RESEARCH ARTICLE 3067
Development 136, 3067-3075 (2009) doi:10.1242/dev.036426
Enhancer-promoter communication at the Drosophila
engrailed locus
Deborah Kwon1, Diane Mucci2, Kristofor K. Langlais1, Jeffrey L. Americo1,*, Sarah K. DeVido1, Yuzhong Cheng1
and Judith A. Kassis1,†
Enhancers are often located many tens of kilobases away from the promoter they regulate, sometimes residing closer to the
promoter of a neighboring gene. How do they know which gene to activate? We have used homing P[en] constructs to study the
enhancer-promoter communication at the engrailed locus. Here we show that engrailed enhancers can act over large distances,
even skipping over other transcription units, choosing the engrailed promoter over those of neighboring genes. This specificity is
achieved in at least three ways. First, early acting engrailed stripe enhancers exhibit promoter specificity. Second, a proximal
promoter-tethering element is required for the action of the imaginal disc enhancer(s). Our data suggest that there are two
partially redundant promoter-tethering elements. Third, the long-distance action of engrailed enhancers requires a combination of
the engrailed promoter and sequences within or closely linked to the promoter proximal Polycomb-group response elements. These
data show that multiple mechanisms ensure proper enhancer-promoter communication at the Drosophila engrailed locus.
INTRODUCTION
Enhancers are often located many tens of kilobases away from the
promoter they regulate, sometimes residing closer to the promoter
of a neighboring gene. How do they know which gene to activate?
Some enhancers preferentially activate one type of core promoter
(promoter specificity) (reviewed by Smale, 2001). In other cases,
sequences near the promoter, called promoter-tethering elements,
are required for transcriptional activation by a particular enhancer.
These elements have been found near the Scr, Abd-B, string and
white promoters (Calhoun et al., 2002; Akbari et al., 2008; Qian et
al., 1992; Lehman et al., 1999). Promoter-tethering elements might
bind proteins that specifically interact with proteins bound to distant
enhancers, facilitating their ability to activate an associated
promoter. In addition, insulator elements, which block the action of
an enhancer in a directional way, provide directionality to enhancer
action at some genomic locations (reviewed by Gaszner and
Felsenfeld, 2006).
The engrailed (en) gene exists in a gene complex with the
coregulated invected (inv) gene (Coleman et al., 1987; Gustavson
et al., 1996). en and inv are co-expressed in a complex manner
throughout development. Early in development, they are required
for segmentation, and are expressed in a series of stripes
continually throughout embryogenesis. Although the location of
En stripes does not change throughout embryonic development,
the enhancers and the trans-acting proteins that regulate their
expression do change. For example, separate fragments of
regulatory DNA act as enhancers for activation by the pair-rule
genes, for activation by Wingless signaling and for regulation by
the trithorax and Polycomb group genes (DiNardo et al., 1988;
1
Laboratory of Molecular Genetics, Eunice Kennedy Shriver National Institute of
Child Health and Human Development, National Institutes of Health, Bethesda,
MD 20892, USA. 2Division of Cellular and Gene Therapies, Center for Biologics
Evaluation and Research, Food and Drug Administration, Bethesda, MD 20892,
USA.
*Present address: Laboratory of Viral Diseases, National Institute of Allergy and
Infectious Diseases, NIH, Bethesda, MD 20892, USA
†
Author for correspondence ([email protected])
Accepted 5 July 2009
Kassis, 1990; DeVido et al., 2008). En and inv are also expressed
in the hindgut, clypeolabrum, central nervous system (CNS),
peripheral nervous system (PNS), fat body and the posterior
compartments of the imaginal discs (DiNardo et al., 1985). The
regulatory sequences of engrailed are distributed throughout a 70
kb region (Kuner et al., 1985). Interestingly, the en and inv
promoters are separated by ~54 kb, yet they appear to be regulated
by the same enhancers (Goldsborough and Kornberg, 1994;
Gustavson et al., 1996), suggesting that en/inv enhancers must be
able to act over long distances. What ensures they activate only
en/inv and not flanking genes? We have used homing Ptransgenes to address this question.
Most P-based constructs insert in the genome in a non-selective
manner. However, a few pieces of regulatory DNA have been found
to alter the insertional specificity of P-constructs, causing the Pconstruct to insert near the gene that the regulatory DNA came from.
This phenomenon is called P-element homing and was first observed
with DNA from the en gene (Hama et al., 1990). DNA fragments
from the bithorax complex, linotte gene and, most recently, even
skipped, have also been shown to mediate homing (Bender and
Hudson, 2000; Taillebourg and Dura, 1999; Fujioka et al., 2009). For
en, P-constructs containing a DNA fragment including the engrailed
promoter and 2.4 kb of upstream sequences (P[en-lacZ]) cause
homing to the en region of the chromosome (Kassis et al., 1992).
Insertions are not site specific, but occur over a region of ~300 kb,
including en and inv and flanking genes (Hama et al., 1990;
Whiteley and Kassis, 1997; DeVido et al., 2008). P[en-lacZ] has no
enhancer activity on its own, but acts as an enhancer detector; that
is, its expression is directed by flanking genomic enhancers (Kassis,
1990; Kassis et al., 1992). We have recently shown that P[en-lacZ]
can be stimulated by en enhancers even when it is inserted into
neighboring genes (DeVido et al., 2008). Furthermore, this longdistance enhancer activity was dependent upon en DNA fragments
that also act as Polycomb-group response elements (PREs). PREs
are DNA elements that bind and mediate the action of the Polycomb
group of transcriptional repressors (for reviews, see Müller and
Kassis, 2006; Ringrose and Paro, 2007). We do not know whether
the PRE activity can be separated from the enhancer-detection
activity of these DNA fragments.
DEVELOPMENT
KEY WORDS: Promoter specificity, Regulatory DNA, Transcriptional control, Drosophila
Here we show that, in addition to the PRE fragments, the en
promoter is necessary for long-distance interactions with en/inv
enhancers. Our data suggest that enhancer-promoter specificity at
the en locus is complex, using different mechanisms for different
enhancers. First, the early stripe enhancers, which respond to the
pair-rule transcriptional activators, exhibit promoter specificity.
Second, a promoter-tethering element is required for interactions
with the imaginal disc enhancer(s). Finally, both the promoter and
the DNA fragment that includes the promoter-proximal PREs are
important for the long-range action of en enhancers.
