RESEARCH ARTICLE 2895
Development 135, 2895-2904 (2008) doi:10.1242/dev.022194
Self-modulation of Notch signaling during ommatidial
development via the Roughened eye transcriptional
repressor
David del Alamo* and Marek Mlodzik†
The Notch (N) signaling pathway is involved in a vast number of patterning processes in all metazoans. The regulation of the core N
pathway is largely understood, but little is known about fine-tuning modulatory effects. Here, we address the role of Drosophila
Krüppel-family Zn-finger transcription factor roughened eye (roe) in the context of N signaling. We demonstrate that during eye
patterning, N signaling regulates the expression of roe. In turn, Roe negatively modulates the expression of target genes of Nsignaling activation. In the absence of roe function, expression of N target genes is elevated and the resulting phenotypes during
patterning of the retina are similar to those of N gain-of-function scenarios. Importantly, our data show that Roe binds regulatory
DNA sequences of N target genes of the E(spl)-complex both in vitro and in vivo, independently of Su(H)-DNA interaction. Thus, our
data suggest that Roe acts as a transcriptional repressor in a negative-feedback loop of the N pathway.
INTRODUCTION
A limited number of intercellular signaling pathways are used
reiteratively in different contexts to control the development of
metazoans. An unanswered question in the study of organism
development is how do these signals cooperate and how are they are
modulated to give rise to different tissue- and time-dependent
responses?
The Notch (N) signaling pathway, which is involved in a vast
number of processes in Drosophila and vertebrates, is a notable
example (reviewed by Artavanis-Tsakonas et al., 1999; Doroquez
and Rebay, 2006; Lai, 2004). Strikingly, a relatively simple
conserved core pathway controls the entire range of N responses.
The N protein is a transmembrane receptor that is modified through
glycosylation and cleavage (S1) in the Golgi (Logeat et al., 1998;
Moloney et al., 2000; Okajima and Irvine, 2002). Two
transmembrane ligands are known in Drosophila: Delta (Dl) and
Serrate (Ser) (reviewed by Fleming et al., 1997). Upon binding,
ligands induce two additional proteolytic events of N, the S2 and S3
cleavages, leading to the release of the intracellular domain (Nintra),
the active form of N (Pan and Rubin, 1997) (reviewed by Selkoe and
Kopan, 2003). Nintra translocates to the nucleus and interacts with a
protein complex that includes the transcription factors Suppressor
of Hairless [Su(H)] and Mastermind (Mam) to regulate target gene
expression (Bray, 2006; Kopan, 2002).
The Drosophila retina is one tissue in which reiterative N
activity is evident. Ommatidial cell determination and
differentiation initiates in third instar larvae in a very ordered
manner. An indentation, the morphogenetic furrow (MF), sweeps
across eye discs from posterior to anterior, leaving behind it the
ommatidial founder cells, photoreceptor 8 precursors (R8), at
Department of Developmental and Regenerative Biology, Mount Sinai School of
Medicine, 1 Gustave L. Levy Place, New York, NY 10029, USA.
*Present address: Département Biologie du Développement, Institute Pasteur,
25 rue du Docteur Roux, 75724 Paris cedex 15, France
†
Author for correspondence (e-mail: [email protected])
Accepted 15 June 2008
evenly spaced intervals (Wolff and Ready, 1993). N function in the
MF is required for the expression of the proneural factor atonal
(ato, ‘proneural enhancement’) (Jarman et al., 1994; Li and Baker,
2001). Proneural enhancement is followed by lateral inhibition
defining the spacing of single ato-expressing R8 precursors (Li
and Baker, 2001; Sun et al., 1998). R8 secretes the EGFR ligand
Spitz (Spi), which signals to surrounding progenitors to be
recruited. Newly specified photoreceptors also secrete Spi to
further recruit the cells that will form the mature ommatidium.
This process is counteracted by N-mediated lateral inhibition.
Overactivation of EGFR signaling leads to an increased number of
ommatidial cells, whereas overactivation of N signaling has the
opposite effect (Cagan and Ready, 1989; Freeman, 1996; Lai and
Rubin, 2001). The process of lateral inhibition by N involves
transcriptional activation of various target genes, including
members of the Enhancer of split complex [E(spl)-C] that act as
transcriptional repressors of proneural genes (Jimenez and IshHorowicz, 1997; Lecourtois and Schweisguth, 1995).
In addition to its role during ommatidial assembly, N has other
roles in cell fate specification posterior to the MF: it is involved in
the specification of photoreceptor R4 versus R3 and R7 versus
R1/R6 fates (Cooper and Bray, 1999; Cooper and Bray, 2000; del
Alamo and Mlodzik, 2006; Fanto and Mlodzik, 1999; Tomlinson
and Struhl, 2000), and the determination of cone cell fate (Fu and
Noll, 1997). In addition, N signaling is required to control cell cycle
progression during the second mitotic wave (SMW) (Baonza and
Freeman, 2005), the regulation of apoptotic cell death and the
specification of pigment cells during pupal development (Miller and
Cagan, 1998; Rusconi et al., 2000).
Although the regulation of the core N pathway is largely
understood, much remains to be known about tissue- and timespecific modulation of N responses. We address the role of the
rotund (rn; m – FlyBase) gene in the context of N signaling. rn
produces two different transcripts, rn and roughened eye (roe),
which encode two isoforms that are members of the Krüppel family
of Zn-finger transcription factors. Rn and Roe have identical Cterminal regions but differing N-terminal sequences caused by the
use of alternative promoters. They display non-overlapping
DEVELOPMENT
KEY WORDS: Drosophila, Cell signaling, Feedback modulation, Transcriptional repression
expression patterns and are not functionally interchangeable (St
Pierre et al., 2002). Although rn is expressed and required during
wing, haltere, antenna, leg and proboscis development (del Alamo
et al., 2002; St Pierre et al., 2002), roe is specifically expressed in
the eye imaginal disc. No detailed functional studies have been
performed but previous reports have shown that eyes mutant for roe
show disrupted ommatidial patterning caused by reduced
photoreceptor numbers (St Pierre et al., 2002).
Here, we analyze the function of roe during eye development and
demonstrate that N signaling modulates its own target gene
activation during retinal patterning through regulation of roe
expression. In the absence of roe function, expression of N targets
is elevated, causing a phenotype similar to a N gain-of-function
scenario. Our results indicate that roe is required for the
specification of single R8 cells and subsequent recruitment of
ommatidial cells. We demonstrate that roe is expressed, under the
control of N signaling, at high levels in the MF and at lower levels
in progenitor cells posterior to it. Importantly, our data show that
Roe can bind E(spl)-C regulatory DNA sequences both in vitro and
in vivo, and, thus, Roe acts as a transcriptional repressor of N target
genes.
MATERIALS AND METHODS
Drosophila stocks
Flies were grown on standard fly medium at 25°C unless otherwise stated.
Strains used are described in FlyBase (www.flybase.net). rn16 and rn20 are
both null alleles caused by small deficiencies (St Pierre et al., 2002). Lossof-function and ectopic expression clones were generated as previously
described (Basler and Struhl, 1994; Xu and Rubin, 1993). Roe ectopic
expression clones in Fig. 3D were induced on sepGAL4 FRT40 UAS-roe/armZ FRT40 heterozygous larvae.
