RESEARCH ARTICLE
291
Development 135, 291-300 (2008) doi:10.1242/dev.009662
Common functions of central and posterior Hox genes for
the repression of head in the trunk of Drosophila
Delphine Coiffier, Bernard Charroux and Stephen Kerridge*
Hox genes are localised in complexes, encode conserved homeodomain transcription factors and have mostly been studied for their
specialised functions: the formation of distinct structures along the anteroposterior axis. They probably derived via duplication
followed by divergence, from a unique gene, suggesting that Hox genes may have retained a common function. The comparison of
their homeodomain sequences groups Hox proteins into Anterior, Central and Posterior classes, reflecting their expression patterns
in the head, trunk and tail, respectively. However, functional data supporting this classification are rare. Here, we re-examine a
common activity of Hox genes in Drosophila: the repression of head in the trunk. First, we show that central and posterior Hox
genes prevent the expression of the head specific gene optix in the trunk, providing a functional basis for the classification. Loss-offunction mutations of optix affect embryonic head development, whereas ectopic Optix expression strongly perturbs trunk
development. Second, we demonstrate that the non-Hox genes teashirt, extradenticle and homothorax are required for the
repression of optix and that Wingless signalling and Engrailed contribute to this repression. We propose that an evolutionary early
function of Hox genes was to modify primitive head morphology with novel functions specialising the trunk appearing later on.
INTRODUCTION
The body plan of all bilaterian animals is composed of three
morphologically distinct regions along the anteroposterior axis: the
head, trunk and tail. In insects, the true head comprises three
segments (antennal, labrum and intercalary) plus the anterior acron
(Jürgens et al., 1986). The cephalopharyngeal cuticle of the larva is
unique in that it is often pigmented and has a crinkled morphology.
Three gnathal segments (mandibular, maxillary and labium) are
thought to have derived from the trunk (Snodgrass, 1938) but have
acquired specific head-like characteristics. The trunk is formed by
three thoracic (prothorax, mesothorax and metathorax) and eight
abdominal segments (A1 to A8), each characterised in the larva by
alternating anterior denticles and posterior naked cuticle. The tail
comprises three segments plus the terminal telson.
The morphological diversity along the anteroposterior axis of
vertebrates and invertebrates relies in part on the activity of Hox genes
(Kaufman et al., 1990; Lewis, 1978). Hox proteins are evolutionarily
conserved transcription factors that control the expression of
downstream target genes (Graba et al., 1997; Pearson et al., 2005)
through a DNA-binding domain called the homeodomain (McGinnis
et al., 1984; Scott and Weiner, 1984). Hox genes in most species reside
in clusters. In Drosophila melanogaster, they are localised in two
complexes (Kaufman et al., 1990; Lewis, 1978): the Antennapedia
and Bithorax complexes. Hox genes are expressed according to the
spatial colinearity rule, with 3⬘ genes acting in the head, median genes
acting in the trunk and 5⬘ genes in the tail parts of the embryo. Loss of
Hox genes results in the transformation of one segment into a
neighbouring, usually anterior one, whereas ectopic Hox activity
usually involves posterior homeotic transformations (Gonzalez-Reyes
and Morata, 1991; Lewis, 1978).
Institut de Biologie du Développement de Marseille Luminy, UMR6216 CNRS
Université de la Méditerranée, Case 907 Parc Scientifique de Luminy, 13288
Marseille Cedex 09, France.
*Author for correspondence (e-mail: [email protected])
Accepted 30 October 2007
On the basis of expression patterns and the sequence similarity of
their homeodomains, Hox proteins from a wide variety of species
have been grouped into three classes (Schubert et al., 1993; Duboule,
1994; de Rosa et al., 1999): Anterior (A), Central (C) and Posterior
(P). In Drosophila, Labial (Lab) is an A class protein functional in the
head, Proboscipedia (Pb) is an A class protein with no known function
during embryogenesis, Deformed (Dfd) and Sex combs reduced (Scr)
are divergent C class proteins active mostly in gnathal segments,
whereas Antennapedia (Antp), Ultrabithorax (Ubx) and Abdominal
A (AbdA) are C class proteins active in thoracic and/or abdominal
segments. Finally, Abdominal B (AbdB) is the sole P class protein
active in the tail as well as in the posterior trunk (Sanchez-Herrero
et al., 1985). To date, the only functional data relevant to this
classification is the ability of A and C class genes to rescue the
tritocerebrum mutant phenotype of the lab gene (Hirth et al., 2001).
As Hox genes are physically clustered on the chromosome, they
probably arose by tandem duplication and acquired novel functions
during evolution (Lewis, 1951). Many targets of Hox genes have
been described (Graba et al., 1997; Pearson et al., 2005; Svingen and
Tonissen, 2006) that are controlled directly by individual, or at most
three, Hox proteins. Established targets therefore represent novel,
acquired functions, as none of the targets are regulated by all or the
majority of Hox genes. There is evidence however that most Hox
genes have a common function for the repression of head in the
trunk, as their loss results in the differentiation of head structures in
each trunk segment in the fly and the beetle Tribolium (Lewis, 1978;
Stuart et al., 1991; Struhl, 1983). This common activity may
therefore represent an ancient function. If so, Hox genes might be
expected to regulate common target genes or activities involved in
head development. Although some putative, common targets have
been reported recently in a microarray approach following ectopic
expression of most, but not all, Hox genes in the embryo (Hueber et
al., 2007) no candidate for a common target of Hox proteins has yet
been identified.
Hox genes do not act alone for segment diversity of the embryo.
In the trunk, the zinc-finger protein Teashirt (Tsh) is co-expressed
and acts with Scr, Antp, Ubx, AbdA and AbdB (hereafter referred to
DEVELOPMENT
KEY WORDS: Drosophila, Hox, optix/Six3, Head, Trunk
RESEARCH ARTICLE
as HoxCP) to promote trunk. Importantly, the loss of all of these
proteins causes a complete transformation of the ventral trunk into
head identity (Roder et al., 1992). Consistent with the notion that
Hox genes and tsh suppress head identity, ectopic activity of Antp,
Ubx, AbdA or Tsh replace certain head identities with trunk
structures (Gonzalez-Reyes and Morata, 1990; de Zulueta et al.,
1994). Hox and tsh genes thus share a common activity to repress
head formation in the trunk. Additionally, to achieve their function,
Hox proteins usually need the presence of their co-factors,
Extradenticle (Exd) and Homothorax (Hth) (Mann, 1995; Mann and
Affolter, 1998), which are also homeodomain proteins (Ryoo and
Mann, 1999) and are highly conserved in bilaterians (Moens and
Selleri, 2006). Together, they form complexes that increase Hox
DNA-binding specificity to regulate their target genes.
In vertebrates and invertebrates Wnt genes have been implicated
in a variety of processes during embryogenesis (Klingensmith and
Nusse, 1994; Logan and Nusse, 2004). In Xenopus and fish,
maternal Wnt/␤-catenin signalling is crucial for the organisation of
the whole body plan, including the head. Later zygotic Wnt/␤catenin is required for repression of head (Niehrs, 1999; Popperl et
al., 1997) showing that Wnt signalling promotes trunk at the expense
of head. By contrast, though much is known about the role of
Drosophila Wingless (Wg) in patterning the posterior region of each
trunk segment (Sanson, 2001; Wodarz and Nusse, 1998), a related
role for Wg signalling in repressing head has not been identified.
