RESEARCH ARTICLE 1315
Development 135, 1315-1324 (2008) doi:10.1242/dev.016469
Three PIGGYBACK genes that specifically influence leaf
patterning encode ribosomal proteins
Violaine Pinon1,*, J. Peter Etchells1,*,†, Pascale Rossignol1, Sarah A. Collier1, Juana M. Arroyo2,
Robert A. Martienssen2 and Mary E. Byrne1,‡
Leaves are determinate organs that arise from the flanks of the shoot apical meristem as polar structures with distinct adaxial
(dorsal) and abaxial (ventral) sides. Opposing regulatory interactions between genes specifying adaxial or abaxial fates function to
maintain dorsoventral polarity. One component of this regulatory network is the Myb-domain transcription factor gene
ASYMMETRIC LEAVES1 (AS1). The contribution of AS1 to leaf polarity varies across different plant species; however, in Arabidopsis,
as1 mutants have only mild defects in leaf polarity, suggesting that alternate pathways exist for leaf patterning. Here, we describe
three genes, PIGGYBACK1 (PGY1), PGY2 and PGY3, which alter leaf patterning in the absence of AS1. All three pgy mutants
develop dramatic ectopic lamina outgrowths on the adaxial side of the leaf in an as1 mutant background. This leaf-patterning
defect is enhanced by mutations in the adaxial HD-ZIPIII gene REVOLUTA (REV), and is suppressed by mutations in abaxial KANADI
genes. Thus, PGY genes influence leaf development via genetic interactions with the HD-ZIPIII-KANADI pathway. PGY1, PGY2 and
PGY3 encode cytoplasmic large subunit ribosomal proteins, L10a, L9 and L5, respectively. Our results suggest a role for translation in
leaf dorsoventral patterning and indicate that ribosomes are regulators of key patterning events in plant development.
INTRODUCTION
Early in development leaf primordia establish dorsoventral polarity.
Outgrowth of the leaf lamina requires juxtaposition of adaxial
(dorsal) and abaxial (ventral) domains of the leaf, which are
specified by concerted interactions between domain-specific genetic
pathways (Barkoulas et al., 2007; Kidner and Timmermans, 2007).
Several transcription factor families are involved in establishing
adaxial and abaxial fates. One such family is the class III
homeodomain-leucine zipper (HD-ZIPIII) genes, which includes
PHABULOSA (PHB), PHAVOLUTA (PHV) and REVOLUTA (REV)
(Byrne, 2006; McConnell et al., 2001; Otsuga et al., 2001; Talbert
et al., 1995; Zhong and Ye, 1999). These genes are all expressed
throughout incipient primordia and later become localised to the
adaxial side of primordia (Emery et al., 2003; McConnell et al.,
2001; Otsuga et al., 2001; Prigge et al., 2005; Talbert et al., 1995;
Zhong and Ye, 1999). Combined mutations in PHB, PHV and REV
reduce adaxial fate, whereas dominant mutations in the HD-ZIPIII
genes show replacement of abaxial tissue by adaxial tissue (Emery
et al., 2003; McConnell et al., 2001; Ochando et al., 2006; Prigge et
al., 2005; Zhong and Ye, 2004). HD-ZIPIII genes have a mutually
antagonistic relationship with KANADI genes, which encode
GARP putative transcription factors (Eshed et al., 1999; Eshed et al.,
2001; Izhaki and Bowman, 2007; Kerstetter et al., 2001). KANADI
genes are expressed abaxially in a pattern complementary to HDZIPIII gene expression. Loss of two or more KANADI genes results
in polarity defects, and reduced abaxial fate is associated with
ectopic outgrowths on the abaxial side of leaves (Eshed et al., 2004;
Izhaki and Bowman, 2007).
One additional component of the leaf dorsoventral patterning
network is the MYB domain transcription factor ASYMMETRIC
LEAVES1 (AS1). Loss of function of the AS1 orthologue in
Antirrhinum, tobacco, tomato and pea results in adaxial defects,
ranging from patches of abaxial cells on the adaxial side of the leaf
to leaves that are radial due to complete loss of adaxial fate (Kim et
al., 2003; McHale and Koning, 2004; Tattersall et al., 2005; Waites
and Hudson, 1995; Waites et al., 1998). By contrast, mutations in
AS1 in Arabidopsis have only subtle polarity defects (Byrne et al.,
2000; Ori et al., 2000; Xu et al., 2003). One possibility is that AS1 in
Arabidopsis contributes to leaf polarity redundantly with other
factors (Byrne et al., 2000; Garcia et al., 2006; Huang et al., 2006;
Ueno et al., 2007).
We have isolated three enhancers of as1, called PIGGYBACK1
(PGY1), PGY2 and PGY3, all of which have a similar phenotype and
condition ectopic leaf lamina outgrowths on the adaxial side of the
as1 leaf. We refer to this phenotype as a ‘piggyback’ phenotype, as
ectopic outgrowths resemble epiphyllous structures found on the
adaxial side of the leaf of the ‘piggyback begonia’ (Begonia hispida
var. cucullifera) (Maier and Sattler, 1977). Here, we describe the as1
pgy phenotype, and demonstrate that AS1 and PGY1 independently
promote dorsoventral polarity. AS1 has minor interactions with the
HD-ZIPIII-KANADI pathway, whereas genetic interactions
position PGY1 as an integral component of this pathway. PGY1,
PGY2 and PGY3 genes encode cytoplasmic large subunit ribosomal
proteins, L10a, L9 and L5. We propose that leaf-patterning
mechanisms involving the HD-ZIPIII-KANADI pathway include
ribosome-mediated translational regulation.
1
MATERIALS AND METHODS
Department of Crop Genetics, John Innes Centre, Norwich NR4 7UH, UK. 2Cold
Spring Harbor Laboratory, Cold Spring Harbor, NY 11724, USA.
*These authors contributed equally to this work
Present address: University of Manchester, Manchester M13 9PT, UK
‡
Author for correspondence (e-mail: [email protected])
†
Accepted 3 January 2008
Plant stocks and growth conditions
pgy1-1, pgy1-2, pgy2-1 and pgy3-1 were generated in an as1-1 mutant
background, as described previously (Byrne et al., 2002). All pgy alleles
segregate as single recessive loci. Mutants were backcrossed to Landsberg
erecta (Ler) twice before genetic analysis. pgy2-2 was a GABI-Kat
(128H07) T-DNA insertion line (Rosso et al., 2003). rev-6 was obtained
DEVELOPMENT
KEY WORDS: Ribosomal protein, Leaf polarity, ASYMMETRIC LEAVES1, PIGGYBACK, Arabidopsis
1316 RESEARCH ARTICLE
Development 135 (7)
from the Arabidopsis Biological Resource Centre (ABRC). kan1-2 and
kan2-1 were obtained from John Bowman. All genetic interactions were in
a Ler background. Plants were grown either in soil or on Murashige and
Skoog media at 22°C with a day length of 16 hours.
Genetics
pgy genes were cloned using Ler ⫻ Columbia F2 mapping populations. For
complementation a 2.1 kb genomic fragment encompassing At2g27530, a 5
kb genomic fragment encompassing At1g33140 and a 3.5 kb genomic
fragment encompassing At3g25520 were cloned into the binary vector
pMDC123 (Curtis and Grossniklaus, 2003) and transformed into pgy11/pgy1-1 as1/+, pgy2-1/pgy2-1 as1/+ and pgy3-1/pgy3-1 as1/+ plants,
respectively, using standard agrobacterium-mediated transformation (Clough
and Bent, 1998). For each complementation construct, basta resistant plants
with an as1 phenotype were confirmed as as1 pgy homozygotes.
as1-1 rev-6 was analysed in the F3 generation of the cross as1-1 ⫻ rev6. In the F2 generation of this cross as1-1 rev-6 segregated at 1:15. pgy1-1
rev-6 were obtained from the F3 generation of the cross pgy1-1 ⫻ rev-6.