MATERIALS AND METHODS
Construction of plasmids
P[enHSP] constructs were generated by cutting the vector pUZ (Lyko et al.,
1997) with restriction enzymes SpeI and NotI (New England Biolabs).
Inserts were generated by PCR with the following en primers. P[enHSP1]
(–2.407 to –0.395 kb): P1, GGGGCGGCCGCGAATTCCGTTGATATGAT
and P2, GCGACTAGTGCATGCTGGAGCTGTCAG; P[enHSP2] (–1.945
to –0.395 kb): P3, GCGGCCGCGAAAGTGTGTAGGGGAAT and P2;
P[enHSP3] (–2.407 to –0.579 kb): P1 and GCGACTAGTCCACAGACACTTTTC. These PCR-amplified fragments were also cut
with both SpeI and NotI and ligated into pUZ. The resulting clones were
sequenced in and around the cloned PCR fragment to ensure sequence
fidelity.
Transgenic lines
P[enHSP] transgenic lines were generated by injections into w1118 embryos
by Genetic Services (Sudbury, MA, USA). Chromosomal insertion sites
were localized by inverse PCR. Genomic DNA was extracted from
transgenic flies and separately digested with MboI, RsaI and HpaII. T4
ligase was added to the digested DNA to create circular DNA fragments that
were amplified using P-end primers GATTAACCCTTAGCATGTCCGTGG and AAGCATACGTTAAGTGGATGT or ATACTTCGGTAAGCTTCGGCTATCGAC and GCAGCCTTGGTAAAACTCCC.
PCR fragments were then sequenced (Macrogen, USA) and the resulting
sequence was entered into a BLAST search to localize insertion sites.
Whole-mount in situ hybridization of embryos
Digoxigenin (DIG)-labeled RNA antisense probe synthesis and whole
mount in situ hybridization was carried out as previously described (Langlais
et al., 2004), with the following modifications. Selected gene fragments
ranging in size from 300 bp to 1000 bp were cloned for use as templates for
probe synthesis. Probes were not fragmented with carbonate buffer. Probe
template primer sequences are available upon request.
Immunohistochemistry and X-gal staining
Preparation of embryos for immunocytochemistry was performed as in
DiNardo et al. (DiNardo et al., 1985). Primary antibodies used were: rabbit
polyclonal anti-β-galactosidase (1:15,000, Cappel), for immunoperoxidase
staining; mouse monoclonal anti-β-galactosidase (1:500, Promega), for
fluorescence staining; and rabbit polyclonal anti-En (1:200). The antibody
used was raised against the N-terminus of En and does not recognize Inv
(DiNardo et al., 1985). An ABC Elite Kit (Vector Labs) was used for
immunoperoxidase staining. For immunofluorescence, anti-rabbit Alexa
Fluor 555 (1:600) and anti-mouse Alexa Fluor 488 (1:400) (Invitrogen) were
used. Embryos were mounted in Vectashield (Vector Labs).
For imaginal disc staining, third instar larvae were cut in half and
inverted, fixed with either 1% glutaraldehyde or 3.2% formaldehyde
(Polysciences, EM grade) in PBS for 15 minutes at room temperature, then
washed three times with PBS and once with X-gal buffer (1 mM MgCl2, 150
mM NaCl, 10 mM NaPO4, pH 7.2) and stained at 37°C in X-gal buffer
containing 1.6% X-gal, 5 mM K3Fe(CN)6 and 5 mM K4Fe(CN)6 for the
times noted in the figure legends.
Generation and characterization of new en mutants
enJ86 and en⌬139 were generated by excision of P[en3R]-134B as described
in DeVido et al. (DeVido et al., 2008). en⌬139 is a deletion of 139 bp
extending from –412 to –273 bp upstream of the en transcription start site.
Development 136 (18)
In enJ86, a 339 bp deletion, extending from –412 to –73 bp, is present. In
addition, enJ86 has retained 1.8 kb of the P-construct, including the 3⬘ P end
and 1.58 kb of rosy sequences.
RESULTS
Expression patterns of genes flanking en and inv
en and inv are contained within a 100 kb region. These two genes are
co-expressed and share regulatory DNA (Goldsborough and
Kornberg, 1994; Gustavson et al., 1996). We have previously shown
that an enhancer-trapping P-construct with en sequences from –2.407
kb to +188 bp fused to lacZ that is inserted in tou is expressed like en
(DeVido et al., 2008). Therefore we asked whether any other genes in
the vicinity of en/inv have similar expression patterns. We performed
in situ hybridization on embryos with RNA probes for transcripts
flanking en and inv (Fig. 1). We compared our results with those in the
literature and also to results in the Berkeley Drosophila Genome
Project gene expression database (http://www.fruitfly.org/cgibin/ex/insitu.pl). No other genes in the region are expressed in patterns
similar to en/inv. Fig. 1 shows in situ hybridization on stage 11
embryos. An additional embryo is shown for those probes that gave a
pattern at another embryonic stage. E(Pc), the gene adjacent to the 5⬘
end of inv, is ubiquitously expressed at a low level. tou, the gene
immediately adjacent to the 5⬘ end of en, is expressed ubiquitously,
with somewhat stronger expression in the nervous system. CG13197
is expressed in the progenitors of the salivary glands. sprt and CG7759
are both expressed in the somatic mesoderm. Drip and CG7777 are
both expressed at late stages in a few cells. We also examined the
expression of E(Pc), tou, sprt and CG7759 in imaginal discs to
determine whether these genes had the same expression pattern as
en/inv in larval tissues. Whereas en and inv are expressed in the
posterior compartment of the imaginal discs, E(Pc), tou, sprt and
CG7759 all had light ubiquitous expression in this tissue (data not
shown).