Here, we show that the Six-gene family member optix, encoding
a conserved homeodomain protein normally limited to the head
(Kawakami et al., 2000; Seimiya and Gehring, 2000), is repressed
by all C and P class Hox genes in the trunk or tail. Additionally, we
demonstrate that the Hox co-factors Extradenticle, Homothorax and
Teashirt are necessary for the repression of optix in the trunk, and
that Wg signalling and Engrailed contributes to this repression.
Therefore, Drosophila has developed multiple inputs to repress head
development in the trunk. From an evolutionary standpoint, we
propose that one of the most ancient functions of Hox genes is to
repress head, a function shared with other non-Hox genes.
MATERIALS AND METHODS
Drosophila strains
The following strains were used: ScrC1 AntpNs+RC3 Df(3R)P9, ScrC1
AntpNs+RC3 UbxMX12 abdAM1 AbdBM8, AntpW10 Df(3R)P9, ScrW17 UbxMX12
abdAM1 AbdBM8, ScrC1 AntpNs+RC3 abdAM1 AbdBM8, ScrC1 AntpNs+RC3
Ubx9-22 AbdBM1, ScrC1 AntpNs+RC3 Df(3R)Ubx109, DfdRX1, labf8, pb5
(Casanova et al., 1987; Hazelrigg and Kaufman, 1983; Lewis, 1978; Merrill
et al., 1989; Pultz et al., 1988; Riley et al., 1987; Struhl, 1983; Wakimoto
and Kaufman, 1981), tsh2757R8 (Laugier et al., 2005), Pbac{PB}optixc01718,
Pbac{WH}optixf04738, Pbac{WH}optixf06630, Df(2R)ED1725 (Bloomington
or Harvard stock centres), exd1 (Rauskolb et al., 1995), hthP2 (Rieckhof et
al., 1997), Df(2R)en and wgCX4 (FlyBase Consortium, 1999). 69B-Gal4, prdGal4, arm-Gal4, nullo-Gal4, UAS-lab, UAS-pb, UAS-Dfd, UAS-Scr, UASAntp, UASUbx, UAS-abdA, UAS-AbdBm, UAS-AbdBr, UAS-wg
(Bloomington), UAS-optix (Seimiya and Gehring, 2000) and UAS-tsh
(Manfroid et al., 2004). To generate exd maternal mutant embryos, exd1
FRT18D/ovoD2 FRT18D; hs-flp1/+ females were heat shocked during the
wandering larval stage (2 hours at 37°C) and crossed with wild-type males.
Standard techniques were used for cuticle preparations. Genotypes were
detected by the absence of expression of Tsh and Hox proteins, or by the
absence of abdA-lacZ present on the TM6B balancer chromosome.
In situ hybridisation and immunostaining
For in situ hybridisation, Digoxigenen (DIG)-labelled antisense RNA probes
for optix, were generated by transcription with T3 RNA polymerase (Promega)
of NotI-digested LD05472 (BDGP: Berkeley Drosophila genome Project)
with DIG-RNA labelling mix containing the UTPDIG (Roche). For wg a DIGlabelled antisense RNA probe was generated by digestion with XbaI and
Development 135 (2)
transcription with T3 RNA polymerase. Standard procedures were used,
except that signals were amplified using the Tyramide Signal Amplification
kit (NEN Life Science). Primary antibodies were: rat anti-Scr (1:200), mouse
anti-Antp (1:10, DSHB, Developmental Studies Hybridoma Bank), mouse
anti-Ubx (1:1) (White and Wilcox, 1985), rat anti-AbdA (1:400, J. Casanova),
mouse anti-AbdB (1:10, DSHB), rabbit anti-Tsh (1:1000, S. Cohen), rat antiElav (1:10, DSHB) and mouse anti-En (1:10, DSHB). Embryos were mounted
in Fluoromount-G (Southern Biotechnology Associates) and analysed with an
LSM 510 Zeiss confocal microscope.
RNAi production of tsh and optix hairpin loops
For dsRNA synthesis, three optix regions of 413, 570 and 375 base pairs (bp)
were amplified from the EST clone LD05472 (BDGP) by PCR with primer
pairs 5⬘CACCAGATTATAGCACCCAG3⬘ and 5⬘CTTCTGCTCGCCATCCCAGA3⬘; 5⬘GCATCCAGCATAGCCAGAAC3⬘ and 5⬘TGTAGGCAGCCGCGTAGGCC3⬘; and 5⬘CAGCGGGTCTGAGGTGTCCA3⬘ and
5⬘GGGGCCACTGGGACCGCCAT3⬘ with T7 promoter sequence at the
5⬘ end (5⬘TAATACGACTCACTATAGGGAGACCAC3⬘). The PCR
product served as template for the T7 transcription reaction with Ribomax
Large Scale Production kit (Promega). The dsRNAs were resuspended in
DEPC-treated water, quantified and diluted to 5 ␮M in DEPC-treated water.
Embryos from 30 minute egg-collections of OreR flies were dechorionated,
aligned on heptane-glued cover slips, desiccated and covered with oil.
Embryos injected with dsRNA, were allowed to develop at 25°C and
cuticles were prepared or fixed and stained. RNAi probes for tsh were
described by Laugier et al. (Laugier et al., 2005). Control embryos were
injected with DEPC-treated water.
RESULTS
Central and posterior Hox and tsh genes repress
head development in the trunk
In order to study the potential common function of Hox genes to
repress head in the trunk of the Drosophila embryo, we have reexamined the morphology of larval cuticles lacking the HoxCP genes.
As reported earlier (Lewis, 1978; Roder et al., 1992; Sanchez-Herrero
et al., 1985; Struhl, 1983), prothoracic-like structures (denticles and
beard) develop in the anterior part of each trunk segment, owing to
Tsh activity, and head-like cuticle forms in the posterior (Fig. 1A,B),
because Tsh expression is not maintained (Roder et al., 1992).
Moreover, the loss of tsh and HoxCP genes replaces all ventral trunk
structures of the larva (denticles and smooth cuticle) with crinkled
cuticle (Roder et al., 1992) (inset Fig. 1C) found normally only in the
head of larvae (Fig. 1A,C). Therefore, like Hox genes, tsh contributes
to the suppression of head in the trunk (Roder et al., 1992).
To analyse the individual capacities of HoxCP genes to ensure this
function, we examined cuticles from embryos carrying individual
Hox gene activities in tsh HoxCP larvae. Cuticle preparations show
that Scr function represses head in the extreme anterior trunk but is
incapable of making denticles without Tsh (Fig. 1D) (see Roder et
al., 1992). Antp, Ubx and AbdA similarly repress head (Fig. 1E-G),
but each acts in a specific way: Antp induces denticles similar to
those found in the thorax (Fig. 1E, see legend), Ubx to those found
in the first abdominal segment (Fig. 1F) and AbdA induces denticles
with second abdominal identity (Fig. 1G). Finally, AbdB represses
head identity producing naked cuticle but does not induce denticles
(Fig. 1H). At the molecular level, we have examined the expression
of shaven baby (svb), which is expressed in the cells destined to form
denticles in the larva (Payre et al., 1999). For each Hox gene capable
of inducing denticles (Antp, Ubx or abdA), svb is detected ventrally
in each trunk segment where these genes are active (see Fig. S1 in
the supplementary material). The activities of Scr and AbdB, in the
absence of Tsh, are incapable of inducing svb expression or denticles
ventrally (see Fig. S1 in the supplementary material).