Immunofluorescence and histology
Larvae and pupae (~48 hours APF) were dissected and stained as described
(Fanto et al., 2000). Primary antibodies used were: mouse α-Elav, rat α-Elav,
mouse α-Wg, mouse α-Dl, mouse α-Nintra, mouse α-Pros (DSHB,
http://www.uiowa.edu/~dshbwww), rabbit α-βGal (Promega), mouse αβGal (Promega), rabbit α-Bib (Doherty et al., 1997), rabbit α-Ato (Jarman
et al., 1994) and mouse α-Boss (Van Vactor et al., 1991). Secondary
antibodies were from Jackson Laboratories. Adult eyes were embedded in
Durcupan resin and tangential sections taken at the equatorial region. At
least three independent eyes were analyzed per genotype.
Antibody production
The Roe ORF was subcloned into pQE (Qiagen) and pGEX (Amersham) for
His-tagged and GST-tagged protein production, respectively. Immunization
of rabbits and preparation of sera was performed by Covance. Antibody
quality and specificity was evaluated by staining imaginal disc containing
rn16 clones (not shown). Details are available upon request.
In situ hybridization
Two different digoxigenin probes were used (DIG RNA labeling kit, Roche).
One was from the roe full-length cDNA while the other was synthesized
from a ~500 bp PCR fragment of this cDNA (details available upon request).
In brief, imaginal discs were fixed in 4% paraformaldehyde at 4°C, and
hybridized in standard 50% formamide hybridization buffer (55°C). Probe
was detected with 1:2000 Alkaline Phosphatase-coupled sheep α-DIG
antibody followed by development with NBT/BCIP (Roche).
Electrophoretic mobility shift assay (EMSA)
EMSA was performed as described (Ausubel et al., 1995). Oligonucleotides
were 32P-radiolabeled using Polynucleotide Kinase (NEB). The 0.3 kb probe
was amplified from the 0.5 kb mδ enhancer using radiolabeled primers.
The non-competitive oligonucletide is a 40 bp fragment from the
E(spl)m8 regulatory region that contains one Su(H) Paired Site (Nellesen et
al., 1999) with the following sequence: ATTGTGTGAGAAACTTACTTTCAGCTCGGTTCCCACGCCAC [Su(H) binding sites in bold].
Development 135 (17)
GST::Su(H) and GST::roe were produced using pGEX vectors (see
above). All binding reactions contained 10-12% glycerol, 100 ng poly dIdC
and 4.5 μg BSA and were incubated for 15 minutes at 30°C before loading
on a prerun gel. Gels were run at 4°C.
Chromatin immunoprecipitation (ChIP) in vivo
In vivo ChIP was performed basically as described (Delaney et al., 2006).
Each experiment, including Input, IP and Mock-IP fractions, was performed
using eye imaginal discs (brain included) from 200 third instar larvae of the
appropriate genotypes. The input fraction was not immunoprecipitated, the
IP fraction was immunoprecipitated using α-Roe antibody (1:1875) and
‘mock-IP’ was immunoprecipitated with preimmune Normal Goat Serum
(1:1875). Final DNA eluate was resuspended in 20 μl for all fractions. The
input fraction (1 μl) and 5 μl each of the IP and mock-IP fractions were used
for PCR in 50 μl. The input PCR (5 μl) and 20 μl each of the IP and mockIP were loaded on gel.
RESULTS
roe is required for proper cell recruitment during
ommatidial development
Flies mutant for the roe null condition rn16/rn20 (see Materials and
methods) die mostly during pupal stages, with escapers displaying
rough eyes that are reduced in size (not shown) (St Pierre et al.,
2002). Tangential sections of these eyes revealed defects in retinal
structure (Fig. 1B), including abnormal ommatidial spacing, a
reduction in number of outer photoreceptors (R1-R6) and an
increase in the number of R7 cells (Fig. 1B,C; see Fig. S1 in the
supplementary material). Additional defects included ommatidial
fusion and loss of pigment cells. The roe phenotype was evident
in third instar imaginal discs, reflecting its requirement in early
ommatidial patterning. Antibody staining revealed fewer Elavpositive cells per ommatidium, consistent with a reduction in
photoreceptor recruitment, an occasional loss of R8, which leads
to the absence of the cluster and spacing defects (asterisks in Fig.
1D, also Fig. 2A), and supernumerary R7 cells (Fig. 1E,E⬘, see
below).
We next analyzed eye clones mutant for the roe null allele, rn16
(see Materials and methods). These displayed phenotypes
identical to those observed in adult escaper eyes (Fig. 1C). In
order to identify the requirement of roe in specific photoreceptors,
we analyzed phenotypically wild-type mosaic ommatidia. In
white (w) clones (only affecting pigment production but not
retinal development), the ratio between ommatidia that are w for
one specific outer photoreceptor and total mosaic ommatidia is
0.5 for each photoreceptor type, because mosaic ommatidia
include either a w (mutant) or a wild-type photoreceptor with the
same probability (not shown). By contrast, if roe is required for
the recruitment or specification of a photoreceptor type, the
number of phenotypically normal ommatidia mutant for that
photoreceptor will be significantly lower than the number of
ommatidia wild type for that photoreceptor, leading to a decreased
ratio. We did observe a reduced ratio for R1 (r=0.32) and R6
(r=0.34; Fig. 1F), which in both cases was statistically significant
(χ2 test, P<0.001). We also analyzed the number of R7s when
compared with the number of outer photoreceptors per ommatidia
(see Fig. S1 in the supplementary material). We detected only
ommatidia with multiple R7 cells when the number of outer R16 photoreceptors was reduced. R1, R6 and R7 are initially
equivalent following their recruitment into the precluster, and Dl
signaling from the R1/R6 precursors to N in R7 specifies the latter
as the sole R7. Ectopic activation of N in R1 and R6 causes these
cells to adopt the R7 fate (Cooper and Bray, 2000). The reduction
in the number of R1-R6 cells in mutant ommatidia, and the
DEVELOPMENT
2896 RESEARCH ARTICLE
Notch signaling feedback modulation
RESEARCH ARTICLE 2897
These results were confirmed by the analysis of rn16 clones in
imaginal discs using markers for different cell types. Three
phenotypic defects were observed in mutant tissue: (1) reduction of
the number of R8 cells and thus ommatidial preclusters (Fig. 2A,A⬘;
α-Ato staining); (2) reduced number of recruited photoreceptors per
ommatidium (Fig. 1D); and (3) multiple R7 cells, as detected in
adult sections and by the molecular R7 marker Prospero (Fig.
1B,C,E,E⬘; and not shown).
In addition, we analyzed the cell number and organization of cone
and pigment cells in pupal eyes. α-Arm staining (see Materials and
methods), which delineates cell membranes, revealed underrecruitment of cone cells (Fig. 1G,H). This was confirmed by
imaginal disc staining with the cone cell marker Cut (not shown).
This analysis also revealed a reduction of secondary and tertiary
pigment cells and defects in interommatidial bristle specification
(Fig. 1G,H).
Taken together, our results indicate that roe is required for proper
ommatidial cell recruitment at several stages of eye development.
Strikingly, the roe phenotype resembles that of a mild overactivation
of N signaling during eye patterning.
presence of multiple R7s only in the context of decreased outer R
cells, suggest that the multiple R7 phenotype is due to a
transformation of R1 and R6 into R7. This is further supported by
the fact that Roe expression is enriched in R1 and R6 precursors
prior to recruitment (see below).