Progeny from pgy1-1 rev-6/+ individuals segregated 1:3 pgy1-1 rev-6
mutants. as1-1 pgy1-1 rev-6 triple mutants were analysed in the F4
generation of the cross as1-1 pgy1-1 ⫻ as1-1 rev-6, after selfing as1-1 pgy11 rev-6/+ F3 plants. Segregation of as1-1 pgy1-1 rev-6 in this F4 generation
was 1:3. as1-1 kan1-2 and pgy1-1 kan1-2 were obtained from the F3
generation of the respective crosses as1-1 ⫻ kan1-2 and pgy1-1 ⫻ kan1-2.
as1-1 pgy1-1 kan1-2 triple mutants were identified in the F4 generation after
selfing as1-1 pgy1-1 kan1-2/+ F3 plants from the cross of kan1-2 ⫻ as1-1
pgy1-1. Segregation of as1-1 pgy1-1 kan1-2 in this F4 generation was 1:3.
Double and triple mutant combinations of as1-1, pgy1-1 and kan2-1 were
generated in an identical manner. as1-1 kan1-2 kan2-1 or kan2-1/+, pgy1-1
kan1-2 kan2-1 or kan2-1/+ and as1-1 pgy1-1 kan1-2 kan2-1 or kan2-1/+
were analysed in the F3 and F4 generations of the respective crosses as1-1
⫻ kan1-2 kan2-1/+, pgy1-1 ⫻ kan1-2 kan2-1/+ and as1-1 pgy1-1 ⫻ kan12 kan2-1/+. In progeny from as1-1 pgy1-1 kan1-2/+ kan2-1/+, plants with a
suppressed as1-1 pgy1-1 phenotype segregated 6:10 and plants with a kan
double mutant phenotype segregated 1:15. Combinations of pgy mutants in
the as1-1 background were generated from the crosses of as1-1 pgy1-1 ⫻
as1-1 pgy2-1, and as1-1 pgy1-1 pgy2-1 ⫻ as1-1 pgy3-1. The genotype of all
combinatorial mutants was confirmed either by sequencing or by CAPS
analysis using allele-specific polymorphisms as listed in Table 1.
Molecular biology
DNA manipulation was carried out using standard methods. RT-PCR and
qRT-PCR analysis was carried out using the gene-specific primers listed in
Table 1. For RT-PCR, RNA was isolated using Trizol (Invitrogen). cDNA
synthesis, following DNase treatment, was performed using a Superscript
First-Strand Synthesis System (Invitrogen). For quantitative RT-PCR (qRTPCR) total RNA was extracted from 10-day-old seedlings using Trizol
reagent and purified using an RNeasy Kit (Qiagen). All samples were
measured in technical triplicates on three biological replicates. For each pair
of primers two controls were used to confirm the absence of genomic DNA
in the RNA extract. The qRT-PCR reaction was performed using SYBR
Green JumpStart Taq ReadyMix (Sigma) on 10 ng cDNA. A standard curve
experiment (Livak and Schmittgen, 2001) showed that all the designed
primers bind with the same efficiency to template. PCR reactions were
performed using an Opticon real-time PCR instrument (MJ Research). The
PCR programme started at 94°C for 2 minutes, followed by 40 cycles of
94°C (15 seconds), 60°C (30 seconds), 72°C (1 minute) and 76°C (1
second). Melting curves were recorded from 65°C to 95°C, reading every
0.5°C. Quantification of gene expression was carried out using the method
of Livak and Schmittgen (Livak and Schmittgen, 2001). Results were
normalised to that of ACTIN2.
In situ hybridisation
Non-radioactive in situ hybridisations were performed as previously
described (Long et al., 1996) using 10-day-old seedlings. For the PGY
probes, gene-specific fragments were amplified using gene specific primers
Table 1. Primers used for genotyping and expression studies
Gene
Forward primer (5⬘ to 3⬘)
Reverse primer (5⬘ to 3⬘)
Genotyping
Genotyping primers
pgy1-1
pgy2-1
pgy3-1
rev-6
kan1-2
kan2-1
GCCTGCCTTGTTAAGACCAG
TCGTGTAGATCTCGGAATGAAA
GTAGGAAGGAGCTCTCGATG
TGCAGGTGAATCCTTTAGCC
CCTCCCAACTCGAAAACAAC
ACAACAACAACAACATCATCATCGA
GCCCATGAAACGAAATCAAT
GAAGCCAAACAATAGGCAAAA
GTCACTGTGAGGGATATC
CGTCACCAAACCCATTAACC
CCTTGGAGCTCTCATGCTTC
GAAGTGGAGGAAGAGGGTATTAGAG
Sequence change C to T
CAPS RsaI digest
CAPS PstI digest
CAPS TaqI digest
CAPS MseI digest
CAPS ClaI digest
qRT-PCR primers
ACTIN2
PHB
PHV
REV
KAN1
KAN2
ATGAAGCACAATCCAAGAGAG
AAGACCCTTGACGAACCTGGTC
ATGTCCCATTCTCTGTAACATCG
GATCCGTGAATGTTCCATTTTG
GATCCAGCATTCAAAATCAGG
TTTGCATGGGAAGTTAATCG
GAGTCATCTTCTCTCTGTTGGC
TGCTCGTAAGATACCATCCTTCC
GTTCATAGCACTCAGCTTCCTGT
GAGAGCTTCCGGTTTACGCTCT
TCCAAATTGATCAAGAAAGTCA
TTGTTCCCGAGATGCTTGAT
GACCAGGACCAAGAAGACGA
TTGTTTCGTTTCCAGGATCA
TCTCCGTTTACAGGAAGCAAA
TGGATGGTGTAACCATTGTTCG
TCGATCTGAGAAGGTGAAGGA
TCATTGCTGGTGTTACTCAAGG
AGCAAAGCCTCTCGTTGCTA
GCCTCTTGCCATCTTTTGTC
ATGAAGATTAAGGTCGTGGCA
CGTGACCTGAGAAGACACTCA
ACGCTCATCTGCACATTCTG
GAAAGATCTGCTTCTCCTCCA
TTGAATGCACAACCCACAAT
GAAATATGAGCTAAGAGGGG
CAAAGCACAAGACCGTGAAA
GTCACCAGCAATGCTTGC
GTCACCAGCAATGCTTGC
CCGAGTTTGAAGAGGCTAC
PGY1
RPL10aA
RPL10aC
PGY2
RPL9B
RPL9D
PGY3
RPL5B
ACTIN8
In situ probe primers
PGY1
PGY2
PGY3
TGGGACCACCACAAAGAAT
TGGAGACGAGCTATCATTTTCA
GCCTTCTTTATCTCATGCCTCT
TGAAATCAAAATCATATTTTAGGAG
TAGTGACTGAAGTATCAATTTTG
AAAATCAAGTCATCAAACTATTGTCA
DEVELOPMENT
RT-PCR primers
(see Table 1) and cloned into the vector pGEM-Teasy (Promega). Antisense
and sense probes were transcribed with SP6 or T7 polymerase following
linearisation of the clone plasmid.
Histology and microscopy
Scanning electron microscopy (SEM) of leaves was carried out as previously
described (Byrne et al., 2003). For SEM analysis of as1 pgy1 rev mutants,
tissue was fixed in 3% glutaraldehyde and dehydrated through an ethanol
series, before critical point drying using a Watford Polaron and sputter
coating with gold (Agar High Resolution Sputter Coater). Samples were
viewed using a Gemini Supra 55 VP SEM under high vacuum with a beam
accelerating voltage of 3 kV. For analysis of leaf vasculature, tissue was
fixed in 3% glutaraldehyde, dehydrated through an ethanol series to 100%
ethanol and embedded in JB4 resin (Agar Scientific). Embedded tissue was
sectioned at 3 ␮m and subsequently stained with 0.02% Toluidine Blue.
Images were obtained using a Nikon E800 microscope. Leaf 6 of 28-dayold plants was used for vascular sections.
RESULTS
Independent pgy mutants have similar
phenotypes
In our screen for modifiers of as1 leaf development we identified a
number of mutants, which had similar leaf development defects and
formed ectopic lamina outgrowths on the adaxial side of the leaf.
Three of these mutants were called pgy1-1, pgy2-1 and pgy3-1.
Allelism analysis demonstrated that these three mutants were
independent loci.
pgy1, pgy2 and pgy3 single mutants had a subtle phenotype
compared with wild type, with formation of slightly pointed leaves
and more prominent marginal serrations (Fig. 1A). Often these
phenotypes were visible only early in development of rosette leaves.