DEVELOPMENT
292
Generic Hox function
RESEARCH ARTICLE
293
In conclusion, though only Tsh, Antp, Ubx and AbdA are capable
of inducing denticles, Tsh, Scr, Antp, Ubx, AbdA and AbdB all
contribute independently to the shared role of repressing head
development.
The head gene optix is repressed by central and
posterior Hox and tsh genes in the trunk
epidermis
In order to identify genes involved in the head to trunk homeosis, we
compared the expression of eight candidate genes (spalt, cap-ncollar, optix, empty-spiracles, orthodenticle, buttonhead, forkhead,
sine oculis) with prominent head expression. Of these, only optix
expression is strictly localised to the wild-type head and gnathal
regions (Fig. 2A-C, not shown), and altered in HoxCP and tsh
HoxCP embryos (Fig. 2D-F and data not shown)
In wild type, optix is expressed from the blastoderm stage in a ring
of cells at the anterior end of the embryo that is destined to form the
clypeolabrum, the pharynx and the acron, according to the projections
on the fate map (Fig. 2A) (Seimiya and Gehring, 2000). At the end of
germ band elongation (Fig. 2B), the anterior cephalic domain extends
dorsally then is separated in two parts, while new small patches of
optix expression appear in cells located in the lateral parts of the
maxillary and labial segments. By stage 14, optix is detected in the
ectoderm covering the supra oesophageal ganglion, which gives rise
to certain parts of the brain (Fig. 2C) (Seimiya and Gehring, 2000),
together with the patches observed in the gnathal segments.
The normal domains of optix are unchanged following the loss of
HoxCP gene activities (Fig. 2A,D). However, ectopic optix
expression is detected from stage 11 onwards in groups of epidermal
cells in the extreme ventral and anterior part (Fig. 2D,F) of the labial,
three thoracic, eight abdominal and a small group of cells in the
ninth abdominal, segments (arrows Fig. 2D,F). The ectopic optix
expression domains are not localised to the posterior domain of the
segments in HoxCP embryos, where the majority of sclerotic plates
develop (Fig. 1B)
Loss of tsh alone has no effect on the expression of optix (not
shown). By contrast, the joint absence of HoxCP and tsh functions
leads to a posterior enlargement of the ectopic patches of optix in
each trunk segment (Fig. 2E,F) compared with loss of HoxCP genes
alone (Fig. 2D).
We conclude that HoxCP genes are sufficient to repress optix in
homologous anterior parts of each trunk segment, whereas HoxCP
genes combine with tsh to repress optix in homologous, more
posterior, ventral regions of each trunk segment.
DEVELOPMENT
Fig. 1. Hox genes repress head and
promote trunk. Cuticles of (A) wild type,
(B) HoxCP, (C) tsh– HoxCP, (D) tsh– Hox- Scr+,
(E) tsh– Hox– Antp+, (F) tsh– Hox– Ubx+, (G)
tsh– Hox– abdA+ and (H) tsh– Hox– AbdB+,
larvae. White arrows, denticles; black
arrows, naked cuticle; arrowheads, crinkled
head cuticle. Head cuticle is mostly in the
posterior part of each trunk segment in B,
but occasionally also differentiates in the
anterior (left and right arrowheads). Inset in
A shows the pigmented crinkled cuticle
typical of the head skeleton. Inset in C
highlights the crinkled cuticle. In D, the
distance from the anterior border of the
crinkled cuticle to the anterior trunk (line) is
larger than that in C. The inset in E shows
the small thoracic denticles (white arrow)
invisible in the larger photograph. Head-like
cuticle develops in A5-8 (arrowheads).
Anterior is on the left for all panels.
294
RESEARCH ARTICLE
Development 135 (2)
Fig. 2. HoxCP and tsh genes
repress optix expression in the
trunk. (A-C) optix expression (green)
in wild type, stage 6 (A), 11 (B) and
14 (C). Arrows, early expression
domain in the labrum; arrowheads,
patches of optix-expressing cells in
maxillary and labial segments. Clbr,
Clypeolabrum; Spog, Supra
oesophagial ganglia. (D,E) Expression
of optix in HoxCP and tsh– HoxCP
embryos at retraction. Elav (red)
highlights the ventral side of the
embryo. White arrows indicate
ectopic patches of optix (green) in the
trunk. The expression domain of optix
in the ventral labial segment is not
visible in this section (D, asterisk, see
E and F). (F) tsh– HoxCP embryo
showing optix compared with
engrailed (red) at stage 12. The
patterns are complementary,
indicating that optix ectopic stripes
are located in the anterior region of
each segment. There is an ectopic
patch of optix in the labial (Lb) and
ninth abdominal segments (A9). B, D
and E are ventral views; A, C and F
are lateral views.
Finally, we examined the effects of early (Fig. 3G) and late (not
shown) ectopic optix expression, to determine whether optix
expression in the trunk is functional. In both cases, the trunk is
abnormal with penetrant (95%, n=230) defects in germ band
retraction (Fig. 3G) and in dorsal closure (not shown), suggesting
that the negative regulation of optix in the trunk is important.
Individual capacities of Hox genes to repress optix
Next, we examined the individual capacities of HoxCP genes to
repress optix. Addition of Scr, Antp, Ubx, abdA or AbdB genes
individually in tsh HoxCP context results in the loss of ectopic
patches of optix in the domains where each Hox gene is expressed
(Fig. 4A-F). Similar results were found on restoring individual Hox
gene functions to HoxCP embryos (data not shown). We conclude
that Scr, Antp, Ubx, abdA and AbdB are sufficient to repress optix in
homologous anterior parts of each trunk segment, where they are
active.
We then asked whether the more anterior Hox genes lab, pb and
Dfd affected optix expression. Dfd is a divergent C type Hox gene
(Schubert et al., 1993), expressed in the maxillary and mandibular
segments in wild-type embryos (Chadwick and McGinnis, 1987).
Loss of Dfd induces ectopic optix expression in the ventral part of
the maxillary segment (arrow, Fig. 4G). Products of the A class gene
lab are detected in the intercalary segment of wild-type embryos
(Diederich et al., 1989). Loss of lab causes no detectable effect on
the localisation of optix transcripts (compare Fig. 4H with Fig. 2B).
To ensure that the loss of lab does not affect the expression of optix,
we expressed lab ectopically in the absence of HoxCP genes using
the prd-Gal4 driver, which is expressed in a pair rule pattern. No
alteration in the ectopic expression of optix was detected ventrally
DEVELOPMENT
The role of optix in head development
In light of these observations, we wondered whether Optix is required
for the normal development of the embryonic head and for the
transformation of trunk in tsh HoxCP embryos. We examined the
cuticular phenotypes of loss-of-function larvae either using three optix
mutant alleles (FlyBase), or induced by the injection of three different
dsRNAi constructs into wild-type embryos (Fig. 3A, n>400 embryos
for each probe). Both techniques gave similar phenotypes, suggesting
that the insertion alleles are amorphs or strong hypomorphs. Indeed,
homozygotes and hemizygotes are indistinguishable from each other
and from optix RNAi-injected embryos. For the latter (n=210), 70%80% gave no signal upon hybridisation with optix probes compared
with control water-injected embryos (n=154), where 95% of embryos
exhibited expression (not shown).
