PHYSIOLOGICAL REVIEWS Vol. 80, No. 3, July 2000 Printed in U.S.A. Corticotropin Releasing Hormone and Proopiomelanocortin Involvement in the Cutaneous Response to Stress ANDRZEJ SLOMINSKI, JACOBO WORTSMAN, THOMAS LUGER, RALF PAUS, AND SAMUEL SOLOMON I. II. III. IV. Physiology of the Systemic Response to Stress: Role of the Hypothalamic-Pituitary-Adrenal Axis The Skin as a Shock Organ for Environmental Stresses Cutaneous Response to Stress: Local Neuroendocrine Signals Corticotropin Releasing Hormone A. CRH expression: intracranial B. CRH expression: peripheral C. CRH expression: skin V. Corticotropin Releasing Hormone Receptors A. CRH receptors: structure and function B. CRH receptors: skin VI. Proopiomelanocortin A. POMC expression: intracranial B. POMC expression: peripheral C. POMC expression: skin VII. Skin as a Target for Proopiomelanocortin Peptides A. Melanocortin receptors B. Opioid receptors C. Phenotypic effects of POMC peptides VIII. Regulation of the Cutaneous Corticotropin Releasing Hormone-Proopiomelanocortin System A. UVR B. Cytokines C. Hair cycle D. Disease states E. Cellular metabolism mediators F. Glucocorticoids IX. Physiological Significance of Cutaneous Production of Corticotropin Releasing Hormone and Proopiomelanocortin X. Hypothesis on an Organized System Mediating Skin Responses to Stress A. Hypothesis B. Background to the organization and function of the SSRS C. Functional organization of SSRS Downloaded from http://physrev.physiology.org/ by 10.220.33.6 on July 4, 2017 Department of Pathology, Loyola University Medical Center, Maywood; Department of Medicine, Southern Illinois University, Springfield, Illinois; Department of Dermatology, Ludwig Boltzmann Institute of Cell Biology and Immunobiology of the Skin, University of Munster, Munster; Department of Dermatology, University Hospital Eppendorf, University of Hamburg, Hamburg, Germany; and Department of Medicine and Biochemistry, McGill University and Royal Victoria Hospital, Montreal, Quebec, Canada 980 980 981 981 981 982 983 984 984 985 988 988 990 990 997 997 1000 1000 1005 1005 1005 1005 1005 1005 1006 1006 1006 1006 1007 1008 Slominski, Andrzej, Jacobo Wortsman, Thomas Luger, Ralf Paus, and Samuel Solomon. Corticotropin Releasing Hormone and Proopiomelanocortin Involvement in the Cutaneous Response to Stress. Physiol Rev 80: 979 –1020, 2000.—The skin is a known target organ for the proopiomelanocortin (POMC)-derived neuropeptides ␣-melanocyte stimulating hormone (␣-MSH), -endorphin, and ACTH and also a source of these peptides. Skin expression levels of the POMC gene and POMC/corticotropin releasing hormone (CRH) peptides are not static but are determined by such factors as the physiological changes associated with hair cycle (highest in anagen phase), ultraviolet radiation (UVR) exposure, immune cytokine release, or the presence of cutaneous pathology. Among the cytokines, the proinflammatory interleukin-1 produces important upregulation of cutaneous levels of POMC mRNA, POMC peptides, and MSH receptors; UVR also stimulates expression of all the components of the CRH/POMC system including expression of the corresponding receptors. Molecular characterization of the cutaneous POMC www.physrev.physiology.org 0031-9333/00 $15.00 Copyright © 2000 the American Physiological Society 979 980 SLOMINSKI, WORTSMAN, LUGER, PAUS, AND SOLOMON Volume 80 gene shows mRNA forms similar to those found in the pituitary, which are expressed together with shorter variants. The receptors for POMC peptides expressed in the skin are functional and include MC1, MC5 and -opiate, although most predominant are those of the MC1 class recognizing MSH and ACTH. Receptors for CRH are also present in the skin. Because expression of, for example, the MC1 receptor is stimulated in a similar dose-dependent manner by UVR, cytokines, MSH peptides or melanin precursors, actions of the ligand peptides represent a stochastic (predictable) nonspecific response to environmental/endogenous stresses. The powerful effects of POMC peptides and probably CRH on the skin pigmentary, immune, and adnexal systems are consistent with stress-neutralizing activity addressed at maintaining skin integrity to restrict disruptions of internal homeostasis. Hence, cutaneous expression of the CRH/POMC system is highly organized, encoding mediators and receptors similar to the hypothalamic-pituitary-adrenal (HPA) axis. This CRH/POMC skin system appears to generate a function analogous to the HPA axis, that in the skin is expressed as a highly localized response which neutralizes noxious stimuli and attendant immune reactions. sors such as bursts of radiation (solar, thermal), mechanical energy, or chemical and biological insults. Because of its functional domains and structural diversity, the skin must have a constitutive mechanism for The vertebrate brain is endowed with the functional control of the endocrine system, which proceeds through highly organized structures. This complex neuroendocrine function involves a myriad of pathways and humoral mediators that are characteristically activated in response to external (environmental) or internal changes sensed as stressful. In chronic sustained stresses, the humorally mediated involvement of the hypothalamic-pituitary-adrenal (HPA) axis is most prominent. Activation of this pathway by the stress-sensoring central circuits or the central action of proinflammatory cytokines proceeds through the hypothalamic production and release of corticotropin releasing hormone (CRH), which stimulates pituitary CRH receptors (5, 27, 110, 118, 232, 313, 421, 430) (Fig. 1). CRH enhances the production and secretion of the anterior pituitary-derived propiomelanocortin (POMC) peptides melanocyte stimulating hormone (MSH), ACTH, and endorphin (17, 110, 208, 267, 268) (Fig. 1). Upon release into the systemic circulation, ACTH reaches the adrenal gland and activates the MC2 receptors (MC2-R), inducing thereby the production and secretion of corticosterone (rodents) or cortisol (humans). These are powerful antiinflammatory factors that counteract the effect of stress and buffer tissue damage. Moreover, the same steroids act to terminate the stress response by interacting directly with central nervous system (CNS) or anterior pituitary receptors to attenuate CRH and POMC peptide production (110, 444). The underlying purpose of this adaptive response is the stabilization and restoration of general homeostasis (27, 42, 110, 208, 232, 267, 268, 415). II. THE SKIN AS A SHOCK ORGAN FOR ENVIRONMENTAL STRESSES The skin, the largest body organ, is strategically located as a barrier between the external and internal environments, being permanently exposed to noxious stres- FIG. 1. Systemic response to stress. The systemic response to stress is activated by environmental/dyshomeostatic signals and biological insults and is sensed by the central nervous system and the immune system, respectively. The main mediator of the response is the hypothalamic-pituitary-adrenal axis (HPA). CRH, corticotropin releasing hormone; POMC, proopiomelanocortin; ACTH, adrenocorticotropic hormone; CA, catecholamines. Downloaded from http://physrev.physiology.org/ by 10.220.33.6 on July 4, 2017 I. PHYSIOLOGY OF THE SYSTEMIC RESPONSE TO STRESS: ROLE OF THE HYPOTHALAMICPITUITARY-ADRENAL AXIS July 2000 CRH-POMC SIGNALING IN A CUTANEOUS STRESS RESPONSE III. CUTANEOUS RESPONSE TO STRESS: LOCAL NEUROENDOCRINE SIGNALS Whereas spatially and temporarily the responses to stress of skin and CNS may be totally dissociated, their similarity in functional relevance raises the possibility of shared mediators. In this regard, it is known that mammalian skin, a well-characterized target for the POMC-derived ACTH and MSH peptides, does contain POMC (220, 376, 438, FIG. 3. Chemical mediators and postulated pathways of the functional arm of the skin CRH/POMC system. URC, urocortin; CRH-Rs, CRH receptors; Rs, catecholamine receptors; MSH, melanocyte stimulating hormone; -END, -endorphin; MC-Rs, melanocortin receptors; END-R, endorphin receptors; 3?, possible stimulatory effect. 445). It has been further shown that the skin has the intrinsic capability to actually produce POMC as well as CRH peptides and to also express the corresponding receptors. Cutaneous modulation of CRH and POMC production could be mediated by proinflammatory cytokines, as is the case at the systemic level. Thus the skin expresses an equivalent of the HPA axis that may acts as a cutaneous defense system, operating as coordinator and executor of local responses to stress (Figs. 2 and 3) (362, 365, 376, 378). Against the background above, we review evidence documenting production and regulation of POMC and CRH peptides, with expression of the corresponding receptors in mammalian skin. Cutaneous mechanism regulating CRH and POMC gene expression are compared with their central homologs, and the function of local CRH and POMC derived peptides is discussed within the context of the skin response to stress. Information is provided on the experimental characterization of receptors for CRH and POMC peptides in skin cells, regulation of their expression, and definition of signal transduction pathways. Potential interactions within the epidermal and follicular keratinocyte compartments occurring between the cutaneous equivalent of the hypothalamic-pituitary axis and the skin immune and pigmentary systems are analyzed against experimental data and clinical information already available. This review ends by setting the stage for future research, basic and clinical, on cutaneous mediators in response to physical, chemical, or biological stressors. IV. CORTICOTROPIN RELEASING HORMONE A. CRH Expression: Intracranial FIG. 2. Cutaneous response to stress. The CRH/POMC system is the integrator and coordinator of the local response to environmental and dyshomeostatic (internal) stimuli. CRH, the most proximal element of the HPA axis, has been already sequenced and its gene cloned (348, 413, Downloaded from http://physrev.physiology.org/ by 10.220.33.6 on July 4, 2017 dealing with those stressors while cellular/tissue damage is still localized and of low magnitude, i.e., before triggering the systemic response. Ideally, such a defense mechanism should possess stress-sensoring capability of very high sensitivity, because of the relatively low intensity of the continuous pleiotropic physicochemical and biological insults affecting the skin. Thus the skin stress response mechanism may be envisioned as efficiently recording fluctuating environmental information; once a critical threshold is reached, this would trigger an organized biological response. Hence, this cutaneous stress response mechanism must be efficient, self-regulated in intensity and field of activity, and endowed with the capability of differentiating environmental noise from biologically relevant signals (365, 376, 378). Those properties imply continuous recognition and integration of appropriate signals, fast response to activation, and high degree of specificity, all to rapidly reestablish tissue homeostasis (Fig. 2). Desirable responses could involve, for example, the stimulation of local biosynthetic pathways for the manufacturing of buffering molecules to counteract the damaging effect of physical, biological, or chemical insults (Fig. 3) (365, 376, 378, 382). 981 982 SLOMINSKI, WORTSMAN, LUGER, PAUS, AND SOLOMON and, through neurons projecting to the pituitary, CRH is involved in osmotic regulation not connected with stress (5, 267). In anterior pituitary corticotrophs, CRH regulates POMC gene activity and production/release of ACTH, -endorphin, and MSH peptides (5, 166, 267, 268). In addition to the hypothalamus, CRH is produced in other areas of the brain (5, 166). CRH production has even been shown in the anterior pituitary, where it may act as a paracrine stimulator of POMC production, as a growth factor for corticotrophs, and as a modulator of expression of the CRH-R1 gene (132, 239, 309, 413, 433). CRH is also involved in functional modulation of the immune system (27, 180, 268a, 331, 392, 394, 418, 430), the reproductive system (100, 267, 297, 301), and the cardiovascular system (19, 112, 267, 316, 320), and it acts as a major catabolic peptide in the hypothalamus, inhibiting food intake, increasing energy expenditure, and producing sustained weight loss (165). B. CRH Expression: Peripheral The CRH gene is widely expressed in extracranial tissues but at levels much lower than in hypothalamus. Expression of the gene has been detected in endometrium, placenta, uterus, ovary, testes, spleen, immune system, pancreas, liver, stomach, small and large bowel, adrenal gland, thyroid gland, and skin (13, 27, 46, 87, 94, 100, 180, 184, 195, 253, 267, 268, 268a, 298 –303, 305, 318, 321, 335, 344, 355, 359 –361, 394, 398, 418, 430, 432, 456). Peripheral processing of pro-CRH into CRH appears to be similar at the peripheral and central levels, as shown in placenta, endometrium, uterus, and immune system (49, 297, 301, 398, 456). In addition to its regulation by similar factors as in the brain (100, 166, 267, 268, 297, 299, 301, 305, 332, 416, 430, 456), CRH production in peripheral tissue is also enhanced by prostaglandins, epidermal growth factor, and platelet growth factor and decreased by nitric oxide (NO) and progesterone (297, 299, 301, 305, 319, 456). Accumulating evidence indicates that CRH produced in uterus and placenta may play an important role in the normal progression of pregnancy (235, 297, 301, 456). CRH is a potent immunomodulator; depending on cellular target, CRH can inhibit or stimulate local immune function (9, 142, 195, 268a, 305, 334, 418, 421, 430). CRH can modify vascular functions (19, 116, 267, 316, 320) and also act as a local growth factor (239, 245, 357, 379, 417, 433). Expression of the CRH-related urocortin gene with production of urocortin peptide has also been documented in peripheral tissues such as placenta, uterus, immune system, stomach, small and large bowel, pancreas, adrenal gland, testis, heart, and skin (18, 262, 263, 298, 380). Downloaded from http://physrev.physiology.org/ by 10.220.33.6 on July 4, 2017 427). Most recently, a family of CRH-related peptides has been identified in mammals, which shares high homology with CRH, and includes urocortin, amphibian sauvagine, and fish urotensin I (97, 436). The corresponding genes have also been cloned (344, 348, 413, 454). The CRH gene is composed of two exons separated by an intron (344, 348, 413). The first exon encodes most of the 5⬘-untranslated region in the mRNA, while the second exon contains the prohormone sequence and the 3⬘-untranslated region. CRH transcripts in the rodent and human brain are ⬃1.4 and 1.5 kb long, respectively (348, 413). The 3⬘-flanking region contains four polyadenylation addition signals (AATAAA). The 5⬘-flanking region contains DNA sequences responsible for tissue specific expression, second messenger binding, and glucocorticoid regulation sites (166, 267, 268). Translation of exon 2 generates the 196-amino acid (aa)-long prepro-CRH, in which the first 26 aa represent the signal peptide, cleaved in the rough endoplasmic reticulum to generate pro-CRH(27O196) (49, 166, 294, 295). Unmodified pro-CRH(27O196) has 18 kDa molecular mass, that increases to 23 kDa after posttranslational modifications (294, 295). Endoproteolytic processing of pro-CRH within the transGolgi-network and secretory granules generates the final 41-aa-long (4.7 kDa) CRH peptide (166, 267, 268, 294, 295). Additional intermediates may include the 16-kDa NH2terminal pro-CRH, pro-CRH-(125O149; 8 kDa), and proCRH-(125O151; 3 kDa). The enzymes involved in this process are the convertases PC1 and PC2 (49). Expression of the CRH gene is controlled by cAMPdependent protein kinase A (PKA), calcium/calmodulindependent protein kinase and diacylglycerol-dependent protein kinase C (PKC) pathways (4, 98, 166, 267, 268, 430). In addition, transcription factors associated with cytokine signaling can also activate the CRH promoter (395). A list of stimulators of CRH production at the central level includes the neurotransmitters serotonin, acetylcholine, histamine, norepineprine, and epinephrine (166, 192, 199, 261, 267, 268); the neuropeptides arginine vasopressin (AVP), ANG II, neuropeptide Y, cholecystokinin, activin, and enkephalin; the cytokines interleukin (IL)-1, IL-6, and tumor necrosis factor (TNF)-␣, which can also stimulate CRH production (27, 50, 166, 267, 268, 305, 395, 418, 420, 421); and leptin (165). Among the negative regulators of CRH production, the most important are glucocorticoids; estrogens and GABA also share this activity (166, 267, 268, 305, 395, 418). In addition, secretion of CRH is inhibited by dynorphin, substance P, somatostatin, and galanin (166). CRH is produced predominantly in the paraventricular nucleus (PVN) of the hypothalamus and delivered into portal capillaries converging in the anterior lobe of the pituitary (5, 166, 267, 268, 418). In addition, autonomic neurons of the PVN projecting to the brain stem and spinal cord supply CRH to the sympathoadrenal system Volume 80 July 2000 CRH-POMC SIGNALING IN A CUTANEOUS STRESS RESPONSE C. CRH Expression: Skin 1. Rodent (321). Corresponding serum concentrations of CRH-IR were 8.6 fmol/ml during anagen III and 5.6 fmol/ml in telogen (321). Surprisingly, however, the corresponding CRH mRNA was consistently below the limit of RT-PCR detectability in any of the different phases of hair cycle (telogen, anagen, and catagen) (360). Because CRH-IR is found in the nerve bundles and perifollicular neural network B throughout the entire hair cycle, and CRH concentrations are higher in tissue than serum (321), we have proposed that in the mice CRH is imported into the skin, entering through descending (afferent) nerves. Such transport would provide a mechanism to precisely regulate domains of local CRH-dependent POMC production (321, 357, 360). The lack of expression of the CRH gene in skin was further confirmed by the results of RT-PCR assays repeated with larger number of cycles and followed by Southern blot hybridization to CRH cDNA; again, these tests failed to show CRH mRNA in mouse skin, despite its presence in brain control (104). Thus the abundance of CRH-IR in the skin and its nerve bundles in the absence of cutaneous CRH gene expression imply that at least in the FIG. 4. Expression of CRH and CRH-R1 antigens throughout hair growth cycle in mice. CRF, CRH; APM, arector pili muscle; DP, dermal papila; E, epidermis; FBN, follicular neural network B; HS, hair shaft; IRS and ORS, inner and outer root sheaths, respectively; Mel, melanocytes; SG, sebaceous gland. [From Roloff et al. (321), with permission from the FASEB Journal.] Downloaded from http://physrev.physiology.org/ by 10.220.33.6 on July 4, 2017 CRH was first detected in the skin by immunocytochemistry as CRH immunoreactivity (CRH-IR) in the C57BL6 mouse, in the pilosebaceous unit of the hair follicle and epidermis (360). CRH-IR was further localized to keratinocytes of the basal epidermis, the outer root sheath (ORS), and the matrix region of developing hair follicles (321). In hair follicles, the highest intensity of stain was seen during the anagen IV/VI stages and the lowest levels in catagen and telogen skin (321). CRH-IR was also found in the nerve bundles and perifollicular neural network B throughout the entire hair cycle (321). A schematic drawing of hair cycle coupled CRH and CRH-R expression in murine skin is presented in Figure 4. Actual identification of CRH was accomplished with two separate techniques based on reverse-phase HPLC combined with CRH RIA (321, 357). Tissue levels of CRH measured by RIA showed hair cycle-dependent fluctuation being highest in anagen II/IV skin (67 fmol/g wet wt) and lowest in catagen and telogen skin (36 fmol/g wet wt) 983 984 SLOMINSKI, WORTSMAN, LUGER, PAUS, AND SOLOMON mice, CRH may reach the skin through descending nerves that target well-defined compartments (360). An alternative explanation, that skin cells could express a hitherto undetected CRH variant or a related CRH gene, is undergoing current testing. In this regard, immunoreactivity corresponding to the related peptide urocortin was detected at varying levels in mouse skin; the highest concentrations were observed in telogen and the lowest in late anagen VI skin (380). 