor gene. Oncogene 26, 269-276.
DEVELOPMENT
3356 RESEARCH ARTICLE