engrailed enhancers can act over long distances
We examined the expression pattern of 17 lines with P[en-lacZ]
insertions into en/inv and flanking genes (Table 1). Two constructs
were used; each had the same en-lacZ transgene with different
markers {either the mini-white (P[en3]) or rosy marker gene
(P[en3R]) (Fig. 2)}. Both of these constructs act as enhancer traps;
that is, their expression patterns are totally dependent on flanking
genomic enhancers (Kassis et al., 1992; DeVido et al., 2008). In the
region of en and inv, P[en3] and P[en3R] insertions occurred over a
293 kb region, from 130 kb downstream to 163 kb upstream of the
major transcription start site of en (Table 1; Fig. 3). We examined
the β-gal expression patterns of these lines in both embryos and
imaginal discs (Fig. 3, top). As expected, insertions of P[en3R] or
P[en3] in the immediate vicinity of en and inv perfectly mimic en/inv
expression (Fig. 3). Likewise, P[en3R] inserted near the E(Pc)
promoter, ~23 kb upstream of inv, was expressed just like en/inv,
even though E(Pc) itself is ubiquitously expressed (Stankunas et al.,
1998) (Fig. 1). More remarkable is that an insertion of P[en3R] just
upstream of the sprt gene, located five transcription units and ~78
kb upstream of inv, is also expressed like en/inv in both embryos and
imaginal discs (Fig. 3, top). For transgenes inserted upstream of en,
we have already reported that an insertion of P[en3] into tou (P[en3]tou) is expressed in late embryonic stripes and in imaginal discs in
a manner similar to en (Fig. 3) (DeVido et al., 2008). We assayed the
expression of five additional P[en3R] transgenes in tou and found
they all exhibited similar patterns (a representative line is shown in
Fig. 3). Finally, P[en3R] inserted into the wal gene, 110 kb upstream
of en, shows some aspects of en expression (Fig. 3). By contrast, β-
DEVELOPMENT
3068 RESEARCH ARTICLE
Enhancer-promoter specificity
RESEARCH ARTICLE 3069
gal expression from a P[lacW] insertion into tou is not expressed like
en. P[lacW] is an enhancer-trapping transgene in which lacZ is
transcribed from the P-element promoter (Bier et al., 1989). Since
P[lacW] is not expressed like en, these data suggest that the en
fragment is necessary for the en-like expression pattern of the P[en3]
and P[en3R] lacZ transgenes inserted in tou.
The location of known en enhancers for stripes and other patterns
relevant to this paper are shown in Fig. 3 (Kassis, 1990; Hama et al.,
1990; DeVido et al., 2008) (our unpublished data). Seventy
kilobases of DNA between the 3⬘ end of inv and the 3⬘ end of tou
have been assayed for enhancer activity (our unpublished data). The
location of the imaginal disc en enhancer(s) is currently unknown,
although genetic evidence suggests that it is located upstream of en
(our unpublished data). Although the DNA of the inv gene has not
been tested for enhancer activity, genetic data suggest that inv and
en share regulatory DNA and data show that a breakpoint mutation
in en, enCX1 (which breaks either in the first exon or the first intron),
separates stripe enhancers from those that cause expression in the
clypeolabrum and hindgut (Gustavson et al., 1996). This suggests
that there are no stripe enhancers near or in the inv gene. Thus, our
data suggest a remarkable ability of en enhancers to act over long
distances, activating the en and inv promoters and ignoring other
promoters in the region.
We also examined whether P[en3R] altered the expression of sprt,
E(Pc) and tou when inserted near those genes in lines P[en3R]+130kb,
+75kb and –87kb, respectively. It was possible that insertion of
P[en3R] would cause flanking genes to be expressed in en-like
patterns. However, we saw no en-like expression of these genes in
either embryos or imaginal discs (data not shown), again suggesting
the specificity of en enhancers for the en promoter fragment.
There is a possibility that additional, distantly located ‘shadow
enhancers’ exist for en and that these transgenes are being activated
by en shadow enhancers, not the enhancers shown in Fig. 3 (Hong
et al., 2008). However, even if en shadow enhancers do exist, they
would have to have specificity for the en and inv promoters, as no
other gene in the region is expressed like en and inv (Fig. 1). We
favor a model, supported below, in which the en enhancers are able
to activate expression over large distances, activating their own
promoter over other promoters in the vicinity.
In addition to en/inv-like patterns discussed above, there are some
local effects that influence the expression of P[en3R] transgenes. For
instance, in P[en3R]+130kb embryos, β-gal is detected in the
presumptive mesoderm in addition to the expression shown,
reflecting the expression pattern of sprt (Tomancak et al., 2002) and
CG7759. Also, some of the inserts in tou are ubiquitously expressed
at a low level in discs. This is evident only when the staining time is
extended. Finally, not all en enhancers are able to act on all P[en3]
or P[en3R] en-lacZ transgenes at all locations. For example, the
enhancers responsible for early en stripes are not able to activate
P[en3] and P[en3R] when they are inserted in tou (DeVido et al.,
2008) (data not shown). The reason for this is not clear, as the
insertions in E(Pc), sprt and wal are expressed in early stripes (not
shown). In addition, enhancers for expression in the hindgut and
clypeolabrum, which are located downstream of the en promoter
(Gustavson et al., 1996) (Fig. 3), more efficiently activate P[en3R]
transgenes inserted in inv or E(Pc) than those inserted in en and
upstream of it (data not shown). These enhancers might not be able
to act over as great a distance as other enhancers, or the endogenous
en promoter might ‘trap’ them, attenuating their ability to activate
transcription of upstream transgenes (see below).
The en promoter is necessary for long-distance
enhancer action
We have previously shown that en DNA from –2.4 to –0.4 kb is
necessary for the long-distance action of en enhancers on P[en3]
inserted in tou (DeVido et al., 2008). We used the construct
DEVELOPMENT
Fig. 1. Expression patterns of en, inv and flanking genes in Drosophila embryos. Gray line indicates genomic DNA, with the coordinates
listed at both ends (genome version R5.1, FlyBase). Arrows below indicate the transcription units and the direction of transcription. In situ
hybridization was performed on embryos using DIG-labeled RNA antisense probes and alkaline phosphatase staining. All embryos are stage 11
unless otherwise noted. For some genes, an additional image of a later stage embryo is shown to demonstrate a specific staining pattern if no
pattern was observed at stage 11. Several genes show weak ubiquitous expression or do not show specific staining at any stage in embryos. Nonspecific yolk sac staining is observed in many embryos, indicated with an asterisk in CG7759. All embryos are oriented anterior to the left and
dorsal up.