2. Human V. CORTICOTROPIN RELEASING HORMONE RECEPTORS A. CRH Receptors: Structure and Function So far, two distinct genes encoding the CRH receptor (CRH-R) family (CRH-R1 and CRH-R2) have been cloned (73, 77, 78, 190, 194, 207, 217, 242, 296, 391, 426, 437). Both receptor groups share high sequence homology, ⬃70%, and belong to the family of seven transmembrane segments proteins coupled to the Gs signaling system. CRH-R1 and CRH-R2 differ in pharmacological ligand profile and predominant tissue distribution; e.g., CRH-R1 has predominantly been found in the pituitary and different regions of the brain (5, 74, 78, 289, 310, 437), whereas CHR-R2 has been isolated from brain, heart, and skeletal muscle (73, 190, 194, 207, 217, 296, 310). Alternatively spliced forms have also been identified, e.g., CRH-R1 (variant ) that contains 29 additional aa in the first intracellular loop and a variant c having a deletion of 120 bp coding for 40 aa from the extracellular NH2-terminal domain (78, 388). Three CRH-R2 spliced variants ␣, , and ␥ that differ in their NH2-terminal domains and anatomical distribution have been identified (190, 194, 207, 217, 242, 296, 391, 426). In humans CRH-R2␣ and CRH-R2 are expressed in peripheral tissues and in brain, whereas in rodents, CRH-R2␣ is found predominantly in brain and CRH-R2 in the periphery (5, 74, 388). So far, CRH-R2␥ variant has been only detected in brain (194). Human and rat CRH-R1 genes contain 14 and 13 exons, respectively (330, 419), whereas the human CRH-R2␣ gene contains 12 exons (207). In addition to CRH receptors, CRH binding proteins of 322 aa have been characterized; these are partially associated with plasma membranes or circulate in the blood (74, 185, 218, 293, 307). CRH binding proteins have high affinity for CRH and are postulated to inactivate extracellular CRH, thus preventing its interaction with receptors. This would be the mechanism for neutralization of the large amounts of circulating CRH present during pregnancy (74, 185, 218, 235, 293, 300, 307). The CRH signal is transduced into cAMP and calciumactivated metabolic pathways via interaction with the CRHR (5, 74, 100, 267, 268, 388). Activation of adenylate cyclase induces production of cAMP, and subsequently of PKAdependent pathways. CRH-R activation of phospholipase C induces production of inositol trisphosphate (IP3), which leads to activation of PKC-dependent pathways. There are data suggesting that CRH signal transduction is directly coupled to calcium channels (109, 198, 388). The CRH signal is transduced more efficiently into stimulation of cAMP production through CRH-R1 than CRH-R2 (74, 442). For example, CRH and urocortin are more potent than sauvagine and urotensin I in activation of adenylate cyclase activity through CRH-R1, although urocortin, sauvagine, and urotensin I are more potent than CRH in the stimulation of cAMP production through CRH-R2 (74, 442). The affinity of CRH for CRH-R1 is similar to that of urocortin and sauvagine, whereas CRH-R2 affinity for CRH is significantly lower than for urocortin, sauvagine, and urotensin I (5, 74, 388). CRH-R have so far been identified in adrenal glands, testes, ovaries, prostate, kidney, liver, gut, spleen, circulating immune cells, synovium, heart, skeletal muscle, Downloaded from http://physrev.physiology.org/ by 10.220.33.6 on July 4, 2017 The CRH gene, although not expressed in mice skin, is nevertheless clearly demonstrable in human skin by RT-PCR amplification of the predicted 413-bp transcript representative of the CRH exon 2 (355, 359, 361). In the latter experiments, the sources of human skin RNA tested were biopsy specimens of scalp, compound melanocytic nevus and basal cell carcinoma, and cultured cell lines of normal and malignant melanocytes and squamous cell carcinoma (355, 359, 361). Melanoma and squamous cell carcinoma cells showed a CRH mRNA transcript 1.5 kb long by Northern blot hybridization (361). CRH peptides were also detected in facial skin, cultured human melanocytes, HaCaT keratinocytes, squamous cell carcinoma, and melanoma cells after RP-HPLC separation followed by monitoring of the eluted fractions with specific antiCRH RIA (355, 361). Most recently, expression of CRH gene was found in a large panel of cultured melanocytes, nevocytes, and melanoma cells, with the highest intensity in malignant melanocytes (121). Indirect immunofluorescence studies localized the CRH antigen to keratinocytes of the epidermis and hair follicle, dermal blood vessels, skeletal muscle, and nerve bundles of human scalp (357). Expression of the related urocortin gene and production of the corresponding urocortin peptide was also shown in human skin (380). In normal melanocytes, production of CRH peptide could be stimulated with ultraviolet radiation B (UV-B; wavelength 290 –320 nm) (355); and in melanoma and squamous cell carcinoma cells, CRH production responded to forskolin, an agent that raises intracellular cAMP levels (361). Conversely, dexamethasone inhibited CRH peptide production in the same cell systems (361). However, despite noticeable changes in CRH peptide production, the level of the corresponding CRH mRNA remained unchanged under each one of the tested conditions, suggesting posttranscriptional regulation. Volume 80 July 2000 CRH-POMC SIGNALING IN A CUTANEOUS STRESS RESPONSE BP) that may inactivate or inhibit local CRH signaling in placenta, amnion, chorion, and maternal decidua (293, 297–301). Near term there is a rapid surge in circulating CRH in human pregnancy that coincides with a decrease of plasma CRH-BP levels (72, 235, 293). B. CRH Receptors: Skin 1. Rodent Searching for mRNA coding for CRH receptors using RT-PCR amplification of RNA isolated from C57BL6 mouse skin has clearly shown the predicted 407-kb product representative of the CRH-R1 mRNA (360). The transcript was present throughout the entire hair cycle, even during the telogen phase (360). In the hairless mice CRH-R1 mRNA was also detected; RT-PCR assay with Southern blot hybridization to murine CRH-R1 cDNA showed its presence in the epidermis (357). Studies with full thickness skin in the C57BL6 mice showed a 2.7-kblong CRH-R1 mRNA transcript by Northern hybridization; it was readily detectable in anagen skin and below detectability in telogen skin (360). In the same model, CRH-R1 protein was localized by indirect immunofluorescence to keratinocytes of the ORS, hair matrix, dermal papilla of anagen VI hair follicles, keratinocytes of inner root sheath (IRS), and ORS of early catagen; in contrast, skin immunoreactive CRH-R1 was very low in telogen skin (Fig. 4) (321). These results suggest that both transcription and translation of the CRH-R1 gene are hair cycle dependent. Most recently, RT-PCR assays using primers described in Reference 318 identified a 615-bp fragment common to the ␣- and -variants of the mouse CRH-R2 cDNA (318; Fig. 5). Sequencing of the cloned segment showed an almost perfect match with the published mouse CRH-R2 genebank sequence; the single difference was a change of G to A found at position 675 in the known sequence (base 7 in the experimental sequence). This base permutation did not affect the amino acid sequence in the encoded peptide fragment that was exactly the same as the known sequence. CRH did exhibit specific binding to skin, as detected by autoradiography with a 125I-[Tyr]-ovine CRH (oCRH) tracer (321). CRH binding was localized to keratinocytes of hair follicles and the epidermis and dermal panniculus carnosus (mostly to dermal muscles; Ref. 321). Displacement curve analysis revealed a single high-affinity binding site with a dissociation constant (Kd) of 3.62 nM and maximum binding (Bmax) of 2.42 amol/mm2 of scanned skin section. Control determinations in rat pituitary revealed a single high-affinity binding site with a similar Kd of 1.53 nM, but with larger number of binding sites, e.g., Bmax was 18.1 amol/mm2 (321). During the hair cycle, 125I-[Tyr]-oCRH specific binding to isolated cell membranes was at the same level in telogen, anagen III, Downloaded from http://physrev.physiology.org/ by 10.220.33.6 on July 4, 2017 uterine myometrium, vascular endothelium, arterial smooth muscle, endometrium, placenta, and skin (5, 13, 19, 74, 86, 100, 139, 150, 151, 163, 181, 190, 200, 267, 268, 296, 297, 301, 302, 305, 318, 320, 321, 334, 338, 357, 388, 391, 409, 410, 456). Molecular and pharmacological characterization of CRH receptors have shown that CRH-R2 is predominantly expressed in peripheral tissues, e.g., heart, skeletal muscle, smooth muscle of arterial wall, vascular endothelium, uterus, placenta, and immune cells (74, 139, 151, 163, 190, 200, 297, 301, 318, 334, 388, 391). Notwithstanding, CRH-R1 has been also detected in intrauterine tissue, placenta, and immune cells (94, 139, 181, 297, 301, 318, 396, 409). The signal transduction pathway activated through peripheral CRH receptors is coupled to the stimulation of cAMP production and subsequent activation of PKA (74). However, involvement of calcium-activated pathways by phospholipase C or membrane-bound calcium channels has also been reported (19, 109, 186 –188, 198, 242, 357, 388). In addition, the NO/cGMP-dependent pathway appears to mediate CRH-R activated vasodilation in human fetal-placental circulation (86), and a sustained vasodilator effect of CRH and sauvagine on rat mesenteric artery through stimulation of NO production has been reported (19). CRH-R located in heart and vasculature mediate the inotropic, vasodilatory, and antiedema effects of CRH or CRH-related peptides (19, 74, 112, 268, 316, 320, 440, 441), whereas receptors present on immune cells mediate complex immune/inflammatory responses (27, 305, 418, 430). Although central CRH (neuroendocrine) effects are immunoinhibitory (27, 268, 305, 418), in peripheral tissues CRH effect on immune balance is complex (27, 142, 180, 268a, 305, 331, 333–335, 418, 430, 440, 441). In fact, CRH may have an opposite immunoactivating effect in periphery, by stimulating proinflammatory reactions (180, 305, 418, 430), although an anti-inflammatory effect for exogenously applied CRH has also been described (142). Paez Pereda et al. (268a) showed that CRH can either stimulate or inhibit IL-1 production depending on monocyte activation status; therefore, it is likely that activation-dependent signal transduction through CRH receptors may explain sometimes contradictory phenotypic effects in immune cells. Locally produced CRH may regulate steroid production in gonads and adrenal glands via a paracrine mechanism of action (56, 102, 103, 150, 387). In placenta and uterus, CRH receptors that include CRH-R1 and CRH-R2 are involved in maintenance of pregnancy as well as initiation and maintenance of labor (235, 297, 301, 456). In this setting, CRH receptors are activated through paracrine or autocrine mechanisms by locally produced CRH or urocortin (297, 301). This action requires precise timeand tissue-restricted differential expression of CRH receptors in intrauterine tissues (86, 87, 94, 297–303, 318, 319, 396, 456). Regulation of CRH activity may be also achieved by the production of CRH binding protein (CRH- 985 986 SLOMINSKI, WORTSMAN, LUGER, PAUS, AND SOLOMON and anagen VI skin (321, 357). It is possible that autoradiography may have detected both CRH-R1 and CRH-R2 because of the low specificity of the technique. Because the distribution of CRH-R1 is hair cycle dependent, CRH-R1 may predominate in epidermal and follicular keratinocytes, whereas CRH-R2 gene expression would predominate in extrafollicular compartments such as panniculus carnosus. A) CRH EFFECT ON HAIR GROWTH AND EPIDERMIS. CRH participation in the regulation of hair growth was evaluated in a well-characterized skin organ culture system (272, 273), in which DNA synthesis in epidermal and dermal compartments reflects predominantly proliferation of keratinocytes, either epidermal or follicular (357). In this model, addition of CRH to telogen and anagen IV skin was found to stimulate DNA synthesis in epidermal keratinocytes, without measurable effect on the dermal compartment (357). However, in anagen II, CRH had the opposite activity on epidermal DNA synthesis, exerting an inhibitory effect, whereas dermal DNA synthesis was enhanced (357). These experiments suggest strong hair cycle restriction in the expression of CRH actions on epidermal and follicular keratinocyte proliferation. Thus experiments with exogenous CRH show variable effects depending on the cellular population targeted and on the hair cycle-dependent expression of CRH-related recep- tors. Contributing factors in determining the effect of exogenous CRH could include the endogenous production of CRH and CRH-related molecules and the CRHactivated production of ACTH and MSH. Preliminary in vivo experiments in mice showed that CRH released slowly from subcutaneous implants placed in the direct vicinity of telogen hair follicles effectively resulted in follicular arrest with extended telogen (resting) stage (R. Paus, K. Fechner, and L. Mecklenburg, unpublished data). It is not yet clear whether hair follicle cycle arrest is a direct action of CRH or whether it simply reflects a systemic effect of serum corticosterone. High serum levels of CRH could substantially raise corticosterone levels through stimulation of the HPA axis (444). High systemic levels of glucocorticosteroid would clearly suffice as the explanation for the profound anagen-inhibitory effect of CRH implants (cf. Refs. 272–274). B) CRH EFFECTS ON THE VASCULAR AND IMMUNE SYSTEMS. Intradermally injected CRH induces local mast cell degranulation in rats and mice (409). This effect is dose dependent, mediated by the amidated form of CRH, and inhibited by the nonpeptide CRH-R1 antagonist antalarmin. Because CRH-R1 mRNA has been detected in mast cells, those effects may be mediated through CRH-R1 (409). CRH-induced degranulation of mast cells is accompanied by increased vascular permeability (reduced by treatment with H1-receptor antagonists), leading to the suggestion that this cutaneous effect of CRH may be primarily addressed at enhancing local vascular permeability (409). However, others have found that direct topical application of CRH to cutaneous or mucosal tissue had instead vasoconstrictive and anti-inflammatory effects (134, 237, 440). Particularly interesting are the studies of CRH on animal models of tissue injury (134, 237, 333–335, 440, 441). Thus when CRH is injected subcutaneously or intravenously to rats with thermal injury, fluid accumulation is decreased by ⬎50% in injured skin of treated animals, independent of the functional activity of the HPA axis. This action has been explained by CRHinduced decrease in negative interstitial fluid pressure on traumatized tissues, thereby reducing edema. Moreover, local injection of CRH reduced doxorubicin-induced inflammation in the eyelid of rabbits and decreased the severity of skin injury (237). In the latter study, CRH did not alter vascular permeability but reduced the expected acute influx of monocytes and macrophages and protected the skin overlying the injection site, substantially reducing the extent of injury. Other studies have shown that in the rat urocortin has significantly higher potency than CRH, inhibiting heat-induced cutaneous edema (422). Because ␣-helical CRH-(9O49) reversed the inhibition of edema produced by either urocortin or CRH, at doses that did not affect ACTH secretion, it has been suggested that those effects are mediated through CRH-R2 (422). Additional CRH effects on inflammation Downloaded from http://physrev.physiology.org/ by 10.220.33.6 on July 4, 2017 FIG. 5. Expression of the CRH receptor type 2 (CRH-R2) gene in the skin of C57BL6 mouse. Primers sequence and RT-PCR conditions for amplification of the 615-bp fragment common to the ␣- and -variants of the mouse CRH-R2 cDNA were performed as described in Reference 318. This fragment was sequenced commercially using the BigDye chemistry kit and a 377XL DNA sequencer from Perkin Elmer/Applied Biosystems (Commonwealth Biotechnologies, Richmond, VA). Two internal primers, inverses of each other and with sequences GTCAATCCTGGCGAGGACGA and TCGTCCTCGCCAGGATTGAC, were used for sequence determination. The cloned segment differed from the published mouse CRH-R2 genebank sequence only in a single base (G to A change at position 675 in the known sequence; base 7 in the experimental sequence). Lane A, DNA ladder; lane B, anagen III; lane C, anagen IV; lane D, anagen VI. Volume 80 July 2000 CRH-POMC SIGNALING IN A CUTANEOUS STRESS RESPONSE 2. Human In human skin biopsy specimens, CRH-R1 mRNA was identified by RT-PCR followed by Southern blot hybridization and found in normal scalp, compound nevus, basal cell carcinoma, and perilesional facial skin (357, 359, 361). The CRH-R1 gene was also expressed in normal and malignant melanocytes (121, 357, 359, 361) and keratino- cytes (359, 361); the expression was upregulated by UVB irradiation or 12-O-tetradecanoylphorbol 13-acetate (TPA) treatment (359). CRH-R1 gene expression was high in melanoma and squamous cell carcinoma cells (121, 361). A) BIOCHEMICAL CHARACTERIZATION OF CRH RECEPTORS. Human melanoma cells and HaCaT keratinocytes exhibit specific binding sites for CRH; application of CRH or of the related sauvagine or urocortin peptides induces rapid and significant increases in intracellular calcium (109, 357). The effect appears to be specific for these peptides, since the neuropeptides -endorphin, ␣-MSH, and ACTH, which also interact with G protein-linked receptors, had either no or minimal effects (357). The calcium stimulatory activity in human melanoma cells is higher for CRH than urocortin or sauvagine peptides, being detected already at concentrations as low as 10⫺12 and 10⫺10 M in a dose-dependent manner (109). Similar to hamster melanoma, the CRH induced intracellular calcium accumulation in these human cell lines was inhibited by the CRH antagonist ␣-helical CRH-(9O41) and by extracellular calcium depletion with EGTA (109). Because human melanoma cells express CRH-R1 mRNA, it was postulated that the above effects are mediated through CRH-R1 (109). Studies on the A 431 human squamous cell carcinoma cells showed that the structurally related peptides CRH, sauvagine, urotensin I, and mystixin-7 and mistyxin-11 stimulated cytosolic calcium accumulation and IP3 production (186 –188). These pharmacological studies suggest therefore that the increases in cytosolic calcium are due to both calcium influx from the extracellular compartment, through calcium channels coupled to CRH receptors and pertussin toxin-sensitive G proteins, and to mobilization of intracellular calcium through intracellular calcium-independent increase in IP3 (186 –188). CRH and CRH-related peptides can also stimulate cAMP production and tyrosine phosphorylation in A 431 carcinoma cells, albeit with a different pattern for each group of peptides tested (186 –188), suggestive of differential CRH receptor subtype activation (187). Most recently, we have provided evidence for the existence of CRH receptors in human keratinocytes and defined cAMP-mediated CRHstimulated pathway in these cells, with demonstrable inhibitory activity on cell proliferation (379). CRH receptors were also identified in human dermal fibroblasts, where two binding sites with different affinities were found (115). The high-affinity binding site had Kd of 20 ⫾ 0.22 pM and Bmax of 1.95 ⫾ 0.22 fmol/mg protein, and the low-affinity class of receptor had Kd of 160 ⫾ 17 nM and Bmax of 2.38 ⫾ 0.27 fmol/mg protein (115). CRH receptor expression was accompanied by the phenotypic effect of CRH blockage of the IL-1␣ stimulated prostacyclin (PGI2) and PGE2 production (114, 115). Because CRH inhibits IL-1␣-stimulated PGI2 and PGE2 synthesis in bovine aortic endothelial cells through probable Downloaded from http://physrev.physiology.org/ by 10.220.33.6 on July 4, 2017 include antinociceptive actions and acceleration of wound healing (333–335, 440, 441). There is indirect evidence for CRH activity on the local regulation of blood flow through effects on the cutaneous vasculature. These would be mediated by interaction with CRH receptors present on smooth muscle of the arterial wall. For example, vasorelaxing effects have been shown in rat mesenteric arteries that imply mediation via CRH-R2 on vascular smooth muscle (320). Other studies have demonstrated the presence of CRH binding sites of high and low affinity on endothelial cells: Kd of 2 ⫾ 0.2 ⫻ 10⫺10 and 1.77 ⫾ 0.14 ⫻ 10⫺6 M and Bmax of 0.79 ⫾ 0.095 and 0.97 ⫾ 0.12 fmol/mg protein, respectively, for high- and low-affinity binding sites (116). The expression of those receptors was accompanied by an inhibitory effect of CRH on IL-1␣-induced prostacyclin and prostaglandin synthesis through inhibition of phospholipase A2 and cyclooxygenase (114 –116). Most recently, a dual vasodilatory effect of CRH and sauvagine on mesenteric artery was described: a short direct effect on smooth muscle, followed by sustained endothelium dependent vasodilation (19). The last effect was associated with stimulation of NO production. Therefore, by analogy with the mesenteric bed (19, 114, 116, 320) and vasculature in the placenta and brain (86, 316, 338), it is possible that CRH would also act through a similar pathway on cutaneous vascular cells, endothelial or smooth muscle, with possible effects on local inflammation, hemostasis, and/or coagulation. C) CRH EFFECTS ON MALIGNANT MELANOCYTES. The hamster melanoma cell line provided further insight into the mechanism of CRH action in the skin (109, 357). This cell system expresses the CRH-R1 gene and CRH binding sites. The melanoma CRH-R1 mRNA transcript is ⬃2.5 kb long, being 0.2 kb shorter than that detected in normal skin (357). CRH had demonstrable biological effects that consisted of a rapid and dose-dependent increase in intracellular calcium concentration. This effect was reduced by preincubation with the CRH antagonist ␣-helical CRH-(9O41) and actually inhibited by depletion of extracellular calcium with 3 mM EGTA. Therefore, CRH signal transduction appears to be coupled, at least partly, to activation of calcium channels (109). The CRH-related peptides sauvagine and urocortin also induced increases in intracellular calcium concentration but at concentrations ⬃1,000-fold higher. 