In contrast to single mutants, rosette leaves of as1 pgy1, as1 pgy2
and as1 pgy3 mutants were distinct from as1, and formed narrower,
elongate leaves with adaxial ectopic lamina (Fig. 1B,C). Ectopic
outgrowths were typically formed in the proximal region of late
rosette leaves; however, the penetrance of this phenotype was
environmentally conditioned, and in extreme cases ectopic
Fig. 1. Arabidopsis pgy1, pgy2 and pgy3 leaf phenotypes.
(A) Rosettes of pgy mutants. From left to right: wild type, pgy1, pgy2,
pgy3. (B) Rosettes of pgy mutants in as1 background. From left to
right: as1, as1 pgy1, as1 pgy2, as1 pgy3. (C) Rosette leaves with
ectopic outgrowths. From left to right: as1 pgy1, as1 pgy2, as1 pgy3.
(D) Rosette of as1 pgy1 pgy2 pgy3 quadruple mutant.
RESEARCH ARTICLE 1317
outgrowths were formed on most rosette and cauline leaves. To
determine the relationship between PGY genes we generated as1
pgy1 pgy2, as1 pgy2 pgy3 and as1 pgy1 pgy3 triple mutants and the
as1 pgy1 pgy2 pgy3 quadruple mutant. Although the frequency of
outgrowths was slightly increased in plants with multiple pgy
mutations, leaf phenotypes were similar to as1 pgy double mutants,
indicating that all three PGY genes contribute to the same
developmental pathway (Fig. 1D and see Fig. S1 in the
supplementary material). To further understand the developmental
defect in these mutants we selected pgy1 for more detailed
characterisation.
Initiation and development of ectopic leaf lamina
in as1 pgy1 mutants
We analysed the developmental progression of as1 pgy1 outgrowths
using SEM. The proximal and adaxial regions of immature late
rosette leaves were examined. In wild-type leaves, larger cubical
cells of the midvein are evident in the medial region of the leaf,
whereas smaller, less regular cells of the lamina are in lateral regions
(Fig. 2A). At a similar stage of development, cells in the midvein
and lamina regions of as1 leaves could be distinguished. These cells
were similar to wild type (Fig. 2B). Early in development of as1
pgy1 mutant leaves, the adaxial surface was characterised by the
appearance of dome-shaped structures (Fig. 2C) that developed into
radial, peg-like structures (Fig. 2D,E). Outgrowths subsequently
became bifacial and leaf-like. One side of fully mature outgrowths
was trichome dense and dark green, similar to the adaxial epidermis
of wild-type leaves, whereas the opposing side of outgrowths had
very few trichomes and was pale green, similar to the abaxial
epidermis of wild-type leaves (Fig. 1C and Fig. 2F). These
epidermal features of mature outgrowths are consistent with the
Fig. 2. Development of ectopic outgrowths in Arabidopsis as1
pgy1. (A-C) Adaxial surface of a late rosette leaf from 12-day-old
plants of wild type (A), as1 (B) and as1 pgy1, showing a dome-shaped
structure (arrow) of an initiating outgrowth (C). (D,E) as1 pgy1 late
rosette leaves from 15-day-old plants, showing ectopic outgrowths
forming peg-like structures. (F) as1 pgy1 late rosette leaf from an 18day-old plant forms a leaf-like structure with trichomes on the adaxial
side but not on the abaxial side of an ectopic outgrowth. Scale bars:
100 ␮m.
DEVELOPMENT
Ribosomal proteins and leaf development
Fig. 3. Vascular patterning defect in Arabidopsis as1 pgy1 leaves.
Cross sections through leaf midveins. In wild type (A), as1 (B) and pgy1
(C), xylem is adaxial and phloem is abaxial. In as1 pgy1 mutants (D),
xylem is surrounded by phloem. ph, phloem; x, xylem. Scale bars:
50 ␮m.
establishment of dorsoventral polarity. Interestingly, the polarity of
outgrowths was always oriented with the adaxial side facing the
distal tip of the leaf and the abaxial side facing the proximal base of
the leaf and the meristem (Fig. 2F).
The as1 pgy1 mutant phenotype suggests a defect
in adaxial fate
Ectopic outgrowths on leaves are typically associated with
dorsoventral polarity defects (Emery et al., 2003; Lin et al., 2003;
McConnell and Barton, 1998; Waites and Hudson, 1995). Analysis
of the adaxial surface of as1 pgy1 mutants did not reveal epidermal
features suggestive of patches of abaxial tissue on the adaxial side
of the leaf (Fig. 2). Another marker of leaf-tissue polarity is vascular
patterning. In Arabidopsis, leaf vascular bundles develop
dorsoventral polarity with xylem tissue in an adaxial position above
abaxial phloem (Fig. 3A). We used this anatomical feature to further
investigate the leaf defect in as1 pgy1. Transverse sections of leaf
midveins of as1 and pgy1 single mutants displayed a vascular
pattern similar to wild type (Fig. 3B,C). However, in the as1 pgy1
double mutants, sections of the midvein had a disorganised and
sometimes radial vascular pattern, with phloem surrounding xylem
(Fig. 3D). Radialisation of the vasculature occurred in regions of the
leaf below outgrowths. Both the ectopic outgrowths from the adaxial
leaf surface and the radial vascular pattern were consistent with
defects in adaxial fate in as1 pgy1 leaves.
rev enhances the as1 pgy1 leaf polarity defect
The dorsoventral polarity defect in as1 pgy1 leaves may occur either
through loss of adaxial fate or gain of abaxial fate. HD-ZIPIII family
genes PHB, PHV and REV act redundantly in specification of leaf
adaxial fate (Emery et al., 2003; Prigge et al., 2005). Loss of REV
function results in formation of longer and narrower leaves
compared with wild type. rev mutants also exhibit reduced lateral
shoot meristem formation, a reduction in floral meristem activity
and vascular patterning defects (Otsuga et al., 2001; Talbert et al.,
1995; Zhong and Ye, 1999). To determine whether PGY1 interacts
Development 135 (7)
Fig. 4. rev enhances as1 and as1 pgy1 leaf phenotypes in
Arabidopsis. (A) rev, with narrow and elongated leaves. (B) pgy1 rev,
with slightly narrower leaves than rev. (C) as1. (D) as1 rev, exhibiting
narrower and a more rippled leaf surface compared with as1. (E) as1
pgy1 rev triple mutants have a more severe phenotype than as1 pgy1
double mutants, with formation of very small rosettes accumulating
anthocyanin in most leaves. (F) SEM of as1 pgy1 rev rosette, showing
radial leaves (arrow). Scale bar: 50 ␮m in F.
with an HD-ZIPIII pathway, we examined genetic interactions
between as1, pgy1 and rev. Double mutants, as1 rev and pgy1 rev,
and the as1 pgy1 rev triple mutant were generated and leaf
development in these mutant combinations was compared with as1
and as1 pgy1.
pgy1 did not dramatically affect rev leaves, although pgy1 rev
double mutants had narrower leaves compared with rev (Fig.
4A,B). Rosette leaves of as1 rev mutants were more elongate and
narrower compared with as1 single mutants, and the leaf adaxial
surface of as1 rev was more rippled than that of as1 (Fig. 4C,D).
In these respects as1 rev leaves were similar to those of as1 pgy1.
However, as1 rev mutants did not develop ectopic outgrowths. By
contrast, as1 pgy1 rev triple mutants had a leaf phenotype more
severe than that of as1 pgy1, with formation of radial leaf-like
structures (Fig. 4E,F), suggesting a more severe loss of adaxial
fate. The as1 pgy1 rev phenotype indicates that all three genes act
to regulate leaf adaxial fate. However, REV, PHB and PHV
transcript levels were not significantly altered in pgy1 or as1 pgy1
mutants, indicating that PGY1 does not regulate transcription of
these genes (Fig. 6K). In contrast to a previous report (Fu et al.,
2007), we found transcript levels of these three HD-ZIPIII genes
were also not significantly altered in as1 relative to wild type (Fig.