3070 RESEARCH ARTICLE
Development 136 (18)
Table 1. Insertion site of transgenes studied
P[en3R]
P[enHSP1]
P[en3R]
P[en3R]
P[en3R]
P[en3R]
P[en3R]
enGAL4
P[enHSP1]
P[enHSP1]
P[enHSP1]
P[enHSP1]
P[en3R]
P[en3R]
P[enHSP3]
P[enHSP2]
P[en3R]
P[enHSP2]
P[en3]
P[en3⌬both]
P[en3]
P[enHSP1]
P[enHSP1]
P[lacW]
P[enHSP1]
P[en3R]
P[en3R]
P[en3R]
P[en3R]
P[en3R]
P[en3R]
Line
Gene*
Location†
+130kb
+75kb
+75kb
+75kb-2
+52kb
+52kb-2
+52kb-3
(+42kb)
+28kb
+28kb+19bp
+19bp
+28kb+19bp
–204bp
–210bp
–250bp
–250bp
–412bp
–1kb
en (–6kb)
en (–6kb)
tou (–66kb)
–67kb
–67kb-2
tou1 (–73kb)
–74kb
–77kb
–77kb-1
–77kb-2
–86kb
–87kb
–163kb
sprt
E(Pc)
E(Pc)
E(Pc)
inv
inv
inv
inv
inv
inv
en
en
en
en
en
en
en
en
en
en
tou
tou
tou
tou
tou
tou
tou
tou
tou
tou
wal
7,285,340
7,340,264
7,340,298
7,340,671
7,363,188
7,363,197
7,363,221
7,373,480
7,387,233
7,387,340
7,415,369
7,415,369
7,415,592
7,415,598
7,415,638
7,415,638
7,415,800
7,416,417
7,421,628
7,421,628
7,481,428
7,482,731
7,482,786
7,488,577
7,489,278
7,492,176
7,492,223
7,492,778
7,501,843
7,502,613
7,578,342
Line names indicate the number of kilobases or bases upstream (negative numbers)
or downstream (positive numbers) of the major en transcription start site (at
7,415,388) (Soeller et al., 1988). A few lines were named previously. For these, the
number of kilobases from the en transcription start site is shown in parentheses.
*Gene inserted in or next to.
†
Nucleotide insertion site (genome version R5.1, FlyBase).
P[enHSP1] (Fig. 2) to ask whether the en promoter fragment is also
necessary for long-distance enhancer action. P[enHSP1] contains
en sequences –2.4 to –0.4 kb cloned upstream of GAL4-binding
sites and the heat shock promoter (hsp) driving lacZ and a miniwhite reporter gene (the pUZ vector) (Lyko et al., 1997). We
examined the expression pattern of β-gal from P[enHSP1] inserted
in E(Pc), inv, en and tou (Fig. 3). Like the expression of β-gal from
P[en3] and P[en3R], β-gal was expressed in an en-like manner in
embryos and imaginal discs when P[enHSP1] is inserted into the en
promoter (Fig. 3, bottom) (although not in early embryos, see
below). This was in contrast to an insertion in tou, in which β-gal
expression from P[enHSP1] was very weak, with en-like stripes
only evident in the abdominal segments late in embryogenesis.
Furthermore, β-gal expression in the imaginal discs was only
evident in a small portion of the posterior compartment in the wing
disc; no other discs showed any β-gal expression (Fig. 3, bottom).
P[enHSP1] inserted in E(Pc) gave no expression in embryos, and
only very light expression in a portion of the posterior compartment
in just the wing disc (Fig. 3). Finally, most surprising to us, even
when P[enHSP1] was inserted into the inv gene, β-gal was
expressed in only a subset of en-expressing cells. Stripes were
activated late and remained weak throughout development.
Furthermore, β-gal expression in imaginal discs was confined to a
small portion of the wing disc. We were concerned that the location
in the inv intron might disrupt the expression of P[enHSP1]-inv.
Fig. 2. P-constructs used in these experiments. (A) Constructs with
the en promoter. P[en3R] {P[en1] from Kassis et al. (Kassis et al., 1992)}
and P[en3] (Devido et al., 2008) contain en sequences (green)
extending from –2.407 kb through to the start site of en transcription
(indicated by the arrow) and 188 bp of the en untranslated leader
fused to Adh-lacZ (blue). P[en3⌬both] contains en sequences from
–395 bp through to +188 bp (Devido et al., 2008). L, loxP site; F, FRT
site; P, P-element ends. (B) Constructs with the heat shock promoter
(HSP). The pUZ vector is shown along with the insertion site for the en
fragments (green) (Lyko et al., 1997). The locations of two Polycomb
response elements (PREs) are shown as green boxes (DeVido et al.,
2008; Kassis, 1994). The extent of the en fragment in each construct is
shown by the green line.
However, we do not believe that this is the case because enGAL4
(which contains en sequences –2.4 kb through to the en promoter
fused to GAL4; FlyBase) is also in the inv intron and is expressed
like en (Table 1).
Our results show that, although the heat shock promoter is able to
act with many en enhancers when P[enHSP1] is inserted near the en
promoter, it is not able to interact with those same enhancers when
it is located at a distance. We suggest that when P[enHSP1] is
inserted in the immediate vicinity of the en promoter it is able to
form the correct chromatin confirmation, or interact with nearby
regulatory fragments that allow it to respond to many en enhancers.
However, when the P[enHSP1] is not in the immediate vicinity of
the en promoter, it cannot access most en enhancers.
The 2 kb fragment of DNA that mediates homing of P[enHSP1]
contains two subfragments that mediate mini-white silencing and
also act as PREs in embryos (Fig. 2) (DeVido et al., 2008; Kassis,
1994). Chromatin immunoprecipitation experiments have shown
that this entire 2 kb fragment is bound by Polycomb group proteins
in both embryos and SL-2 cells (Nègre et al., 2006; Strutt and Paro,
1997). As stated above, this fragment has also been shown to be
required for the ability of en enhancers to stimulate expression from
P[en3] inserted in tou (DeVido et al., 2008). Taken together, our data
clearly show that both the 2 kb promoter-proximal PRE-containing
fragment and the en promoter are required for the long-distance
action of en enhancers.
DEVELOPMENT
Construct
Enhancer-promoter specificity
RESEARCH ARTICLE 3071
Early stripe enhancers exhibit promoter
specificity
We made two other versions of P[enHSP] that contain smaller
fragments of en DNA that also homed to the en region,
P[enHSP2] and P[enHSP3] (Fig. 2). In all, we obtained six lines
with P-constructs inserted within 1 kb upstream of the
transcription start site of en (Table 1). This allowed us to compare
the expression pattern of transgenes with the en promoter to those
without it, which were inserted at nearly the same location. We
also examined the expression from P[en3⌬both]-en that is
inserted 6 kb upstream of en. Our data show that the early stripe
enhancers, those activated by the pair-rule genes, act
preferentially on the en promoter (Fig. 4; data not shown).