987 988 SLOMINSKI, WORTSMAN, LUGER, PAUS, AND SOLOMON VI. PROOPIOMELANOCORTIN B. POMC Expression: Intracranial The pituitary gland has been recognized as an important source of melanotropic factors (6, 14), defined as ␣and -MSH and -endorphin (cf. Refs. 110, 141, 143, 201, 444). The structures of the POMC gene and of the POMC protein have been well established (cf. Refs. 75, 110, 141, 143, 444). The POMC gene is expressed predominantly in the anterior pituitary where it comprises ⬃30% of all mRNA (282). POMC mRNA concentration is one to two orders of magnitude higher in pituitary than in brain (17). In general, mammals trascribe only one POMC gene per haploid genome (99), although the mouse genome contains two nonallelic POMC ␣- and -genes (425). The mouse POMC ␣-gene is transcribed in pituitary and brain; it is located on chromosome 12 and shares high homology with human, bovine, and rat POMC genes (424). The POMC -gene has ⬍90% aa sequence homology (predicted from cDNA sequence) with ␣-POMC (425). The POMC -gene is not expressed in pituitary, has the characteristics of a pseudogene, and is located on chromosome 19 (425). Lower vertebrates including lamprey, fish, and frogs also express two forms of POMC gene that have different degree of homology depending on the species (12, 402). The human POMC gene is located on chromosome 2 (25). The mammalian POMC gene contains three exons and two introns; exon 1 corresponds to the 5⬘-untranslated mRNA; exon 2 contains a part of the 5⬘-untranslated mRNA, sequences of the signal peptide, and start se- quences of the NH2-terminal fragment (NT); and exon 3 codes for the COOH terminus of NT, joining peptide (JP), ACTH, -lipotropin (LPH), and for 3⬘-untranslated mRNA (17, 25, 59, 75, 99, 143, 170, 222). In the pituitary and brain, the primary transcripts are spliced out to generate a POMC mRNA of ⬃1.1 kb (17, 25, 99, 170, 222). Shorter and longer POMC transcripts also exist but are found only in extrapituitary tissues that include skin (17, 76, 84, 91, 99, 167, 353, 371). The POMC mRNA size heterogeneity has been explained by alternative splicing, variation in the length of the poly(A)⫹ tail, or use of alternate transcription initiation sites (17, 76, 84, 91, 99). POMC mRNA is translated into a single 30-kDa protein product, the precursor of ACTH, endorphins, melanotropins (MSH), and lipotropins (LPH) (25, 59, 170, 383). These neuropeptides are differentially generated through successive cell-specific processing steps and postranslational modifications that include endo- and exopeptidase cleavage, amidation, and acetylation (7, 8, 17, 20, 25, 59, 170, 383). As indicated in Figure 6, posttranslational processing of POMC yields a large number of biologically active peptides. POMC is processed in the corticotrophs of the anterior pituitary to form ACTH, -LPH, and NT, with smaller amount of ␥-LPH and -endorphin (59). Further processing occurs in the intermediate lobe: NT to ␥-MSH, ACTH to ␣-MSH and corticotrophin-like intermediate lobe peptide (CLIP), and -LPH to -MSH, -endorphin, -endorphin-(1O26) and -endorphin-(1O27). All of the peptides formed in this manner undergo amidation, mono- and diacetylation, phosphorylation, glycosylation, and methylation before processing of POMC is completed (7, 8, 17, 20, 25, 59, 170, 383). In the pituitary, the biosynthetic processing of the POMC precursor starts with specific cleavage by the convertases PC1 and PC2 at the post-pairs of basic residues (Lys-Arg) and (Arg-Arg) (59, 90, 345, 455). The convertase PC1 cleaves POMC to produce a 16-kDa NT, the JP, and the COOH-terminal peptides ACTH and -LPH with some -endorphin (25, 59). PC1 is expressed solely in corticotrophs determining their commitment to the production and secretion of ACTH. In melanotrophs, the coexpression of convertases PC1 and PC2, as well as the expression of carboxypeptidase E, and the amidating and N-acetylating enzymes determine that this cell type produces essentially ␣-MSH and -endorphin (25, 59, 90, 106, 170, 270, 345, 383). PC2 convertase cleaves the first 14 aa of the ACTH sequence to generate ACTH-(1O14)OH peptide and -LPH to -MSH and -endorphin (25, 59). The ACTH-(1O14)OH after COOH-terminal amidation generates desacetyl-␣-MSH, a step required for biologic activity (25, 59, 383). Interestingly, whereas subsequent ␣-N-acetylation at the NH2 terminus, that results in ␣-MSH, enhances the melanocyte stimulating bioactivity of the tridecapeptide (25, 59, 383), and acetylation of -end inhibits its opioid activity (25, 59). The O-acetylation of ␣-MSH forms N,O-diacetyl-␣-MSH. It Downloaded from http://physrev.physiology.org/ by 10.220.33.6 on July 4, 2017 inhibition of phospholipase A2 and cyclooxygenase (116), it is highly possible that a similar regulatory mechanisms may be operative in dermal endothelial cells of human skin. B) CRH EFFECTS ON CELL PROLIFERATION. CRH has heterogeneous effects on cell proliferation. Thus, in HaCaT keratinocytes, cell growth is inhibited after addition of 10⫺11–10⫺8 M CRH to the culture medium (379). In contrast, in melanoma cultures, the effect is biphasic in that short-term incubation (6 h) with CRH (10⫺10–10⫺8 M) inhibits DNA synthesis in either serum-containing or serum-free media, whereas long-term incubation (3– 4 days) at high CRH concentration (10⫺7–10⫺6 M) stimulates the growth of melanoma cells (357, A. Slominski and B. Zbytek, unpublished data). Both stimulation and inhibition of cell proliferation by CRH have been described in AT-t20 pituitary cells (239, 433), whereas cell growth is inhibited in CRH-treated mammary cancer cells (417). CRH at concentrations of 10⫺10–10⫺6 M had no effect on melanin synthesis in cultured melanoma cells (Slominski and Zbytek, unpublished data). Volume 80 July 2000 CRH-POMC SIGNALING IN A CUTANEOUS STRESS RESPONSE 989 has been suggested that PC1 or PC2 may be also involved in the generation of ␥-MSH peptides; however, the mechanism of the reaction and the potential involvement of other enzymes remain to be clarified (90, 345). Production and secretion of POMC peptides is organ specific, and in the pituitary it is lobe specific and under multihormonal control with main stimulatory input by CRH and AVP, and inhibitory regulation by adrenal glucocorticoids (17, 25, 50, 59, 99, 110, 141, 170, 192, 222, 383, 439). Epinephrine also has ACTH stimulatory activity, and the cAMP-PKA system appears to be the main intracellular signaling pathway for this pituitary action (10) that stimulates ACTH secretion, similar to the effect of pituitary adenylate cyclase-activating peptide (PACAP) and vasoactive intestinal polypeptide (VIP) (11). PACAP and VIP enhance separately the CRH stimulation of the POMC gene, but without additive effect. Other factors that stimulate production of POMC peptides by the anterior pituitary are PACAP, VIP, serotonin, oxytocin, ANG II, bradykinin, and leptin, whereas GABA decreases it (11, 17, 25, 59, 81, 124, 165, 170, 222, 243, 327, 383, 414). In the intermediate pituitary, neither glucocorticoids nor CRH has any effect on POMC gene expression, although CRH can selectively induce release of ␣-MSH (17, 25, 59, 170, 222, 383). ␣-MSH release from the intermediate pituitary is stimulated by -adrenergic agonists, whereas negative regulators of this process are dopaminergic and ␣-adrenergic agonists, PGE2, and branched amino acids (17, 25, 59, 170, 222, 329, 383). The proinflammatory cytokines IL-1, IL-2, IL-6, TNF-␣, and INF-␥ stimulate pituitary POMC gene expression and production of POMC peptides (17, 25, 27, 32, 33, 118, 170, 305, 313, 383, 421). However, the mechanism of this regulation is complex. For example, IL-1 stimulates POMC promoter activity in AtT-20 cells in a bimodal manner (weak short-term effects followed by strong longterm effects) (182). A similar effect was found for TNF-␣; IL-6 had a robust stimulatory long-term effect, whereas INF-␥ had acute stimulatory effects followed by a marked inhibitory effect. The effect of the cytokines on POMC gene expression is mediated by the tyrosine phosphorylation cascade (182). IL-1, IL-6, and TNF-␥ can also significantly potentiate the stimulatory effect of CRH on POMC expression (17, 25, 33, 118, 170, 305, 313, 383, 421). Leukemia inhibitory factor (LIF) can stimulate POMC gene expression and secretion by corticotrophs (80), acting synergistically with CRH to potentiate POMC transcription and production of ACTH (15). Most recently, it has been proposed that LIF and IL-1 activate the suppressors of cytokine signaling (SOCS) pathway, which would inhibit POMC gene expression and ACTH secretion, thus Downloaded from http://physrev.physiology.org/ by 10.220.33.6 on July 4, 2017 FIG. 6. Processing of POMC in the pituitary gland and central nervous system. END, endorphin; N-TERM, NH2-terminal segment; JP, joining peptide; LPH, lipotrophin; CLIP, corticotropinlike intermediated lobe peptide; I, dibasic amino acid cleavage recognition site; O, glycosylation sites; P, phosphorylation sites. [From Castro and Morrison (59), by permission from Critical Reviews in Neurobiology.] 990 SLOMINSKI, WORTSMAN, LUGER, PAUS, AND SOLOMON acting as a negative-feedback mediator in cytokine activity on the neuro-immuno-endocrine axis (16). B. POMC Expression: Peripheral of POMC in lymphoid tissues, perhaps due to the presence of distinct proteases that are selectively expressed in LPS-treated B cells where a truncated form of ACTH is detected (144). Neutrophils, however, have only been shown to express a 9.5-kb POMC mRNA transcript and do not release ␣-MSH (393). Recently, CRH was found to be synthesized and released by lymphocytes where it upregulates POMC mRNA production (144, 305, 385, 393, 407). Cells in the monocytic lineage that contain POMC and produce melanocortins include human peripheral blood monocytes, epidermal Langerhans cells, cell lines derived from myeloid malignancies (U937), and rodent peritoneal macrophages (55, 206, 216, 225, 238, 240, 247). Basal production of melanocortins by monocytic cells is low but increases significantly upon stimulation with LPS, mitogens (concanavalin A), or tumor promoters (phorbol 12-myristate 13-acetate) (224, 247). In addition to immunocompetent cells, other cells known to release immunomodulating cytokines such as cardiac muscle cells, fibroblasts, and keratinocytes have been found to synthesize and release POMC peptides and thereby contribute to the development of an immune response (220, 241, 337, 408). In humans, increased production of POMC peptides has been detected during the course of arthritis, in viral and parasitic infections, and in inflammatory skin diseases such as atopic eczema (32, 61, 62, 135, 136, 144, 258, 259, 384, 443). ␣-MSH injected systemically has immunosuppressor activity blocking IL-6- and TNF-␣-induced fever, inhibiting the development of adjuvant-induced arthritis, and preventing endotoxin-induced hepatitis by antagonizing various cytokines and chemokines (60, 61, 83, 152, 210), suggesting its participation in the immune responses against viral infections. Indeed, POMC elements may bind POMC transcription factors present in the human immunodeficiency virus-1 genome, in cytomegalovirus, and in some oncogenes (c-fes, MAT-1). Therefore, signals known to mediate the activation of POMC transcription factors such as corticotropin releasing factor, tumor promoters, or ultraviolet light may activate viruses or oncogenes and thus facilitate infection and possibly tumor development (208). ␣-MSH also antagonizes the neuroendocrine effects of CRH and IL-1 (347, 423). C. POMC Expression: Skin MSH was the first POMC peptide detected directly in the skin (411), which expresses the POMC gene and produces also ACTH and -endorphin (cf. Refs. 220, 365, 376, 378, 445). POMC gene transcription and translation in the mammalian skin was originally observed in the C57BL6 mice (370, 371). Subsequently, POMC gene expression has been found in human skin, normal and pathological, and in cutaneous cell culture systems (57, 67, 71, 96, 104, 107, Downloaded from http://physrev.physiology.org/ by 10.220.33.6 on July 4, 2017 Transcription and translation of the POMC gene have been detected in most peripheral tissues including placenta, uterus, gonads, thyroid, pancreas, adrenals, gastrointestinal tract, lungs, spleen, immune system, and skin (17, 27, 32, 33, 117, 170, 220, 226, 238, 258 –260, 297, 301, 305, 365, 376, 383, 445). These extracranial sites produce shorter and longer POMC transcripts, in addition to the 1.1-kb message (17, 84, 91, 99, 167, 353, 371). That heterogeneity may represent alternative splicing, variation in the length of the poly(A)⫹ tail, or use of alternative transcription initiation sites (76). It has been questioned whether mRNA smaller than 1.1 kb are translatable, since they lack the signal peptide that enables the end products to exit the cell (85, 167). In this regard, a POMC mRNA of only 0.8 kb found in placenta, testes, and ovary has been associated with the production of secretory POMC peptides (cf. Refs. 3, 167, 301, 383). Furthermore, in vitro assays have shown that short POMC transcripts can indeed be translated (85); possible mechanisms allowing translocation of peptides and proteins lacking the signal sequence have been recently described (197). It appears that most tissues have the ability to produce POMC but at levels much lower than in pituitary (17, 27, 32, 33, 59, 170, 297, 305, 376, 383, 456). In placenta and testes, production of POMC peptides is stimulated by CRH (3, 297, 301, 302). In the immune system, POMC expression and peptide release are stimulated by CRH, AVP, lipopolysaccharide (LPS), and IL-1 and inhibited by glucocorticoids (27, 33, 183, 305, 421). Because of the significance of the immune system in the skin (43), it could participate as a local site of production of the POMC peptides -endorphin, ACTH, and ␣-MSH. In fact, full-length POMC transcripts have been detected in splenic mononuclear cells (MNC), which process POMC to ACTH through the same pathway as in corticotrophs (225). Also, lymphocytes and macrophages form predominantly -endorphin and ACTH-(1—9), with smaller amounts of ACTH-(1O24), ACTH-(1O25), ACTH(1O26), and -endorphin-(144O146). T lymphocytes of human and murine origin as well as lymphoma-derived T-cell lines both express POMC mRNA and release the POMC peptides ␣-MSH and ACTH (55, 144, 224, 225, 259, 393). In human lymphocytes, POMC mRNA transcripts of 0.8, 1.2, and 1.5 kb have been detected (393). Similarly, murine ␥/␦ epidermal T lymphocytes express a truncated form of POMC and release ␣-MSH (108). The presence of ACTH immunoreactivity has been clearly demonstrated in rodents T-helper cells, cytotoxic T cells, and B cells (224). There is also evidence suggesting differential processing Volume 80 CRH-POMC SIGNALING IN A CUTANEOUS STRESS RESPONSE July 2000 1. Expression of POMC gene and production of POMC peptides in skin cells TABLE Cell Type POMC mRNA POMC Peptides MSH, melanocyte stimulating hormone; LPH, lipotrophin; POMC, proopiomelanocortin; ND, not done; NA, not applicable. * ␥-MSH is present in transformed melanocytes. † Below detectability by immunocytochemistry. ‡ Below detectability by in situ hybridization and immunocytochemistry. 108, 122, 128, 131, 168, 169, 189, 211, 212, 215, 219, 223, 255, 337, 353, 354, 356, 359, 360, 363, 370, 371, 381, 408, 411, 446). Table 1 summarizes the expression of POMC peptides in different cutaneous compartments. 1. Rodent Immunoreactive ␣-MSH has been detected in rodent skin from Wistar, Hooded, and Norwegian Brown rats, gerbils, and hairless mice (411). Cutaneous ␣-MSH (mean concentrations, expressed as ng/g wet tissue wt) has ranged from a low of 0.3 (Norwegian Brown rat) to a high of 3.2 (gerbils), values consistently lower than the corresponding hypothalamic and pituitary concentrations (411). Nevertheless, the skin levels are similar to the levels measured in extrahypothalamic-pituitary regions of the brain (411). Skin ␣-MSH peptide concentrations are unaffected by hypophysectomy, at least in rat, gerbil, and mouse skin (411). Moreover, skin peptide concentration is not modified by daily injection of ␣-MSH that increase 7- to 10-fold the ␣-MSH plasma levels of hypophysectomized or intact rats. Therefore, MSH peptides detected in the skin are not of pituitary or plasma origin (411). Instead, these data and direct evidence obtained in the C57BL6 mouse (see below) indicate that ␣-MSH present in rodent skin is the result of local production. Our own molecular studies in mouse skin have shown that the POMC gene is actually transcribed, translated (371), and further processed to the POMC peptides ACTH, MSH, and -endorphin (122, 356, 371). Also, the hairless mice ex- press POMC mRNA in skin, as shown by RT-PCR and Northern blot hybridization of epidermal mRNA (G. Ermak and A. Slominski, unpublished data). A) POMC GENE EXPRESSION AND POMC PEPTIDES PRODUCTION IN C57BL6 MOUSE SKIN. The POMC transcript of C57BL6 mice skin is 0.9 kb long, and the POMC protein, detected with an anti--endorphin antibody, has 30 –33 kDa molecular mass (371). The truncated form of POMC mRNA has been detected in epidermis and in epidermal Thy-1⫹ dendritic cells in the C57BL6 mouse skin (107, 108). A combination of Northern and Western blot analysis with immunocytochemistry detected both mRNA transcript and POMC protein during the active growth phase of the hair cycle (anagen) (122, 356, 360, 371). Because POMC gene expression was not detected (371) or was very low (360) in the resting phase of the hair cycle (telogen), the experiments were interpreted as indicative of hair cycle-dependent gene expression and thus raised the possibility of POMC product involvement in skin appendage physiology (104, 273, 356, 368). In additional studies, the exon 3 of the POMC transcript was found to be constitutively expressed in skin, being low in telogen and significantly upregulated in the growth phase of the hair cycle (anagen) (360). An attempt to determine the size of POMC mRNA on anagen skin using pituitary and brain RNA as standards give inconclusive results. This was due to the large discrepancy in tissue gene expression (per unit of mRNA ), with levels at least 10,000-fold higher in pituitary than skin. Nevertheless, a truncated 0.9-kb POMC transcript was still present throughout the entire anagen, and an additional 1.1-kb POMC transcript was detected in anagen IV (360). Another attempt was then made to detect full-length POMC mRNA at a latter stage of the hair cycle (anagen VI skin) (104), when melanogenic activity reaches its peak (368, 369, 373). RT-PCR amplification was performed with primers spanning exons 1–3 and exons 2–3 (signal peptide and coding region) or exon 3 (coding region only), followed by Southern hybridization to murine POMC cDNA. Only a 475-bp transcript from exon 3 was detected; fragments of 810 and 738 bp corresponding to regions spanning exons 1–3 and exons 2–3 were present in pituitary and brain controls but absent in anagen skin (104). Thus, in anagen VI skin, the truncated 0.9-kb transcript may be the sole or predominant POMC species (104), yet it is the appearance of a 1.1-kb POMC transcript in anagen IV (day 5 after anagen induction) that correlates with the detection of a 30- to 33-kDa POMC protein on same day specimens; the POMC protein was not found in telogen or during the preceding days of anagen development (371). Therefore, selective expression of the 1.1-kb transcript (during anagen IV) may be the predominant pathway that leads to synthesis of the POMC protein in mouse skin (104). Nevertheless, truncated POMC mRNA transcripts may be translated (85), and peptides and proteins lacking Downloaded from http://physrev.physiology.org/ by 10.220.33.6 on July 4, 2017 Epidermal keratinocytes Present ␣-, -, ␥-MSH, ACTH, -endorphin, -LPH Follicular keratinocytes Present ␣-, -MSH, ACTH, -endorphin Epidermal melanocytes Present ␣-, -MSH,* ACTH, -endorphin Follicular melanocytes ND Absent† Dermal nevocytes Present ␣-, -MSH, ACTH, -endorphin Sebocytes Present ␣-, -MSH, -endorphin Sweat gland cells ND ␣-, -, ␥-MSH Endothelial cells Present ␣-MSH, ACTH, -endorphin Langerhans cells Present ␣-MSH, ACTH Monocytes Present ␣-MSH, ACTH Macrophages Present ␣-MSH, ACTH Lymphocytes Present ␣-MSH, ACTH Fibroblasts Present ND Adipocytes ND ND Skeletal muscle ND ACTH Smooth muscle‡ Absent Absent Nerves NA ␣-, ␥-MSH, ACTH 991 992 SLOMINSKI, WORTSMAN, LUGER, PAUS, AND SOLOMON and perifollicular nerves ending, although it is additionally expressed in keratinocytes of ORS and hair matrix during anagen IV (273). POMC mRNA has been detected by in situ hybridization localized to the the dermal sebaceous glands in skin from the anagen III-VI phase of the hair cycle, whereas epithelial expression of the same POMC mRNA, first detected in scattered keratinocytes of the epidermis and ORS of hair follicles of anagen I, increases during progression to anagen VI (230, 231). The convertases PC1 and PC2, present at very low levels in epidermal keratinocytes of telogen skin, increase in anagen VI, with PC1 showing the greatest change (230). In the pilosebaceous unit, only PC1 is detected in telogen skin, whereas PC2 becomes detectable in anagen VI skin (230). Thus a close temporal correlation exists between localization and intensity of POMC mRNA expression, expression of the POMC processing convertases PC1 and PC2, and detection of POMC derived peptides. B) POMC GENE EXPRESION AND POMC PEPTIDE PRODUCTION IN RODENT MELANOMAS AND CELL CULTURE SYSTEMS. In the amelanotic rodent melanoma lines, Bomirski AbC1 hamster and Cloudman S91 mouse clone 6, Northern hybridization analysis detected POMC mRNA transcripts of 3.5, 1.5, and ⬃1–1.1 kb (353). Expression of POMC mRNA in both cell lines correlated with detection of a 30-kDa POMC protein by Western blotting and by cytoplasmic immunostaining with antibodies against -endorphin and ␥3-MSH (353, 367). These results indicate that hamster and mouse melanoma cells can transcribe and translate the POMC gene. POMC mRNA production in the AbC1 line was stimulated by exposure to L-DOPA (353). Of potential oncologic relevance, the amelanotic Bomirski tranplantable hamster melanoma and melanotic variants are linked by common origin (41, 353, 367). In comparative analysis, POMC mRNA was expressed only in