The most common phenotypes are the absence of structures
deriving from the labrum (Fig. 3B-E) (Jürgens et al., 1986) and
defects in mouth hook formation, which are absent (Fig. 3E),
deformed or reduced (Fig. 3D). Together these abnormalities
correlate with the domains of optix expression in the head and
maxillary segment (Fig. 2A-C). However, we found no evident
abnormality in structures deriving from the labial segment where a
small group of optix-expressing cells is observed (Fig. 2B).
As optix has an embryonic function in the head, it could be
responsible for the crinkled cuticle present in the trunk of tsh HoxCP
embryos. However, loss of optix, tsh and HoxCP genes or
inactivation of optix and tsh by dsRNAi injection in HoxCP embryos
were indistinguishable from tsh HoxCP mutants (Fig. 3F). We
conclude that Optix is not the only factor responsible for the head
morphology present in the trunk of such embryos. However, it
represents an excellent molecular marker for head.
Generic Hox function
RESEARCH ARTICLE
295
(not shown), showing that Lab is unable to repress optix in the trunk.
The A class Hox Pb is detected in the gnathal segments but has no
known function during embryogenesis (Pultz et al., 1988) and has
no effect on the expression of optix (not shown).
These results show that the C and P class Hox genes (Dfd, Scr,
Antp, Ubx, abdA and AbdB) negatively regulate optix, in the ventral
part of the epidermis of the gnathal or trunk segments where the Hox
genes are active, whereas the A class genes lab and pb do not.
The Hox co-factors Extradenticle and Homothorax
repress optix expression in the trunk
To increase their DNA-binding specificity and regulate their targets,
Hox proteins require the activity of co-factors (Mann, 1995; Mann
and Affolter, 1998; Mann and Chan, 1996) including Exd and Hth.
We examined optix expression in exd and hth embryos. For both,
optix is expressed ectopically in a large ventral part of twelve trunk
[maxillary (Mx) to A7] segments from stage 11 onwards (Fig. 6AD). Ectopic optix expression is more intense in the posterior two
gnathal and thoracic segments compared with the abdominal
domains of these embryos, indicating a thoracic transformation to a
more anterior identity, which is coherent with the differentiation of
head-like, crinkled cuticle in the thorax of the larvae (insets Fig.
6E,F). In addition, in A8, where AbdB is strongly detected in the
DEVELOPMENT
Fig. 3. optix is required for the development of the labrum and
mouth hooks during embryogenesis. (A) Genomic region of optix
showing the insertions and the probes (red lines) used for the RNAi
experiments. (B-G) Cuticle preparations of wild type (B, dorsal; C, lateral),
Df/optix (D, laterodorsal; E, ventral) head skeletons, tsh– optixC01718
HoxCP (F, ventral) and nullo-Gal4 UAS-optix (G, lateral) larva. Derivatives
of the labrum (red; lr, labrum; es, epistomal sclerite) and labral sense
organ are absent and the maxillary-derived, mouth hooks (MH) are
missing (E) or reduced (D) in Df/optix (compare B-E). All sense organs,
apart from the labral one, are unaffected in the different optix alleles
(D,E) and RNAi-treated larvae (not shown). In E, the asterisk indicates
head cuticle in place of the mouth hooks, labral and adjacent structures
normally found in this position (see B,C). H piece (H), hypostomal sclerite
(hys) and lateralgräten (LG) derive from segments posterior to the labrum
(Jürgens et al., 1986). The head-like cuticle present on the ventral side of
tsh– optixC01718 HoxCP (arrowhead in F) and tsh–HoxCP (Fig. 1C) embryos
are indistinguishable. In G, early ectopic expression of optix results in a
failure in retraction of the germ band.
Effects of ectopic expression of Hox and tsh genes
upon optix expression
Next, we asked whether ectopic Hox or tsh production could repress
optix expression in its normal domains in the head and gnathal
segments. Ubiquitous expression in the epidermis from stage 10
(using 69B-Gal4) of Tsh, Scr, Antp, Ubx, abdA and AbdB represses
optix in the late gnathal domains, but not in the initial domain in the
true head (Fig. 5A-C, not shown). However, earlier production of
Hox or Tsh proteins ubiquitously from the blastoderm stage, using
the nullo-Gal4 driver, strongly reduced or removed optix expression
in the initial head, as well as the gnathal regions (Fig. 5D,E, not
shown).
We then analysed the effect of ubiquitous activity of Dfd, Lab and
Pb on optix expression. Mis-expressed Dfd does not repress optix in
the head or in the gnathal segments, the normal domain of Dfd
expression (Fig. 5F) (Chadwick and McGinnis, 1987); however, the
gnathal patches of optix are enlarged (compare Fig. 5F, Fig. 2B,C
and Fig. 5A) and in the thorax ectopic optix is detected in pairs of
lateral groups of cells. These patches possibly correspond to ectopic
maxillary structures (mouth hooks) known to develop in these
positions in larvae upon expression of Dfd (Fig. 5F) (Kuziora and
McGinnis, 1988) and correlate with one role of optix for normal
mouth hook development (Fig. 3B-E). Similarly, early (but not late)
ectopic induction of Lab also results in ectopic optix expression in
the thorax (Fig. 5G), where three pairs of lateral patches of cells are
detected. In addition in the maxillary and labial segments, the
patches of optix are enlarged (compare Fig. 5A with F). Neither early
nor late ectopic Pb expression has any effect on the expression of
optix (not shown).
These results corroborate the idea that tsh and all Hox genes
active in the embryo can regulate the optix gene. However, only tsh,
central and posterior Hox genes have a common function to repress
the expression of optix, each acting in distinct domains of the gnathal
and/or trunk domains of the ventral epidermis. The A class genes lab
and pb, are the only Hox genes that cannot repress optix expression.
Although Dfd represses optix in the ventral maxillary epidermis
(Fig. 4G), ectopic assays indicate that Dfd and Lab, but not Pb, are
capable of activating optix in more lateral positions.
296
RESEARCH ARTICLE
Development 135 (2)
Fig. 4. Each Hox CP gene represses
optix in its ventral, anterior ectodermal
activity domain. Expression of optix
(green) in (A) tsh– HoxCP, (B) tsh– Hox–
Scr+, (C) tsh– Hox– Antp+, (D) tsh– Hox–
Ubx+, (E) tsh– Hox– abdA+, (F) tsh– Hox–
AbdB+, (G) Dfd, (H) lab. (A) Elav staining
(red) highlights the ventral side. (B-F) The
distribution of Hox proteins is in red.
Arrows delimit the boundaries between
optix expression and Hox domains. Scr+ (B)
has one patch less (Lab segment)
compared with A; Antp+ (C) presents only
two (Lab and T1), Ubx+ (D) four (Lab to T3),
abdA+ (E) five (Lab to A1) and AbdB+ (F) has
eight (Lab to A4) ectopic patches of optix.