Although lacZ expression from P[en3R]–210bp, –412bp and
P[en3⌬both]-en(–6kb) occurred in early embryos, expression
from P[enHSP] constructs did not occur until approximately late
stage 10, when it turns on in a stochastic manner, only visible in
just a few cells per stripe (Fig. 4C,D). The stripes fill in a little
later in development, after which the embryos are almost
indistinguishable from P-en-promoter-containing lines (Fig. 4EH). These data suggest that the pair-rule proteins, which directly
activate early en expression, exhibit promoter specificity.
DEVELOPMENT
Fig. 3. Expression patterns of enhancer traps in the en/inv genomic region. Gray line indicates genomic DNA. Arrows under the genomic
DNA line show the position and direction of transcription units. Vertical arrows indicate the position of insertion of the transgene indicated. The
exact insertion site of each P-construct is listed in Table 1. Transgenes with the en promoter are above the genomic DNA line, those with the heat
shock promoter are below the genomic DNA line. The position of all known en stripe enhancers and other enhancers important for these
experiments are shown as colored boxes: green, clypeolabrum; yellow, posterior spiracles; blue, hindgut; orange, stripe in every segment; red, even
or odd stripes (pair-rule enhancers); purple, en intron enhancer: hindgut, posterior spiracles, fat body, even stripes and every segment (Kassis, 1990)
(our unpublished data). The imaginal disc enhancer is upstream of en but the exact location is not known (unpublished data). β-Galactosidase
protein is visualized by immunoperoxidase staining in embryos and X-gal staining in imaginal discs. A lateral view of a germ-band-shortened
embryo (stage 13), ~10 hours after egg laying, with anterior to the right and dorsal up, is shown for each transgene. A wing (left) and leg (right)
imaginal disc (posterior compartment to the right) is also shown for each transgene (except P[lacW]-tou). Discs were fixed in formaldehyde and
stained for varying amounts of time to equalize staining intensity. Lines with P[en3] or P[en3R] insertions in en or inv stained within 30 minutes;
E(Pc),1 hour; tou, 2.5 hours; sprt and wal, 5 hours. Note that the expression in the posterior compartment of the P[en3R]-131 line is variegated,
suggesting that activation by en enhancers in some cells is stronger than in others. This variegation is not evident when the discs are stained for a
longer period of time. For imaginal disc staining, lines P[enHSP1]+28kb, +19bp and –67kb were fixed with formaldehyde and stained for varying
times: P[enHSP1]+19bp, 30 minutes; P[enHSP1]+28kb, 2.5 hours; P[enHSP1]-67kb, 48 hours. Line P[enHSP1]+75kb was fixed with glutaraldehyde
and stained for >24 hours. We were not able to see β-gal activity in this line when it was fixed with formaldehyde.
3072 RESEARCH ARTICLE
Development 136 (18)
Fig. 4. Promoter specificity of early en enhancers. (A-H) Immunoperoxidase staining showing β-gal protein in embryos. The name of the line is
shown on top, with embryos at two stages shown beneath. (A,B) Stage 8; (C,D) stage 10; (E-H) stage 11. All embryos are oriented anterior to the
left and dorsal up. Images are lateral views, except C and G, which are dorsal-lateral views.
expression when the en promoter is present. These data suggest
that promoter-tethering sequences are present in both PRE2 and
within the en promoter fragment we used, perhaps fulfilling
redundant roles (see below).
The en promoter ‘traps’ en enhancers, whereas
the heat shock promoter does not
In embryos homozygous for P[en3R]–210bp or P[en3R]–412bp,
En is not expressed in stripes, but can be detected in the PNS,
hindgut (hg), clypeolabrum (cl), fat body (fb) and posterior
spiracles (ps) (Fig. 6A). β-gal, however, is detected in stripes but
not in the hg, cl, PNS, fb, or ps (Fig. 6A). The enhancers for hg,
cl, fb and ps are located downstream of the en transcription unit,
whereas most of the stripe enhancers are located upstream (except
those located in the intron) (Fig. 1) (the location of the PNS
enhancer is not known). We suggest that the stripe enhancers, first
encountering the en promoter within P[en3R], drive lacZ
expression, but are precluded from activating the endogenous en
promoter. However, the hg, cl, fb and ps enhancers first encounter
the endogenous en promoter and do not activate the expression of
lacZ. By contrast, when P[enHSP2] or P[enHSP3] is inserted just
upstream of en, En is expressed in stripes in addition to its
expression in the hg, cl, fb, PNS and ps (Fig. 6B; data not shown).
Thus, en stripe enhancers are not ‘trapped’ by the heat shock
promoter. β-gal expression from P[enHSP2] and P[enHSP3] is
not seen in the hg, PNS, cl, fb or ps (Fig. 6B; data not shown). The
differential effects of P[en3R] and P[enHSP2] and P[enHSP3] on
en stripe expression is reflected in the phenotype of these lines.
P[en3R]–210bp and –412bp lines die as embryos with severe
segmentation defects (data not shown). By contrast,
P[enHSP2]–250bp homozygous embryos do not have
segmentation defects; however, this construct is a lethal en allele,
with lines dying at third instar larval or pupal stages. We suggest
that P[enHSP2]–250bp disrupts en expression later in
Fig. 5. A promoter-tethering element is contained within PRE2. The name of the line is on top, with a wing disc (left) and a leg disc (right)
shown underneath each line. Discs were fixed with formaldehyde and stained for varying times: P[en3R]–210bp and P[en3⌬both]-en(–6kb), 45
minutes; P[enHSP2]–250bp, 2 hours; P[enHSP]–250bp, 29 hours.
DEVELOPMENT
Sequences within PRE2 act as a promotertethering element
We also examined the expression of lacZ in imaginal discs
from the lines with P-constructs inserted just upstream of en.
Expression of β-gal in imaginal discs from P[en3R]–210bp
and –412bp, P[enHSP1]+19bp, and P[enHSP2]–250bp and
–1kb was nearly identical (Figs 3 and 5; data not shown). By
contrast, to our surprise, there was almost no β-gal expression
in imaginal discs from P[enHSP3]–250bp (Fig. 5), the
construct that lacks PRE2. In this case, β-gal is evident only
in a small portion of the posterior compartment in the wing
disc. Note that P[enHSP2]–250bp and P[enHSP3]–250bp are
inserted in the same orientation and at the same exact position,
250 bp upstream of the major transcription start site of en
(Table 1; Fig. 6B). We suggest that sequences within PRE2 are
required for the imaginal disc enhancer(s) to activate the heat
shock promoter, even when it is inserted very near the en
transcription start site. Thus, PRE2 fulfills the role of a
promoter-tethering element for the heat shock promoter, a
proximal-promoter fragment of DNA necessary for enhancer
activity.