the rapidly growing amelanotic Ab variant, whereas POMC mRNA was not detected in the two slower growing Ma and MI melanotic variants (353). We have therefore suggested that in this system POMC gene expression may represent an autoregulatory mechanism whose expression stimulates progression to the malignant phenotype (367). The melanocytic cell lines that produce ␣-MSH include LND2 and different subclones of B16 and Cloudman S19 melanomas, normal nontransformed (Melan A) and ras transformed (LTRras11–3, PAGTori and PAGT5) mouse melanocytes, and human melanoma lines (67, 71, 128, 223, 457). In the B16 melanoma line, immunoreactive ␣-MSH (␣-MSH-IR) has been further identified by RPHPLC as desacetyl-␣-MSH (223). The highest concentrations of ␣-MSH-IR were found in the least differentiated, most metastatic melanoma cell lines and in ras-transformed melanocytes (223). In mice transplanted with various B16 melanomas, only the highly metastatic variant was ␣-MSH positive, with the IR located predominantly in the peripheral invading zones (457). This was in contrast Downloaded from http://physrev.physiology.org/ by 10.220.33.6 on July 4, 2017 the signal sequence may still be translocated (197). Thus the 0.9-kb POMC mRNA cannot be entirely excluded as a source of POMC peptides. Glucocorticoids are the physiological suppressors of pituitary POMC production (99, 110, 141, 170, 383, 444), and correspondingly, the synthetic glucocorticoid dexamethasone attenuates POMC mRNA production in anagen skin (104). Topical dexamethasone treatment is accompanied by decreased mRNA coding for the cutaneous MC1 (receptor for ␣-MSH) and for tyrosinase, and tyrosinase activity is correspondingly decreased (104). Topical application of dexamethasone also produces massive catagen development and rapid inhibition of melanogenesis (104, 273, 274, 372). Thus murine hair growth and attendant melanogenesis may be jointly regulated by local POMC peptide production/MC1 receptor stimulation (104), and suppression of this local pathway by glucocorticoids would explain the observed termination of both hair growth and follicular melanogenesis. In mouse skin extracts, the POMC products detected by RP-HPLC coupled to specific RIA assays include -endorphin, ␣-MSH, and ACTH peptides (122, 273, 356). Thus accumulated evidence indicates that mouse skin produces POMC, which is then processed to its secretory neuropeptides; triggering of this expression sequence may be linked to hair cycle (122, 231, 273, 356, 360, 368, 371). Accordingly, -endorphin concentrations increase during anagen development, reach a peak in anagen VI, and decline during follicle involution (catagen); the lowest levels are reached in the resting phase (telogen) (122, 371). The pattern for ACTH immunoreactivity is similar to -endorphin, e.g., low levels in telogen with a rise during anagen to a peak in anagen VI skin (356). These episodic variations in local levels of POMC peptides also correlate with expression of the convertases PC1 and PC2, from a high level in anagen VI to being low in telogen (230). The pattern of predictable intermittent cutaneous accumulation of ACTH, MSH, and -endorphin peptides indicates precise regulatory control that determines actual production rates; whether the peptides degradation rates are also under regulatory control remains to be tested. The differential expression of POMC products is not only associated with functional changes (hair cycle phase) but is also anatomically restricted (cellular compartment specific). In this regard, immunocytochemistry studies have shown that -endorphin staining is primarily limited to sebocytes (Fig. 7), ACTH stain to epidermal and ORS keratinocytes, and to skeletal muscle, whereas -MSH stains follicular and epidermal keratinocytes, sweat gland ducts, and sebocytes (122, 230, 231, 273, 356, 371). These immunostains also show the already mentioned temporal dependence on hair cycle phase, with lowest levels in telogen and progressive increases to a peak in anagen VI (122, 231, 371). ␣-MSH is detected throughout the entire hair cycle mainly in nerve bundles Volume 80 July 2000 CRH-POMC SIGNALING IN A CUTANEOUS STRESS RESPONSE 993 to levels below the limit of detectability of the assay in the low metastatic F1 variant, which grows as a noninvading tumor. Characterization of POMC mRNA from the S-91 melanoma cell line PS-1-HGPRT-1 showed three transcripts of ⬃6.5, 3.5, and 1.1 kb (71). These corresponded, respectively, to nonspliced primary transcription product, alternatively spliced product, and mature POMC. In the same melanoma cell line, UVB stimulated POMC gene expression and production and release of ACTH and ␣-MSH in a dose-dependent manner (71). Because all of the above models of melanoma express MSH receptors, the observed production of POMC peptides could represent an autostimulatory mechanism, which accelerates growth and aggressive malignant behavior. The general trend is that POMC gene is more actively transcribed, or produces more POMC-derived ␣-MSH in the least differentiated, most malignant hamster and mouse melanoma cells and in ras-transformed melanocytes (223, 353, 367, 457). Deregulated intrinsic expression of the POMC gene appears then as a common factor preceding malignant transformation of melanocytes and/or melanoma progression to less differentiated faster growing forms (223, 353, 367, 457). Thus local expression of POMC peptides triggered by undetermined factors could alter melanoma cell phenotype promoting tissue invasion. POMC peptides would exert this action through auto-, intra-, or paracrine mechanisms; alternatively, POMC peptides may affect surrounding tissues such as immune elements or vascular system to further promote tumor growth and metastatic cascade. In addition to being present in melanoma, POMC peptides are also produced by several nonmelanoma rodent skin cell lines (71, 108, 220, 223). For example, the immortalized (BALB/c) PAM 212 keratinocytes, in which Downloaded from http://physrev.physiology.org/ by 10.220.33.6 on July 4, 2017 FIG. 7. Hair cycle-associated expression of -endorphin in sebaceous glands of the C57BL6 mouse. The -endorphin antigen was localized to the sebaceous glands by immunocytochemistry with anti--endorphin antibody. Left: low magnification (⫻100). a, Telogen; b, anagen I; c, anagen II; d, anagen IV; e, anagen V. Right: high magnification (⫻560) showing -endorphin immunorectivity in individual glands. a, Anagen I; b, anagen IV; c, anagen V; d, anagen V. [From Slominski et al. (371), with permission from Birkhaeuser Publishers.] 994 SLOMINSKI, WORTSMAN, LUGER, PAUS, AND SOLOMON production of ACTH and MSH is stimulated by UVB or dibutyryl cAMP (71), and immune cells such as epidermal Thy-1⫹ lymphocytes, Langerhans cells, and circulating cells of monocytic lineage express the POMC gene and produce POMC peptides (108, 220). 2. Human 446). In this regard, cultured keratinocytes and melanocytes produce POMC peptides and release ␣-MSH and ACTH into the medium (67, 189, 337, 354, 446). Production of ␣-MSH and ACTH can be significantly upregulated at the protein and mRNA levels upon treatment with phorbol 12-myristate 13-acetate, IL-1, and UV light (67, 96, 219 –221, 337, 341, 342, 446). A) EXPRESSION OF POMC GENE AND PRODUCTION OF POMC PEPTIDES IN VIVO. Production of POMC peptides in vivo was strongly suggested by the immunocytochemical studies performed in skin biopsy specimens and cultured cells and was supported by the corresponding detection of POMC mRNA. In situ hybridization experiments with normal human skin showed strong POMC mRNA expression in epidermal melanocytes and keratinocytes, whereas in the dermis, POMC mRNA was detected at much lower levels, in endothelial and perivascular cells (57). Thus these studies confirmed previous work implicating epidermal and dermal cells as source of cutaneous POMC peptides (57, 107, 168, 169, 189, 212, 219, 255, 337, 354, 359, 381, 389, 408, 438, 446). Of note, ␥-MSH-IR was shown in nerve fibers in the basal layers of epidermis, in the upper dermis, close to Merkel cells, in Meissner’s corpuscles, around ORS of the hair follicle, in nerve bundles of the deep dermis, and to a lesser degree around sweat glands and blood vessels (169, 212). Because POMC peptides have been detected in the circulating immune system (27, 32, 33, 169, 219 –221, 247, 305), together with cutaneous nerves, they may represent additional sources of POMC peptides in the skin. Most resident skin cells express in situ ␣-MSH and ACTH, -MSH, -endorphin, and ␥-MSH peptides (Table 1), arising from different portions of the POMC protein precursor. The peptide nature of the immunocytochemically detected antigens was confirmed with RP-HPLC analyses that did demonstrate the presence of desacetyl␣-MSH, mature ␣-MSH, and ACTH peptides in extracts of human epidermis (438) and in perilesional and lesional skin from areas of basal cell carcinoma (363). Thus these analyses performed in biopsy specimens, in conjunction with the cell culture studies, demonstrate that POMC precursor protein is produced in situ, being processed locally to the final secretory peptides. Expression of MSH and ACTH was accompanied by epidermal expression of the POMC processing enzymes PC1 and PC2 convertases, with PC2 showing tendency to coexpress with ␣-MSH (438). It therefore appears that POMC processing may be cell type regulated similar to pituitary corticotrophs and melanotrophs, i.e., skin cells may specialize in the production of either ACTH or ␣-MSH as initially proposed (376). The detection of POMC peptides in skin is common to a broad spectrum of apparently unrelated conditions, from the neoplastic melanocytic nevi, melanoma, basal cell carcinoma, and squamous cell carcinoma to the in- Downloaded from http://physrev.physiology.org/ by 10.220.33.6 on July 4, 2017 MSH was initially detected as immunoreactivity in extracts of normal human skin and identified by RP-HPLC in isolated epidermis as the desacetyl-, monoacetyl-, and diacetyl forms (411, 438); this established the background for further studies on the local expression of POMC peptides. With the use of immunocytochemistry on frozen sections of normal human skin, ␣-MSH was found in epidermal melanocytes and Langerhans cells, and ACTH was found in differentiating keratinocytes (438). Pathological specimens of human skin evaluated by immunocytochemistry also showed POMC-derived antigens in dermal and epidermal compartments (381). The POMC peptides expressed included ACTH, ␣-MSH, and -endorphin, although a consistent pattern did not emerge (381). In normal corporal skin (obtained after surgery), POMC peptides were detected in dermis but not epidermis. Dermal POMC peptides were present in anagen hair follicles, where they accumulated in keratinocytes of ORS and hair matrix. In human scalp, POMC peptides were seen in both epidermal and follicular keratinocytes (381). The possible discrepancy with the results of Wakamatsu et al. (438), who did detect POMC peptides in epidermis of normal corporal skin, may be explained by the lower sensitivity for detection in the Formalin-fixed paraffin-embeded tissues (381). Direct RIA analyses in normal human skin showed that immunoreactive MSH levels were indeed very low or below the level of detectability (214). The same group found high MSH levels in melanoma lesions, which, together with our detection of ACTH, ␣-MSH, and -endorphin in a wide range of skin diseases suggest that POMC peptide expression represents a disease-related phenomenon (381). Such a possibility received strong support from observations in keloids, a rather homogeneous primary reactive skin disorder, where POMC products were consistently detectable (10 of 11 cases) and localized to keratinocytes and mononuclear cells (381). Because POMC mRNA was detectable by RT-PCR in biopsy specimens from normal scalp, basal cell carcinoma, and compound nevus, cutaneous POMC peptides appear to originate from local production (359). Together these findings suggest that POMC peptides are produced and stored locally in lesional (especially reactive) skin cells as a component of the cutaneous response to injury. More recently, it was confirmed that human skin cells could actually produce POMC peptides either in vivo (57, 168, 169, 211, 212, 220, 255, 363, 381, 438) or in cell culture systems (67, 96, 107, 189, 337, 341, 342, 354, 359, 408, 438, Volume 80 July 2000 CRH-POMC SIGNALING IN A CUTANEOUS STRESS RESPONSE POMC spillover from the skin is also suggested by studies in severe atopic dermatitis and psoriasis (125, 135, 136, 252). These patients showed increased serum -endorphin levels; however, because of the previous immunocytochemical detection of POMC peptides in psoriatic skin (381), it was suggested that circulating -endorphin could be generated, at least partly, in lesional skin (135). POMC peptide production was evaluated by indirect immunofluorescence in skin biopsies from 16 patients with vitiligo lesions and 13 matched healthy controls (212). Keratinocytes from control skin and from involved and uninvolved skin of vitiligo patients expressed ␣-, -, and ␥3-MSH (212). MSH-IR was, however, higher in keratinocytes and extracellular compartments of involved vitiligo skin than in control skin. The adnexal structures (sweat glands and pilosebaceus orifices) showed no difference in the intensity of stain (212). Plasma ␣-MSH levels were similar in vitiligo and control patients, whereas -endorphin levels were higher in vitiligo, failing to show the normal circadian rhythmic change (252). B) EXPRESSION OF POMC GENE AND PRODUCTION OF POMCDERIVED PEPTIDES IN VITRO. Expression of the POMC gene has been noted in cells of epidermal and dermal origin that include normal melanocytes and keratinocytes (57, 66, 96, 107, 189, 219, 337, 354, 359, 438, 446), Langerhans cells (247), fibroblasts (408), human dermal microvascular endothelial cells (HDMEC) (341, 342), circulating immune cells (34, 35, 40, 41, 72, 258 –260), and malignant melanocytes and keratinocytes (67, 128, 354, 363, 411). Gene expression was accompanied by detection of POMC-derived ACTH, ␣-MSH, and -endorphin immunoreactivities in cultured cells and culture medium. Characterization of ␣-MSH and ACTH peptides by RP-HPLC analyses of cell extracts in normal and malignant melanocytes and in keratinocytes showed multiple forms of POMC peptides (128, 131, 337, 354, 363, 411, 438), which included ACTH(1O10), acetyl-ACTH-(1O10), ACTH-(1O17), ACTH(1O39), desacetyl-␣-MSH, and ␣-MSH (354, 363, 411, 438). Western blot analyses have confirmed the production of -LPH and -endorphin in normal keratinocytes (446), whereas normal melanocytes and squamous cell carcinoma cell -endorphin was detected by RP-HPLC analyses combined with specific RIA assay (354). In melanoma and squamous cell carcinoma cells, ACTH, ␣-MSH, and -endorphin were determined by RP-HPLC-RIA (411); one of the ACTH-IR peaks eluted at the same time as ACTH(1O13) (354). These observations suggested that processing of POMC to -endorphin, ACTH, and ␣-MSH is a constitutive property of skin cell type, regardless of whether they are benign or malignant. Production of POMC peptides in keratinocytes and melanocytes was found to be under regulatory control, being stimulated by UVB, selected cytokines, and other factors (47, 64, 67, 220, 337, 446) (see below). Also, HDMEC stimulated by UVB and UVA produce and release ␣-MSH and ACTH (341, Downloaded from http://physrev.physiology.org/ by 10.220.33.6 on July 4, 2017 flammatory keloids, psoriasis, and scarring alopecia (381). This finding suggests that deregulated local production of POMC may be a common reactive phenomenon in cutaneous pathology (381), a possibility supported by the results of studies on the progression of pigmented lesions (127–129, 131, 211, 214, 215, 255, 381). In semiquantitative study, POMC-derived antigens were below the limit of detectability by immunocytochemistry in normal skin melanocytes and in benign blue nevi (255). In contrast, common and dysplastic melanocytic nevi showed weak positivity for ␣-MSH, ACTH, and -endorphin antigens in 14, 33, and 44% of the specimens, respectively, with a tendency for higher expression levels in dysplastic nevi (255). In melanoma, POMC antigens were easily detectable in ⬎50% of cases, and the stain was also more intense and diffuse in the more aggressive forms: the nodular type (pure vertical growth phase), the vertical growth phase of superficial spreading type, acral lentiginous types, and metastatic melanomas (211, 255). Direct measurement of ␣-MSH with RIA found that concentrations in skin melanomas were variable from 0.21 to 2.32 pmol/g wt and in lymph node metastasis from 0.31 to 4.25 pmol/g wt (214). The ␣-MSH-IR detected in melanomas was chromatographically heterogeneous; only a small fraction represented authentic ␣-MSH peptide, whereas most of the immunoreactivity corresponded to more hydrophobic species of larger molecular weight (128, 131). The larger molecular weight ␣-MSH-IR species probably have preserved COOH-terminal amino acid sequence and may contain the whole 1–13 ␣-MSH sequence (128, 131). Immunocytochemistry studies performed in 30 specimens from basal cell carcinoma patients showed heterogeneous distribution of immunoreactive ␣-MSH, -MSH, and ACTH peptides in tumor cells, lesional and perilesional areas, epidermal and follicular keratinocytes, dermal mononuclear cells, and extracellular matrix (363). The frequency of peptide detection was similar in lesional and perilesional areas and in tumor cells. RP-HPLC studies combined with RIA monitoring of eluted fractions documented that ACTH and ␣-MSH of lesional and perilesional areas corresponded to the authentic peptides; an additional peptide eluted at the same time as desacetyl␣-MSH. POMC mRNA was also detected by RT-PCR in extracts of perilesional and lesional skin (363). Most interestingly, the MC1-R gene encoding the receptor activated by MSH and ACTH was also expressed in the same lesional and perilesional skin, suggesting paracrine/autocrine mechanisms of action for the peptides. Perhaps POMC peptides facilitate basal cell carcinoma development and/or progression (363). Ghanem et al. (127) found that melanoma patients have increased serum levels of ␣-MSH-IR, and these could be positively correlated with progression of clinical stage or level of invasion. This suggests that local tissue MSH could eventually spill into the blood. The possibility of 995 996 SLOMINSKI, WORTSMAN, LUGER, PAUS, AND SOLOMON 342). Of further interest, these endothelial cells express the convertase PC1, whose mRNA production is again stimulated by UVA as well as IL-1 and ␣-MSH (341). 