(G) Loss of Dfd induces an ectopic optix
patch in the maxillary segment (white
arrow); arrowheads indicate the two
normal domains of optix in the gnathal
segments. (H) optix distribution is normal in
lab (compare Fig. 2B). All panels are ventral
aspects.
Wingless signalling and Engrailed contribute to
the repression of optix in the trunk
The absence of tsh and HoxCP genes results in the derepression of
optix only in the ventral, anterior and median, but not in the posterior
part of trunk segments, corresponding to the normal domain of wg
and en (Fig. 2F, Fig. 7A,B) (Wodarz and Nusse, 1998). Loss of En
abrogates Hh signalling and En and Wg are required to maintain the
expression of one another from stage 10 onwards (reviewed by
Wodarz and Nusse, 1998). As the location of en and wg stripes is
approximately complementary to the domains of ectopic optix
expression in the trunk segments of HoxCP and tsh HoxCP embryos
(Fig. 2F, Fig. 7A,B), we asked whether Wg and En contribute to the
repression of optix in the posterior parts of trunk segments in tsh
HoxCP embryos.
With this aim, we removed en or wg in tsh HoxCP embryos. In
both contexts, optix expression is detected throughout the ventral
part of each trunk segment with far fewer ventral cells that are
devoid of optix signal (Fig. 7C,D). In embryos that lack only wg or
en function, no ectopic activation of optix is seen (not shown)
implying that the repressive action of Wg or En upon optix relies on
the absence of Hox and Tsh proteins. Ectopic Wg or En production
has no clear effect on the normal expression of optix (not shown).
These results are perhaps not surprising, as these genes are normally
co-expressed in specific cells in the head (Fig. 2F, Fig. 7A). These
results favour the idea that Wg signalling and En contribute to the
suppression of head development in the Drosophila trunk, but these
activities are only revealed in the absence of Hox and Tsh (Fig. 7E).
DISCUSSION
On the basis of their homeodomain sequences and expression
patterns, Hox proteins across the animal kingdom fall into A, C or P
classes (de Rosa et al., 1999; Schubert et al., 1993). Here, we show
that C and P class Hox genes share a function, repressing head
development in the trunk, which, on the basis of morphology, has
been described both in Drosophila and Tribolium (Lewis, 1978;
Stuart et al., 1991). Our novel observation is the molecular
manifestation of these concerted Hox activities involving the
restriction of a common molecular target, optix/dSix3, and the Sixclass homeodomain protein it encodes. Indeed, though optix
expression is normally restricted to the head, it can be differentially
extended to the trunk on removing Hox or co-factor activities there.
DEVELOPMENT
epidermis (Fig. 6A,B), and A9, optix is neither detected in exd nor
hth embryos. We conclude that these Hox co-factors are required for
the prevention (by Hox protein) of head development and/or optix
expression in the trunk, with the exception of A8 and 9.
Generic Hox function
RESEARCH ARTICLE
297
Fig. 5. Effects of ubiquitous Hox
activation on optix expression. (A) Wildtype, (B) 69B-Gal4>UAS-Ubx and (C) 69BGal4>UAS-tsh embryos: the gnathal patches
of optix (arrowheads) are missing in the
mutants but the head domains are largely as
in wild type following late Hox induction.
(D) nullo-Gal4>UAS-Ubx and (E) nulloGal4>UAS-AbdB. Early activation of Hox
proteins eliminates both the head (asterisk)
and gnathal expression domains of optix
(compare with Fig. 2B,C). (F) 69-Gal4>UASDfd. Late Dfd expression induces ectopic
patches of optix in small lateral groups of
cells in the thoracic segments (arrows) and
enlarged gnathal patches (arrowheads,
compare with Fig. 2B,C and 5A). (G) nulloGal4>UAS-lab. Early, but not late (not
shown), induction of Lab results in lateral
patches of optix in the thoracic segments
(arrows) and enlarged optix patches in the
maxillary and labial segments (arrowheads,
compare with A). B,E-G are ventral views; A,
C and D are lateral views.
Common and divergent activities of Hox genes
Hox genes are conserved in higher animals and have well described
activities concerning their specific roles in segment morphology. For
example Ubx and AbdA directly repress the transcription of the
Distal-less (Dll) gene in the abdomen of the embryo (Gebelein et al.,
2002; Gebelein et al., 2004). Moreover, direct Hox targets specific
to individual or up to three Hox genes have been widely described
(reviewed by Graba et al., 1997; Pearson et al., 2005). Hox genes are
thought to have derived by gene duplication (Lewis, 1951) and
divergence of activity (Carroll, 1995). If Hox genes derived from a
common ancestral gene, then two extreme hypotheses seem
plausible: either ancient Hox functions have been retained or been
lost in current-day Hox genes. Our results favour the former idea, as
all C and P class Hox genes repress head formation and the
expression of optix, in their domains of function, in the trunk
epidermis (Fig. 4A-G). Similar functional equivalence of Hox
proteins has been reported in the nervous system for A and C genes
by Hirth et al. (Hirth et al., 2001).
The A class Hox genes, lab and pb, are not involved in the
repression of optix during embryogenesis. As Lab, like optix, is
expressed and active in the true head, this is not surprising. However,
lab is able to activate optix, following early and continuous ectopic
expression. pb is not active in the embryo and is not able to repress
or activate optix. Thus, optix is a common target of all seven fly Hox
genes that are active in the embryo.
Genes outside of the Hox complex contribute to
head repression in the trunk
We further document that tsh contributes to the morphological
repression of head (de Zulueta et al., 1994; Roder et al., 1992), and
the molecular repression of optix in the trunk (Fig. 2E). However,
loss of Tsh alone does not cause derepression of optix in the trunk;
its activity is only revealed when HoxCP genes are absent, showing
that Tsh and HoxCP genes have common functions. Interestingly
three vertebrate orthologues of tsh have been described that are
expressed in distinct caudal rostral and dorsal ventral domains of the
mouse embryo (Caubit et al., 2000; Manfroid et al., 2004).
In addition, Exd and Hth repress optix in the maxillary, labial,
thoracic and first seven abdominal segments (Fig. 6A-D). The
highly conserved nature of these Hox co-factors and our
observations support the notion that the Hox/Exd/Hth interaction is
an ancient one. However, there is one exception to this rule. Ectopic
expression of optix is not detected in the eighth or ninth abdominal
DEVELOPMENT
The common ability of C and P Hox genes to repress ‘head’ suggests
that this function is an ancient one compared with novel functions,
which are required for morphological novelties observed in distinct
parts of the body, which evolved later on. Although we have been
unable to demonstrate a function for Optix in the trunk of tsh HoxCP
embryos (Fig. 3F), Optix perturbs trunk morphogenesis when
ectopically expressed uniformly (Fig. 3G). The Hox co-factors Exd
and Hth also repress optix in the trunk, consistent with a common
role for C and P Hox genes in the repression of head and indicating
that Hox/Exd/Hth complexes are ancient acquisitions, in accordance
with their universality in bilaterians. Furthermore, we show that
additional, conserved genes, including tsh, en and wg have a
common function with C and P Hox genes to repress head identity
(Fig. 7E).
298
RESEARCH ARTICLE
Development 135 (2)
Fig. 6. Expression of optix in
mutations for exd and hth.