Roe represses N target gene expression
The loss-of-function data suggested that roe antagonizes N signaling
activity (see above). We thus wanted to confirm this hypothesis with
gain-of-function studies. First, clonal overexpression of roe in
developing ommatidia produced a phenotype similar to that of N
loss-of-function clones: the recruitment of supernumerary
photoreceptors to the cluster (Fig. 3A,A⬘). This is in agreement with
our loss-of-function data (reduced number of R-cells) and consistent
with Roe being a negative regulator of N signaling. Expression of N
signaling target genes was difficult to analyze owing to the
recruitment of extra photoreceptors, which show reduced levels of
DEVELOPMENT
Fig. 1. roe loss-of-function causes defective ommatidial cell
recruitment. (A-C) Tangential eye sections with anterior leftwards and
dorsal upwards. (A) Wild-type adult eye. Outer photoreceptors (R1-6)
and the inner R7 are found in every ommatidium (R8 is in a different
plane) surrounded by pigment cells (rhabdomeres are numbered in
inset). (B) rn16/rn20 mutant eye with most ommatidia containing fewer
R-cells and irregular spacing. (C) Mosaic eye bearing rn16 clones
(absence of pigment). roe– ommatidia show a reduced number of R1R6 cells and often multiple R7s (examples indicated with yellow
arrowheads; see Fig. S1 in the supplementary material). There are also
defects in spacing (example marked by asterisk). (D-E⬘) Areas posterior
to the MF in 3rd instar eye discs (anterior is leftwards) stained for α-Elav
(red, marking all R-cells), α-Boss (turquoise in D, marking R8) and αPros (blue in E,E⬘; marking R7). (D) rn16 mutant disc; (E,E⬘) mosaic discs
with wild-type tissue marked by arm-lacZ (green in E, outlined in E⬘).
Fewer R cells are recruited per ommatidium. Spacing defects result from
the presence of fewer R8 founder cells (examples highlighted by
asterisks, see also Fig. 2A,A⬘). α-Pros labels R7 cells (and cone cells in a
different plane, which are Elav negative). The multiple R7 phenotype is
observed inside mutant tissue (example indicated by yellow arrowhead;
wild-type clusters with a single R7 are indicated by arrows). Only the
nuclei of R7, R3 and R4 are visible in this focal plane in most clusters.
(F) Graph showing the frequency of individual mutant R cells in mosaic
ommatidia with a wild-type wt phenotype (random frequency reflecting
no requirement is 0.5; n=152 in nine eyes analyzed). R1 and R6 show a
significantly reduced frequency, indicating a functional requirement of
roe in these cells. (G,H) Pupal retinae stained with α-Arm, which
delineates cell membranes: (G) wild type (‘c’ marking cone cells and ’1’
primary pigment cells in example) and (H) rn16 are shown. The quasicrystalline lattice of wild-type pupal eyes is severely disturbed in roe
mutants. Cone cell, secondary and tertiary pigment cell, and
interommatidial bristle numbers are reduced compared with wild type.
N target gene expression is elevated in roe clones
Based on this phenotype, we explored the possibility that roe is
acting as a negative regulator of N activity. We thus analyzed the
expression of N target genes in roe16 clones.
Ato expression (α-Ato) is first detected as a continuous stripe in
the MF and subsequently resolves into single cells (R8) (Jarman et
al., 1994; Sun et al., 1998). In roe mutant clones, we observed
occasional loss of Ato staining in single cells, indicative of the
failure to specify R8 photoreceptors (arrows in Fig. 2A,A⬘; compare
with arrowheads in same panels). There was no significant change
in Ato expression during proneural enhancement within the MF
(Fig. 2A,A⬘). To confirm a role of roe in the regulation of ato
expression during lateral inhibition, we analyzed the expression of
the lacZ-reporter ato5⬘F9.3-Z (ato-lacZ in Fig. 2B,B⬘). This reporter
is repressed by N signaling through lateral inhibition at this stage
(Sun et al., 1998). In roe clones, ato5⬘F9.3-Z expression was
completely lost, indicating that N activity on this reporter was
increased in the roe mutant background (Fig. 2B,B⬘).
We next analyzed the expression of lacZ reporter lines that are
positively regulated by N signaling during eye patterning (Cooper
et al., 2000). E(spl)mβ1.5-Z (mβ-lacZ in Fig. 2C,C⬘) shows a general
expression posterior to the furrow and its expression was increased
inside roe- clones (Fig. 2C,C⬘). E(spl)mγ1.1-Z (mγ-lacZ in Fig.
2D,D⬘) is expressed in a more restricted manner posterior to the MF.
In roe– clones, this expression was also upregulated (Fig. 2D,D⬘).
In contrast to these N targets, we did not observe changes in
expression of the core N signaling component Dl or N itself (Fig.
2E-F), suggesting that roe might act downstream of N. Taken
together, these data suggest that Roe attenuates N signaling.
2898 RESEARCH ARTICLE
Development 135 (17)
Fig. 2. roe loss-of-function affects the expression of N-signaling targets. Panels show third instar mosaic imaginal discs bearing rn16 clones,
marked by absence of arm-lacZ (red in A,E,F) or Ubi-GFP (red in B-D) and outlined in white in right panels. α-Elav is green in B-E. (A,A⬘) α-Ato (blue)
is detected as a continuous band at the MF and resolves into individual cells (R8) posterior to it. α-Ato is reduced in single cells inside the mutant
clone (arrows) when compared with surrounding wild-type tissue (arrowheads). (B,B⬘) The Ato reporter line ato5⬘F9.3-Z (blue), which is repressed
by N-signaling during R8 lateral inhibition, is not detected inside mutant tissue. (C,C⬘) The E(spl)mβ1.5-Z reporter line (blue), which is regulated by N
signaling, shows higher expression levels inside mutant clones when compared with surrounding wild-type cells. (D,D⬘) The E(spl)mγ1.1-Z reporter
(blue), which is activated by N signaling, is expressed in isolated cells posterior to the MF. Inside mutant tissue, more positive cells are observed
when compared with surrounding wild-type tissue. (E-F⬘) Neither N (E,E⬘, blue and monochrome, detected by α-Nintra) nor Dl expression levels (F,F⬘,
turquoise and monochrome) are affected inside mutant tissue.
In leg imaginal discs, the big brain (bib) gene is expressed in
concentric rings, which constitute the presumptive leg joint cells, in
response to N signaling (Fig. 4E) (de Celis et al., 1998). Activation
of N within the dpp expression stripe (dppGAL4, UAS-NΔECD)
ectopically activates Bib expression (Fig. 4B,B⬘). By contrast,
ectopic expression of Roe in the same domain, led to a repression of
endogenous Bib expression (Fig. 4C,C⬘). In all cases, expression of
wingless (wg) in a ventral-anterior wedge, independent of N
signaling, was not affected (blue in Fig. 4C; not shown), indicating
that the effect was specific. Similarly, the N-signaling reporter/target
E(spl)mβ1.5-Z (mβ-lacZ in Fig. 4D-E) is expressed in concentric
rings coincident with those of bib (Fig. 4D,D⬘). Expression of Roe
within the dpp-domain (dppGAL4, green in Fig. 4E) represses
E(spl)mβ1.5-Z (Fig. 4E,E⬘). By contrast, as with bib, expression of
activated N under dppGAL4 control causes ectopic upregulation of
E(spl)mβ1.5-Z (not shown).