2. Modulators of POMC gene expression in the skin TABLE Agent 3. Regulation Cytokines and growth factors IL-1 TNF-␣ Endothelin-1 TGF- Physicochemical factors Ultraviolet radiation Dibutyryl cAMP TPA and PMA L-Dopa Dexamethasone POMC Production (mRNA and/or Peptides) Stimulated Stimulated Stimulated Inhibited Stimulated Stimulated Stimulated Stimulated Inhibited TPA, 12-O-tetradecanoylphorbol 13-acetate; PMA, phorbol 12-myristate 13-acetate; IL-1, interleukin-1; TNF-␣, tumor necrosis factor-␣; TGF-, transforming growth factor-. central level, could play a more dominant regulatory role on POMC peptides production in the skin. In this regard, the proinflammatory cytokine IL-1 has a significant stimulatory/inductory effect on POMC gene expression in resident skin cells and circulating immune cells including macrophages (27, 32, 33, 57, 219 –221, 337, 445, 446). Indeed, IL-1 increases production of POMC mRNA and ACTH, ␣-MSH, and -LPH peptides in cultured normal and malignant epidermal melanocytes and keratinocytes (67, 219 –221, 337, 445, 446). In HDMEC, expression of POMC gene is also stimulated by IL-1 (341, 342). Another cytokine, TNF-␣, stimulates production of POMC mRNA in normal dermal fibroblasts (408), whereas transforming growth factor (TGF)- inhibits it in the same cell system and in keratinocytes, but not in keloidal fibroblasts (408). Neither TNF-␣ nor endothelin-1 affects POMC peptide production in melanocytes and keratinocytes (67). Further confirming the selectivity of cytokine action, the release of ␣-MSH by transformed human keratinocyte line is not altered by the cytokines IL-2, IL-6, TGF-, and interferon (IFN)-␥. Thus selected cytokines and growth factors produced in the skin can act locally, stimulating or inhibiting POMC gene expression and peptide production in a cell type-restricted fashion. In rodent skin, the expression of POMC gene and production of POMC peptides appear to be regulated by the same biological clock that controls hair cycle (104, 122, 273, 356, 360, 368, 371). Although the effector messengers of that clock remain the subject of numerous hypotheses, a pacemaker, local or distant, would generate the signals that periodically stimulate and inhibit cutaneous POMC gene expression (104, 272, 273, 276, 356, 360, 368, 371, 372, 376). Because the anagen-induced cutaneous POMC gene expression is inhibited by topical application of the synthetic glucocorticoid dexamethasone, which also terminates hair growth, it is possible that the dexamethasone-induced attenuation of POMC gene activ- Downloaded from http://physrev.physiology.org/ by 10.220.33.6 on July 4, 2017 It is generally accepted that translation of the POMC mRNA requires the full-length transcript composed of three exons, where exon 1 contains the signal peptide (17, 99, 170, 383). In human skin cells, the size of the POMC transcript is of 1.2 or 1.3 kb, similar to that detected in the hypothalamus and pituitary (220, 337, 446). In contrast, in rodent skin, a shorter 0.9-kb form predominates, although a full-length 1.1-kb transcript is also detected (104, 360, 371). It is not yet clear which of these forms is translated in rodent skin, since it is possible that the shorter 0.9-kb POMC could be translatable (85) because of mechanisms that would allow the translocation of peptides and proteins lacking the signal sequence (197). Cloning of POMC mRNA fragments from human skin has shown only 86% homology with the pituitary transcript, with no differences in the region coding for ACTH and -endorphin (57). This only partial POMC mRNA homology raises the question of whether additional nonallelic forms of POMC are expressed in the skin. It must be noted that lower vertebrates express two forms of POMC gene (12, 402), whereas in the mouse genome, two nonallelic ␣- and -POMC genes have been identified (425). Production of the final ACTH, MSH, and endorphin peptides is a complex multistep process that requires POMC processing by prohormone convertases (PC1 and PC2). The PC1 gene is expressed in human keratinocytes, where it is upregulated by UVB (47, 48), whereas Scholzen et al. (341) showed that dermal microvascular cells express PC1 mRNA, which is again stimulated by UV, and by IL-1 and ␣-MSH. Immunocytochemistry studies showed that the PC1 and PC2 enzymes are expresssed in the human skin, in epidermal keratinocytes and melanocytes (438), and in the anal mucosa (159). In the C57BL/6 mouse, the enzymes are expressed in follicular and epidermal keratinocytes and sebaceous gland (230). The overall processing of POMC in skin cells yields multiple forms of ACTH, desacetyl-␣-MSH, ␣-MSH, -LPH, and -endorphin (122, 131, 223, 337, 354, 356, 363, 411, 438, 446), but whether similar posttranslational modifications of intermediates of POMC, as in pituitary and brain, e.g., amidation, acetylation, glycosylation, and phosphorylation, would also occur in the skin remains to be defined. A list of the factors that can stimulate or inhibit production of POMC peptides in the skin is presented in Table 2. The lack of cutaneous access to the rich source of neuroendocrine factors represented by the hypothalamus suggests that control of full expression of the POMC gene in the skin is probably different from the pituitary. It is possible that the immune system, also involved at the Volume 80 July 2000 CRH-POMC SIGNALING IN A CUTANEOUS STRESS RESPONSE oxidative stress, cAMP, and PKC all appear to participate in the regulation of POMC gene expression. VII. SKIN AS A TARGET FOR PROOPIOMELANOCORTIN PEPTIDES A role for POMC peptides in the regulation of skin pigmentary system is suggested by observations in the POMC knock-out mice model; surprisingly, these animals survive to adulthood (450). Lack of POMC gene expression is characterized by the main phenotypic traits of severe obesity and adrenal insufficiency; also prominent is a defect in fur pigmentation (450). This pattern is strikingly similar to the clinical picture of patients with pituitary POMC gene mutations that generate allelic forms with defective production of POMC protein (154, 196). Affected individuals present with red hair pigmentation, severe early-onset obesity, and adrenal insufficiency. There is also a large body of clinical information on POMC peptides excess syndromes that confirm the skin as a target for POMC-derived peptides (cf. Refs. 101, 113, 137, 141, 171, 201, 202, 204, 220, 221, 244, 282, 283, 352, 376, 384, 397, 412, 445). For example, humans with pathologically increased levels of plasma ACTH (Addison disease) or excessive ACTH production by tumors (Nelson syndrome) have hyperpigmentation and skin atrophy (101, 113, 137, 141), while the administration of MSH or ACTH peptides stimulates melanogenesis (201, 202, 204). Prolonged administration of synthetic ACTH in humans induces acne, skin atrophy, hyperpigmentation, and hypertrichosis (101, 113, 137, 141), whereas elevated serum concentrations of ␣-MSH are associated with skin pigmentation (289). Additional research performed on human and animal models (see sect. VII, A and C) indicates that also immune, epidermal, adnexal, vascular, and dermal structures represent additional targets for POMC peptides. A. Melanocortin Receptors It is known that the phenotypic effects of POMC peptides are mediated via interaction with cell surface receptors linked to the G protein (101, 110, 141, 257, 444). MSH and ACTH activate melanocortin (MC) receptors, whereas -endorphin acts predominantly on - and ␦-opioid receptors. The expression of MC and endorphin receptors in different skin compartments is listed in Table 3; the following section discusses the skin MC receptors. Investigations performed in frog melanophores showed that ␣-MSH interacts with cell surface receptors to induce cAMP production and the final phenotypic effect of skin darkening (2, 141, 201, 350). In S91 melanoma cells, MSH interacts with specific cell surface receptors, activates adenylyl cyclase activity, and increases intracel- Downloaded from http://physrev.physiology.org/ by 10.220.33.6 on July 4, 2017 ity may be mediated by a direct effect on the cutaneous clock (104). A major cutaneous stressor, UVR, can stimulate/induce cutaneous POMC gene expression as shown in human and rodent normal and malignant cultured keratinocytes and melanocytes (48, 64, 67, 71, 96, 220, 221, 337, 446). The response to UVR was found to be dose dependent when assessing ACTH and ␣-MSH production and secretion in normal and malignant keratinocytes (67, 71, 219 –221, 337, 446) and of -LPH and -endorphin in keratinocytes (446). These effects were accompanied by correspondingly increased POMC mRNA production . A similar UVR-induced stimulation of POMC gene expression, with increased ACTH and ␣-MSH production and release to the culture media, was observed in rodent transformed keratinocytes and melanoma cells (64, 71). Most recently, UVB and UVA treatment of HDMEC resulted in increased expression of the POMC gene with increased production and release of ACTH and ␣-MSH (341, 342). Humans and horses exposed to sunlight exhibit increases in the circulating levels of ␣-MSH and ACTH (129, 157, 158), and experimental whole body exposure to UVR increases -LPH and -endorphin serum levels (23, 205). UV-absorbing topical sun blockers abrogate the -LPH response (23), implicating mediation by a photoreaction. Although the pituitary gland was postulated as the source of these humoral responses, the experiments cited suggest a stress-sensing role for the skin and also support the skin as an alternate source for circulating neuropeptides. Because of the significance of its interaction with the skin, the contribution of UVR to the production of nuclear signals deserves further examination. Theoretically, UVR could activate the genome directly or, indirectly via action on membrane-bound signaling processes, production of second messengers, or via pathways activated by oxidative stress (cf. Ref. 378). In support of the latter possibility, N-acetyl-cysteine (NAC), a precursor to glutathione that acts as an intracellular free radical scavenger, abolished the UVR-stimulated POMC peptide production in human keratinocytes and melanocytes (67). It was then postulated that NAC may inhibit POMC peptides production through attenuation of the oxidative stress triggered by UVR (64, 67). The tyrosine phosphorylation inhibitors tyrphostin and genistein had no effect on basal or UVRstimulated POMC production (67). Exposure to dibutyryl cAMP had stimulatory effects on basal ␣-MSH and ACTH production in a number of cell lines, which include transformed (BALB/c) PAM 212 keratinocytes and Cloudman S91 melanoma cells, PS-1-HGPRT-1 clone, and normal and transformed human keratinocytes and melanocytes, suggesting involvement of cAMP-activated pathways in that process (67, 71). Finally, phorbol 12-myristate 13acetate and TPA enhanced POMC gene expression in melanocytes and keratinocytes (219, 220, 337, 446), suggesting involvement of PKC-activated pathway(s). Thus 997 998 SLOMINSKI, WORTSMAN, LUGER, PAUS, AND SOLOMON TABLE 3. Expression of MC and opioid receptors MC Receptor Epidermal keratinocytes Follicular keratinocytes Epidermal melanocytes Follicular melanocytes Dermal nevocytes Sebocytes Sweat gland cells Endothelial cells Langerhans cells Monocytes Macrophages Lymphocytes Fibroblasts Adipocytes MC1 MC1 MC1, MC2† MC1 MC1 MC5 MC1, MC5 MC1 MC1 MC1 MC1 MC1 MC1 MC2, MC5 Opioid Receptor -Opiate -Opiate ND ND ND -Opiate -Opiate Absent ND ND ND ND Absent Absent receptor receptor receptor receptor MC, melanocortin; ND, not done. † Detected by RT-PCR. lular cAMP (cf. Refs. 201, 244, 279). This is followed by increases in tyrosinase activity and melanin production (447, 448), stimulation of dendrite formation (cf. Ref. 101), and variable effects on cell proliferation (244, 277, 279, 284, 285, 287). On the basis of these findings, it was proposed that in rodent melanocytes the phenotypic effects of MSH are mediated by cAMP through activation of PKA and phosphorylation/dephosphorylation reactions (92, 101, 141, 161, 193, 244, 257, 277–279, 281, 284, 285, 367, 448). Binding of MSH to the MSH receptor with subsequent activation of adenylyl cyclase was found dependent on the presence of calcium in the receptor milieu; calcium binding protein (CBP) may partially activate the receptor even in the absence of the ligand (105). Activation of PKC by ␣-MSH may also be involved in stimulation of melanogenesis (51, 271), and some investigators have suggested that MSH receptor signal transduction may be coupled to phospholipase C-activated production of IP3 and diacylglycerol with subsequent mobilization of intracellular calcium (51). However, studies on different melanoma models have generated conflicting results, e.g., in human melanomas ␣-MSH was found indeed to stimulate IP3 production (399), whereas in hamster melanoma, the MSH signal transduction and subsequent phenotypic effect were linked to cAMP without any evidence of IP3 production (366). A similar discrepancy is found in adrenal cortex. Some authors observed that ␣-MSH stimulated exclusively cAMP production without effect on IP3 (162), whereas others showed a concentration-dependent effect. At low concentrations, ␣-MSH stimulated IP3 production, and at high concentrations, it instead stimulated cAMP production (177, 178). The latter investigators further postulated that the steroidogenic action of ␣-MSH, but not ACTH, involved stimulation of PKC and tyrosine kinases as the result of phospholipase C activation (179). To further search for second messengers of MC2 receptor (MC2-R) different from cAMP, ACTH was modified by the attachement of o-nitrophenylsulfenyl to a tryptophan residue (NSP-ACTH). NPS-ACTH was found to rapidly stimulate intracellular calcium mobilization and production of 15-lipoxygenase metabolites of arachidonic acid in bovine fasciculata-reticularis cells (451). Therefore, calcium and lipoxygenase metabolites may act as additional second messengers of ACTH in bovine adrenal cells, and the ACTH-(11O24) region may be important in this regulation (451). However, it is still unclear whether the reported effects reflect the activation of solely MC2-R or, of other receptors as for example, MC5 that has high affinity for ACTH and is also expressed in the adrenal cortex (248, 431). Pharmacological studies with cloned MC receptors have shown that their signal transduction is coupled to activation of adenylyl cyclase (82, 88, 123, 248 –251, 256, 257). Although modest activation of IP3 production by MSH binding to MC3 was reported (88, 257), there is no evidence that cloned MC1 and MC2 receptors would be coupled to other than cAMP second messenger generating systems (88). The postreceptor pathways activated by ␣-MSH binding to the MC5-R in B lymphocytes involve stimulation of the Janus kinase 2 (JAK2) and signal transducers and activators of transcription (STAT1) pathways (52), as well as transmission through the same phosphorylation pathway used by cytokines and growth factors. In cells of monocytic lineage, ␣-MSH acts on MC1-R through cAMPactivated pathways to suppress the activation of nuclear transcription factor NFB induced by inflammatory agents (227). Activation of NFB may be required for expression of cytokines and adhesion molecules (229). Activation of MC1-R in immune cells inhibits NO and neopterin production as well as prostaglandin synthesis (209, 312, 390). MSH receptors have been detected and characterized in rodent melanoma cells (64, 68 –70, 95, 101, 161, 175, 176, 244, 265, 266, 277–279, 281, 283–285, 351, 352, 358, 364, 366, 434, 435), normal and malignant human melanocytes (1, 93, 101, 119, 120, 130, 161, 164, 257, 352, 401), keratinocytes (31, 35, 64 – 66, 220, 264, 363), and other cutaneous cells and extracutaneous tissues including brain, adrenal gland, gonads, and immune cells (29, 34, 45, 79, 88, 141, 147, 209, 220, 249, 251, 312, 390). In vivo experiments on mice showed wide distribution of MSH binding sites, to almost all organs (406). The work of the pigment biology group at Yale University has been fundamental in the characterization of cell-surface MSH receptors (38, 95, 193, 201, 244, 277–279, 284, 285, 287, 434, 435, 447– 449). In fact, the observation that after binding the ligand, the MSH receptor is internalized and translocated to the Golgi region (434) represents the first demonstration of receptor internalization after binding of a peptide hormone. Ultrastructural and biochemical assays showed translocation of the MSH-MSH-R complex from the cell surface to melanosomes and demonstrated the presence of actual intracellular MSH binding sites (68, 101, 244, 279, Downloaded from http://physrev.physiology.org/ by 10.220.33.6 on July 4, 2017 Cell Type Volume 80 July 2000 CRH-POMC SIGNALING IN A CUTANEOUS STRESS RESPONSE 283). MSH receptor expression was cell cycle dependent and restricted predominantly to G2 phase (435). This G2 phase coupling of increased MSH receptor expression is associated with increased cellular responsiveness to the ligand (40, 64, 234, 283, 449). Factors that raise intracellular cAMP levels such as dibutyryl cAMP and cholera toxin can also upregulate MSH receptor expression (95). In general, factors increasing intracellular levels of cAMP, such as MSH and ACTH, upregulate expression of their own receptors (70, 71, 249, 291, 400). Positive cooperativity of MSH receptors has been documented in mouse and hamster melanoma cells as well as in immortalized human keratinocytes (64, 65, 234, 364). Melanocortin receptors were characterized in crosslinking experiments that identified a membrane-bound receptor of ⬃45 kDa in a number of melanocytic lines (101). Cloning of the MC1-R and MC2-R receptors was also performed with mRNA isolated from melanocytes (82, 250). Currently, there is a family of MC receptors that includes five members MC1-R to MC5-R, that share high sequence homology (cf. Refs. 88, 171, 251). All five genes belong to the superfamily of seven transmembrane G protein-coupled receptors (82, 88, 171, 248 –251); these are 298 –372 amino acids long and have short intracellular COOH-terminal and short NH2-terminal extracellular domains. MC receptors are coupled to an adenylyl cyclase, with possible additional coupling in MC3-R to phospholipase C (cf. Refs. 82, 88, 123, 248 –251). The MC receptors have different pharmacological profiles of activation by MSH and ACTH peptides (82, 88, 248 –251, 290, 317, 339, 340). In rodents, the receptor for ␣-MSH, MC1-R, has high affinity for ␣-MSH, low for ACTH and -MSH, and lowest for ␥-MSH (88, 248, 250, 251, 317). In humans, MC1-R has equally high affinity for ␣-MSH and ACTH and lower affinity for -MSH and ␥-MSH (82, 88, 123, 250, 251). The receptor for ACTH, MC2-R, exhibits absolute specificity for ACTH (88, 250). MC3-MC5-R show equal affinity for ␣-MSH and ACTH, whereas MC3-R or ␥3-MSH receptor has high affinity for ␥-MSH (cf. Refs. 88, 123, 248 –251). MC1 receptors have been detected in skin, brain, and immune system; MC2-R in adrenal gland, adipose tissue, and skin; MC3-R in brain, placenta, gut, and thymus; MC4-R in brain; and MC5-R in brain, adipose tissue, muscles, esophagus, thymus, prostate, skin, and exocrine glands that include Harderian, lacrimal, and specialized (preputial) or nonspecialized sebaceous glands (45, 79, 82, 88, 104, 123, 141, 161, 209, 220, 248, 250, 251, 257, 317, 362, 400, 404, 431). The distribution of MC1-R, MC2-R, and MC5-R in skin is presented in Table 3. The mRNA for MC1-R and MC2-R have been detected in rodent skin by Northern blot hybridization (104). MC2-R mRNA was de- tected by RT-PCR in human skin biopsy specimens of compound melanocytic nevus and in cultured normal and malignant melanocytes (362). Of note, in human melanocytes, ACTH appears to be more potent than ␣-MSH in stimulation of melanogenesis (161). MC1-R has a prominent role in regulation of mammalian pigmentation (88, 101, 141, 171, 248, 250, 257, 397). In rodents, MC1-R is encoded by the extension locus (E), which has four alleles resulting from point mutations (88, 257, 317). These allelic forms differ in their responsiveness to ␣-MSH and may even constitutively activate adenylyl cyclase without interacting with the ligand. Similar regulatory features have been described in other species (88, 171, 257). In humans, mutations at the MC1 locus generate allelic forms of the receptor which differ in ligand specificity and most importantly in phenotypic effect concerning hair and skin pigmentation (88, 171, 257, 386, 397, 428). It has also been proposed that defective MC1-R function may be associated with an increased incidence of melanoma (429). MC1-R is also a target for other regulatory proteins. For example, the agouti signaling protein (ASP), which is expressed in skin, inhibits the binding of ␣-MSH to MC1-R, with resulting inhibition of MSH-stimulated cAMP production and melanogenesis (cf. Refs. 88, 171, 251, 257, 397, 401). ASP also acts as antagonists to the other MC receptors, MC2-R to MC5-R (cf. Refs. 88, 171, 251). ASP bound to MC1-R can inhibit cAMP-mediated activation and melanogenesis, independently of exogenously added ␣-MSH (171, 257, 401). Because signal transduction in MC1-R is coupled to Gs but not Gi protein, ASP could antagonize auto- or intracrine effects of endogenously produced MSH or ACTH. Alternatively, binding of ASP to MC1-R could generate changes in the receptor immediate environment that would activate other, unrelated receptors. Agouti-related protein (AGRP), which shares sequence homology with ASP, is a naturally occurring antagonist of MC3 to MC5 receptors that may be involved in the hypothalamic control of feeding behavior (452). AGRP probably acts through competitive inhibition of ␣-MSH binding to MC3 to MC5 receptors and inhibition of ␣-MSHinduced cAMP production (452). Additional antagonists of MC receptors are dynorphin peptides (313). 