Expression of optix (green) in exd
(A,C) and hth (B,D) mutant
embryos, and cuticle preparations
(E,F). (A,B) Stage 12; (C,D)
retracted germ band stage.
Expression of optix is strongest in
the maxillary (Mx), labial (Lb) and
thoracic segments and weaker in
A1-7. There is no significant
expression of optix in the A8,
where AbdB is detected (A,B), nor
in A9 segments. There is a
stronger segmentation defect in
exd compared with hth embryos.
In the thorax of exd and hth (E,F
insets), crinkled head-like cuticle
differentiates. A and B are lateral
views, C-F are ventral views.
6A,B) in the absence of these co-factors; its ability to act
independently of these co-factors has already been shown for the
formation of the filzkörpers (Peifer and Wieschaus, 1990).
In the thorax of exd and hth larvae, the patterns have been
interpreted as naked in the case of exd (Peifer and Wieschaus, 1990)
or a posteriorly directed transformation for hth (Rieckhof et al.,
1997). As there is strong ectopic expression of optix in the thorax
Fig. 7. The role of Engrailed and Wingless
signalling in the repression of optix.
Expression of wg (red) and optix (green) in
HoxCP (A) and tsh– HoxCP (B) embryos at the
retracted germ band stage. optix and wg
patterns of expression are complementary in
each trunk segment and are colocalised in
parts of the labrum and gnathal domains
(yellow). (C,D) Expression of optix in wg– tsh–
HoxC (C) and tsh– en– HoxC (D) embryos;
optix expression covers a larger region of the
ventral side of each trunk segment compared
with B. (A,B) ventral views; (C) lateral view.
(E) Summary of the repression activities of
HoxCP, Tsh and Wg in a typical trunk
segment.
DEVELOPMENT
segments, where the AbdB, P class, Hox protein acts, in either exd
(Fig. 6A) or hth mutant embryos (Fig. 6B). Exd binds to Hox
proteins via the hexapeptide motif and specific C-terminal regions
(Chang et al., 1995; Knoepfler and Kamps, 1995). Unique among
Hox proteins, AbdB does not possess the classical hexapeptide motif
and has not been reported to bind Exd in vitro (Mann and Affolter,
1998). Our results suggest that AbdB can repress optix (Fig. 4F, Fig.
(Fig. 6A-F) we propose another possibility that the thorax is replaced
with structures normally found in a more anterior position (Fig.
6E,F): i.e. in the head.
Tsh and HoxCP proteins do not repress the expression of optix in
ventral posterior regions of the trunk segments (Fig. 2E), but do so
when Wg or En are also abrogated. As loss of en, wg or tsh or in
double combinations does not lead to ectopic optix expression in the
trunk, our results favour the idea that Wg signalling and En share a
common function with tsh and HoxCP genes to repress head in the
trunk. We note that Tsh has been implicated in the late function of
Wg signalling for the patterning of the trunk segments (Gallet et al.,
1998; Gallet et al., 1999) and that Exd is required for the
maintenance of wg, en and tsh transcription (Peifer and Wieschaus,
1990; Rauskolb and Wieschaus, 1994), which could explain the
extent of optix ectopic patches in this context (Fig. 6A,D).
This is the first evidence suggesting that Wg signalling is capable
of repressing head in any invertebrate species, though this is a well
documented function for Wnt signalling in vertebrates (Niehrs,
1999; Popperl et al., 1997). The role of wg for the suppression of
head in the fly trunk is masked by a redundant, activity shared by
HoxCP and Tsh factors. In the brain of mice lacking Six3 (optix
orthologue), Wnt1 expression is extended anteriorly, leading to
posteriorisation of the brain. Thus, forebrain regionalisation requires
the repression of Wnt1 by Six3 (Lagutin et al., 2003).
Role of Optix during embryonic head
development
The phenotypic analysis of optix during embryogenesis reveals that
it acts in the labrum (Fig. 3): its initial blastoderm domain of
expression (Fig. 2A). Additionally, optix is involved in the normal
development of the mouth hooks (Fig. 3D) and is detected in a pair
of cells from stage 11 in the maxillary segment from which the
hooks derive (Fig. 2B). Previously, Optix has been shown to induce
ectopic eye development (Seimiya and Gehring, 2000) in the adult,
following ectopic optix production. In all organisms tested, the
expression of Six3 is limited to the forebrain and the optic vesicles.
In vertebrates, gain of function induces an enlarged brain and eye or
ectopic retina or lens development (Bovolenta et al., 1998; Liu et al.,
2006; Loosli et al., 1999; Zuber et al., 1999), whereas loss of
function leads to the failure of forebrain development or eye
formation (Carl et al., 2002; Lagutin et al., 2003). Six3 family
members, including Optix, therefore have activities restricted to
parts of the head.
Evolutionary considerations
Bilaterians (especially the chordates) possess both Hox and
parologous Para Hox complexes (Garcia-Fernandez, 2005).
Analysis of these clusters indicates that they arose by gene
duplication and divergence. A recent study has compared the Hox
and paraHox complexes from both triploblast and diploblast
(cniderians) species and suggests that the original ‘protoHox’
complex was made up of only anterior class Hox genes (Chourrout
et al., 2006). This idea is consistent with the observation that, during
embryogenesis of vertebrate and some invertebrate (Scholtz et al.,
1994) species, the head is the first to develop morphologically, with
the central parts added on during later steps of development.
Furthermore, one school of thought favours the idea, from the
observation of gene expression patterns in cnidarian species, that
ancient organisms possessed a large head with no trunk and reduced
tail parts (Meinhardt, 2002). Our results favour the idea that head is
evolutionarily more primitive than trunk, as the C and P Hox genes
repress head and the head specific gene optix in the trunk. Early
RESEARCH ARTICLE
299
ectopic expression of the sole A class Hox that is active in the
embryo, Lab, can activate optix (Fig. 5G). This effect may represent
a vestige of the most ancient Hox function: the modification of head
identity (see Hirth et al., 2001).
In conclusion, we show that HoxCP genes share a common role
to suppress head development in the trunk in addition to their well
documented, novel roles for segment identity. This common
function has been retained by all central and posterior Hox proteins,
as well as by their co-actors Exd, Hth, Tsh, Wg and En. Clearly, our
results favour the idea that complex organisms have acquired
multiple factors to repress head, as well as the acquisition of novel
functions to diversify the trunk. As these factors are conserved in
vertebrates, we expect these roles, at least in part, to be conserved.
We thank G. Morata, W. McGinnis, W. Gehring, S. Cohen, J. Casanova, M.
Scott, E. Sanchez-Herrero, R. Mann, M. Calleja, J. Kennison, B. Monier, S.
Merabet, Y. Graba, J.-P. Vincent, F. Maschat and the Bloomington fly stock
center for supplying flies or materials. S. Merabet, Y. Graba and H. Meinhardt
are acknowledged for their helpful suggestions. Some antibodies were
obtained from the Developmental Studies Hybridoma Bank maintained by the
Department of Pharmacology and Molecular Sciences at Johns Hopkins
University of Medicine and the Department of Biological Sciences at Iowa
University under contract NO1-HD-2-3144 from NICHD. D.C. was funded by
the Ministère de la Recherche et Technologie and Fondation de la Recherche
Médicale and this work was funded by a grant from the Association de la
Recherche sur le Cancer to S.K.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/135/2/291/DC1
References
Bovolenta, P., Mallamaci, A., Puelles, L. and Boncinelli, E. (1998). Expression
pattern of cSix3, a member of the Six/sine oculis family of transcription factors.