In summary, these data indicate that: (1) roe overexpression
causes similar phenotypes to N loss of function; and (2) that roe is a
general inhibitor of N signaling target gene expression only limited
by its expression pattern.
roe expression is controlled by N signaling
Previous studies have suggested that roe is expressed at high levels in
the MF (St Pierre et al., 2002). Using two different RNA probes (see
Materials and methods) we were able to detect roe expression not only
in the MF but also posterior to it (Fig. 5A; not shown). In order to
define roe expression in detail, we developed a polyclonal antibody
(see Materials and methods). In agreement with our in situ
hybridization experiments, antibody staining revealed that Roe is
expressed at high levels in the MF, and at lower levels in
DEVELOPMENT
N activity per se. To circumvent this problem, we used the welldefined N function in R3/R4 specification. Following the
recruitment of the R3/R4 precursor pair, elevated Fz/PCP signaling
in R3 leads to higher expression levels of Dl and neuralized in R3.
This causes a directional activation of N in R4, which then specifies
R4 fate. N activity can be monitored by the expression of the
reporter line E(spl)mδ0.5-Z (Cooper and Bray, 1999; del Alamo and
Mlodzik, 2006; Fanto and Mlodzik, 1999). We overexpressed Roe
using a sevenless (sev)-derived driver line, sepGAL4, which is active
at high levels in the R3/R4 precursor pair (Fanto et al., 2000), and
observed a large number of R3/R3 symmetrical ommatidia
(35.4±6.7%, Fig. 3B,C), characteristic of a failure of N activation in
R4 precursors. Consequently, imaginal disc staining of the N target
reporter E(spl)mδ0.5-Z showed reduced or absent expression in R4
(not shown). To further analyze this effect, we induced clones of
cells expressing two copies of sepGAL4, UAS-Roe and confirmed the
reduction in expression of E(spl)mδ0.5-Z (Fig. 3D,D⬘).
In contrast to Roe overexpression, constitutive activation of N in
both cells of the R3/R4 pair (sep-NΔECD, see Materials and methods),
causes the opposite phenotype, leading to R4/R4 symmetrical
clusters (32.6±4.3%, Fig. 3C and not shown). Notably, this phenotype
was suppressed by simultaneous co-expression of Roe and NΔECD
(Fig. 3C and not shown), resulting in 16.9±9.1% R3/R3 symmetrical
clusters and 8±3.5% R4/R4-type clusters (Fig. 3C). The loss-of-Rcell phenotype of sep-NΔECD was increased, although this phenotype
is not likely to be produced by defective cell recruitment as sepGAL4
is expressed at high levels only in photoreceptors after recruitment.
To confirm the ability of Roe to negatively modulate N signaling,
we turned to a heterologous system, the leg imaginal disc, where roe
is not expressed endogenously (not shown) (St Pierre et al., 2002).
Notch signaling feedback modulation
RESEARCH ARTICLE 2899
interommatidial progenitor cells posterior to the furrow (Fig. 5B,B⬘,
note largely non-overlapping staining between Elav- and Roe-positive
cells). In accordance with its predicted Zn-finger transcription factor
nature (St Pierre et al., 2002), Roe was detected only in the nuclei (Fig.
5B,B⬘). Furthermore, elevated Roe expression was observed in the
R1/R6 precursor pair (identified by their position with respect to the
whole cluster) at the onset of Elav expression (Fig. 5C). The identity
of R1 and R6 was further confirmed by co-staining with a sevenless
reporter line (sevGAL4, UAS GFP), which is expressed in R1, R6 and
R7 prior to recruitment (Fig. 5D,D⬘). These observations support our
previous observation of a specific requirement in the R1/R6 pair (Fig.
1F; see above).
The Roe expression pattern is strikingly similar to that of N
activity posterior to the MF. Thus, we analyzed the effect of N
signaling on Roe expression. First, we tested loss-of-function
clones of N (N55e11) and observed a clear cell-autonomous
reduction of Roe expression inside mutant tissue, both at the MF
and posterior to it (Fig. 5E,E⬘). A similar effect was seen with
DlRevF10 clones (not shown). Conversely, ectopic activation of N
signaling (NΔECD; see Materials and methods) caused ectopic
upregulation of Roe close to the MF and elevated expression
posterior to it (Fig. 5F,F⬘; overexpression of Dl caused the same
effects, not shown). Expression analysis at the MF is complex,
because N can induce ectopic MFs and photoreceptor
differentiation (with subsequent reduction of roe expression
levels) through activation of dpp expression during the
reincarnation process of MF movement (Fig. 5F,F⬘; data not
shown) (Kumar and Moses, 2001).
In contrast to N, loss-of-function of EGFR signaling generated
through clonal expression of UAS-DERDN or UAS-aos (Freeman,
1994; Freeman, 1996), or loss-of-function of the Hh and Dpp
signaling pathways did not affect roe expression (not shown).
DEVELOPMENT
Fig. 3. Overexpression of Roe phenocopies N loss-of-function phenotypes and represses N target genes during eye development.
(A,A⬘) roe overexpression clones (marked by GFP in green, outlined in A⬘) in third instar eye disc cause recruitment of supernumerary photoreceptors
(anti-Elav, magenta), similar to N pathway loss-of-function clones (compare with Fig. 5E). (B) Tangential section of adult eye of the genotype sepGAL4,
UAS-roe with schematic shown on the right (black and red arrows represent the two chiral forms; green arrows represent symmetrical clusters; black
dot shows loss of R cells). Increased levels of Roe expression in R3/R4 precursors often cause the formation of symmetrical R3/R3 type ommatidia
(some R4/R4 type are also observed; quantified in C). (C) Quantification of the phenotypes of sev-driven expression of roe, NΔECD and together.
Ectopic expression of NΔECD causes a high number of R4/R4-type symmetrical ommatidia and R-cell loss, while Roe causes mostly R3/R3-type and
occasional R-cell loss. The NΔECD phenotype is antagonized by Roe co-expression and a reversion to a significant percentage of R3/R3-type ommatidia
typical of Roe overexpression is observed (the ‘loss of R-cell’ phenotype is enhanced, see text for details). Total number of ommatidia scored was 391
(roe), 545 (NΔECD) and 329 (roe + NΔECD) with at least three eyes per genotype analyzed. (D,D⬘) Third instar eye disc bearing clones of cells expressing
two copies of sepGAL4, UAS-roe (marked by absence of Ubi-GFP in green, see Materials and methods). Expression of the R4-specific N reporter
mδ-lacZ (red) is largely suppressed inside the Roe-overexpressing tissue. Cells outside the clone can be either wild type or have one copy of sepGAL4,
UAS-roe, which can also suppress mδ-lacZ to a lower extent (not shown). α-Elav is in blue.
2900 RESEARCH ARTICLE
Development 135 (17)
Fig. 4. Roe represses N signaling targets during leg disc patterning.