We previously found that PRE2 could mediate weak long-range
activation of lacZ from P[en3] when inserted in tou, but that a
fragment containing PRE1 could substitute for PRE2. Here, PRE1
is still present in P[enHSP3], and thus PRE1 cannot substitute for
the activity of PRE2 in this assay. This leads to the conclusion that
the promoter-tethering activity is distinct from the previously
described activity of PRE2. Finally, we note that there appears to
be another, perhaps redundant, promoter-tethering element
present in the en promoter fragment from –395 to +188 bp.
P[en3⌬both] contains sequences from –395 to +188 bp but no
PRE1 or PRE2 sequences (Fig. 2). β-gal expression from
P[en3⌬both]-en(–6kb) in both embryos and imaginal discs
mimics en, showing that PRE2 is not required for β-gal
development, perhaps in the imaginal discs. Finally,
P[enHSP3]–250bp flies survive over en null mutants, with only a
slight wing defect, reflecting minimal interference with en
expression.
Note that the promoter competition we observe does not occur
to the same extent for P[en3] and P[en3R] insertions further
upstream of en. There is no disruption of en expression from
insertions into flanking genes; that is, P[en3] or P[en3R] inserted
in inv, tou, E(Pc), sprt or wal do not cause en mutations. Even
when P[en3] is inserted ~6 kb upstream of en, it does not disrupt
embryonic en stripes, and survives weakly over en null alleles,
with only minor defects in the posterior compartment in the wing.
Fig. 6. The en promoter, but not the heat shock promoter,
captures en stripe enhancers. (A) Top: diagram of P-construct
inserted in line P[en3R]–210bp. Thick line indicates genomic DNA.
Arrows indicate the position and direction of transcription of the
genomic en gene and the genes within P[en3R]. Bottom: doublelabel (DL) for En (red) and β-gal (green) shows that P[en3R]–210bp
interferes with the transcription of the endogenous en gene in
stripes. β-gal is expressed in stripes. By contrast, En, but not β-gal, is
expressed in the clypeolabrum (cl), hindgut (hg), PNS, fat body (fb)
and posterior spiracles (ps). Top row of images: ventral-lateral view
of the anterior part of a stage 11 embryo is shown, with dorsal up
and anterior to the left. Bottom row of images: lateral view of the
posterior part of a stage 13 embryo, with dorsal up and anterior to
the left. (B) Top: the position and orientation of the P[enHSP]–250bp
transgene. Images show that En and β-gal are both expressed in
stripes in these embryos. As in A, En, but not β-gal, is expressed in
the clypeolabrum (cl). Lateral view of the anterior part of a stage 13
embryo, with anterior to the left and dorsal up, is shown. The En
antibody also stains the salivary glands non-specifically, and these are
evident as horizontal line-like structures in the En and DL images.
RESEARCH ARTICLE 3073
Our data suggest that the en promoter present in a P[en] construct
only strongly competes with the endogenous en promoter when it
is inserted into the immediate vicinity of the endogenous en
promoter.
More evidence for two partially redundant
promoter-tethering elements at en
We previously reported that a 530 bp deletion in the en locus,
including the 181 bp PRE and sequences upstream, caused a slight
defect in the posterior region of the wings, suggesting a decrease in
the activity of the wing imaginal disc enhancer (DeVido et al., 2008).
Using the same method, we generated another line, enJ86B, that
contains a 339 bp deletion, removing sequences from –412 to –73
bp upstream of the en transcription start site (see Materials and
methods for details). Embryonic en expression is normal in this line
(data not shown). enJ86B/enIM99 (enIM99 is a lethal en allele) flies
survive, but have wings with slight defects in the posterior
compartment, suggesting a disruption in en expression in the wing
imaginal disc. A smaller deletion, from –412 to –273 bp upstream
of the en transcription start site (line en⌬139), causes no discernible
phenotypic defect. We suggest that there is a promoter-tethering
element in the 200 bp fragment extending from –273 to –73 bp
upstream of the en transcription start site that facilitates expression
in the imaginal discs.
DISCUSSION
Comparison of the inv and en promoters
en and inv exist in a gene complex, encode related proteins with
redundant functions and share regulatory DNA (Goldsborough
and Kornberg, 1994; Gustavson et al., 1996). Thus, en enhancers
must be able to activate both the en and inv promoters, which are
separated by 54 kb. What properties do these two promoters
share? First, en and inv are both TATA-less promoters. Both en
and inv have the initiator promoter element (Inr) and the
downstream promoter element (DPE). The inv promoter has a
perfect match to the Inr consensus sequence for Drosophila (at
nucleotide 7,363,212), and a near match to the DPE 28 bp after
the initiating adenine. The en promoter has a near match to the Inr
consensus and a perfect match to the DPE located 30 bp
downstream of the third nucleotide of the Inr sequence (Burke and
Kadonaga, 1996). Second, both promoters have binding sites for
the transcription factor GAGA, which are located just upstream
of the transcription start site. GAGA-binding sites greatly increase
the activity of the en promoter (Orihara et al., 1999). Third, both
have Polycomb response elements (PREs) located very close to
the promoters (Nègre et al., 2006; DeVido et al., 2008)
(Cunningham, Brown and Kassis, unpublished). Finally, we
compared the DNA sequences from 600 bp upstream to 400 bp
downstream of the inv promoter with the 588 bp en promoter
fragment we used and found a few stretches of sequence identity.
The longest was a 14/15 bp match located from –57 to –42
upstream of the en transcription start site and from –40 to –25 bp
upstream of the inv transcription start site. The functional
significance of this is unknown.
We examined the sequences around the presumed transcription
start sites for all of the transcripts shown in Fig. 1 (we assumed
that the transcripts for these genes in FlyBase and GenBank are
full length). Strikingly, aside from sprt, none of these genes had
sequences that matched the TATA, Inr or DPE consensus
sequences [consensus sequences from Juven-Gershon et al.
(Juven-Gershon et al., 2008)]. Like en and inv, the sprt gene has
Inr and DPE elements. Unlike en and inv, no PREs were found at
DEVELOPMENT
Enhancer-promoter specificity
the sprt gene [as judged by the binding of PcG proteins (Oktaba
et al., 2008; Schwartz et al., 2006)]. We suggest that sprt is not
activated by en enhancers because it lacks the PREs (or associated
sequences) that are necessary for the long-distance action of the
en enhancers.