6K).
pgy1 enhances rev inflorescence defects
In addition to leaf defects, rev mutants had a pronounced effect on
lateral meristem function, with fewer axillary meristems and
abnormal flowers (Fig. 5A,B). Inflorescences of rev single mutants
produce wild-type flowers, as well as flowers with a reduced
DEVELOPMENT
1318 RESEARCH ARTICLE
Ribosomal proteins and leaf development
RESEARCH ARTICLE 1319
Fig. 5. pgy1 enhances rev axillary meristem defects
in Arabidopsis. (A) Wild-type flowering plant. (B) rev
mutants lack axillary meristems at the base of some
cauline leaves (arrows). (C) pgy1 rev plant with reduced
stature compared with wild type and rev. Inflorescence
forms few or no flowers. (D) SEM of pgy1 rev
inflorescence. Most floral meristems either produce
filamentous structures or fail to produce any organs.
(E) rev phb phv/+ plant with reduced stature and
inflorescence with few flowers. (F) SEM of rev phb phv/+
inflorescence. Most floral meristems produce
filamentous structures similar to those in pgy1 rev. Scale
bars: 200 ␮m in D,F.
floral meristems mostly form a single radial organ (Prigge et al.,
2005). rev phb phv/+ floral meristems also produce filamentous
structures as with pgy1 rev mutants (Fig. 5E,F). These interactions
further support the suggestion that both PGY1 and REV are together
required for organ patterning.
KANADI genes are required for the as1 pgy1
phenotype
KANADI family genes repress HD-ZIPIII genes and specify
abaxial fate. kan1 single mutants have only subtle leaf phenotypes,
whereas kan1 kan2 double mutants have adaxialised, small and
Fig. 6. kan1 suppresses the as1 pgy1 leaf
phenotype in Arabidopsis. (A-C) Rosettes of as1 (A),
as1 kan1 (B) and as1 kan1 kan2/+ (C). The rosette
leaves of as1 kan1 (B) and as1 kan1 kan2/+ (C) have a
surface slightly less rippled than as1 (A). (D-F) Rosettes
of as1 pgy1 (D), as1 pgy1 kan1 (E) and as1 pgy1 kan1
kan2/+ (F). The as1 pgy1 phenotype is suppressed by
kan1, and to a greater extent in a kan1 kan2/+
background, such that as1 pgy1 kan1 kan2/+ rosette
leaves are more similar to as1. (G-J) Plants of kan1 kan2
(G), as1 kan1 kan2 (H), pgy1 kan1 kan2 (I) and as1 pgy1
kan1 kan2 (J). The kan1 kan2 phenotype is not
suppressed by as1, pgy1, or by as1 pgy1.
(K) Quantitative RT-PCR was used to assay expression
levels of PHB, PHV, REV, KAN1 and KAN2 in the
following genotypes: wild type, pgy1, as1 and as1 pgy1.
Results were normalised to ACTIN2, with the value from
wild-type plants arbitrarily set to 1.0. Bars indicate the
standard deviation between three biological replicates.
ANOVA statistical analysis indicates a significant
difference between Ler and as1 pgy1 for KAN1 and
KAN2 expression. Scale bars: 1 cm in G-J.
DEVELOPMENT
complement of inner whorl organs. Additionally, rev floral
meristems may fail to produce a flower, instead only forming a
terminal filamentous structure (Otsuga et al., 2001; Talbert et al.,
1995). Although the leaf phenotype of rev was only slightly
modified by pgy1, the inflorescence and flowers of rev were
significantly altered by pgy1. pgy1 rev inflorescences initially
formed one or two fertile flowers. Subsequent floral meristems only
gave rise to a terminal filamentous organ or did not produce organs
(Fig. 5C,D). The pgy1 enhancement of rev was similar to phv and
phb/+ enhancement of rev. rev phv, rev phb/+ and rev phv phb/+
mutants initially produce several fertile flowers and subsequent
narrow leaves with ectopic radial leaf-like structures forming on the
abaxial side of the leaf (Fig. 6G) (Eshed et al., 2001; Eshed et al.,
2004; Kerstetter et al., 2001). To further understand the interaction
of PGY1 with the HD-ZIPIII-KANADI dorsoventral patterning
pathway we generated the as1 kan1 and pgy1 kan1 double mutants
and the as1 pgy1 kan1 triple mutant. as1 kan1 leaves were only
slightly different from those of as1, being less rolled under at the
margins (Fig. 6A,B). The leaf phenotype of pgy1 is subtle and no
significant changes were apparent in the pgy1 kan1 double mutants
(data not shown). In contrast to as1 kan1, the as1 pgy1 kan1 triple
mutant displayed significant suppression of the as1 pgy1
phenotype. In the vegetative rosette, as1 pgy1 kan1 leaves did not
have the narrow, elongated shape of as1 pgy1 leaves, and the triple
mutant had a phenotype more like that of as1 (Fig. 6D,E),
indicating that the suppression of the as1 pgy1 phenotype by kan1
is mainly the effect of an interaction between pgy1 and kan1. As
with kan1, the as1 pgy1 phenotype was also suppressed by kan2
(data not shown).
Abaxial defects are enhanced by combining kan mutants,
indicating dosage effects between KANADI genes (Eshed et al.,
2004; Izhaki and Bowman, 2007). Therefore we tested if a dosage
effect would have consequences on as1 and as1 pgy1 mutants. We
generated as1 kan1 kan2/+ and as1 pgy1 kan1 kan2/+ combinatorial
mutants. Leaves of as1 kan1 kan2/+ were similar to those of as1
kan1, showing only mild suppression of as1 (Fig. 6A-C). By
contrast, the suppression of as1 pgy1 was more pronounced in as1
pgy1 kan1 kan2/+ mutants relative to as1 pgy1 kan1, with leaves
broader and rounder, and developing only few outgrowths (Fig. 6DF). These interactions suggest an underlying dosage effect of
KANADI function on pgy1. Consistent with these genetic
interactions, expression of KAN1 and KAN2 was not significantly
altered in as1 or pgy1, whereas both KAN1 and KAN2 were slightly
upregulated in as1 pgy1 (Fig. 6K). The suppression of the as1 pgy1
phenotype by kan mutations suggest that ectopic expression of
KANADI genes is a cause of the ectopic outgrowths on the adaxial
side of as1 pgy1 leaves.
To further test dose effects of kan mutants on as1 pgy1, we
generated as1 kan1 kan2 and pgy1 kan1 kan2 triple mutants, as well
as the as1 pgy1 kan1 kan2 quadruple mutant. Leaves of as1 kan1
kan2 were more severely affected and smaller in size than those of
kan1 kan2, but otherwise had features of kan1 kan2 leaves (Fig. 6H)
(Ha et al., 2007). pgy1 kan1 kan2 leaves were indistinguishable
from kan1 kan2 leaves (Fig. 6I). In the as1 pgy1 kan1 kan2
quadruple mutant leaves had abaxial outgrowths as in kan1 kan2
(Fig. 6J). These phenotypes indicate that neither AS1 nor PGY1 are
required for the severe adaxialised leaf phenotypes resulting from
loss of both kan1 and kan2. In the as1 pgy1 kan1 kan2 quadruple
mutants, outgrowths were often limited to the abaxial side of the
leaves, consistent with KAN requirement for the as1 pgy1
phenotype.
pgy1 suppresses kan gynoecium defects
KANADI genes repress HD-ZIPIII genes and kan mutant
phenotypes are in part due to ectopic HD-ZIPIII gene expression
(Eshed et al., 2001; Izhaki and Bowman, 2007). Genetic interactions
indicate that PGY1 functions together with REV in organ patterning
and that pgy1 may enhance rev through effects on other HD-ZIPIII
genes. However, pgy1 does not suppress the strong leaf defect of
kan1 kan2 mutants. To further explore the relationship between AS1,
PGY1 and KANADI genes, we tested whether as1 and pgy1 could
suppress other kan mutant phenotypes. The kan1 kan2 double
mutant has dramatic effects on gynoecium development, with
Development 135 (7)
Fig. 7. pgy1 suppresses the kan1 kan2/+ gynoecium phenotype
in Arabidopsis. (A-D) Flowering inflorescences of wild type (A), kan1
kan2/+ (B), as1 kan1 kan2/+ (C) and pgy1 kan1 kan2/+ (D). (E-H) Single
siliques of wild type (E), kan1 kan2/+ (F), as1 kan1 kan2/+ (G) and pgy1
kan1 kan2/+ (H). kan1 kan2/+ and as1 kan1 kan2/+ siliques exhibit a
similar phenotype, with proliferation of septum and formation of
ectopic styles along the abaxial replum, between the two fused carpels
(arrows). pgy1 kan1 kan2/+ silique (H) has less ectopic tissue and is
more elongated compared with kan1 kan2/+ siliques (F). Scale bars: 1
mm in E-H.