Panels show leg discs, with anterior leftwards and dorsal upwards. Wg
(blue, negative control) is expressed in a ventral wedge at the A/P
boundary in a N-independent manner. (A,A⬘) Bib (red, monochrome in
A⬘) is expressed in concentric rings in leg discs, corresponding to the
presumptive leg segment joints defined by N signaling. (B,B⬘) dppGAL4driven NΔECD ectopic expression (marked by GFP, green) causes a cellautonomous expansion of Bib expression inside the dppGAL4 domain.
(C,C⬘) Ectopic expression of Roe under the control of dppGAL4 (green)
causes cell-autonomous repression (arrowheads) of Bib (red,
monochrome in C’). (D,D⬘) The E(spl)mβ1.5-Z reporter line (mβ-lacZ red
and monochrome) is regulated by N signaling and expressed in concentric
rings corresponding to presumptive cells of the leg joints. (E,E⬘) dppGAL4driven ectopic expression of Roe (green) causes cell-autonomous
repression (arrowheads) of mβ-lacZ (red, monochrome in E⬘).
Roe binds to E(spl)-C regulatory sequences
roe encodes a putative Zn-finger transcription factor (St Pierre et
al., 2002) and our antibody staining showed nuclear subcellular
localization of the protein, suggesting that Roe might act by
binding to DNA to regulate the transcription of N targets. To test
this hypothesis, we performed Electrophoretic mobility shift
assays (EMSAs). As a probe, we used a 300 bp DNA fragment
included in the ~500 bp mδ0.5 enhancer sequence (Cooper et al.,
2000) that contains the Su(H) paired sites (SPS) (Nellesen et al.,
1999) (see Fig. 6A for schematic; see also Materials and
methods). Our previous experiments showed that the mδ0.5
sequence was responsive to Roe overexpression in vivo (e.g. Fig.
3D).
We used GST::Su(H) as a positive control and we detected Su(H)
binding to the probe (Fig. 6B, lanes 1-2). We were also able to
detect a shift with GST::Roe (Fig. 6B, lanes 5-6). Interestingly, the
simultaneous presence of both proteins lead to the same shifts that
were observed with each individual protein (Fig. 6B, lane 3),
indicating that Su(H) and Roe bind DNA independently of each
other. GST-pull down experiments failed to detect any interaction
between Su(H) and Roe (not shown), further confirming this
conclusion. The binding was successfully out-competed by an
excess of cold probe in both cases (Fig. 6B, lanes 4 and 7),
indicating a specific interaction. In an attempt to further define Roe
binding sites in this probe, we performed EMSA with nine
overlapping 60 bp oligonucleotides covering the whole 300 bp
fragment (P1-P9 in Fig. 6A; see Fig. S2 in the supplementary
material). We detected binding of GST::Roe to all oligonucleotides.
The GST::Roe binding was specific, as it was out-competed by an
excess of the respective cold oligonucleotides but not by an equal
excess of an unrelated oligonucleotide (see Fig. S2 in the
supplementary material; see also Materials and methods). These
data suggest that multiple specific Roe-binding sites exist in
E(spl)mδ regulatory sequences.
In order to prove that Roe binds to regulatory DNA sequences in
vivo during normal eye development, we performed chromatin
immunoprecipitation assays (ChIPs, see Materials and methods)
from in vivo samples. In this assay, we were able to recover the 300
bp fragment from DNA immunoprecipitated using the anti-Roe
antibody on eye imaginal disc homogenates (Fig. 6C). By contrast,
when preimmune serum was used (mock-ChIP), no specific bands
were immunoprecipitated (Fig. 6C, right lane). As a specificity
control, we performed ChIP with anti-Roe with sequences from the
unrelated antimicrobial gene attacinA (Delaney et al., 2006) and did
not detect binding, confirming that the Roe interaction with
E(spl)mδ regulatory DNA is specific (Fig. 6C, lower panel). To
further define the specificity of the interaction, we performed ChIP
with imaginal discs from roe null (rn16) larvae and did not detect an
interaction, either with the E(spl)mδ regulatory DNA sequences or
with the AttA promoter (Fig. 6D, upper and lower panels,
respectively), again indicating that the ChIP interaction is specific
for Roe.
In summary, our results indicate that Roe binds to E(spl)mδ
regulatory DNA sequences both in vitro and in vivo independently
of Su(H), providing a molecular mechanism for Roe action in
repressing N-signaling target genes.
DEVELOPMENT
Taken together, our results indicate that Roe is localized to the
nucleus of cells at the MF and in progenitor cells and that its
expression is (at least partially) under N-signaling control. Our data
suggest that Roe is part of a negative-feedback loop modulating N
signaling outcome during ommatidial patterning.
Notch signaling feedback modulation
RESEARCH ARTICLE 2901
Fig. 5. roe expression is under the control of N activity. Panels
show third instar eye disc regions around the MF; anterior is upwards.
(A) In situ hybridization staining: roe is expressed in the MF (yellow
arrowhead) and posterior to it. (B,B⬘) α-Roe staining (turquoise,
monochrome in B⬘). Roe is a nuclear protein detected at high levels in
the MF and at lower levels posterior to it. Roe is higher in
interommatidial (progenitor) cells and shows only low levels in
photoreceptors (Elav, red). (C) Third instar eye disc posterior to the MF
showing α-Roe (turquoise) and α-Elav (red) staining. Note higher levels
of Roe in R1/R6 precursors (examples marked with asterisks). (D,D⬘)
High magnification of an ommatidial precluster showing α-Elav (red),
α-Roe (blue) and sevGAL4 UAS-GFP (green) staining (D) and schematic
cartoon (D⬘). Note that sevGAL4 and Roe are co-expressed in R1/R6
precursors prior to Elav detection. (E,E⬘) N loss-of-function clones
(marked by absence of Ubi-GFP, green) cause reduction in Roe
expression levels (blue, monochrome in E⬘), both within the MF
(compare to B’) and posterior to it. Photoreceptors are marked with αElav (red in E). (F-F⬙) Clones expressing NΔECD (marked by co-expression
of GFP, green, outlined in F⬘) cause ectopic MF initiation in cells anterior
to endogenous MF and ectopic cell-autonomous upregulation of Roe
(blue, monochrome in F⬘) posterior to MF. Clones are as expected
associated with loss of photoreceptors (note reduction in α-Elav, red
and monochrome in F⬙). Close to and within the MF, NΔECD-expressing
clones cause a precocious initiation of the MF state with associated
non-autonomous Roe activation (see also Results).
DISCUSSION
Lateral inhibition mediated by N signaling is used reiteratively during
Drosophila development. Lateral inhibition normally occurs in groups
of initially equivalent cells to limit the number of those that acquire a
certain fate by repression of cell fate determinants via the E(spl)
complex genes (reviewed by Bray, 2006; Jimenez and Ish-Horowicz,
1997; Lecourtois and Schweisguth, 1995). For example, N acts in
proneural clusters to ensure that the proper number of sensory organ
precursors (SOPs) is specified (reviewed by Simpson, 1997), or
during eye development to restrict the number of progenitor cells that
are recruited into the ommatidial cluster (Cagan and Ready, 1989).
roughened eye: a tissue-specific modulator of
N signaling
Loss-of-function phenotypes of roe phenocopy mild N gain-offunction defects during ommatidial patterning: failure to specify R8
cells, under-recruitment of R-cells and specification of multiple R7
cells at the expense of R1/R6. In accordance, we identify several N
targets that are upregulated in roe loss-of-function clones, including
E(spl)-C reporter lines. Pupal eye analyses reveal that in addition to
photoreceptors other ommatidial cells are affected, including cone
cells, secondary and tertiary pigment cells, and interommatidial
bristles. Dl and Spi are expressed in R cells activating N and Egfr
pathways, respectively, in surrounding progenitor cells, where they
cooperate with the transcription factor Lozenge to specify the cone
cell fate (Daga et al., 1996; Flores et al., 2000). roe loss-of-function
can induce higher levels of N target genes that lead to a reduction in
the number of R cells. As R cells produce the signals that specify
cone cells, it is likely that fewer R cells produce, in turn, fewer cone
cells.