2. Regulation of MC-R expression Several years ago Pawelek et al. (283) proposed that UVB-induced melanogenesis was mediated through upregulation of the MSH receptor system. This was based on observations of upregulated expression of functional MSH receptors by UVB that amplified the melanogenic effect of exogenous MSH in a dose-dependent manner both in vivo and in cell culture systems (31, 38, 40, 48, 64, 68, 71, 283, 378). UVB action appeared to involve arrest of Downloaded from http://physrev.physiology.org/ by 10.220.33.6 on July 4, 2017 1. Molecular characterization of melanocortin receptors 999 1000 SLOMINSKI, WORTSMAN, LUGER, PAUS, AND SOLOMON B. Opioid Receptors Most recently expression of -opioid receptors that bind with high-affinity -endorphin was detected in cultured human epidermal keratinocytes (30). In human skin, in situ hybridization and immunocytochemistry has shown that the receptors are localized to keratinocytes of the epidermis and ORS of the hair follicles and to peripheral epithelial cells of sebaceous glands and secretory portion of sweat glands (30). The expression of -opiate receptors was downregulated by both the antagonist naltrexone and the agonist -endorphin (30). Presence of the related -opioid receptor has been documented in human and mouse skin (453). Furthermore, -endorphin acts as a local pain modulator (148). C. Phenotypic Effects of POMC Peptides 1. Pigmentary system The stimulatory role of melanocortins on mammalian pigmentation has been discussed extensively (101, 126, 141, 155, 161, 171, 201, 203, 213, 244, 257, 284, 336, 352, 374). There is a general agreement that the POMC pep- tides with the most significant melanogenic activity are ACTH, ␣-MSH, and -MSH; the activity of ␥-MSH is low, and that of endorphins and CLIP is undetectable (101, 141, 161, 236, 257, 358, 400). Structurally ACTH and MSH peptides have in common the amino acid sequence -Tyrx-Met-x-His-Phe-Arg-Trp- that contains the tetrapeptide His-Phe-Arg-Trp critical for melanotropic activity (141, 160). The functional relevance of -MSH in mammals has been debated, since some considered it an artifact of -LPH proteolytic degradation (343). However, Bertagna et al. (26) have demonstrated convincingly that -MSH is a normal product of POMC processing in human nonpituitary tissues. -MSH stimulates melanogenesis in cell culture and skin pigmentation in humans (202, 400) and rodents (101, 201, 244, 279, 306). ␥-MSH peptides have low melanogenic activity in murine and hamster malignant melanocytes (358) as well as in frog and lizard melanophores (101, 141, 257). Although the overall role of ␥-MSH peptides in the regulation of mammalian pigmentation may be small, selected ␥-MSH peptides could still modulate pigmentation indirectly, by modifying the cellular response to other melanotropins. For example, ␥2-MSH may potentiate the melanogenic activity of ␣- or -MSH, whereas ␥3-MSH, acting as a partial agonist on MSH receptors, can largely inhibit the melanogenic activity of ␣or -MSH (358). A) MELANOGENIC EFFECTS IN CELL CULTURES. Studies on rodent malignant and normal melanocytes have uncovered the role of MSH receptors in the regulation of melanocyte functions via cAMP-dependent pathways (101, 141, 155, 201, 244, 257, 278 –286, 366). Melanogenesis is a highly regulated process modified by posttranslational, translational, or transcriptional mechanisms (101, 141, 244, 257, 279). In melanoma cells, both ␣- and -MSH stimulate melanogenesis activating tyrosinase as well as post-dopa oxidase steps (101, 141, 257, 281, 283). In rodent malignant melanocytes, ␣-MSH and -MSH are more potent than ACTH in stimulation of melanogenesis (101, 244, 279). The effect of MSH on cell proliferation is variable and depends on cellular genotype (101, 161, 244, 257, 277–279, 284, 285, 287, 288, 352). The finding of inhibition of proliferation in amelanotic cells indicates that this effect is unrelated to production of toxic intermediates of melanogenesis (244, 279, 366). MSH stimulates dendrite production through a pathway independent from that regulating melanogenesis, although cAMP mediated (257, 366, 367). Similar MSH effects, e.g.., stimulation of melanogenesis, dendrite formation, and stimulation of cell proliferation, are seen in normal cultured mouse melanocytes (141, 155, 257). In cultured human melanocytes, ␣-MSH, -MSH, and ACTH at concentrations in the nanomolar range or lower stimulate melanogenesis, cell proliferation, dendrite formation, and cAMP production (1, 161, 400). In some studies ACTH was more potent than MSH (161), whereas in Downloaded from http://physrev.physiology.org/ by 10.220.33.6 on July 4, 2017 the cell cycle at the G2 phase, when cultured rodent melanocytes express maximal MSH receptor activity and responsiveness to MSH (64, 283). UVB stimulates expression of MC1-R in normal and malignant human and rodent melanocytes and in keratinocytes (38, 64, 68, 71, 119, 120, 378). When the skin is exposed to UVR, thermal, chemical, or biological insults, it responds with enhanced production of cytokines, growth factors, ACTH, MSH, and intermediates of melanogenesis (365, 378). In normal and malignant melanocytes, many cytokines such as Il-1␣, IL-1, endothelin-1, adult T-cell leukemia-derived factor/thioredoxin (ADF/TRX), INF-␣, INF-, INF-␥, dibutyryl cAMP, and the hormones ␣-MSH, -MSH and ACTH can upregulate expression of the MC-1 gene and of functional cellsurface MSH receptors (31, 64, 67, 70, 71, 95, 119, 120, 175, 176, 400). IL-1 can also stimulate MC-1 receptor expression in normal and malignant human keratinocytes (31, 64) and HDMEC (341, 342). ␣-MSH, -MSH, and ACTH as well as factors raising intracellular cAMP have similar effects in transformed keratinocytes (31) and HDMEC (341, 342). Melanin precursors such as L-tyrosine and phosphorylated isomers of L-DOPA also stimulate expression of MSH receptors and melanogenic responsiveness to -MSH (233, 364, 377). Retinoic acid, while stimulating MSH receptor expression, inhibits MSH-induced melanogenesis (69, 265). In addition, retinoic acid and vitamin E inhibit MSH-sensitive adenylate cyclase activity in mouse melanoma cells (328). TNF-␣ inhibits MC1 expression in melanocytes (119). Volume 80 July 2000 CRH-POMC SIGNALING IN A CUTANEOUS STRESS RESPONSE 2. Epidermis Since the detection of MSH binding sites in cultured human squamous cell carcinoma and immortalized keratinocytes (31, 65), several groups, with a single exception (400), have shown that human keratinocytes express both the MC1-R gene and MSH receptors (35, 47, 48, 64 – 66, 220, 264, 363). Moreover, the MSH receptor protein expressed on the cell surface of keratinocyte is similar to that characterized in pigment cells (65). Experiments in HaCaT keratinocytes showed that ␣-MSH stimulates cell proliferation and downregulates 70-kDa heat shock protein (HSP70) expression (264). ␣-MSH inhibition of HSP70 expression was only observed at high calcium concentrations when keratinocytes were induced to differentiate, and it was accompanied by increased sensitivity to oxidative stress and decreased survival (264). In agreement with that finding is the enhanced MC1-R gene expression associated with calcium-induced epidermal keratinocyte differentiation (64). Further studies in keratinocytes showed that ␣-MSH can modulate cytokine production (47, 48, 220, 314). Specifically, ␣-MSH stimulates production of the immunoinhibitory IL-10 and inhibits the IL-1induced production and secretion of IL-8 and GRO␣. It has been proposed that ␣-MSH inhibition of IL-1 effects is mediated by downregulation of NFB (219). In human adult skin, epidermal keratinocytes are negative for MC1-R antigen, with the exception of perilesional keratinocytes of the skin involved by melanoma (35). In contrast, epidermal keratinocytes in fetal skin are positive for the MC1-R (35). A role for ACTH on epidermal keratinocyte function is unclear, although clinically ACTH has been implicated in the pathogenesis of acanthosis nigricans (113, 137). ␥1-, ␥2-, and -MSH at the high concentration of 10⫺6 M stimulate mouse epidermal keratinocyte proliferation in organ culture of telogen skin, but not in anagen skin (370, 375). -MSH inhibits epidermal keratinocyte proliferation in anagen IV (370, 375), whereas ␣-MSH shows the same inhibitory effect on telogen skin (273). ACTH at high concentrations inhibits DNA synthesis in epidermal keratinocytes (356). The finding of increased -endorphin levels in sera of patients with atopic dermatitis and psoriasis (125, 135, 136) has suggested a pathogenic role for the peptide in those conditions. Actual -opiate receptors, downregulated by -endorphin, have been detected in epidermal and follicular keratinocytes (30). Also the -opiate receptors antagonist naloxone can relieve itching in patients with chronic liver diseases, but it is unclear whether the effect is exerted at the cutaneous or systemic levels (24). 3. Dermis Human dermal fibroblasts have been recently recognized as a target for ␣-MSH (36, 191). Thus ␣-MSH stimulates synthesis and activity of collagenase/matrix metalloproteinase-1 in a dose-dependent manner (191). ␣-MSH alone stimulates IL-8 release; however, when added together with IL-1, it inhibits the IL-1-induced IL-8 secretion from fibroblasts (36). These effects may be mediated by Downloaded from http://physrev.physiology.org/ by 10.220.33.6 on July 4, 2017 other reports both peptides were equipotent (1, 400). ␥-MSH, which stimulates cAMP production, has no significant effect on melanogenesis or proliferation when added alone at concentrations equal to or lower than 100 nM in human or rodent melanocytes (400). Among the effects of ␣-MSH and ACTH on melanogenesis are increases in concentration of tyrosinase and tyrosinaserelated proteins (1, 400, 401) and in the eumelanin-topheomelanin ratio (161). ␣-MSH can also stimulate attachment of human melanocytes to laminin and fibronectin (161) and inhibit TNF-␣-stimulated intercellular adhesion molecule-1 expression in normal and malignant human melanocytes (149, 246). Mutations in MC1 receptor that produce unresponsiveness of epidermal melanocytes to MSH have resulted in the red hair phenotype (257, 428). B) MELANOGENIC EFFECTS IN VIVO. In rodents, application of ␣-MSH stimulates melanogenesis or switches pheomelanogesis to eumelanogenesis (cf. Refs. 88, 101, 126, 140, 141, 257, 405). In several strains of adult mice as well as in Siberian hamsters, ␣-MSH specifically stimulates follicular melanogenesis, depending on genotype and hair cycle (53, 54, 88, 126, 140, 141, 203, 213, 257). For example, e/e mice are not responsive to MSH propigmentary action (405). ␣-MSH stimulates tyrosinase activity at the transcriptional, translational, or posttranslational level depending on the phase of hair cycle (53, 54, 101, 126, 141, 257). This is consistent with the hair cycle restricted expression of melanogenesisrelated genes, protein concentration, and enzymatic activity (368, 369, 373). -MSH also stimulates tyrosinase activity, as observed in skin of newborn Syrian golden hamsters as well as black and brown mice (306), and has actual melanogenic activity in adult guinea pigs and hairless mice (38, 39). Overall, the promelanogenic effect of MSH peptides has been documented in a number of species (88, 101, 126, 141, 257). In humans, the systemic administration of ␣- and -MSH or ACTH stimulates skin pigmentation (202). Subcutaneous application of ␣-MSH enhances tanning in sunexposed areas of the skin (204), whereas the skin and hair pigmentation of patients with Addison disease or Nelson syndrome is related to increased concentration of circulating ACTH (101, 113, 137, 257). Furthermore, increased skin pigmentation has been described in a patient having increased ␣-MSH hypersecretion without adrenal failure (289). In most patients with ACTH/␣-MSH excess, hyperpigmentation is generalized but most prominent in sunexposed areas. 1001 1002 SLOMINSKI, WORTSMAN, LUGER, PAUS, AND SOLOMON whereas melanocortins such as -MSH and ␥-MSH, which require the expression of other MC receptors, exhibit less pronounced immunomodulatory activity. It is not yet clear whether MC-1R expressing immunocytes are also affected by agouti protein. Acting on vascular endothelial cells ␣-MSH directly stimulates the adherence and transmigration of inflammatory cells, a prerequisite for immune and inflammatory reactions. This effect could be mediated through the expression of adhesion molecules such as E-selectin and VCAM (see above). E-selectin is required for the rolling of cutaneous lymphocyte-associated antigen (CLA)-expressing lymphocytes and VCAM, which mediates lymphocyte flattening and transmigration, is the ligand for VLA-4 expressed on lymphocytes (133, 156). Therefore, ␣-MSH could influence the outcome of a local immune response by shifting the expression of adhesion molecules. However, in ongoing inflammatory reactions characterized by the upregulation of proinflammatory cytokines, ␣-MSH seems to function as a downregulatory signal. An important example of the immunosuppressive capacity of ␣-MSH is demonstrated by its effect on the outcome of the contact hypersensitivity (CHS) reaction (Fig. 8). Thus administration of ␣-MSH, systemic or topi- 4. Immune system The POMC peptides -endorphin, ACTH, and ␣-MSH have strong immunomodulating potential resulting in an overall immunosuppressive effect (32, 33, 111, 209, 269, 346). The melanocortin ␣-MSH seems to have the widest spectrum of immunomodulating capacities. Human and murine monocytes as well as macrophages express MC1-R, and LPS and mitogens enhance its expression on monocytes, whereas several cytokines are without effect (28, 312, 390). When cultured in the presence of granulocyte-macrophage colony-stimulating factor, IL-4, and monocyte conditioned medium, human peripheral bloodderived dendritic cells express MC-1R with the highest levels in the fully mature cells (21, 22). It must also be noted that whereas POMC peptides affect the function of T, B, and NK cells, it is not yet clear whether these cells express any of the known MC receptors. MC1-R is nevertheless expressed on cells of the monocytic lineage and on cells involved in the modulation of immune and inflammatory responses such as neutrophils, mast cells, endothelial cells, keratinocytes, and endothelial cells (34, 36, 47, 63, 147, 304). The MC1-R ligands ␣-MSH and ACTH affect the function of cells involved in immunoregulation, FIG. 8. ␣-MSH applied topically prevents nickel-induced contact dermatitis. On day 0, ␣-MSH cream (100 M) (left) or placebo (cream only) (right) was applied in an occlusive dressing for 2 h. Afterwards, a patch test with nickel at concentrations 0, 0.01, 0.1, 1, and 5% was performed. The skin was inspected and photographed 2 days later. Pretreatment with ␣-MSH inhibited the erythematous response to nickel. Downloaded from http://physrev.physiology.org/ by 10.220.33.6 on July 4, 2017 its effects on AP-1 and NFB function. Thus ␣-MSH directly activates AP-1, but it inhibits IL-1-induced AP-1 activation and stimulates NFB, without affecting IL-1induced DNA binding (36). These effects may be mediated by MC1-R, because this receptor is expressed on skin fibroblasts (36). HDMEC also express functional MC1-R as detected by molecular probing for gene expression, by binding of 125 I-labeled ␣-MSH, and by the stimulation of cAMP production by ␣-MSH (341, 342). ␣-MSH also stimulates in a dose-dependent manner the production and secretion of IL-8 and GRO␣, being synergistic with TNF-␣ and IL-1 (342). These effects appear to be dependent on cAMP production and activation of PKA. Thus ␣-MSH may play a crucial role on endothelial cell function, decreasing the adherence and transmigration of inflammatory cells, a prerequisite for immune and inflammatory reactions. There is evidence on HDMEC that ␣-MSH, which by itself upregulates the expression of E-selectin and vascular cell adhesion molecule (VCAM) mRNA, inhibits the LPS-mediated upregulation of these adhesion molecules (172– 174, 220, 221). These findings were confirmed at the protein level and the functional level by adhesion assays using T lymphocytes and cultured human dermal microvascular endothelial cells (172, 174). ␣-MSH, although capable of activating NF-B by itself on endothelial cells, blocks completely the LPS- or IL-1-mediated NFB activation (172–174). These findings suggest that ␣-MSH modulates the activity/availability of a transcription factor required for VCAM and E-selectin activation. Volume 80 July 2000 CRH-POMC SIGNALING IN A CUTANEOUS STRESS RESPONSE would be in allergic diseases such as contact dermatitis (see Fig. 8), atopic dermatitis, asthma, autoimmune diseases, and organ transplantation. In contrast, cutaneous tumors may be associated with overproduction of POMC peptides, which may represent a mechanism for escape from immune surveillance (127–129, 223, 353, 363, 367). In these cases, neutralization of ␣-MSH could represent a useful approach. In addition to causing skin damage, UVR is associated with cutaneous and systemic immunosuppression (220, 378). Thus UVR impairs the function of epidermal immunocompetent cells such as Langerhans cells and induces the production of immunosuppressing cytokines. In the preceding sections we reviewed the stimulatory effect of UVR on the cutaneous production of POMC peptides and on expression of MC1-R by skin cells. These data in conjunction with expression of functional MC1-R on immune cells implicate POMC-MC1-R axis as an important coordinator in the response to UVR. Such effect addressed probably at attenuating the UVR-induced inflammatory reaction could be exerted directly or indirectly. In the latter, UVR-stimulated ␣-MSH expression would induce production of immunosuppressive factors, resulting in local (skin) and systemic immunosuppression (220, 378). 5. Hair Hypertrichosis is a process whereby a minute, nonpigmented vellus hair follicle (HF) is converted into a large terminal HF that produces strong, pigmented hair shafts. To some extent this process may, at least in part, reflect a change in HF cycling, since hypertrichotic HF have a substantially longer anagen phase than the original vellus HF (cf. Ref. 272). In humans, overproduction of ACTH, e.g., by pituitary tumors or therapeutic administration of ACTH, is a well-recognized cause of acquired hypertrichosis (272, 444). This induction of hypertrichosis by ACTH provides circumstantial evidence that the neuropeptide may stimulate and/or prolong anagen. ␣-MSH may also have a role in the regulation of hair growth, since ␣-MSH receptors have been detected in the human HF (273). In minks and weasels, the effect of POMC peptides on hair growth has been the subject of detailed studies (cf. Refs. 126, 272). Thus it has been observed that hypophysectomy prevents the spontaneous onset of molting, an effect corrected by exogenous ␣-MSH or ACTH (325, 326). Furthermore, in the mink, bilateral adrenalectomy causes a sharp rise in pituitary ACTH release and premature onset of anagen (322, 324). In fact, hair growth in mink can be induced directly by intracutaneous injection of ACTH, but not ␣-MSH (323) (Fig. 9). In the C57BL6 mouse, ACTH has a bimodal hair cycle-dependent effect on hair growth, e.g., intracutaneous injection of ACTH in Downloaded from http://physrev.physiology.org/ by 10.220.33.6 on July 4, 2017 cal, suppresses CHS at both the elicitation and sensitization phases (138, 153, 209, 315, 349). In addition, when ␣-MSH is applied before epicutaneous sensitization with haptens, it induces tolerance, which is hapten specific, since animals can be still sensitized with other antigens. The induction of hapten-specific tolerance by ␣-MSH may be mediated by IL-10, because it is blocked by administration of anti-IL-10 antibodies (138). Furthermore, in the mouse, a single intravenous ␣-MSH injection results in significant elevation of IL-10 plasma levels lasting for more than 2 wk (220). Another mechanism involved in ␣-MSH tolerance induction may be its downregulatory effect on the expression of accessory molecules such as CD86 and CD40 on antigen-presenting cells (21, 22, 28). Therefore, ␣-MSH may impair the function of antigen presenting cells (APC) and shift the outcome of an immune response toward tolerance acting directly as well as via IL-10 induction. The notion that ␣-MSH interferes with the function of APC has received support from experiments with Langerhans cells prepared from normal murine skin. The cells were treated in vitro with ␣-MSH derivatized with dinitrofluorobenzene (DNFB) and then used to induce CHS in naive syngeneic mice. Treatment with ␣-MSH impaired Langerhans cell ability to induce CHS but failed to induce tolerance, suggesting that additional pathways are responsible for antigen tolerance induction (89); thus a second application of the allergen induces production of proinflammatory cytokine IL-1 which upregulates the expression of adhesion molecules on endothelial cells. Pretreatment with ␣-MSH before challenge downregulates the expression of adhesion molecules on endothelial cells (172). Therefore, inflammatory cells required for the CHS reaction are unable to adhere and penetrate through the vessel wall, and CHS is suppressed. These findings suggest a therapeutic role for ␣-MSH in cutaneous immune responses. There is evidence from several studies indicating that most of the anti-inflammatory effects of ␣-MSH are exerted by its NT tripeptide (209, 210). This tripeptide can actually compete with ␣-MSH for MC-1R binding and, by itself, induces IL-10 production by monocytes as well as downregulates CD86 expression (29). In vivo the NT MSH tripeptide is capable of blocking the induction as well as the elicitation of CHS, similar to the intact ␣-MSH molecule. In addition, epicutaneous application of the tripeptide at the site of sensitization suppresses the elicitation of CHS and induces tolerance (220). Therefore, topical application of these tripeptides, of ⬃350 Da molecular mass, and thus capable of penetrating the epidermis, may represent a novel approach for the treatment of allergic and inflammatory skin diseases. ␣-MSH as well as its NT tripeptide can apparently serve as antagonist of proinflammatory signals and thereby downregulate immune and inflammatory responses. Therefore, its major therapeutical potential 1003 1004 SLOMINSKI, WORTSMAN, LUGER, PAUS, AND SOLOMON Volume 80 6. Sebaceous glands FIG. 9. ACTH induces anagen development in minks. Minks were injected intradermally with ACTH (A: arrows) or with ␣-MSH (B: arrows). The contralateral hip of each mink was injected with solvent control (PBS). [From Rose (323), with permission from Blackwell Science, Inc.] telogen skin induces anagen development (275), whereas in anagen skin it induces the premature onset of catagen (228). The C57BL6 mouse has been also studied as a model for the effect of POMC peptides on hair growth (228, 273, 275, 356, 370, 371, 375). In mice, hair growth is synchronized along three developmental stages: resting (telogen), growth (anagen), and regression (catagen) (272, 368). The anagen follicle produces the hair shaft formed by pigmented, keratinized epithelial cells. Hair growth and the cyclic activity of the hair follicle are timed by a “biological clock” of unknown nature through as yet ill-understood tissue interactions. In rodents, the cyclic activity of hair follicles is accompanied by periodic changes in the physiology of the entire skin (cf. Refs. 272, 368). These are expressed morphologically as skin thickening, increased vascularization, and skin pigmentation. The cyclic activity of hair is coupled to cyclic changes in local immune system (272, 273); in the pigmentary system (368, 369, 373); in POMC expression, production of POMC peptides, ACTH, ␣-MSH, and -LPH influence sebaceous gland function (412). In the rat, ACTH has sebotropic activity that has been explained by its stimulation of adrenal androgens and progesterone secretion, since adrenalectomy completely inhibits this sebotropic effect. Also in rodents ␣-MSH stimulates sebum secretion and lipogenesis in cutaneous sebaceous glands and in specialized pheromone-producing preputial glands acting as trophic factor for those glands. ␣-MSH action on the preputial glands of rodents stimulates production and release of female sex attractant odors and of male aggression-promoting pheromones (412). ␣-MSH specifically stimulates wax and sterol ester biosynthesis (79, 412). It has been postulated