proliferation of ectopic septum and ovules on the abaxial sides of the
carpels (Eshed et al., 2001). As with the kan1 kan2 mutant, the
combination of kan1 kan2/+ also displayed gynoecium defects, with
ectopic septum and style tissues between the fused carpels, and an
increase in apical style and stigma size (Fig. 7F). In as1 kan1 kan2/+
mutants, gynoecia were smaller, but otherwise similar to those
of kan1 kan2/+ (Fig. 7G). In pgy1 kan1 kan2/+ mutants, the
characteristic silique phenotype of kan1 kan2/+ (Fig. 7B,F) was
suppressed by pgy1 (Fig. 7D,H). The siliques were more elongated
in pgy1 kan1 kan2/+ compared with kan1 kan2/+, and their
morphology was similar to wild type (Fig. 7A,E) except for
occasional ectopic style tissue along the abaxial replum (Fig. 7H).
pgy1 kan1 kan2/+ are fertile, whereas kan1 kan2/+ gynoecium
defects result in greatly reduced fertility. Therefore PGY1, but not
AS1, is required for the kan1 kan2/+ gynoecium phenotype.
PGY genes encode ribosomal proteins
PGY1, PGY2 and PGY3 were identified by positional cloning, and
all three genes were found to encode cytoplasmic large subunit
ribosomal proteins (Fig. 8A). pgy1-1 had a base pair change
resulting in a premature stop codon in At2g27530. A second
independent allele of pgy1, designated pgy1-2, also had a base pair
change resulting in a premature stop codon in At2g27530. The as1
pgy1-2 mutant phenotype was the same as as1 pgy1-1. This gene
encodes ribosomal protein L10a, which is a member of the
L1p/L10e family, involved in binding and release of deacylated tRNA from the E site of the ribosome (Nikulin et al., 2003;
Yusupov et al., 2001). A point mutation in pgy2-1 resulted in a
splicing defect in At1g33140, whereas an insertion mutant allele,
DEVELOPMENT
1320 RESEARCH ARTICLE
Ribosomal proteins and leaf development
RESEARCH ARTICLE 1321
margins of developing leaves (Fig. 8B-D and see Fig. S3 in the
supplementary material). These high levels of expression are
coincident with small cytoplasmically dense cells. PGY genes,
therefore, do not appear to regulate organ patterning through tissuespecific expression.
Fig. 8. Arabidopsis PGY genes encode ribosomal proteins.
(A) Schematic representation of PGY1/RPL10aB, PGY2/RPL9C,
PGY3/RPL5A genes showing sites of point mutations in pgy1-1, pgy1-2,
pgy2-1, pgy3-1 alleles and site of T-DNA insertion in pgy2-2.
(B-D) mRNA expression patterns of PGY1 (B), PGY2 (C) and PGY3 (D) in
transverse sections of 10-day-old vegetative apices. All three genes are
expressed in the meristem and throughout leaf primordia. In older
leaves expression is higher in the vasculature and at the margins of the
leaf, in cytoplasmically dense cells. Scale bars: 50 ␮m.
pgy2-2, failed to accumulate significant levels of transcript (see
Fig. S2A in the supplementary material). As with as1 pgy2-1
mutants, as1 pgy2-2 mutants formed adaxial ectopic outgrowths.
PGY2 encodes ribosomal protein L9, which is a member of the
L6p/L9e family. This ribosomal protein is located at the base of the
stalk protuberance, in a region important for translation-initiationfactor binding (Ban et al., 1999). A point mutation in pgy3-1
resulted in an amino acid change in the protein encoded by
At3g25520, which encodes ribosomal protein L5. This ribosomal
protein is a member of the L18p/L5e family. L18p/L5e binds the
5S RNA and is involved in anchoring of peptidyl-tRNA during
translation (Meskauskas and Dinman, 2001).
The ribosomal proteins encoded by all three PGY genes are
members of small gene families and have one or two closely related
members in Arabidopsis (see Table S1 in the supplementary material)
(Barakat et al., 2001). The relatively subtle phenotype of pgy mutants
may be due to redundancy between ribosomal proteins in
Arabidopsis, or PGY genes may not have a role in global translation
due to tissue-specific expression. To test for possible differential
expression between the PGY ribosomal protein family members, we
analysed expression in shoot tissues using RT-PCR. All of these
ribosomal protein genes were ubiquitously expressed in the shoot
(see Fig. S2B in the supplementary material). To investigate PGY
function in leaf development further, we analysed the mRNA
expression pattern of PGY1, PGY2 and PGY3 using in situ
hybridisation. All three PGY genes were expressed throughout the
vegetative meristem and in young organ primordia. In older organ
primordia, expression was most prominent in adaxial cells and in the
Development of ectopic leaves
Establishment of dorsoventral polarity in incipient leaf primordia
requires specification of both adaxial and abaxial domains. In a
model in which leaf outgrowth is promoted by juxtaposition of
these two domains it might be expected that an ectopic patch of
one fate within the field of the other would form a continuous
boundary, and lamina outgrowth at this boundary would surround
the circumference of the ectopic patch. This appears to be the case
in Antirrhinum, where mutations in the AS1 orthologue
PHANTASTICA (PHAN) result in lamina surrounding ectopic
patches of abaxial tissue (Waites and Hudson, 1995). Likewise, in
tobacco plants with reduced PHAN function, adaxial ectopic
lamina outgrowth is contiguous along a boundary of tissue
with reduced adaxial fate (McHale and Koning, 2004). Ectopic
lamina outgrowths in maize dorsoventral polarity mutants are also
most often formed as a continuum along an adaxial-abaxial
boundary (Evans, 2007; Juarez et al., 2004a; Juarez et al., 2004b;
Schichnes et al., 1997; Timmermans et al., 1998). As in these
examples, outgrowths in as1 pgy1 mutants could result from small
patches of abaxial cells on the adaxial side of the leaf. However,
in as1 pgy1 mutants there was no clear evidence of abaxial cell
types on the adaxial epidermis of the leaf. One possibility is that
ectopic abaxial patches in subepidermal layers, such as in the
vasculature, recapitulate an adaxial-abaxial boundary for ectopic
outgrowth.
An alternative, but not exclusive, possibility is that as1 pgy1
outgrowths are the result of establishment of a new proximodistal
axis of growth. Two of the earliest signatures of leaf primordia
initiation are downregulation of class I KNOX genes and formation
of a localised auxin maxima in the peripheral region of the meristem
(Heisler et al., 2005; Jackson et al., 1994; Reinhardt et al., 2000;
Reinhardt et al., 2003). In addition, auxin has been implicated in the
formation of ectopic outgrowths on the hypocotyls of kan1 kan2
kan4 mutants (Izhaki and Bowman, 2007). Ectopic outgrowths in
as1 pgy1 mutants may, likewise, initiate at sites of a localised auxin
maximum, possibly established through interactions between
patterns of ectopic KNOX expression, conferred by as1, and
regulators of auxin distribution.
There is no morphological evidence that outgrowths are
associated with a structured meristem. In addition, the KNOX genes
BP (also known as KNAT1 – TAIR) and KNAT2 are not required for
as1 pgy1 outgrowths (M.E.B., unpublished), although the role of
KNOX genes in the piggyback phenotype may be masked by
redundancy. Interestingly, all bifacial outgrowths in as1 pgy1
mutants were oriented with the adaxial side towards the distal tip of
the leaf and the abaxial side towards the proximal base of the leaf.
This invariant polarity, in the absence of a meristem, suggests
sensitivity to additional patterning cues.
DEVELOPMENT
DISCUSSION
PGY1, PGY2 and PGY3 genes encode ribosomal proteins. A role for
these genes in leaf patterning is revealed by leaf development
phenotypes in an as1 background. Genetic interactions
demonstrated that PGY1 and AS1 act independently in promoting
adaxial fate or repressing abaxial fate, with PGY1 being an integral
component of the HD-ZIPIII-KANADI pathway.