Reciprocal to the loss-of-function defects, Roe overexpression
(Fig. 3) leads to repression of N target genes resulting in the
recruitment of extra photoreceptors. Similarly, we demonstrate that
Roe is able to repress the N-signaling dependent R4 fate.
Importantly, the repression effect of Roe can be antagonized by
simultaneous co-expression of an activated form of N, suggesting
that a fine balance between the activity of N-signaling and Roe is
employed in many of these cell fate decisions. Taken together, these
results indicate that roe is a negative modulator of N target gene
expression. However, the effects of Roe are only partial when
compared with N. For example, full activation of N leads to
complete abolishment of photoreceptor recruitment (see Fig. 5F, for
example), whereas roe-null (rn16) clones show a reduced number of
photoreceptors per ommatidium (Fig. 1D,E). These data suggest that
Roe functions as a negative-feedback modulator rather than as a core
component of the N pathway.
Importantly, loss- and gain-of-function experiments with N and
Dl show that roe expression is under the control of N signaling,
defining a new self-regulatory feedback loop. Sequence analysis
demonstrates that four high-affinity Su(H)-binding sites exist in
the introns of the rn/roe gene and one of them lies within 1 kb of
the roe transcriptional start site (Berman et al., 2004). We thus
propose a model where N self-modulates its activity at the level
of target gene expression by activating roe expression, which, in
turn, represses expression of N target genes during ommatidial
patterning.
DEVELOPMENT
During Drosophila eye development, following the specification
of the ommatidial founder cell R8, the remaining cells of the
ommatidium are sequentially recruited through a two-step
mechanism: first, Spitz (Spi) signals to the Drosophila EGF receptor
in surrounding progenitor cells and induces recruitment (Freeman,
1996) and, second, Dl/N-signaling represses the recruitment to ensure
that only the appropriate number of cells join the cluster (Cagan and
Ready, 1989; Fortini et al., 1993). N signaling is not only involved in
the regulation of ommatidial assembly during eye development, but
several other processes as well (see Introduction). Presumably,
different N targets or different levels of N activity, or both, together
with integration of signals from other pathways account for the large
variety of cell responses. How this is achieved is largely unknown
(reviewed by Bray, 2006; Doroquez and Rebay, 2006). Here, we have
identified and molecularly defined the role of the Roe transcription
factor as a negative modulator of N target gene expression,
functioning in a negative-feedback loop of N signaling itself.
2902 RESEARCH ARTICLE
Development 135 (17)
The transcriptional repressor Roe functions in
parallel to Su(H) action
Our results demonstrate that Roe can bind directly to DNA both in
vitro and in vivo. This binding is independent of Su(H), as no
difference in DNA-binding ability of either of these transcription
factors was detected in the presence of the other. However, the
DNA-binding specificity of Roe remains unclear. EMSA analysis
shows that multiple binding sites exist in E(spl)mδ regulatory
sequences. Sequence comparison among the different fragments
used (Fig. S2 in the supplementary material) did not identify a
consensus binding site. This suggests that Roe displays low
binding specificity to DNA in vitro. Thus, higher specificity as
evident in vivo must be achieved through interactions of Roe with
other DNA-binding transcription factors and/or transcriptional cofactors.
Current models of N activation propose that the Nintra domain
translocates to the nucleus where it forms a complex with the DNAbinding transcription factor Su(H) and the co-activator Mam
(Wilson and Kovall, 2006). This complex further recruits other coactivators, like the histone acetyl-transferase CBP/p300 or the
spliceosome component SKIP (Wallberg et al., 2002; Zhou et al.,
2000). In the absence of N signaling, Su(H) itself acts as a
transcriptional repressor (Castro et al., 2005), interacting with the
adaptor protein Hairless, which recruits co-repressors to the complex
(reviewed by Bray, 2006; Kao et al., 1998; Nagel et al., 2005). Thus,
the translocation of Nintra to the nucleus and its interaction with
Su(H) switches a transcriptional repressor complex to an activator
complex.
How does Roe fit into this scenario? First, activation of Nsignaling upregulates Roe expression. Roe in turn binds to the
regulatory sequences of specific target genes in the vicinity of the
Su(H) complex and antagonizes its activity. Through this
mechanism, N signaling cannot only turn an off-state into an onstate [via Su(H)], but can also regulate the activity levels of this
switch (via Roe). In this model, a target gene is activated less in
the presence of Roe than it is in its absence, although it is
generally on (Fig. 6E). Roe could also affect the turnover of Su(H)
on the DNA. Recent studies have shown that the nuclear
translocation of Nintra not only causes the switch from a repression
to an activation complex, but also affects the Su(H) binding
turnover at the DNA. In the presence of Nintra, Su(H) occupancy
of target binding sites is higher than in its absence, suggesting that
Su(H) binds dynamically to DNA (Krejci and Bray, 2007).
Further studies will be required to precisely assess the role of Roe
in N target repression.
The fact that Roe can bind to regulatory sequences independently
of the core N-transcriptional machinery raises the interesting
possibility of differential target-specific modulation. This mode of
regulation is particularly useful in the fine control of multiple
cellular outcomes elicited by a single signaling pathway, as is the
DEVELOPMENT
Fig. 6. Roe binds E(spl)-C regulatory DNA
sequences both in vitro and in vivo. (A) Schematic
presentation of the relative position of the 0.3 kb
fragment used as a probe for EMSA or amplified in in
vivo chromatin immunoprecipitation (ChIP) assays with
respect to the E(spl)mδ gene. Coordinates are based
upon ‘Release 5’ of the Drosophila genome sequence
(BDGP, http://www.fruitfly.org/). 60 bp fragments
denoted as P1-P9 correspond to the probes used in
EMSAs described in Fig. S2 in the supplementary
material. (B) Representative EMSA experiment using
the 0.3 kb fragment (A) as a probe. Lanes are as
follows: (1) Free probe (FP) +2.5 μg Su(H), (2) FP + 5
μg Su(H), (3) FP+2.5 μg Su(H) + 2.5 μg Roe, (4) FP +
2.5 μg Su(H) + 2.5 μg Roe + excess cold probe (ECP)
as competitor, (5) FP + 2.5 μg Roe, (6) FP + 5 μg Roe,
and (7) FP + 2.5 μg Roe + ECP. Shifts caused by Su(H)
and Roe (lanes 1,2 and 5,6, respectively) are
unaffected when both proteins are simultaneously
present (lane 3). (C) In vivo ChIP from a wild-type eye
imaginal discs. A band corresponding to the 0.3 kb
fragment is amplified when the sample is
immunoprecipitated with anti-Roe antibody (Roe-ChIP
lane, compare with INPUT lane) but not when
preimmune NGS was used for IP (mock-ChIP lane). As
a control for specificity, anti-Roe did not coimmunoprecipitate DNA from the AttacinA (AttA)
promoter. (D) In vivo ChIP from homozygous roe null
(rn16) eye discs. No specific ChIP band was amplified
when the sample was immunoprecipitated either with
anti-Roe antibody or preimmune NGS (mock-IP). Same
results were obtained with DNA from the AttA
promoter. In both C and D, weak bands can be
observed occasionally, owing to nonspecific binding of DNA to the resin used during the IP process. (E) Model for Roe action on N targets. In the
absence of N-signaling activity, N target genes are repressed by DNA-bound Su(H) together with transcriptional co-repressors. Upon N activation,
Nintra translocates to the nucleus and, together with Mam and other transcriptional co-activators (not shown), binds to Su(H) to turn ON the
expression of target genes. We propose a third scenario in which N self-modulates its transcriptional activity by upregulating Roe. Roe binds to
regulatory sequences of N target genes independently of Su(H), leading to an attenuated transcriptional activity.