Mech. Dev. 70, 201-203.
Carl, M., Loosli, F. and Wittbrodt, J. (2002). Six3 inactivation reveals its essential
role for the formation and patterning of the vertebrate eye. Development 129,
4057-4063.
Carroll, S. B. (1995). Homeotic genes and the evolution of arthropods and
chordates. Nature 376, 479-485.
Casanova, J., Sanchez-Herrero, E., Busturia, A. and Morata, G. (1987). Double
and triple mutant combinations of bithorax complex of Drosophila. EMBO J. 6,
3103-3109.
Caubit, X., Core, N., Boned, A., Kerridge, S., Djabali, M. and Fasano, L.
(2000). Vertebrate orthologues of the Drosophila region-specific patterning gene
teashirt. Mech. Dev. 91, 445-448.
Chadwick, R. and McGinnis, W. (1987). Temporal and spatial distribution of
transcripts from the Deformed gene of Drosophila. EMBO J. 6, 779-789.
Chang, C. P., Shen, W. F., Rozenfeld, S., Lawrence, H. J., Largman, C. and
Cleary, M. L. (1995). Pbx proteins display hexapeptide-dependent cooperative
DNA binding with a subset of Hox proteins. Genes Dev. 9, 663-674.
Chourrout, D., Delsuc, F., Chourrout, P., Edvardsen, R. B., Rentzsch, F.,
Renfer, E., Jensen, M. F., Zhu, B., de Jong, P., Steele, R. E. et al. (2006).
Minimal ProtoHox cluster inferred from bilaterian and cnidarian Hox
complements. Nature 442, 684-687.
de Rosa, R., Grenier, J. K., Andreeva, T., Cook, C. E., Adoutte, A., Akam, M.,
Carroll, S. B. and Balavoine, G. (1999). Hox genes in brachiopods and
priapulids and protostome evolution. Nature 399, 772-776.
de Zulueta, P., Alexandre, E., Jacq, B. and Kerridge, S. (1994). Homeotic
complex and teashirt genes co-operate to establish trunk segmental identities in
Drosophila. Development 120, 2287-2296.
Diederich, R. J., Merrill, V. K., Pultz, M. A. and Kaufman, T. C. (1989).
Isolation, structure, and expression of labial, a homeotic gene of the
Antennapedia Complex involved in Drosophila head development. Genes Dev. 3,
399-414.
Duboule, D. (1994). A Guidebook to Homeobox Genes. Oxford: Oxford University
Press.
FlyBase Consortium (1999). The FlyBase database of the Drosophila Genome
Projects and community literature. Nucleic Acids Res. 27, 85-88.
Gallet, A., Erkner, A., Charroux, B., Fasano, L. and Kerridge, S. (1998). Trunkspecific modulation of Wingless signalling in Drosophila by Teashirt binding to
Armadillo. Curr. Biol. 8, 893-902.
Gallet, A., Angelats, C., Erkner, A., Charroux, B., Fasano, L. and Kerridge, S.
(1999). The C-terminal domain of Armadillo binds to hypophosphorylated
Teashirt to modulate Wingless signalling in Drosophila. EMBO J. 18, 2208-2217.
DEVELOPMENT
Generic Hox function
RESEARCH ARTICLE
Garcia-Fernandez, J. (2005). The genesis and evolution of homeobox gene
clusters. Nat. Rev. Genet. 6, 881-892.
Gebelein, B., Culi, J., Ryoo, H. D., Zhang, W. and Mann, R. S. (2002).
Specificity of Distalless repression and limb primordia development by abdominal
Hox proteins. Dev. Cell 3, 487-498.
Gebelein, B., McKay, D. J. and Mann, R. S. (2004). Direct integration of Hox and
segmentation gene inputs during Drosophila development. Nature 431, 653659.
Gonzalez-Reyes, A. and Morata, G. (1990). The developmental effect of
overexpressing a Ubx product in Drosophila embryos is dependent on its
interactions with other homeotic products. Cell 61, 515-522.
Gonzalez-Reyes, A. and Morata, G. (1991). Organization of the Drosophila head
as revealed by the ectopic expression of the Ultrabithorax product. Development
113, 1459-1471.
Graba, Y., Aragnol, D. and Pradel, J. (1997). Drosophila Hox complex
downstream targets and the function of homeotic genes. BioEssays 19, 379-388.
Hazelrigg, T. and Kaufman, T. C. (1983). Revertants of dominant mutations
associated with the antennapedia gene complex of Drosophila melanogaster:
cytology and genetics. Genetics 105, 581-600.
Hirth, F., Loop, T., Egger, B., Miller, D. F., Kaufman, T. C. and Reichert, H.
(2001). Functional equivalence of Hox gene products in the specification of the
tritocerebrum during embryonic brain development of Drosophila. Development
128, 4781-4788.
Hueber, S., Bezdan, D., Henz, S., Blank, M., Wu, H. and Lohmann, I. (2007).
Comparative analysis of Hox downstream genes in Drosophila. Development
134, 381-392.
Jürgens, G., Lehmann, R., Scharding, M. and Nüsslein-Volhard, C. (1986).
Segmental organization of the head in the embryo of Drosophila melanogaster:
a blastoderm fate map of the cuticle structures of the larval head. Roux’s Arch.
Dev. Biol. 195, 359-377.
Kaufman, T. C., Seeger, M. A. and Olsen, G. (1990). Molecular and genetic
organization of the Antennapedia gene complex of Drosophila melanogaster.
Adv. Genet. 27, 309-362.
Kawakami, K., Sato, S., Ozaki, H. and Ikeda, K. (2000). Six family genes
structure and function as transcription factors and their roles in development.
BioEssays 22, 616-626.
Klingensmith, J. and Nusse, R. (1994). Signaling by wingless in Drosophila. Dev.
Biol. 166, 396-414.
Knoepfler, P. S. and Kamps, M. P. (1995). The pentapeptide motif of Hox
proteins is required for cooperative DNA binding with Pbx1, physically contacts
Pbx1, and enhances DNA binding by Pbx1. Mol. Cell. Biol. 15, 5811-5819.
Kuziora, M. A. and McGinnis, W. (1988). Autoregulation of a Drosophila
homeotic selector gene. Cell 55, 477-485.
Lagutin, O. V., Zhu, C. C., Kobayashi, D., Topczewski, J., Shimamura, K.,
Puelles, L., Russell, H. R., McKinnon, P. J., Solnica-Krezel, L. and Oliver, G.
(2003). Six3 repression of Wnt signaling in the anterior neuroectoderm is
essential for vertebrate forebrain development. Genes Dev. 17, 368-379.
Laugier, E., Yang, Z., Fasano, L., Kerridge, S. and Vola, C. (2005). A critical role
of teashirt for patterning the ventral epidermis is masked by ectopic expression
of tiptop, a paralog of teashirt in Drosophila. Dev. Biol. 283, 446-458.
Lewis, E. B. (1951). Pseudoallelism and gene evolution. Cold Spring Harb. Symp.