PGY1 is a component of the HD-ZIPIII-KANADI
pathway
Genetic interactions indicate that AS1 interacts to a minor extent
with the HD-ZIPIII-KANADI gene pathway. The as1 leaf
phenotype was only moderately affected by loss of REV, KAN1 and
KAN2 genes. Potentially other members of these gene families are
downstream of AS1 and more dramatic polarity effects are masked
by misexpression of the YABBY gene FILAMENTOUS FLOWER
(FIL) in as1 (Garcia et al., 2006; Li et al., 2005).
In comparison, PGY1 has reciprocal interactions with both HDZIPIII and KANADI family genes. PGY1 may have common
downstream targets with REV, or may regulate other HD-ZIPIII
genes. Aspects of as1 pgy1 leaf phenotypes resemble rev phv and
rev phv phb/+ mutant leaves. These combinatorial mutants exhibit a
rippled leaf surface and develop ectopic leaf lamina on the adaxial
side of the leaf (this study) (Prigge et al., 2005). Likewise, the
similarity of the pgy1 rev inflorescence phenotype to the enhanced
rev phenotype from loss of phv or phb/+ opens the possibility that
downstream targets of PGY1 are HD-ZIPIII genes.
Loss of KANADI function suppresses the leaf phenotype of as1
pgy1, and this suppression is specific to pgy1. Interactions with
KANADI genes are also evident in the flower, and pgy1 can rescue
the carpel patterning defects of kan1 kan2/+ mutants. However,
neither as1 pgy1 nor pgy1 can rescue the kan1 kan2 phenotype.
Therefore, PGY1 is not strictly necessary for kan1 kan2 phenotype,
and pgy1 loss-of-function is not sufficient to compensate the loss of
both KAN1 and KAN2. Together these interactions suggest an
antagonistic relationship between PGY1 and KANADI genes,
possibly through opposing interactions with a common downstream
target. Potential common downstream targets are HD-ZIPIII genes,
which are negatively regulated by KANADI genes and, as noted
above, may be positively regulated by PGY1.
Potential role of translation in development
Most ribosomal proteins in animals are encoded by a single copy
gene, and mutations in these genes have gross effects on
development. For example, mutations in ribosomal protein genes in
Drosophila result in a semi-dominant Minute phenotype
characterised by slow growth and reduced size of heterozygotes, and
homozygous lethality (Lambertsson, 1998; Marygold et al., 2007).
However, Drosophila Minute mutants also display various
developmental defects, as does the mouse Minute mutant belly spot
and tail (Bst; also known as Rpl24 – Mouse Genome Informatics),
and ribosomal protein mutants in zebrafish (Amsterdam et al., 2004;
Oliver et al., 2004; Uechi et al., 2006).
By contrast to animals, all ribosomal protein genes in
Arabidopsis are represented by small gene families (Barakat et al.,
2001). Mutations in an S5 ribosomal protein gene, arabidopsis
minute-like1 (aml1), are semi-dominant. As with Drosophila
Minute mutants, aml1 heterozygotes are smaller in size than wild
type, and homozygotes are embryo lethal (Weijers et al., 2001).
Unlike aml1, mutations in several ribosomal protein genes are
recessive and result in subtle developmental defects. Mutations in
POINTED FIRST LEAF (PFL) and POINTED FIRST LEAF2
(PFL2), which encode an S18 ribosomal protein and an S13
ribosomal protein, respectively, have some reduced growth and
changes to the shape of early formed leaves (Ito et al., 2000; Van
Lijsebettens et al., 1994). Mutations in SHORT VALVE1 (STV1),
which encodes an L24 ribosomal protein, are reduced in stature but,
in addition, display carpel-tissue-patterning defects (Nishimura et
al., 2005). This phenotype mimics the floral phenotype of AUXIN
RESPONSE FACTOR gene mutants, ettin (ett) and monopteros
Development 135 (7)
(mp), and it has been proposed that STV1 modulates ETT and MP
expression via translation of short upstream open-reading-frames
(uORFs) encoded in the 5⬘ UTR of ETT and MP transcripts
(Nishimura et al., 2005).
Mutations in PGY1, PGY2 and PGY3 and combined mutations in
these genes have relatively subtle effects on development,
suggesting that select targets are more sensitive to loss of these
ribosomal proteins rather than a global effect on protein synthesis.
The nature of these three ribosomal proteins does not immediately
suggest a mechanism for the specificity of the phenotype. One
possibility is that PGY proteins have a function independent from
the ribosome, as reported for some other ribosomal proteins (Wool,
1996). However, PGY genes and related family members are
expressed throughout actively dividing tissues, as would be
anticipated for ribosomal proteins involved in global protein
synthesis (this study) (Schmid et al., 2005). An alternate possibility
is that not all ribosomes are equivalent. The presence of different
isoforms and post-translational modifications of ribosomal proteins
result in ribosome heterogeneity, and this may generate functionally
distinct ribosomes with target-transcript specificity (Carroll et al.,
2007; Giavalisco et al., 2005; Komili et al., 2007). This appears to
be the case in Saccharomyces cerevisiae, where mutations in
ribosomal protein paralogues have different phenotypic
consequences (Komili et al., 2007). PGY target specificity may be
conferred by interaction with other proteins or protein complexes.
An interacting complex may be the small RNA silencing complex,
RISC, which interacts with large subunit ribosomal proteins
(Chendrimada et al., 2007; Ishizuka et al., 2002). Or specificity may
be inherent in target transcripts, either in non-coding UTR
sequences, as with STV1 targets or, for example, may be mediated
through the binding of small RNAs such as mircoRNAs or transacting siRNAs (ta-siRNAs). In this respect, it is noteworthy that
several leaf dorsoventral polarity gene families are targeted by small
RNAs. The adaxial HD-ZIPIII genes are targets of microRNAs
mir165 and mir166, whereas the AUXIN RESPONSE FACTOR
genes ETT and ARF4, which are required for abaxial fate, are targets
of TAS3-derived ta-siRNAs (Allen et al., 2005; Rhoades et al., 2002;
Tang et al., 2003). These proposed models for PGY function are not
necessarily mutually exclusive, and it seems likely that global effects
on translation are, to some extent, masked by redundancy between
family members in Arabidopsis. Although the mechanism is still to
be defined, PGY mutants provide new insights into regulatory
networks controlling leaf patterning and begin to address the role of
the ribosome as a regulator of development.
We thank colleagues at JIC for valuable discussion and comments on the
manuscript. We also thank Desmond Bradley and Sinead Drea for advice on in
situ hybridisation, Adrian Turner for advice on qRT-PCR, Andrew Davis for
photography, Kim Findley for SEM training and the JIC Horticultural Services
staff for plant care. We thank John Bowman for providing seed of kan1 and
kan2 mutants. V.P. is supported by a Marie Curie Early Stage Training
Programme Studentship (JICISBEST). This work was funded by the
Biotechnology and Biological Sciences Research Council (BBSRC) to M.E.B. and
by the Royal Society as a Wolfson Merit Award to M.E.B.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/135/7/1315/DC1
References
Allen, E., Xie, Z., Gustafson, A. M. and Carrington, J. C. (2005). microRNAdirected phasing during trans-acting siRNA biogenesis in plants. Cell 121, 207221.
Amsterdam, A., Sadler, K. C., Lai, K., Farrington, S., Bronson, R. T., Lees, J. A.
and Hopkins, N. (2004). Many ribosomal protein genes are cancer genes in
zebrafish. PLoS Biol. 2, E139.
DEVELOPMENT
1322 RESEARCH ARTICLE
Ban, N., Nissen, P., Hansen, J., Capel, M., Moore, P. B. and Steitz, T. A. (1999).
Placement of protein and RNA structures into a 5 Å-resolution map of the 50S
ribosomal subunit. Nature 400, 841-847.
Barakat, A., Szick-Miranda, K., Chang, I. F., Guyot, R., Blanc, G., Cooke, R.,
Delseny, M. and Bailey-Serres, J. (2001). The organization of cytoplasmic
ribosomal protein genes in the Arabidopsis genome. Plant Physiol. 127, 398415.