case of N in the developing eye. In this regard, in a roe loss-offunction background, we observed upregulated expression of the Ntarget genes of the E(spl)-C, involved in ommatidial assembly; by
contrast, we did not observe any effect on the N-target CyclinA,
which is required in interommatidial cells to control proliferation
(not shown) (Baonza and Freeman, 2005).
Rn and Roe: one gene with two isoforms and two
functions
The Roe and Rn isoforms of the rn gene share the last 450 C-terminal
residues, including five of the six Zn fingers. However, rescue
experiments performed in previous studies show they are not
functionally interchangeable (St Pierre et al., 2002). Studies on the
function of the Rn isoform during wing development have shown that
it is required for hinge development, without any relationship to N
signaling regulation (del Alamo et al., 2002). Our data and these
previous studies indicate that Roe is a transcriptional repressor,
whereas Rn is likely to function as an activator (Terriente Felix et al.,
2007). The rn gene is thus a notable example of how functional
diversification can be achieved during evolution by domain swapping
among proteins through alternative splicing and promoter usage.
We are grateful to Spyros Artavanis-Tsakonas, Sarah Bray, Fernando J. DiazBenjumea, Gary Struhl and the Bloomington Stock Center for fly stocks and
reagents. We thank Sophy Okello for embryo injections, William Gault, Robert
Krauss, Jaskirat Singh and Jun Wu for comments on the manuscript, and all
members of the Mlodzik laboratory for input and support. This work was
supported by NIH/NEI grant RO1 EY13256 to M.M. and a fellowship from the
Spanish Ministry of Education and Science to D.D.A.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/135/17/2895/DC1
References
Artavanis-Tsakonas, S., Rand, M. D. and Lake, R. J. (1999). Notch signaling:
cell fate control and signal integration in development. Science 284, 770-776.
Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G.,
Smith, J. A. and Struhl, K. (1995). Current Protocols in Molecular Biology. New
York, NY: John Wiley and Sons.
Baonza, A. and Freeman, M. (2005). Control of cell proliferation in the
Drosophila eye by Notch signaling. Dev. Cell 8, 529-539.
Basler, K. and Struhl, G. (1994). Compartment boundaries and the control of
Drosophila limb pattern by Hedgehog protein. Nature 368, 208-214.
Berman, B. P., Pfeiffer, B. D., Laverty, T. R., Salzberg, S. L., Rubin, G. M.,
Eisen, M. B. and Celniker, S. E. (2004). Computational identification of
developmental enhancers: conservation and function of transcription factor
binding-site clusters in Drosophila melanogaster and Drosophila pseudoobscura.
Genome Biol. 5, R61.
Bray, S. J. (2006). Notch signalling: a simple pathway becomes complex. Nat. Rev
Mol. Cell. Biol. 7, 678-689.
Cagan, R. L. and Ready, D. F. (1989). Notch is required for successive cell
decisions in the developing Drosophila retina. Genes Dev. 3, 1099-1112.
Castro, B., Barolo, S., Bailey, A. M. and Posakony, J. W. (2005). Lateral
inhibition in proneural clusters: cis-regulatory logic and default repression by
Suppressor of Hairless. Development 132, 3333-3344.
Cooper, M. T. and Bray, S. J. (1999). Frizzled regulation of Notch signalling
polarizes cell fate in the Drosophila eye. Nature 397, 526-530.
Cooper, M. T. and Bray, S. J. (2000). R7 photoreceptor specification requires
Notch activity. Curr. Biol. 10, 1507-1510.
Cooper, M. T., Tyler, D. M., Furriols, M., Chalkiadaki, A., Delidakis, C. and
Bray, S. (2000). Spatially restricted factors cooperate with notch in the
regulation of Enhancer of split genes. Dev. Biol. 221, 390-403.
Daga, A., Karlovich, C. A., Dumstrei, K. and Barnejee, U. (1996). Patterning of
cells in the Drosophila eye by Lozenge, which shares homologous domains with
AML1. Genes Dev. 10, 1194-1205.
de Celis, J. F., Tyler, D. M., de Celis, J. and Bray, S. J. (1998). Notch signalling
mediates segmentation of the Drosophila leg. Development 125, 4617-4626.
del Alamo, D. and Mlodzik, M. (2006). Frizzled/PCP-dependent asymmetric
neuralized expression determines R3/R4 fates in the Drosophila eye. Dev. Cell 11,
887-894.
del Alamo, D., Terriente, J., Galindo, M. I., Couso, J. P. and Diaz-Benjumea, F.
J. (2002). Different mechanisms initiate and maintain wingless expression in the
Drosophila wing hinge. Development 129, 3995-4004.
RESEARCH ARTICLE 2903
Delaney, J. R., Stoven, S., Uvell, H., Anderson, K. V., Engstrom, Y. and
Mlodzik, M. (2006). Cooperative control of Drosophila immune responses by
the JNK and NF-kappaB signaling pathways. EMBO J. 25, 3068-3077.
Doherty, D., Jan, L. Y. and Jan, Y. N. (1997). The Drosophila neurogenic gene big
brain, which encodes a membrane-associated protein, acts cell autonomously
and can act synergistically with Notch and Delta. Development 124, 3881-3893.
Doroquez, D. B. and Rebay, I. (2006). Signal integration during development:
mechanisms of EGFR and Notch pathway function and cross-talk. Crit. Rev.
Biochem. Mol. Biol. 41, 339-385.
Fanto, M. and Mlodzik, M. (1999). Asymmetric Notch activation specifies
photoreceptors R3 and R4 and planar polarity in the Drosophila eye. Nature 397,
523-526.
Fanto, M., Weber, U., Strutt, D. I. and Mlodzik, M. (2000). Nuclear signaling by
Rac and Rho GTPases is required in the establishment of epithelial planar polarity
in the Drosophila eye. Curr. Biol. 10, 979-988.
Fleming, R. J., Purcell, K. and Artavanis-Tsakonas, S. (1997). The NOTCH
receptor and its ligands. Trends Cell. Biol. 7, 437-441.