Quant. Biol. 16, 159-174.
Lewis, E. B. (1978). A gene complex controlling segmentation in Drosophila.
Nature 276, 565-570.
Liu, W., Lagutin, O. V., Mende, M., Streit, A. and Oliver, G. (2006). Six3
activation of Pax6 expression is essential for mammalian lens induction and
specification. EMBO J. 25, 5383-5395.
Logan, C. Y. and Nusse, R. (2004). The Wnt signaling pathway in development
and disease. Annu. Rev. Cell Dev. Biol. 20, 781-810.
Loosli, F., Winkler, S. and Wittbrodt, J. (1999). Six3 overexpression initiates the
formation of ectopic retina. Genes Dev. 13, 649-654.
Manfroid, I., Caubit, X., Kerridge, S. and Fasano, L. (2004). Three putative
murine Teashirt orthologues specify trunk structures in Drosophila in the same
way as the Drosophila teashirt gene. Development 131, 1065-1073.
Mann, R. S. (1995). The specificity of homeotic gene function. BioEssays 17, 855863.
Mann, R. S. and Chan, S. K. (1996). Extra specificity from extradenticle: the
partnership between HOX and PBX/EXD homeodomain proteins. Trends Genet.
12, 258-262.
Mann, R. S. and Affolter, M. (1998). Hox proteins meet more partners. Curr.
Opin. Genet. Dev. 8, 423-429.
McGinnis, W., Levine, M. S., Hafen, E., Kuroiwa, A. and Gehring, W. J.
(1984). A conserved DNA sequence in homoeotic genes of the Drosophila
Antennapedia and Bithorax complexes. Nature 308, 428-433.
Development 135 (2)
Meinhardt, H. (2002). The radial-symmetric hydra and the evolution of the
bilateral body plan: an old body became a young brain. BioEssays 24, 185-191.
Merrill, V. K., Diederich, R. J., Turner, F. R. and Kaufman, T. C. (1989). A
genetic and developmental analysis of mutations in labial, a gene necessary for
proper head formation in Drosophila melanogaster. Dev. Biol. 135, 376-391.
Moens, C. B. and Selleri, L. (2006). Hox cofactors in vertebrate development.
Dev. Biol. 291, 193-206.
Niehrs, C. (1999). Head in the WNT: the molecular nature of Spemann’s head
organizer. Trends Genet. 15, 314-319.
Payre, F., Vincent, A. and Carreno, S. (1999). ovo/svb integrates Wingless and
DER pathways to control epidermis differentiation. Nature 400, 271-275.
Pearson, J. C., Lemons, D. and McGinnis, W. (2005). Modulating Hox gene
functions during animal body patterning. Nat. Rev. Genet. 6, 893-904.
Peifer, M. and Wieschaus, E. (1990). Mutations in the Drosophila gene
extradenticle affect the way specific homeo domain proteins regulate segmental
identity. Genes Dev. 4, 1209-1223.
Popperl, H., Schmidt, C., Wilson, V., Hume, C. R., Dodd, J., Krumlauf, R. and
Beddington, R. S. (1997). Misexpression of Cwnt8C in the mouse induces an
ectopic embryonic axis and causes a truncation of the anterior neuroectoderm.
Development 124, 2997-3005.
Pultz, M. A., Diederich, R. J., Cribbs, D. L. and Kaufman, T. C. (1988). The
proboscipedia locus of the Antennapedia complex: a molecular and genetic
analysis. Genes Dev. 2, 901-920.
Rauskolb, C. and Wieschaus, E. (1994). Coordinate regulation of downstream
genes by Extradenticle and the homeotic selector proteins. EMBO J. 13, 35613569.
Rauskolb, C., Smith, K. M., Peifer, M. and Wieschaus, E. (1995). Extradenticle
determines segmental identities throughout Drosophila development.
Development 121, 3663-3673.
Rieckhof, G. E., Casares, F., Ryoo, H. D., Abu-Shaar, M. and Mann, R. S.
(1997). Nuclear translocation of Extradenticle requires homothorax, which
encodes an Extradenticle related homeodomain protein. Cell 91, 171-183.
Riley, P. D., Carroll, S. B. and Scott, M. P. (1987). The expression and
regulation of Sex combs reduced protein in Drosophila embryos. Genes Dev. 1,
716-730.
Roder, L., Vola, C. and Kerridge, S. (1992). The role of the teashirt gene in trunk
segmental identity in Drosophila. Development 115, 1017-1033.
Ryoo, H. D. and Mann, R. S. (1999). The control of trunk Hox specificity and
activity by Extradenticle. Genes Dev. 13, 1704-1716.
Sanchez-Herrero, E., Vernos, I., Marco, R. and Morata, G. (1985). Genetic
organization of Drosophila bithorax complex. Nature 313, 108-113.
Sanson, B. (2001). Generating patterns from fields of cells. Examples from
Drosophila segmentation. EMBO Rep. 2, 1083-1108.
Scholtz, G., Patel, N. H. and Dohle, W. (1994). Serially homologous engrailed
stripes are generated via different cell lineages in the germ band of amphipod
crustaceans (Malacostraca, Peracarida). Int. J. Dev. Biol. 38, 471-478.
Schubert, F. R., Nieselt-Struwe, K. and Gruss, P. (1993). The Antennapedia-type
homeobox genes have evolved from three precursors separated early in
metazoan evolution. Proc. Natl. Acad. Sci. USA 90, 143-147.
Scott, M. P. and Weiner, A. J. (1984). Structural relationships among genes that
controldevelopment: sequence homology between the Antennapedia,
Ultrabithorax, and fushi tarazu loci of Drosophila. Proc. Natl. Acad. Sci. USA 81,
4115-4119.
Seimiya, M. and Gehring, W. J. (2000). The Drosophila homeobox gene optix is
capable of inducing ectopic eyes by an eyeless-independent mechanism.
Development 127, 1879-1886.
Snodgrass, R. E. (1938). Evolution of Annelida, Onychophora and Arthropoda.
Smithson. Misc. Coll. 138.
Struhl, G. (1983). Role of the esc+ gene product in ensuring the selective
expression of segment specific homeotic genes in Drosophila. J. Embryol. Exp.
Morphol. 76, 297-331.
Stuart, J., Brown, S., Beeman, R. and Denell, R. (1991). A deficiency of the
homeotic complex of the beetle Tribolium. Nature 350, 72-74.
Svingen, T. and Tonissen, K. F. (2006). Hox transcription factors and their elusive
mammalian gene targets. Heredity 97, 88-96.
Wakimoto, B. T. and Kaufman, T. C. (1981). Analysis of larval segmentation in
lethal genotypes associated with the Antennapedia gene complex in Drosophila
melanogaster. Dev. Biol. 81, 51-64.
White, R. A. and Wilcox, M. (1985). Distribution of Ultrabithorax proteins in
Drosophila. EMBO J. 4, 2035-2043.
Wodarz, A. and Nusse, R. (1998). Mechanisms of Wnt signaling in development.
Annu. Rev. Cell Dev. Biol. 14, 59-88.
Zuber, M. E., Perron, M., Philpott, A., Bang, A. and Harris, W. A. (1999). Giant
eyes in Xenopus laevis by overexpression of XOptx2. Cell 98, 341-352.
DEVELOPMENT
300