Barkoulas, M., Galinha, C., Grigg, S. P. and Tsiantis, M. (2007). From genes to
shape: regulatory interactions in leaf development. Curr. Opin. Plant Biol. 10,
660-666.
Byrne, M. E. (2006). Shoot meristem function and leaf polarity: the role of class III
HD-ZIP genes. PLoS Genet. 2, e89.
Byrne, M. E., Barley, R., Curtis, M., Arroyo, J. M., Dunham, M., Hudson, A.
and Martienssen, R. A. (2000). Asymmetric leaves1 mediates leaf patterning
and stem cell function in Arabidopsis. Nature 408, 967-971.
Byrne, M. E., Simorowski, J. and Martienssen, R. A. (2002). ASYMMETRIC
LEAVES1 reveals knox gene redundancy in Arabidopsis. Development 129,
1957-1965.
Byrne, M. E., Groover, A. T., Fontana, J. R. and Martienssen, R. A. (2003).
Phyllotactic pattern and stem cell fate are determined by the Arabidopsis
homeobox gene BELLRINGER. Development 130, 3941-3950.
Carroll, A. J., Heazlewood, J. L., Ito, J. and Millar, A. H. (2007). Analysis of the
Arabidopsis cytosolic ribosome proteome provides detailed insights into its
components and their post-translational modification. Mol. Cell. Proteomics doi:
10.1074/mcp.M700052-MCP200.
Chendrimada, T. P., Finn, K. J., Ji, X., Baillat, D., Gregory, R. I., Liebhaber, S.
A., Pasquinelli, A. E. and Shiekhattar, R. (2007). MicroRNA silencing through
RISC recruitment of eIF6. Nature 447, 823-828.
Clough, S. J. and Bent, A. F. (1998). Floral dip: a simplified method for
Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 16,
735-743.
Curtis, M. D. and Grossniklaus, U. (2003). A gateway cloning vector set for
high-throughput functional analysis of genes in planta. Plant Physiol. 133, 462469.
Emery, J. F., Floyd, S. K., Alvarez, J., Eshed, Y., Hawker, N. P., Izhaki, A.,
Baum, S. F. and Bowman, J. L. (2003). Radial patterning of Arabidopsis shoots
by class III HD-ZIP and KANADI genes. Curr. Biol. 13, 1768-1774.
Eshed, Y., Baum, S. F. and Bowman, J. L. (1999). Distinct mechanisms promote
polarity establishment in carpels of Arabidopsis. Cell 99, 199-209.
Eshed, Y., Baum, S. F., Perea, J. V. and Bowman, J. L. (2001). Establishment of
polarity in lateral organs of plants. Curr. Biol. 11, 1251-1260.
Eshed, Y., Izhaki, A., Baum, S. F., Floyd, S. K. and Bowman, J. L. (2004).
Asymmetric leaf development and blade expansion in Arabidopsis are mediated
by KANADI and YABBY activities. Development 131, 2997-3006.
Evans, M. M. (2007). The indeterminate gametophyte1 gene of maize encodes a
LOB domain protein required for embryo Sac and leaf development. Plant Cell
19, 46-62.
Fu, Y., Xu, L., Xu, B., Yang, L., Ling, Q., Wang, H. and Huang, H. (2007).
Genetic interactions between leaf polarity-controlling genes and
ASYMMETRIC LEAVES1 and 2 in Arabidopsis leaf patterning. Plant Cell
Physiol. 48, 724-735.
Garcia, D., Collier, S. A., Byrne, M. E. and Martienssen, R. A. (2006).
Specification of leaf polarity in Arabidopsis via the trans-acting siRNA pathway.
Curr. Biol. 16, 933-938.
Giavalisco, P., Wilson, D., Kreitler, T., Lehrach, H., Klose, J., Gobom, J. and
Fucini, P. (2005). High heterogeneity within the ribosomal proteins of the
Arabidopsis thaliana 80S ribosome. Plant Mol. Biol. 57, 577-591.
Ha, C. M., Jun, J. H., Nam, H. G. and Fletcher, J. C. (2007). BLADE-ON-PETIOLE
1 and 2 control Arabidopsis lateral organ fate through regulation of LOB domain
and adaxial-abaxial polarity genes. Plant Cell 19, 1809-1825.
Heisler, M. G., Ohno, C., Das, P., Sieber, P., Reddy, G. V., Long, J. A. and
Meyerowitz, E. M. (2005). Patterns of auxin transport and gene expression
during primordium development revealed by live imaging of the Arabidopsis
inflorescence meristem. Curr. Biol. 15, 1899-1911.
Huang, W., Pi, L., Liang, W., Xu, B., Wang, H., Cai, R. and Huang, H. (2006).
The proteolytic function of the Arabidopsis 26S proteasome is required for
specifying leaf adaxial identity. Plant Cell 18, 2479-2492.
Ishizuka, A., Siomi, M. C. and Siomi, H. (2002). A Drosophila fragile X protein
interacts with components of RNAi and ribosomal proteins. Genes Dev. 16,
2497-2508.
Ito, T., Kim, G. T. and Shinozaki, K. (2000). Disruption of an Arabidopsis
cytoplasmic ribosomal protein S13-homologous gene by transposonmediated mutagenesis causes aberrant growth and development. Plant J. 22,
257-264.
Izhaki, A. and Bowman, J. L. (2007). KANADI and class III HD-Zip gene families
regulate embryo patterning and modulate auxin flow during embryogenesis in
Arabidopsis. Plant Cell 19, 495-508.
Jackson, D., Veit, B. and Hake, S. (1994). Expression of maize KNOTTED1 related
homeobox genes in the shoot apical meristem predicts patterns of
morphogenesis in the vegetative shoot. Development 120, 405-413.
RESEARCH ARTICLE 1323
Juarez, M. T., Kui, J. S., Thomas, J., Heller, B. A. and Timmermans, M. C.
(2004a). microRNA-mediated repression of rolled leaf1 specifies maize leaf
polarity. Nature 428, 84-88.
Juarez, M. T., Twigg, R. W. and Timmermans, M. C. (2004b). Specification of
adaxial cell fate during maize leaf development. Development 131, 45334544.
Kerstetter, R. A., Bollman, K., Taylor, R. A., Bomblies, K. and Poethig, R. S.
(2001). KANADI regulates organ polarity in Arabidopsis. Nature 411, 706-709.
Kidner, C. A. and Timmermans, M. C. P. (2007). Mixing and matching pathways
in leaf polarity. Curr. Opin. Plant Biol. 10, 13-20.
Kim, M., McCormick, S., Timmermans, M. and Sinha, N. (2003). The
expression domain of PHANTASTICA determines leaflet placement in compound
leaves. Nature 424, 438-443.
Komili, S., Farny, N. G., Roth, F. P. and Silver, P. A. (2007). Functional
specificity among ribosomal proteins regulates gene expression. Cell 131, 557571.
Lambertsson, A. (1998). The minute genes in Drosophila and their molecular
functions. Adv. Genet. 38, 69-134.
Li, H., Xu, L., Wang, H., Yuan, Z., Cao, X., Yang, Z., Zhang, D., Xu, Y. and
Huang, H. (2005). The Putative RNA-dependent RNA polymerase RDR6 acts
synergistically with ASYMMETRIC LEAVES1 and 2 to repress BREVIPEDICELLUS
and MicroRNA165/166 in Arabidopsis leaf development. Plant Cell 17, 21572171.
Lin, W. C., Shuai, B. and Springer, P. S. (2003). The Arabidopsis LATERAL
ORGAN BOUNDARIES-domain gene ASYMMETRIC LEAVES2 functions in the
repression of KNOX gene expression and in adaxial-abaxial patterning. Plant Cell
15, 2241-2252.
Livak, K. J. and Schmittgen, T. D. (2001). Analysis of relative gene expression
data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.
Methods 25, 402-408.
Long, J. A., Moan, E. I., Medford, J. I. and Barton, M. K. (1996). A member of
the KNOTTED class of homeodomain proteins encoded by the STM gene of
Arabidopsis. Nature 379, 66-69.
Maier, U. and Sattler, R. (1977). The structure of the epiphyllous appendages of
Begonia hispida var. cucullifera. Can. J. Bot. 55, 264-280.