The minimal heat shock promoter present in P[enHSP] contains
sequences –44 to +204 bp of the HSP70 promoter. It contains the
TATA element but does not have any of the GAGA sites that are
located further upstream. We previously found that a slightly
different version of this promoter (from –73 to +70 bp) would not
function in a reporter construct with the en stripe enhancer present
in the intron, although it was able to function with enhancers that
drive expression in the hindgut, fat body and posterior spiracles
(Kassis, 1990). Those data, combined with our current results,
clearly show that different en enhancers have different promoter
requirements. The ability of different types of core promoters to
recognize different enhancers has been reported by many other
investigators and may be a common mechanism to achieve enhancer
specificity in Drosophila (Merli et al., 1996; Ohtsuki et al., 1998;
Butler and Kadonaga, 2001; Butler and Kadonaga, 2002; JuvenGershon et al., 2008).
Promoter-enhancer communication at engrailed
At least three distinct processes mediate promoter specificity at en.
First, the early stripe enhancers, those activated by the pair-rule
transcription activators, require the en promoter; they are not able to
stimulate the heat shock promoter. We suggest this could be due to
the type of core promoter present at en, or to sequences very near the
transcription start site. The en allele enJ86 contains a deletion from
–412 to –73 bp upstream of the en transcription start site and shows
no disruption of early en expression. Thus, sequences within 73 bp
of the transcription start site are sufficient for interaction with early
stripe enhancers. Caudal, an early acting developmental
transcription factor, was recently found to specifically activate DPEcontaining promoters (Juven-Gershon et al., 2008). It would be
interesting to test whether pair-rule proteins also exhibit promoter
specificity.
Second, we propose there are two promoter-tethering elements
that mediate interactions with the imaginal disc enhancers. One of
them is located in the 181 bp element, PRE2, and another is located
between –273 and –73 bp. en joins a growing list of Drosophila
genes that have promoter-tethering elements, including the homeotic
genes Scr and Abd-B, as well as the white and string genes (Calhoun
et al., 2002; Akbari et al., 2008; Qian et al., 1992; Lehman et al.,
1999). It is likely that many other genes with extensive regulatory
regions have promoter-tethering elements.
Finally, we have previously shown that the 2 kb PRE fragment,
from –2.4 to –0.4 kb, is required for distantly located transgenes to
interact with the en enhancers (DeVido et al., 2008). Here we show
that the en promoter is also required for long-range enhancerpromoter interactions. We suggest that both the promoter and the
PRE fragment are necessary to form the correct chromatin structure
to allow interactions with distant en enhancers. In conclusion, our
data suggest that multiple mechanisms exist to ensure that en
enhancers activate the correct promoters.
Acknowledgements
We thank Renato Paro for the pUZ vector; Pat O’Farrell and Nikita Yakubovich
for the anti-En antibody; Miki Fujioka, Jim Jaynes, Karl Pfeifer, Mark Mortin
and the Kassis lab members for comments on this manuscript. Diane Mucci
was supported by a grant from the Cystic Fibrosis Foundation and by internal
Development 136 (18)
funds from the Food and Drug Administration. This research was supported by
the Intramural Research Program of the NIH, NICHD. Deposited in PMC for
release after 12 months.
References
Akbari, O. S., Bae, E., Johnsen, H., Villaluz, A., Wong, D. and Drewell, R. A.
(2008). A novel promoter-tethering element regulates enhancer-driven gene
expression at the bithorax complex in the Drosophila embryo. Development 135,
123-131.
Bender, W. and Hudson, A. (2000). P element homing to the Drosophila bithorax
complex. Development 127, 3981-3992.
Bier, E., Vaessin, H., Shepherd, S., Lee, K., McCall, K., Barbel, S., Ackerman,
L., Carretto, R., Uemura, T., Grell, E. et al. (1989). Searching for pattern and
mutation in the Drosophila genome with a P-lacZ vector. Genes Dev. 3, 12731287.
Burke, T. W. and Kadonaga, J. T. (1996). Drosophila TFIID binds to a conserved
downstream basal promoter element that is present in many TATA-box-deficient
promoters. Genes Dev. 10, 711-724.
Butler, J. E. F. and Kadonaga, J. T. (2001). Enhancer-promoter specificity
mediated by DPE or TATA core promoter motifs. Genes Dev. 15, 2515-2519.
Butler, J. E. F. and Kadonaga, J. T. (2002). The RNA polymerase II core promoter:
a key component in the regulation of gene expression. Genes Dev. 16, 25832592.
Calhoun, V. C., Stathopoulos, A. and Levine, M. (2002). Promoter-proximal
tethering elements regulate enhancer-promoter specificity in the Drosophila
Antennapedia complex. Proc. Natl. Acad. Sci. USA 99, 9243-9247.
Coleman, K. G., Poole, S. J., Weir, M. P., Soeller, W. C. and Kornberg, T.
(1987). The invected gene of Drosophila: sequence analysis and expression
studies reveal a close kinship to the engrailed gene. Genes Dev. 1, 19-28.
DeVido, S. K., Kwon, D., Brown, J. L. and Kassis, J. A. (2008). The role of
Polycomb-group response elements in regulation of engrailed transcription in
Drosophila. Development 135, 669-676.
DiNardo, S., Kuner, J. M., Theis, J. and O’Farrell, P. H. (1985). Development of
embryonic pattern in D. melanogaster as revealed by accumulation of the
nuclear engrailed protein. Cell 43, 59-69.
DiNardo, S., Sher, E., Heemskerk-Jongens, J., Kassis, J. A. and O’Farrell, P. H.
(1988). Two-tiered regulation of spatially patterned engrailed gene expression
during Drosophila embryogenesis. Nature 332, 604-609.
Fujioka, M., Wu, X. and Jaynes, J. B. (2009). A chromatin insulator mediates
transgene homing and very long-range enhancer-promoter communication.
Development 136, 3077-3087.
Gaszner, M. and Felsenfeld, G. (2006). Insulators: exploiting transcriptional and
epigenetic mechanisms. Nat. Rev. Genet. 7, 703-713.
Goldsborough, A. S. and Kornberg, T. B. (1994). Allele-specific quantification of
Drosophila engrailed and invected transcripts. Proc. Natl. Acad. Sci. USA 91,
12696-12700.
Gustavson, E., Goldsborough, A. S., Ali, Z. and Kornberg, T. B. (1996). The
Drosophila engrailed and invected genes: Partners in regulation, expression, and
function. Genetics 142, 893-906.