Flores, G. V., Duan, H., Yan, H., Nagaraj, R., Fu, W., Zou, Y., Noll, M. and
Barnejee, U. (2000). Combinatorial signaling in the specification of unique cell
fates. Cell 103, 75-85.
Fortini, M. E., Rebay, I., Caron, L. A. and Artavanis-Tsakonas, S. (1993). An
activated Notch receptor blocks cell-fate commitment in the developing
Drosophila eye. Nature 365, 555-557.
Freeman, M. (1994). Misexpression of the Drosophila argos gene, a secreted
regulator of cell determination. Development 120, 2297-2304.
Freeman, M. (1996). Reiterative use of the EGF receptor triggers differentiation of
all cell types in the Drosophila eye. Cell 87, 651-660.
Fu, W. and Noll, M. (1997). The Pax2 homolog sparkling is required for
development of cone and pigment cells in the Drosophila eye. Genes Dev. 11,
2066-2078.
Jarman, A. P., Grell, E. H., Ackerman, L., Jan, L. Y. and Jan, Y. N. (1994).
Atonal is the proneural gene for Drosophila photoreceptors. Nature 369, 398400.
Jimenez, G. and Ish-Horowicz, D. (1997). A chimeric enhancer-of-split
transcriptional activator drives neural development and achaete-scute
expression. Mol. Cell. Biol. 17, 4355-4362.
Kao, H. Y., Ordentlich, P., Koyano-Nakagawa, N., Tang, Z., Downes, M.,
Kintner, C. R., Evans, R. M. and Kadesch, T. (1998). A histone deacetylase
corepressor complex regulates the Notch signal transduction pathway. Genes
Dev. 12, 2269-2277.
Kopan, R. (2002). Notch: a membrane-bound transcription factor. J. Cell Sci. 115,
1095-1097.
Krejci, A. and Bray, S. (2007). Notch activation stimulates transient and selective
binding of Su(H)/CSL to target enhancers. Genes Dev. 21, 1322-1327.
Kumar, J. P. and Moses, K. (2001). The EGF receptor and notch signaling
pathways control the initiation of the morphogenetic furrow during Drosophila
eye development. Development 128, 2689-2697.
Lai, E. C. (2004). Notch signaling: control of cell communication and cell fate.
Development 131, 965-973.
Lai, E. C. and Rubin, G. M. (2001). Neuralized is essential for a subset of Notch
pathway-dependent cell fate decisions during Drosophila eye development.
Proc. Natl. Acad. Sci. USA 98, 5637-5642.
Lecourtois, M. and Schweisguth, F. (1995). The neurogenic suppressor of
hairless DNA-binding protein mediates the transcriptional activation of the
enhancer of split complex genes triggered by Notch signaling. Genes Dev. 9,
2598-2608.
Li, Y. and Baker, N. E. (2001). Proneural enhancement by Notch overcomes
Suppressor-of-Hairless repressor function in the developing Drosophila eye. Curr.
Biol. 11, 330-338.
Logeat, F., Bessia, C., Brou, C., LeBail, O., Jarriault, S., Seidah, N. G. and
Israel, A. (1998). The Notch1 receptor is cleaved constitutively by a furin-like
convertase. Proc. Natl. Acad. Sci. USA 95, 8108-8112.
Miller, D. T. and Cagan, R. L. (1998). Local induction of patterning and
programmed cell death in the developing Drosophila retina. Development 125,
2327-2335.
Moloney, D. J., Panin, V. M., Johnston, S. H., Chen, J., Shao, L., Wilson, R.,
Wang, Y., Stanley, P., Irvine, K. D., Haltiwanger, R. S. et al. (2000). Fringe is
a glycosyltransferase that modifies Notch. Nature 406, 369-375.
Nagel, A. C., Krejci, A., Tenin, G., Bravo-Patino, A., Bray, S., Maier, D. and
Preiss, A. (2005). Hairless-mediated repression of notch target genes requires
the combined activity of Groucho and CtBP corepressors. Mol. Cell. Biol. 25,
10433-10441.
Nellesen, D. T., Lai, E. C. and Posakony, J. W. (1999). Discrete enhancer
elements mediate selective responsiveness of Enhancer of split Complex genes
to common transcriptional activators. Dev. Biol. 213, 33-53.
Okajima, T. and Irvine, K. D. (2002). Regulation of notch signaling by o-linked
fucose. Cell 111, 893-904.
Pan, D. and Rubin, G. M. (1997). Kuzbanian controls proteolytic processing of
Notch and mediates lateral inhibition during Drosophila and vertebrate
neurogenesis. Cell 90, 271-280.
DEVELOPMENT
Notch signaling feedback modulation
Rusconi, J. C., Hays, R. and Cagan, R. L. (2000). Programmed cell death and
patterning in Drosophila. Cell Death Differ. 7, 1063-1070.
Selkoe, D. and Kopan, R. (2003). Notch and Presenilin: regulated intramembrane
proteolysis links development and degeneration. Annu. Rev. Neurosci. 26, 565597.
Simpson, P. (1997). Notch signaling in development: on equivalence groups and
asymmetric developmental potential. Curr. Opin. Genet. Dev. 7, 537-542.
St Pierre, S. E., Galindo, M. I., Couso, J. P. and Thor, S. (2002). Control of
Drosophila imaginal disc development by rotund and roughened eye:
differentially expressed transcripts of the same gene encoding functionally
distinct zinc finger proteins. Development 129, 1273-1281.
Sun, Y., Jan, L. Y. and Jan, Y. N. (1998). Transcriptional regulation of atonal
during development of the Drosophila peripheral nervous system. Development
125, 3731-3740.
Terriente Felix, J., Magarinos, M. and Diaz-Benjumea, F. J. (2007). Nab
controls the activity of the zinc-finger transcription factors Squeeze and Rotund
in Drosophila development. Development 134, 1845-1852.
Development 135 (17)
Van Vactor, D. L., Jr, Cagan, R. L., Kramer, H. and Zipursky, S. L. (1991).
Induction in the developing compound eye of Drosophila: multiple mechanisms
restrict R7 induction to a single retinal precursor cell. Cell 67, 1145-1155.
Wallberg, A. E., Pedersen, K., Lendahl, U. and Roeder, R. G. (2002). p300 and
PCAF act cooperatively to mediate transcriptional activation from chromatin
templates by notch intracellular domains in vitro. Mol. Cell. Biol. 22, 7812-7819.
Wilson, J. J. and Kovall, R. A. (2006). Crystal structure of the CSL-NotchMastermind ternary complex bound to DNA. Cell 124, 985-996.
Wolff, T. and Ready, D. F. (1993). Pattern formation in the Drosophila retina. In
The Development of Drosophila melanogaster (ed. M. Bate and A. MartinezArias), pp. 1277-1326. Cold Spring Harbor, NY: Cold Spring Harbor Press.
Xu, T. and Rubin, G. M. (1993). Analysis of genetic mosaics in developing and
adult Drosophila tissues. Development 117, 1223-1237.
Zhou, S., Fujimuro, M., Hsieh, J. J., Chen, L., Miyamoto, A., Weinmaster, G.
and Hayward, S. D. (2000). SKIP, a CBF1-associated protein, interacts with the
ankyrin repeat domain of NotchIC To facilitate NotchIC function. Mol. Cell. Biol.
20, 2400-2410.
DEVELOPMENT
2904 RESEARCH ARTICLE