Marygold, S. J., Roote, J., Reuter, G., Lambertsson, A., Ashburner, M.,
Millburn, G., Harrison, P., Yu, Z., Kenmochi, N., Kaufman, T. C. et al.
(2007). The ribosomal protein genes and Minute loci of Drosophila
melanogaster. Genome Biol. 8, R216.
McConnell, J. R. and Barton, M. K. (1998). Leaf polarity and meristem formation
in Arabidopsis. Development 125, 2935-2942.
McConnell, J. R., Emery, J., Eshed, Y., Bao, N., Bowman, J. and Barton, M. K.
(2001). Role of PHABULOSA and PHAVOLUTA in determining radial patterning
in shoots. Nature 411, 709-713.
McHale, N. A. and Koning, R. E. (2004). PHANTASTICA regulates
development of the adaxial mesophyll in Nicotiana leaves. Plant Cell 16,
1251-1262.
Meskauskas, A. and Dinman, J. D. (2001). Ribosomal protein L5 helps anchor
peptidyl-tRNA to the P-site in Saccharomyces cerevisiae. RNA 7, 1084-1096.
Nikulin, A., Eliseikina, I., Tishchenko, S., Nevskaya, N., Davydova, N.,
Platonova, O., Piendl, W., Selmer, M., Liljas, A., Drygin, D. et al. (2003).
Structure of the L1 protuberance in the ribosome. Nat. Struct. Biol. 10, 104108.
Nishimura, T., Wada, T., Yamamoto, K. T. and Okada, K. (2005). The
Arabidopsis STV1 protein, responsible for translation reinitiation, is required for
auxin-mediated gynoecium patterning. Plant Cell 17, 2940-2953.
Ochando, I., Jover-Gil, S., Ripoll, J. J., Candela, H., Vera, A., Ponce, M. R.,
Martinez-Laborda, A. and Micol, J. L. (2006). Mutations in the microRNA
complementarity site of the INCURVATA4 gene perturb meristem function and
adaxialize lateral organs in arabidopsis. Plant Physiol. 141, 607-619.
Oliver, E. R., Saunders, T. L., Tarle, S. A. and Glaser, T. (2004). Ribosomal
protein L24 defect in belly spot and tail (Bst), a mouse Minute. Development
131, 3907-3920.
Ori, N., Eshed, Y., Chuck, G., Bowman, J. L. and Hake, S. (2000). Mechanisms
that control knox gene expression in the Arabidopsis shoot. Development 127,
5523-5532.
Otsuga, D., DeGuzman, B., Prigge, M. J., Drews, G. N. and Clark, S. E. (2001).
REVOLUTA regulates meristem initiation at lateral positions. Plant J. 25, 223236.
Prigge, M. J., Otsuga, D., Alonso, J. M., Ecker, J. R., Drews, G. N. and Clark,
S. E. (2005). Class III homeodomain-leucine zipper gene family members have
overlapping, antagonistic, and distinct roles in Arabidopsis development. Plant
Cell 17, 61-76.
Reinhardt, D., Mandel, T. and Kuhlemeier, C. (2000). Auxin regulates the
initiation and radial position of plant lateral organs. Plant Cell 12, 507-518.
Reinhardt, D., Pesce, E. R., Stieger, P., Mandel, T., Baltensperger, K., Bennett,
M., Traas, J., Friml, J. and Kuhlemeier, C. (2003). Regulation of phyllotaxis by
polar auxin transport. Nature 426, 255-260.
Rhoades, M. W., Reinhart, B. J., Lim, L. P., Burge, C. B., Bartel, B. and Bartel,
D. P. (2002). Prediction of plant microRNA targets. Cell 110, 513-520.
DEVELOPMENT
Ribosomal proteins and leaf development
Rosso, M. G., Li, Y., Strizhov, N., Reiss, B., Dekker, K. and Weisshaar, B.
(2003). An Arabidopsis thaliana T-DNA mutagenized population (GABI-Kat) for
flanking sequence tag-based reverse genetics. Plant Mol. Biol. 53, 247-259.
Schichnes, D., Schneeberger, R. and Freeling, M. (1997). Induction of leaves
directly from leaves in the maize mutant Lax midrib1-O. Dev. Biol. 186, 3645.
Schmid, M., Davison, T. S., Henz, S. R., Pape, U. J., Demar, M., Vingron, M.,
Scholkopf, B., Weigel, D. and Lohmann, J. U. (2005). A gene expression map
of Arabidopsis thaliana development. Nat. Genet. 37, 501-506.
Talbert, P. B., Adler, H. T., Parks, D. W. and Comai, L. (1995). The REVOLUTA
gene is necessary for apical meristem development and for limiting cell
divisions in the leaves and stems of Arabidopsis thaliana. Development 121,
2723-2735.
Tang, G., Reinhart, B. J., Bartel, D. P. and Zamore, P. D. (2003). A biochemical
framework for RNA silencing in plants. Genes Dev. 17, 49-63.
Tattersall, A. D., Turner, L., Knox, M. R., Ambrose, M. J., Ellis, T. H. and
Hofer, J. M. (2005). The mutant crispa reveals multiple roles for PHANTASTICA
in pea compound leaf development. Plant Cell 17, 1046-1060.
Timmermans, M. C. P., Schultes, N. P., Jankovsky, J. P. and Nelson, T. (1998).
Leafbladeless1 is required for dorsoventrality of lateral organs in maize.
Development 125, 2813-2823.
Uechi, T., Nakajima, Y., Nakao, A., Torihara, H., Chakraborty, A., Inoue, K.
and Kenmochi, N. (2006). Ribosomal protein gene knockdown causes
developmental defects in zebrafish. PLoS ONE 1, e37.
Ueno, Y., Ishikawa, T., Watanabe, K., Terakura, S., Iwakawa, H., Okada, K.,
Machida, C. and Machida, Y. (2007). Histone deacetylases and ASYMMETRIC
LEAVES2 are involved in the establishment of polarity in leaves of Arabidopsis.
Plant Cell. 19, 445-457.
Development 135 (7)
Van Lijsebettens, M., Vanderhaeghen, R., De Block, M., Bauw, G., Villarroel,
R. and Van Montagu, M. (1994). An S18 ribosomal protein gene copy at the
Arabidopsis PFL locus affects plant development by its specific expression in
meristems. EMBO J. 13, 3378-3388.
Waites, R. and Hudson, A. (1995). phantastica: a gene required for
dorsoventrality of leaves in Antirrhinum majus. Development 121, 2143-2154.
Waites, R., Selvadurai, H. R., Oliver, I. R. and Hudson, A. (1998). The
PHANTASTICA gene encodes a MYB transcription factor involved in growth and
dorsoventrality of lateral organs in Antirrhinum. Cell 93, 779-789.
Weijers, D., Franke-van Dijk, M., Vencken, R. J., Quint, A., Hooykaas, P. and
Offringa, R. (2001). An Arabidopsis Minute-like phenotype caused by a semidominant mutation in a RIBOSOMAL PROTEIN S5 gene. Development 128,
4289-4299.
Wool, I. G. (1996). Extraribosomal functions of ribosomal proteins. Trends
Biochem. Sci. 21, 164-165.
Xu, L., Xu, Y., Dong, A., Sun, Y., Pi, L. and Huang, H. (2003). Novel as1 and as2
defects in leaf adaxial-abaxial polarity reveal the requirement for ASYMMETRIC
LEAVES1 and 2 and ERECTA functions in specifying leaf adaxial identity.
Development 130, 4097-4107.
Yusupov, M. M., Yusupova, G. Z., Baucom, A., Lieberman, K., Earnest, T. N.,
Cate, J. H. and Noller, H. F. (2001). Crystal structure of the ribosome at 5.5 A
resolution. Science 292, 883-896.
Zhong, R. and Ye, Z. H. (1999). IFL1, a gene regulating interfascicular fiber
differentiation in Arabidopsis, encodes a homeodomain-leucine zipper protein.
Plant Cell 11, 2139-2152.
Zhong, R. and Ye, Z. H. (2004). Amphivasal vascular bundle 1, a gain-of-function
mutation of the IFL1/REV gene, is associated with alterations in the polarity of
leaves, stems and carpels. Plant Cell Physiol. 45, 369-385.
DEVELOPMENT
1324 RESEARCH ARTICLE