Hama, C., Ali, Z. and Kornberg, T. B. (1990). Region-specific recombination and
expression are directed by portions of the Drosophila engrailed promoter. Genes
Dev. 4, 1079-1093.
Hong, J. W., Hendrix, D. A. and Levine, M. S. (2008). Shadow enhancers as a
source of evolutionary novelty. Science 321, 1314.
Juven-Gershon, T., Hsu, J. Y. and Kadonaga, J. T. (2008). Caudal, a key
developmental regulator, is a DPE-specific transcriptional factor. Genes Dev. 22,
2823-2830.
Juven-Gershon, T., Hsu, J. Y., Theisen, J. W. M. and Kadonaga, J. T. (2008).
The RNA polymerase II core promoter: the gateway to transcription. Curr. Opin.
Cell Biol. 20, 253-259.
Kassis, J. A. (1990). Spatial and temporal control elements of the Drosophila
engrailed gene. Genes Dev. 4, 433-443.
Kassis, J. A. (1994). Unusual properties of regulatory DNA from the Drosophila
engrailed gene: Three “pairing-sensitive” sites within a 1.6-kb region. Genetics
136, 1025-1038.
Kassis, J. A., VanSickle, E. P. and Sensabaugh, S. M. (1991). A fragment of
engrailed regulatory DNA can mediate transvection of the white gene in
Drosophila. Genetics 128, 751-761.
Kassis, J. A., Noll, E., VanSickle, E. P., Odenwald, W. F. and Perrimon, N.
(1992). Altering the insertional specificity of a Drosophila transposable element.
Proc. Natl. Acad. Sci. USA 89, 1919-1923.
Kuner, J. M., Nakanishi, M., Ali, Z., Drees, B., Gustavson, E., Theis, J.,
Kauvar, L., Kornberg, T. and O’Farrell, P. H. (1985). Molecular cloning of
engrailed: a gene involved in the development of pattern in Drosophila
melanogaster. Cell 42, 309-316.
Kutach, A. K. and Kadonaga, J. T. (2000). The downstream promoter element
DPE appears to be as widely used as the TATA box in Drosophila core promoters.
Mol. Cell. Biol. 20, 4754-4764.
DEVELOPMENT
3074 RESEARCH ARTICLE
Langlais, K. K., Stewart, J. A. and Morton, D. B. (2004). Preliminary
characterization of two atypical sGC in the central and peripheral nervous
system of Drosophila melanogaster. J. Exp. Biol. 207, 2323-2338.
Lehman, D. A., Patterson, B., Johnston, L. A., Balzer, T., Britton, J. S., Saint,
R. and Edgar, B. A. (1999). Cis-regulatory elements of the mitotic regulator,
string/Cdc25. Development 126, 1793-1803.
Lyko, F., Brenton, J. D., Surani, M. A. and Paro, R. (1997). An imprinting
element from the mouse H19 locus functions as a silencer in Drosophila. Nat.
Genet. 16, 171-173.
Merli, C., Bergstrom, D. E., Cygan, J. A. and Blackman, R. K. (1996). Promoter
specificity mediates the independent regulation of neighboring genes. Genes
Dev. 10, 1260-1270.
Müller, J. and Kassis, J. A. (2006). Polycomb response elements and targeting of
Polycomb group proteins in Drosophila. Curr. Opin. Genet. Dev. 16, 476-484.
Nègre, N., Hennetin, J., Sun, L. V., Lavrov, S., Bellis, M., White, K. P. and
Cavalli, G. (2006). Chromosomal distribution of PcG proteins during Drosophila
development. PLoS Biol. 4, e170.
Ohtsuki, S., Levine, M. and Cai, H. N. (1998). Different core promoters
possess distinct regulatory activities in the Drosophila embryo. Genes Dev. 12,
547-556.
Oktaba, K., Gutierrez, L., Gagneur, J., Girardot, C., Sengupta, A. K., Furlong,
E. E. M. and Müller, J. (2008). Dynamic regulation of Polycomb group protein
complexes controls pattern formation and the cell cycle in Drosophila. Dev. Cell
15, 1-13.
Orihara, M., Hosono, C., Kojima, T. and Saigo, K. (1999). Identification of
engrailed promoter elements essential for interactions with a stripe enhancer in
Drosophila embryos. Genes Cells 4, 205-218.
RESEARCH ARTICLE 3075
Qian, S., Varjavand, B. and Pirrotta, V. (1992). Molecular analysis of the zestewhite interaction reveals a promoter-proximal element essential for distant
enhancer-promoter communication. Genetics 131, 79-90.
Ringrose, L. and Paro, R. (2007). Polycomb/Trithorax response elements and
epigenetic memory of cell identity. Development 134, 223-232.
Schwartz, Y. B., Kahn, T. G., Nix, D. A., Li, X. Y., Bourgon, R., Biggin, M. and
Pirrotta, V. (2006). Genome-wide analysis of Polycomb targets in Drosophila
melanogaster. Nat. Genet. 38, 700-705.
Smale, S. T. (2001). Core promoters: active contributors to combinatorial gene
regulation. Genes Dev. 15, 2503-2508.
Soeller, W. C., Poole, S. J. and Kornberg, T. (1988). In vitro transcription of the
Drosophila engrailed gene. Genes Dev. 2, 68-81.
Stankunas, K., Berger, J., Ruse, C., Sinclair, D. A. R., Randazzo, F. and Brock, H.
W. (1998). The Enhancer of Polycomb gene of Drosophila encodes a chromatin
protein conserved in yeast and mammals. Development 125, 4055-4066.
Strutt, H. and Paro, R. (1997). The Polycomb group protein complex of
Drosophila melanogaster has different compositions at different target genes.
Mol. Cell. Biol. 17, 6773-6783.
Taillebourg, E. and Dura, J. M. (1999). A novel mechanism for P element
homing in Drosophila. Proc. Natl. Acad. Sci USA 96, 6856-6861.
Tomancak, P., Beaton, A., Weiszmann, R., Kwan, E., Shu, S., Lewis, S. E.,
Richards, S., Ashburner, M., Hartenstein, V., Celniker, S. E. et al. (2002).
Systematic determination of patterns of gene expression during Drosophila
embryogenesis. Genome Biol. 3, 0088.1-0088.14.
Whiteley, M. and Kassis, J. A. (1997). Rescue of Drosophila engrailed mutants
with a highly divergent mosquito engrailed cDNA using a homing, enhancertrapping transposon. Development 124, 1531-1541.
DEVELOPMENT
Enhancer-promoter specificity