that the sebotropic activity of ␣-MSH and ACTH is mediated by a peptide sequence different from the melanotropic one (412). In rodents, ␣-MSH and perhaps ACTH may be important for skin thermoregulation, preventing overwetting of hairs, and by behavior regulation through their action on nonspecialized and specialized sebaceous glands (412). MC5-R that are fully functional are actually expressed in cutaneous sebaceous and preputial glands and in Harderian and lacrimal glands (79, 431). In the latter, melanocortin binding sites have been detected and ACTH and ␣-MSH stimulate lacrimal protein production and peroxidase secretion (79, 431). ACTH also stimulates porphyrins synthesis by Harderian glands (79). MC5-R-deficient mice have severely defective cutaneous water repulsion and thermoregulation, from impaired sebaceous Downloaded from http://physrev.physiology.org/ by 10.220.33.6 on July 4, 2017 and expression of MC1-R (104, 122, 356, 360, 370, 371); and in hair follicle innervation (276). It has been proposed that the hair cycle-dependent local production of POMC and expression of the corresponding receptors are integral effectors of the biological clock that regulates cyclic activity of hair follicles, skin, and subcutis. In this context POMC peptides imported from extracutaneous sources may have limited effects because of competition for local receptors with endogenous peptides; therefore, any effect(s) of systemic supplies would be restricted to the phases when local production is low or absent. For example, ␥- and -MSH at pharmacological doses stimulate DNA synthesis in the epidermal compartment of mouse skin (370, 375). However, this effect is seen only in telogen but not during anagen development. Furthermore, pharmacological doses of ␣-MSH inhibit proliferation of epidermal and follicular keratinocytes, but again only in telogen and not anagen skin (273). ACTH also acts in telogen skin, where it has a dose-dependent dual effect, e.g., at physiological doses it stimulates DNA synthesis in dermal but not epidermal compartments, whereas at pharmacological doses ACTH inhibits DNA synthesis in both dermal and epidermal compartments (356). July 2000 CRH-POMC SIGNALING IN A CUTANEOUS STRESS RESPONSE lipids production (79). In the MC5-R knock-out mice, Harderian gland function is also impaired (79), suggesting a role for MC5-R in the protection of the eye from environmental stresses. In humans, it is likely that MSH and ACTH peptides act on sebaceous glands functions, since hypopituitarism is associated with decreased sebum production (137). VIII. REGULATION OF THE CUTANEOUS CORTICOTROPIN RELEASING HORMONEPROOPIOMELANOCORTIN SYSTEM UVR also has a dominant stimulatory role on CRH and POMC peptide production as well as in the expression of the corresponding receptors amplifying the phenotypic effects of MSH. Thus UVR stimulates CRH peptide production in human melanocytes in a dosedependent manner with increased production at higher levels of radiation (355). UVR also stimulates POMC gene expression with enhanced production and secretion of POMC peptides such as ACTH, ␣-MSH, -LPH, and -endorphin in a number of rodent and human cutaneous cell systems (48, 64, 67, 71, 96, 219 –221, 337, 341, 342, 446). Also stimulated by UVR is the expression of prohormone convertase PC1, responsible for the processing of both pro-CRH and POMC (341). Recent data suggest that UVRstimulated CRH and POMC peptide production may be mediated by UVR-triggered oxidative stress (64, 67, 378). Thus the powerful cutaneous stressor represented by UVR stimulates all of the components of the regulatory arm (production of CRH and POMC peptides) in the local CRH-POMC system. In addition, UVR activates the functional arm of the system by inducing expression of the corresponding receptors. The latter effect is illustrated by the stimulation of MC1-R mRNA with increased expression of functional MSH receptors that follows, in a dosedependent manner, UVR exposure (38, 64, 68, 71, 119, 120, 378). The UVR stimulatory effect on functional MSH receptors has been correlated with amplification of the melanogenic effect of MSH peptides in number of cell culture systems (31, 38 – 40, 64, 68, 71, 283); it is also seen in vivo, where it is associated with melanocyte proliferation (38, 39, 378). B. Cytokines These secretory products of the skin immune system (SIS) also regulate cutaneous CRH-POMC system activity. The cytokine IL-1 has significant stimulatory effects on POMC gene expression and on the production of POMCderived ACTH, ␣-MSH, and -LPH peptides by resident skin cells and circulating immune cells (27, 32, 33, 67, 219 –221, 337, 341, 342, 445, 446). There is parallel stimulation of PC1 gene expression (340, 341), and IL-1 also stimulates MC1-R expression (31, 64, 119, 220, 341, 342). Another cytokine, TNF-␣, stimulates POMC gene expression in dermal fibroblasts (408); TGF- has the opposite effect, inhibiting POMC gene expression in the same cell system and in keratinocytes (408). Other related products such as endothelin-1, ADF/TRX, INF-␣, INF-, and INF-␥ can also stimulate the expression of functional MSH receptors on melanocytes (31, 64, 70, 71, 95, 119, 120, 175, 176, 400). Thus, similar to UVR, the SIS also participates, through the opposing action of selected cytokines, in the regulation of local expression of POMC and its corresponding receptors. C. Hair Cycle In rodents, this cyclic process is characterized by dramatic changes in skin physiology, with variations in CRH content, expression of the POMC gene, production of POMC peptides, expression of CRH-R1 and MC1-R receptors, and expression of PC1 and PC2 convertases (104, 122, 230, 273, 321, 356, 360, 368). Thus the local pacemaker that determines the hair cycle also determines, directly or indirectly, the expression of the CRHPOMC system in rodent skin (104, 272, 273, 276, 356, 360, 368, 371, 372, 376). The effector messengers regulating cyclic follicular activity remain to be defined (104, 272, 273, 276, 368, 376). D. Disease States In normal corporal human skin (whole body except scalp and face), expression of the POMC gene is low or below the level of detectability (214, 381). In contrast, gene expression becomes readily detectable in pathological conditions such as keloids, psoriasis, basal and squamous cell carcinomas, vitiligo, and melanomas (127, 131, 135, 211, 212, 255, 363, 381). Most interestingly, malignant progression of pigmented lesions is accompanied by increased expression of POMC peptides in the atypical melanocytes of dysplastic nevi or melanoma (211, 255, 381). Concordantly, increased production of POMC peptides is found in the more advanced and aggressive forms of melanoma (127, 128, 131, 250, 353, 367, 457). Thus disease process can stimulate cutaneous POMC gene expression. E. Cellular Metabolism Mediators Factors that raise intracellular cAMP levels such as dibutyryl cAMP, forskolin, and MSH stimulate production of Downloaded from http://physrev.physiology.org/ by 10.220.33.6 on July 4, 2017 A. UVR 1005 1006 SLOMINSKI, WORTSMAN, LUGER, PAUS, AND SOLOMON CRH and of POMC-derived peptides in skin cells (64, 67, 341, 361). In addition, dibutyryl cAMP and the hormones ␣-MSH, -MSH, and ACTH stimulate expression of the functional cell surface MSH receptors in melanocytes, keratinocytes, and dermal microvascular endothelial cells (31, 64, 70, 71, 95, 119, 120, 175, 176, 341, 342, 400); in the latter, phorbol 12-myristate 13-acetate and TPA enhance POMC gene expression (219, 220, 337, 446). Together these observations suggest that PKA and PKC mediate significant regulatory pathways in cutaneous CRH-POMC system. F. Glucocorticoids IX. PHYSIOLOGICAL SIGNIFICANCE OF CUTANEOUS PRODUCTION OF CORTICOTROPIN RELEASING HOMRONE AND PROOPIOMELANOCORTIN As noted above, local production of CRH and POMC and corresponding receptors expression can occur in response to environmental stimuli that do not reach the brain (e.g., UVR). This evidence strongly implies that cutaneous production of these peptides, and their effect on skin function may be regulated independently from their systemic counterpart. The effects of the CRH/POMC responses are cell-compartment and function specific. For example, CRH and related peptides stimulate intracellular calcium accumulation in malignant melanocytes and in normal and malignant keratinocytes and affect cell proliferation (109, 186 –188, 357, 379). CRH action is nevertheless modified by a timing component, since implantation of slow-releasing CRH capsules in the vicinity of HF with the telogen phase will effectively arrest hair cycle progression, producing an extended telogen phase (273). Overall, peripheral CRH acts as a growth factor for the epidermis and HF, has antiedema effects, and is a vasodilator agent potentially enhancing blood flow through dermis acting on the vascular smooth muscle and endothelium (19, 86, 114, 116, 134, 316, 320, 338, 422, 440). CRH could be important for local hemostasis, since it inhibits IL-1-induced prostacyclin and prostaglandin synthesis (114, 116). It is also considered an immunomodulatory factor (9, 134, 142, 237, 268a, 305, 334, 335, 418, 430, 440), consistent with its ability to induce mast cell degranulation (409). With regard to the POMC peptides MSH and ACTH, these stimulate epidermal and follicular melanogenesis, melanocyte proliferation, and modify immune and secretory functions of pigment cells (cf. Refs. 64, 101, 126, 141, 149, 161, 202, 220, 365, 374, 376, 445). ACTH, -endorphin, and especially ␣-MSH are strong immunomodulators exerting an overall immunosuppressive effect (32, 33, 111, 209, 220, 269). For example, ␣-MSH can function as an antagonist of IL-1 and induce production of immunosuppressive cytokines while suppressing the expression of accessory molecules on APC (22, 28, 58, 138, 147, 219, 220, 254, 314). Of clinical significance, ␣-MSH and its NH2terminal tripeptide can prevent the induction of the contact hypersensitivity reaction and even block its elicitation (138, 153, 209, 220, 315, 349). ␣-MSH has already been used successfully for the treatment of contact dermatitis (Fig. 8). MSH affects epidermal keratinocyte proliferation stimulating cell differentiation and differentially modulates cytokine production (cf. Refs. 64, 220, 264, 273, 314, 370, 375). ACTH stimulates hair growth by inducing anagen development (Fig. 9) (273, 275, 322, 323). The MC5-R knock-out mice model, which has defective sebaceous gland function and thermoregulation (79), provides further evidence for the role of ACTH/MSH in those functions (79, 412, 431). ␣-MSH has a regulatory role in rodent nonspecialized and specialized sebaceous gland function; it stimulates lipogenesis and sebum secretion as well as production and release of female sex attractant odors and male aggression-promoting pheromones (79, 412, 431). Finally, MSH stimulates dermal fibroblast collagenase production and secretion as well as cytokine production (36, 191, 220). In summary, cutaneous POMC peptides have marked effects on the pigmentary, immune, epidermal, adnexal, and dermal functions of the skin, enhancing melanogenesis, stimulating cellular differentiation, stimulating hair growth and sebaceous gland functions, and attenuating inflammatory reactions. X. HYPOTHESIS ON AN ORGANIZED SYSTEM MEDIATING SKIN RESPONSES TO STRESS A. Hypothesis The findings in the skin of CRH/CRH-like peptides, POMC peptides, and their corresponding receptors strongly advocate against random occurrence (Fig. 10). Rather, similar to the central levels, expression of these elements is highly organized. The functional purpose of this CRH/POMC system would be to respond to external and internal stresses through local pigmentary, immune, epidermal, adnexal (HF and sebaceous, eccrine, and apoccrine glands), and vascular structures to stabilize skin function and prevent disruption of internal homeostasis. This skin stress response system (SSRS) has Downloaded from http://physrev.physiology.org/ by 10.220.33.6 on July 4, 2017 Dexamethasone inhibits CRH production in cultured human skin cells and attenuates POMC gene expression in rodent skin (104, 361). Dexamethasone also inhibits expression of the MC1-R gene in rodent skin (104), and it terminates anagen-associated melanogenesis by inducing catagen (104, 274, 372). Thus, in analogy with their central action, glucocorticoids attenuate the local CRH/POMC system activity. Volume 80 July 2000 CRH-POMC SIGNALING IN A CUTANEOUS STRESS RESPONSE 1007 the capacity to regulate its level of expression independent of the CNS. The SSRS operates at the cellular, tissue, and organ level via a combination of intra-, auto-, and paracrine mechanisms (Fig. 10). Because of the differences in skin structure between furry animals and humans, as well as the nature of the predominant stress reaching the viable portion of the skin, the operational organization of the local CRH-POMC system has characteristic species specificity. In humans, the SSRS is most reactive to solar radiation and thus linked to the pigmen- tary system; in rodents (mostly nocturnal animals), the SSRS is more reactive to chemical insults and coupled to the activity of adnexal structures. B. Background to the Organization and Function of the SSRS Physiologically, the skin is the body organ with the most extensive exposure to the environment; as such, it Downloaded from http://physrev.physiology.org/ by 10.220.33.6 on July 4, 2017 FIG. 10. Diagramatic presentation of cutaneous CRH/ POMC system. A: cutaneous sites of CRH and POMC peptide production. B: cutaneous sites of CRH and POMC receptor expression. C: scheme of CRH/POMC function in the response to injury, through para- and autocrine mechanisms. 1008 SLOMINSKI, WORTSMAN, LUGER, PAUS, AND SOLOMON C. Functional Organization of SSRS When the normal integrity of the skin is disrupted, it is most important to restrict maximally the consequent biological reaction, to preserve its functional properties. The actions of the CRH-POMC system at the cellular level prevent spreading of the field of stress. Within this context, the space-restricted paracrine, autocrine, and intracrine mechanisms of action are critical for limiting tissue damage. Expression of truncated products lacking the signal peptide that would allow easy export from the cell would also ensure that the effect would be localized to structures in the immediate vicinity of manufacturing sites. The SSRS immunosuppressive activity decreases recruitment of local immunocytes; local immunoglobulin and cytokine production would abate, and local dermal capillary permeability would return to basal levels. Most important in this conception is the timing of the functional sequence, since CRH-POMC activation must follow the primary reactive mechanisms. It is possible that the full expression of CRH-POMC effects may require the presence of stress-dependent products acting as potential cofactors. An effect of stress-released molecules acting as cofactor for CRH-POMC phenotypic effects is supported by, for example, the finding of pigmentation restricted to the solar radiation-exposed areas in patients with adrenal destruction (Addison disease) or with tumoral pituitary ACTH hypersecretion (Nelson syndrome). CRH/POMC molecules similar to those produced in the skin are being released continuously by the HPA axis and are likely to influence skin function. However, some degree of cutaneous insensitivity to CRH-POMC peptides of central origin may result from local impermeability or in situ degradation of peptides. In contrast, an opposite endocrine central effect from the low constitutive activity of the CRH-POMC skin system would seem less likely. Thus, when the intensity of skin damage is major, by the time the extent of local involvement might release a large amount of POMC peptides that could spill into systemic circulation, the systemic reaction to stress via the central HPA axis would have been already activated. Therefore, peripheral contribution to the acute systemic response to stress would be insignificant. Nevertheless, we cannot exclude the possibility that in this setting, as well as in pathological conditions resulting in chronic, sustained CRH/POMC skin overproduction, the same molecules could serve a different role as messengers of cutaneous distress. The latter function might be accomplished directly by the hormonal products themselves, or indirectly by stimulating ascending neural pathways. We thank Drs. Z. Abdel-Malek, T. Kishimoto, E. Linton, J. Pawelek, J. Roberts, and E. Wei for their valuable comments. The excellent secretarial work of T. Hermann is acknowledged. This work was supported by National Science Foundation Grants IBN-9896030, IBN-9604364, and IBN-9405242; American Cancer Society, IL Division, Grant gg-51; Bane Charitable Trust Grant LU#9178 (to A. Slominski); Deutsche Forschungsgeimeinschaft Grant Pa 345/6 –1 (to R. Paus); a grant from Wella, Darmstadt (to R. Paus); and a grant from Deutsche Forschungsgeimeinschaft (to T. Luger). Address for reprint requests and other correspondence: A. Slominski, Dept. of Pathology, Univ. of Tennessee Memphis, Rm. 576 BMH-Main, 899 Madison Ave., Memphis, TN 38163. REFERENCES 1. ABDEL-MALEK Z, SWOPE VB, SUZUKI I, AKCALI C, HARRIGER MD, BOYCE ST, URABE K, AND HEARING VJ. Mitogenic and melanogenic stimulation of normal human melanocytes by melanotropic peptides. Proc Natl Acad Sci USA 92: 1789 –1793, 1995. 2. ABE K, BUTCHER W, NICHOLSON WE, BAIRDE CE, LIDDLE RA, AND LIDDLE GW. Adenosine 3,5-monophosphate (cyclic AMP) as the mediator of the actions of melanocyte stimulating hormone (MSH) and norepinephrine on the frog skin. Endocrinology 84: 362–368, 1969. 3. ACKLAND JF, SCHWARTZ NB, MAYO KE, AND DODSON RE. Nonsteroidal signals originating in the gonads. Physiol Rev 72: 731–787, 1992. 4. ADLER GK, ROSEN LB, FIANDACA MJ, AND MAJZOUB JA. Protein kinase-C activation increases the quantity and poly(A) tail length of corticotropin-releasing hormone messenger RNA in NPLC cells. Mol Endocrinol 6: 476 – 483, 1992. 5. AGUILERA G. Corticotropin releasing hormone, receptor regulation and the stress response. Trends Endocrinol 9: 329 –336, 1998. 6. ALLEN BM. The results of extirpation of the anterior lobe of the hypophysis and of the thyroid of Rana pipiens larvae. Science 44: 755–758, 1916. 7. ALLEN RG, HATFIELD JM, STACK J, AND RONNEKLEIV O. Posttranslational processing of proopiomelanocortin (POMC)-derived Downloaded from http://physrev.physiology.org/ by 10.220.33.6 on July 4, 2017 has a critical role in the protection of global homeostasis. Thus the continuous barrier represented by skin is exposed to extreme temperatures, radiation, biological agents, and trauma. The most important cutaneous stress is the solar radiation, particularly the ultraviolet spectrum which interacts with epidermal components and leads, when excessive, to the local accumulation of toxic products. Exposure of humans to high-intensity solar radiation results in a highly circumscribed immediate reaction, i.e., typical erythematous eruption restricted to the exposure site; more chronically, it results in pigmentation. The reactive accumulation of the pigment melanin, which acts as a light filter and scavenger of cellular toxins and free radicals, prevents further skin damage. CRH, ACTH, -endorphin, and MSH peptides, together with receptors for CRH and the POMC peptides, are all present in the skin, while the corresponding genes are also expressed locally (Fig. 10). That the components of the highly organized system involved in the systemic response to stress would be expressed in cells whose normal destiny is to differentiate and die strongly support functional relevance for this energy-requiring function. Indeed, testing the functional modulation of the skin CRH-POMC system has shown strong linkages to UVR, cytokines, hair cycle, disease states, and metabolic modifiers. Volume 80 July 2000 8. 9. 10. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. peptides during fetal monkey pituitary development. Adrenocorticotropin (ACTH) and ␣-melanotropins (␣-MSHs). Dev Biol 126: 164 –172, 1988. ALLEN RG, ORWELL E, KENDALL JW, HERBERT E, AND PAXTON H. The distribution of forms of adrenocorticotropin and beta-endorphin in normal, tumorous, and autopsy human pituitary tissue: virtual absence of 13K adrenocorticotropin. J Clin Endocrinol Metab 51: 376 –380, 1980. ANGIONI S, PETRAGLIA F, GALLINELLI A, COSSARIZZA A, FRANCESCHI C, MUSCETTOLA M, GENAZZANI AG, SURICO N, AND GENAZZANI AR. Corticotropin-releasing hormone modulates cytokines release in cultured human peripheral blood mononuclear cells. Life Sci 53: 1735–1742, 1993. AOKI Y, IWASAKI Y, KATAHIRA M, YOISO, AND SAITO H. Regulation of the rat proopiomelanocortin gene expression in AtT-20 cells. I. Effects of common segregatogues. Endocrinology 138: 1923–1929, 1997. AOKI Y, IWASAKI Y, KATAHIRA M, OISO Y, AND SAITO H. Regulation of the rat proopiomelanocortin gene expression in AtT-20 cells. II. Effects of the pituitary adenylate cyclase-activating polypeptide and vasoactive intestinal polypeptide. Endocrinology 138: 1930 –1940, 1997. ARENDS RJ, VERMEER H, MARTENS GJ, LEUNISSEN JA, WENDELAAR BONGA SE, AND FLIK G. Cloning and expression of two proopiomelanocortin mRNAs in the common carp (Cyprinus carpio L.). Mol Cell Endocrinol 143: 23–31, 1998. ASAKURA H, ZWAIN IH, AND YEN SS. Expression of genes encoding corticotropin-releasing factor (CRF), type 1 CRF receptor, and CRF-binding protein and localization of the gene products in the human ovary. J Clin Endocrinol Metab 82: 2720 –2725, 1997. ATWELL WJ. On the nature of the pigmentation changes following hypophysectomy in the frog larva. Science 49: 48 –50, 1916. AUERNHAMMER CJ, CHESNOKOVA V, AND MELMED S. Leukemia inhibitory factor modulates interleukin-1-induced activation of the hypothalamo-pituitary-adrenal axis. Endocrinology 139: 2201–2208, 1998. AUERNHAMMER CJ, CHESNOKOVA V, BOUSQUET C, AND MELMED S. Pituitary corticotroph SOCS-3: novel intracellular regulation of leukemia-inhibitory factor-mediated proopiomelanocortin gene expression and adrenocorticotropin secretion. Mol Endocrinol 12: 954 –961, 1998. AUTELITANO DJ, LUNDBLAD JR, BLUM M, AND ROBERTS JL. Hormonal regulation of POMC gene expression. Annu Rev Physiol 51: 715–726, 1989. BAMBERGER CM, WALD M, BAMBERGER AM, ERGÜN S, BEIL FU, AND SCHULTE HM. Human lymphocytes produce urocortin, but not corticotropin-releasing hormone. J Clin Endocrinol Metab 83: 708 –711, 1998. BARKER DM AND CORDER R. Studies of the role of endotheliumdependent nitric oxide release in the sustained vasodilator effects of corticotrophin releasing factor and sauvagine. Br J Pharmacol 126: 317–325, 1999. BATEMAN A, SOLOMON S, AND BENNETT HP. Post-translational modification of bovine pro-opiomelanocortin. J Biol Chem 265: 22130 –22136, 1990. BECHER E, MAHNKE K, BHAROWAJ R, SCHWARZ T, AND LUGER TA. Human dendritic cells express a receptor which is specific for the immunosuppressing neuropeptide ␣-MSH. J Invest Dermatol 109: 254, 1997. BECHER E, MAHNKE K, BRZOSKA T, KALDEN DH, GRABBE S, AND LUGER TA. Human peripheral blood derived dendritic cells express functional melanocortin receptor MC-1. Ann NY Acad Sci 885: 188 –195, 1999. BELON PE. UVA exposure and pituitary secretion: variations of human lipotropin concentrations (LPH) after UVA exposure. Photochem Photobiol 42: 327–329, 1985. BERNSTEIN JE AND SWIFT R. Relief of intractable pruritus with naloxone. Arch Dermatol 115: 1366 –1367, 1979. BERTAGNA X. Proopiomelanocortin-derived peptides. Endocrinol Metab Clin North Am 23: 467– 485, 1994. BERTAGNA X, LENNE F, COMAR D, MASSIAS JF, WAJCMAN H, BAUDIN V, LUTON JP, AND GIRARAD F. Human ␣-melanocyte- 27. 28. 29. 30. 31. 32. 33. 34. 35. 36. 37. 38. 39. 40. 41. 42. 43. 44. 45. 46. 47. 48. 49. 1009 stimulating hormone revisited. Proc Natl Acad Sci USA 83: 9719 – 9723, 1986. BESEDOVSKY HO AND DEL REY A. Immune-neuro-endocrine interactions: facts and hypotheses. Endocr Rev 17: 64 –102, 1996. BHARDWAJ RS, BECHER E, MAHNKE K, HARTMEYER M, SCHWARZ T, SCHOLZEN T, AND LUGER TA. Evidence for the differential expression of the functional alpha-melanocyte-stimulating hormone receptor MC-1 human monocytes. J Immunol 158: 3378 –3384, 1997. BHARDWAJ RS, SCHWARZ A, BECHER E, MAHNKE K, ARAGANE Y, SCHWARZ T, AND LUGER TA. Pro-opiomelanocortinderived peptides induce IL-10 production in human monocytes. J Immunol 156: 2517–2521, 1996. BIGLIARDI PL, BIGLIARDI-QI M, BUECHNER S, AND RUFLI T. Expression of -opiate receptor in human epidermis and keratinocytes. J Invest Dermatol 111: 297–301, 1998. BIRCHALL N, ORLOW SJ, KUPPER T, AND PAWELEK J. Interactions between ultraviolet light and interleukin-1 on MSH binding in both mouse melanoma and human squamous carcinoma cells. Biochem Biophys Res Commun 175: 839 – 845, 1991. BLALOCK JE. Molecular basis for bidirectional communication between the immune and the neuroendocrine systems. Physiol Rev 69: 1–32, 1989. BLALOCK JE. The syntax of immune-neuroendocrine communication. Immunol Today 15: 504 –511, 1994. BOHM M AND LUGER TA. The pilosebaceous unit is part of the skin immune system. Dermatology 196: 75–79, 1998. BOHM M, METZE D, SCHULTE U, BECHER E, LUGER TA, AND BRZOSKA T. Detection of melanocortin-1 receptor antigenicity on human skin cells in culture and in situ. Exp Dermatol 8: 453– 461, 1999. BOHM M, SCHULTE U, KALDEN H, AND LUGER TA. Alpha-melanocyte-stimulating hormone modulates activation of NF-B and AP-1 and secretion of interleukin-8 in human dermal fibroblasts. Ann NY Acad Sci 885: 277–286, 1999. BOITANI C, MATHER JP, AND BARDIN CW. Stimulation of adenosine 3⬘,5⬘-monophosphate production in rat Sertoli cells by ␣-melanotropin-stimulating hormone (␣MSH) and des-acetyl ␣MSH. Endocrinology 118: 1513–1518, 1986. BOLOGNIA JL, MURRAY M, AND PAWELEK J. Evidence that UVBinduced melanogenesis is mediated through the MSH receptor system. J Invest Dermatol 92: 651– 660, 1989. BOLOGNIA JL, MURRAY-GONZALES M, AND PAWELEK J. Hairless pigmented guinea pigs: a new animal model for studies of the pigmentary system. Pigment Cell Res 3: 150 –156, 1990. BOLOGNIA JL, SODI SA, CHAKRABORTY AK, FARGNOLI MC, AND PAWELEK JM. Effects of ultraviolet irradiation on the cell cycle. Pigment Cell Res 7: 320 –325, 1994. BOMIRSKI A, SLOMINSKI A, AND BIGDA J. The natural history of a family of transplantable melanomas in hamsters. Cancer Met Rev 7: 95–119, 1988. BORRELLI E. A chilled-out knockout. Nature Genet 19: 108 –109, 1998. BOS JD. Skin Immune System (SIS). Boca Raton FL: CRC, 1997 BOSTON BA, BLAYDON KM, VARNERIN J, AND CONE RD. Independent and additive effects of central POMC and leptin pathways on murine obesity. Science 278: 1641–1644, 1997. BOSTON BA AND CONE RD. Characterization of melanocortin receptor subtype expression in murine adipose tissues and in the 3T3–L1 cell line. Endocrinology 137: 2043–2050, 1996. BROUXHON SM, PRASAD AV, JOSEPH SA, FELTEN DL, AND BELLINGER DL. Localization of corticotropin-releasing factor in primary and secondary lymphoid organs of the rat. Brain Behav Immun 12: 107–122, 1998. BRZOSKA T, KALDEN DH, SCHOLZEN T, AND LUGER TA. Molecular basis of the ␣-MSH/IL-1 antagonism. Ann NY Acad Sci 885: 230 –238, 1999. BRZOSKA T, SCHOLZEN T, BECKER E, HARTMEYER M, BLETZ T, SCHWARZ T, AND LUGER TA. UVB irradiation regulates the expression of proopiomelanocortin, prohormone convertase 1 and melanocortin receptor 1 by human keratinocytes. J Invest Dermatol 108: 622, 1997. BRAR B, SANDERSON T, WANG N, AND LOWRY JP. Post-transla- Downloaded from http://physrev.physiology.org/ by 10.220.33.6 on July 4, 2017 11. CRH-POMC SIGNALING IN A CUTANEOUS STRESS RESPONSE 1010 50. 51. 52. 53. 54. 56. 57. 58. 59. 60. 61. 62. 63. 64. 65. 66. 67. tional processing of human procorticotrophin-releasing factor in transfected mouse neuroblastoma and Chinese hamster ovary cell lines. J Endocrinol 154: 431– 440, 1997. BRUNETTI L, PREZIOSI P, RAGAZZONI E, AND VACCA M. Involvement of nitric oxide in basal and interleukin-1-induced CRH and ACTH release in vitro. Life Sci 53: 219 –222, 1993. BUFFEY J, THODY AJ, BLEEHEN SS, AND S MACNEIL. ␣-Melanocyte-stimulating hormone stimulates protein kinase C activity in murine B16 melanoma. J Endocrinol 133: 333–340, 1992. BUGGY JJ. Binding of ␣-melanocyte-stimulating hormone to its G-protein-coupled receptor on B-lymphocytes activates the Jak/ STAT pathway. Biochem J 331: 211–216, 1998. BURCHILL SA AND THODY AJ. Melanocyte-stimulating hormone and the regulation of tyrosinase activity in hair follicular melanocytes of the mouse. J Endocrinol 111: 225–232, 1986. BURCHILL SA, VIRDEN R, FULLER BB, AND THODY AJ. Regulation of tyrosinase synthesis by ␣-melanocyte-stimulating hormone in hair follicular melanocytes of the mouse. J Endocrinol 116: 17–23, 1988. BUZZETTIR R, MCLOUGHLIN L, LAVENDER PM, CLARK AJ, AND REES LH. Expression of pro-opiomelanocortin gene and quantification of adrenocorticotropic hormone-like immunoreactivity in human normal peripheral mononuclear cells and lymphoid and myeloid malignancies. J Clin Invest 83: 733–737, 1989. CALOGERO AE, BURRELLO N, NEGRI-CESI P, PAPALE L, PULUMBO MA, CIANCI A, SANFILIPPO S, AND D’AGATA R. Effects of corticotropin-releasing hormone on ovarian estrogen production in vitro. Endocrinology 137: 4161– 4166, 1996. CAN G, ABDEL-MALEK Z, PORTER-GILL PA, GILL P, BOYCE S, GRABOWSKI GA, NORDLUND J, AND FAROOQUI J. Identification and sequencing of a putative variant of proopiomelanocortin in human epidermis and epidermal cells in culture. J Invest Dermatol 111: 485– 491, 1998. CANNON JG, TATRO JB, REICHLIN S, AND DINARELLO CA. Alpha melanocyte stimulating hormone inhibits immunostimulatory and inflammatory actions of interleukin 1. J Immunol 137: 2232–2236, 1986. CASTRO MG AND MORRISON E. Post-translational processing of proopiomelanocortin in the pituitary and in the brain. Crit Rev Neurobiol 11: 35–57, 1997. CATANIA A, GERLONI V, PROCACCIA S, AIRAGHI L, MANFREDI MG, LOMATER C, GROSSI L, AND LIPTON JM. The anticytokine neuropeptide alpha-melanocyte-stimulating hormone in synovial fluid of patients with rheumatic diseases: comparisons with other anticytokine molecules. Neuroimmunomodulation 1: 321–328, 1994. CATANIA A AND LIPTON JM. Alpha-melanocyte stimulating hormone in the modulation of host reactions. Endocr Rev 14: 564 –576, 1993. CATANIA A, MANFREDI MG, AIRAGHI L, VIVIRITO MC, CAPETTI A, MILAZZO F, LIPTON JM, AND ZANUSSI C. Plasma concentration of cytokine antagonists in patients with HIV infection. Neuroimmunomodulation 1: 42– 49, 1994. CATANIA A, RAJORA N, CAPSONI F, MINONZIO F, STAR RA, AND LIPTON JM. The neuropeptide alpha-MSH has specific receptors on neutrophils and reduces chemotaxis in vitro. Peptides 17: 675– 679, 1996. CHAKRABORTY A, BOLOGNIA J, FUNASAKA Y, SLOMINSKI A, BOLOGNIA J, SODI S, ICHIHASHI M, AND PAWELEK JM. UV light and MSH receptors. Ann NY Acad Sci 885: 110 –116, 1999. CHAKRABORTY A AND PAWELEK J. MSH receptors in immortalized human epidermal keratinocytes: a potential mechanism for coordinate regulation of the epidermal-melanin unit. J Cell Physiol 157: 344 –350, 1993. CHAKRABORTY A, FUNASAKA Y, PAWELEK JM, NAGAHAMA M, ITO A, AND ICHIHASHI M. Enhanced expression of melanocortin-1 receptor (MC1-r) in normal human keratinocytes during differentiation: evidence for increased expression of POMC peptides near suprabasal layer of epidermis. J Invest Dermatol 112: 853– 860, 1999. CHAKRABORTY A, FUNASAKA Y, SLOMINSKI A, ERMAK G, HWANG J, PAWELEK JM, AND ICHIHASHI M. Production and release of proopiomelanocortin (POMC)-derived peptides by hu- 68. 69. 70. 71. 72. 73. 74. 75. 76. 77. 78. 79. 80. 81. 82. 83. 84. 85. 86. 87. Volume 80 man melanocytes and keratinocytes in culture: regulation by UVB. Biochim Biophys Acta 1313: 130 –138, 1996. CHAKRABORTY AK, ORLOW SJ, BOLOGNIA JL, AND PAWELEK J. Structural/functional relationships between internal and external MSH receptors: modulation of expression in Cloudman melanoma cells by UVB radiation. J Cell Physiol 147: 1– 6, 1991. CHAKRABORTY AK, ORLOW SJ, AND PAWELEK JM. Stimulation of melanocyte-stimulating hormone receptors by retinoic acid. FEBS Lett 276: 205–208, 1990. CHAKRABORTY AK AND PAWELEK JM. Upregulation of MSH receptor by MSH in Cloudman melanoma cells. Biochem Biophys Res Commun 188: 1325–1331, 1992. CHAKRABORTY AK, SLOMINSKI A, ERMAK G, HWANG J, AND PAWELEK JM. Ultraviolet B and melanocyte-stimulating hormone (MSH) stimulate mRNA production for ␣MSH receptors and proopiomelanocortin-derived peptides in mouse melanoma cells and transformed keratinocytes. J Invest Dermatol 105: 655– 659, 1995. CHALLIS JRG. CRH, a placental clock and preterm labour. Nature Med 1: 416, 1995. CHALMERS DT, LOVENBERG TW, AND DE SOUZA EB. Localization of novel corticotropin-releasing factor receptor (CRF2) mRNA expression to specific subcortical nuclei in rat brain: comparison with CRF1 receptor mRNA expression. J Neurosci 15: 6340 – 6350, 1995. CHALMERS DT, LOVENBERG TW, GRIGORIADIS DE, BEHAN DP, AND DE SOUZA EB. Corticotropin-releasing factor receptors: from molecular biology to drug design. Trends Pharmacol Sci 17: 166 –172, 1996. CHANG AC, CHOCHET M, AND COHEN SN. Structural organization of human genomic DNA encoding pro-opiomelanocortin peptide. Proc Natl Acad Sci USA 77: 4890 – 4894, 1980. CHANG AC, ISRAEL A, GAZDAR A, AND COHEN SN. Initiation of proopiomelanocortin mRNA from a normally quiescent promoter in a human small cell lung cancer cell line. Gene 84: 115–126, 1989. CHANG CP, PEARSE RV, O’CONNELL S, AND ROSENFELD MG. Identification of a seven transmembrane helix receptor for corticotropin-releasing factor and sauvagine in mammalian brain. Neuron 11: 1187–1195, 1993. CHEN R, LEWIS KA, PERRIN MH, AND VALE WW. Expression cloning of a human corticotropin-releasing-factor receptor. Proc Natl Acad Sci USA 90: 8967– 8971, 1993. CHEN W, KELLY MA, OPITZ-ARAYA X, THOMAS RE, LOW MJ, AND CONE RD. Exocrine gland dysfunction in MC5-R-deficient mice: evidence for coordinated regulation of exocrine gland function by melanocortin peptides. Cell 91: 789 –798, 1997. CHESNOKOVA V, AUERNHAMMER CJ, AND MELMED S. Murine leukemia inhibitory factor gene disruption attenuates the hypothalamo-pituitary-adrenal axis stress response. Endocrinology 139: 2209 –2216, 1998. CHEUNG CC, CLIFTON DK, AND STEINER RA. Proopiomelanocortin neurons are direct targets for leptin in the hypothalamus. Endocrinology 138: 4489 – 4492, 1997. CHHAJLANI V AND WIKBERG JE. Molecular cloning and expression of the human melanocyte stimulating hormone receptor cDNA. FEBS Lett 309: 417– 420, 1992. CHIAO H, FOSTER S, THOMAS R, LIPTON J, AND STAR RA. Alpha-melanocyte-stimulating hormone reduces endotoxin-induced liver inflammation. J Clin Invest 97: 2038 –2044, 1996. CLARK AJ, LAVENDER PM, BESSER GM, AND REES LH. Proopiomelanocortin mRNA size heterogeneity in ACTH-dependent Cushing’s syndrome. J Mol Endocrinol 2: 3–9, 1989. CLARK AJ, LAVENDER PM, COATES P, JOHNSON MR, AND REES LH. In vitro and in vivo analysis of the processing and fate of the peptide products of the short proopiomelanocortin mRNA. Mol Endocrinol 4: 1737–1743, 1990. CLIFTON VL, READ MA, LEITCH IM, GILES WB, BOURA AL, ROBINSON PJ, AND SMITH R. Corticotropin-releasing hormoneinduced vasodilatation in the human fetal-placental circulation: involvement of the nitric oxide-cyclic guanosine 3⬘,5⬘-monophosphate-mediated pathway. J Clin Endocrinol Metab 80: 2888 –2893, 1995. CLIFTON VL, TELFER JF, THOMPSON AJ, CAMERON IT, TEOH TG, LYE SJ, AND CHALLIS JR. Corticotropin-releasing hormone and Downloaded from http://physrev.physiology.org/ by 10.220.33.6 on July 4, 2017 55. SLOMINSKI, WORTSMAN, LUGER, PAUS, AND SOLOMON July 2000 88. 89. 90. 91. 93. 94. 95. 96. 97. 98. 99. 100. 101. 102. 103. 104. 105. proopiomelanocortin-derived peptides are present in human myometrium. J Clin Endocrinol Metab 83: 3716 –3721, 1998. CONE RD, LU D, KOPPULA S, VAGE DI, KLUNGLAND H, BOSTON B, CHEN W, ORTH DN, POUTON C, AND KESTERSON RA. The melanocortin receptors: agonists, antagonists, and the hormonal control of pigmentation. Recent Prog Horm Res 51: 287–318, 1996. DAI R AND STREILEIN JW. Ultraviolet B-exposed and soluble factor-pre-incubated epidermal Langerhans cells fail to induce contact hypersensitivity and promote DNP-specific tolerance. J Invest Dermatol 108: 721–726, 1997. DAY R, SCHAFER , WATSON SJ, CHRETIEN M, AND SEIDAH MKH/NG. Distribution and regulation of the prohormone convertases PC1 and PC2 in the rat pituitary. Mol Endocrinol 6: 485– 497, 1992. DEBOLD CR, MENEFEE JK, NICHOLSON WE, AND ORTH DN. Proopiomelanocortin gene is expressed in many normal human tissues and in tumors not associated with ectopic adrenocorticotropin syndrome. Mol Endocrinol 2: 862– 870, 1988. DEGANI H, DEJORDY JO, AND SALOMON Y. Stimulation of cAMP and phosphomonoester production by melanotropin in melanoma cells: 31P NMR studies. Proc Natl Acad Sci USA 88: 1506 –1510, 1991. DESCHODT-LANCKMAN M, VANNESTE Y, LOUR B, MICHEL A, LIBERT A, CHANEM G, AND LEJEUNE F. Degradation of ␣-melanocyte stimulating hormone (␣-MSH) by CALLA/endopeptidase 24.11 expressed by human melanoma cells in culture. Int J Cancer 46: 1124 –1130, 1990. DIBLASIO AM, GIRALDI FP, VIGANO P, PETRAGLIA F, BIGNALI M, AND CAVAGNINI F. Expression of corticotropin-releasing hormone and its R1 receptor in human endometrial stromal cells. J Clin Endocrinol Metab 82: 1594 –1597, 1997. DIPASQUALE A, MCGUIRE J, AND VARGA JM. The number of receptors for ␣-melanocyte stimulating hormone in Cloudman melanoma cells is increased by dibutyryl adenosine 3⬘:5⬘-cyclic monophosphate or cholera toxin. Proc Natl Acad Sci USA 74: 601– 605, 1977. DISSANAYAKE NS AND MASON RS. Modulation of skin cell functions by transforming growth factor-1 and ACTH after ultraviolet irradiation. J Endocrinol 159: 153–163, 1998. DONALDSON CJ, SUTTON SW, PERRIN MH, CORRIGAN AZ, LEWIS KA, JERIVIER, VAUGHAN JM, AND VALE WW. Cloning and characterization of human urocortin. Endocrinology 137: 2167– 2170, 1996. DORIN RI, ZLOCK DW, AND KILPATRICK K. Transcriptional regulation of human corticotropin releasing factor gene expression by cyclic adenosine 3⬘,5⬘-monophosphate: differential effects at proximal and distal promoter elements. Mol Cell Endocrinol 96: 99 –111, 1993. DROUIN J, NEMER M, CHARRON J, GAGNER JP, JEANNOTTE L, SUN YL, THERRIEN M, AND TREMBLAY Y. Tissue specific activity of the pro-opiomelanocortin (POMC) gene and repression by glucorticoids. Genome 31: 510 –519, 1989. DUFAU ML, TINAJERO JC, AND FABBRI A. Corticotropin-releasing factor: an antireproductive hormone of the testis. FASEB J 7: 299 –307, 1993. EBERLE AN. The Melanotropins: Chemistry, Physiology and Mechanism of Action. New York: Karger, 1988. EHRHART-BORNSTEIN M, HINSON JP, BORNSTEIN SR, ASCHERBAUM W, AND VINSON GP. Intra-adrenal interactions in the regulation of adrenocortical steroidogenesis. Endocr Rev 19: 101– 143, 1998. ERDEN HF, ZWAIN IH, ASAKURA H, AND YEN SS. Corticotropinreleasing factor inhibits luteinizing hormone-stimulated P450c17 gene expression and androgen production by isolated thecal cells of human ovarian follicles. J Clin Endocrinol Metab 83: 448 – 452, 1998. ERMAK G AND SLOMINSKI A. Production of POMC, CRH-R1, MC1, and MC2 receptor mRNA and expression of tyrosinase gene in relation to hair cycle and dexamethasone treatment in the C57BL/6 mouse skin. J Invest Dermatol 108: 160 –165, 1997. ESHEL Y AND SALOMON Y. Calmodulin-binding peptides interfere with melanocyte-stimulating hormone receptor activity and stimu- 106. 107. 108. 109. 110. 111. 112. 113. 114. 115. 116. 117. 118. 119. 120. 121. 122. 123. 124. 1011 late adenosine 3⬘,5⬘-monophosphate production in M2R mouse melanoma cells. Endocrinology 134: 177–185, 1994. EVANS VR, MANNING AB, BERNARD LH, CHRONWALL BM, AND MILLINGTON WR. ␣-Melanocyte-stimulating hormone and N-acetyl-endorphin immunoreactivities are localized in the human pituitary but are not restricted to the zona intermedia. Endocrinology 134: 97–106, 1994. FAROOQUI JZ, MEDRANO EE, ABDEL-MALEK Z, AND NORDLUND J. The expression of proopiomelanocortin and various POMC-derived peptides in mouse and human skin. Ann NY Acad Sci 680: 508 –510, 1993. FAROOQUI JZ, MEDRANO EE, BOISSY RE, TIGELAAR RE, AND NORDLUND JJ. Thy-1⫹ dendritic cells express truncated form of POMC mRNA. Exp Dermatol 4: 297–301, 1995. FAZAL N, SLOMINSKI A, CHOUDHRY MA, WEI ET, AND SAYEED MM. Effect of CRF and related peptides on calcium signalling in human and rodent melanoma cells. FEBS Lett 435: 187–190, 1998. FELING P, BAXTER JD, AND FROHMAN LA. Endocrinology and Metabolism (3rd ed.). New York: McGraw-Hill, 1995. FISCHER EG. Opioid peptides modulate immune functions. Immunopharmacol Immunotoxicol 10: 265–326, 1988. FISHER LA. Central actions of corticotropin-releasing factor on autonomic nervous activity and cardiovascular functioning. Ciba Found Symp 172: 243–253, 1993. FITZPATRICK TB, EISEN AZ, WOLFF K, FREEDBERG IM, AND AUSTEN KF. Dermatology in General Medicine. New York: McGraw Hill, 1987. FLEISHER-BERKOVICH S AND DANON A. Effect of corticotropinreleasing factor on prostaglandin synthesis in endothelial cells and fibroblasts. Endocrinology 136: 4068 – 4072, 1995. FLEISHER-BERKOVICH S, RIMON G, AND DANON A. Corticotropin releasing factor modulates interleukin-1-induced prostaglandin synthesis in fibroblasts: receptor binding and effects of antagonists. Regul Peptides 77: 121–126, 1998. FLEISHER-BERKOVICH S, RIMON G, AND DANON A. Modulation of endothelial prostaglandin synthesis by corticotropin releasing factor and antagonists. Eur J Pharmacol 353: 297–302, 1998. FODOR M, SLUITER A, FRANKHUIZZEN-SIEREVOGE A, WEIGANT VM, HOOGERHOUT P, WILDT DJ, AND VERSTEEG DH. Distribution of Lys-gamma2-melanocyte stimulating hormone (Lysgamma 2-MSH)-like immunoreactivity in neuronal elements in the brain and peripheral tissues of the rat. Brain Res 731: 182–189, 1996. FUKATA J, IMURA H, AND NAKAO K. Cytokines as mediators in the regulation of the hypothalamic-pituitary-adrenocortical function. J Endocrinol Invest 17: 141–155, 1994. FUNASAKA Y, CHAKRABORTY AK, HAYASHI Y, KOMOTO M, OHASHI A, NAGAHAMA M, INOUE Y, PAWELEK J, AND ICHIHASHI M. Modulation of melanocyte-stimulating hormone receptor expression on normal human melanocytes: evidence for a regulatory role of ultraviolet B, interleukin-1␣, interleukin-1, endothelin-1 and tumor necrosis factor-␣. Br J Dermatol 139: 216 –224, 1998. FUNASAKA Y AND ICHIHASHI M. The effect of ultraviolet B induced adult T cell leukemia-derived factor/thioredoxin (ADF/TRX) on survival and growth of human melanocytes. Pigment Cell Res 10: 68 –73, 1997. FUNASAKA Y, SATO H, CHAKRABORTY AK, OHASHI A, CHROUSOS GP, AND ICHIHASHI M. Expression of proopiomelanocortin, corticotropin-releasing hormone (CRH), and CRH receptor in melanoma cells, nevus cells, and normal melanocytes. J Invest Dermatol Symp Proc 4: 105–109, 1999. FURKERT J, KLUG U, SLOMINSKI A, EICHMULLER S, MEHLIS B, KERTSCHER U, AND PAUS R. Identification and measurement of beta-endorphin levels in the skin during induced hair growth in mice. Biochim Biophys Acta 1336: 315–322, 1997. GANTZ I, KONDA Y, TASHIRO T, SHIMOTO Y, MIWA H, MUNZERT G, WATSON SJ, DEL VALLE J, AND YAMADA T. Molecular cloning of a novel melanocortin receptor. J Biol Chem 268: 8246 – 8250, 1993. GARCIA-GARCIA L, FUENTES JA, AND MANZANARES J. Differential 5-HT-mediated regulation of sites-induced activation of proopiomelanocortin (POMC) gene expression in the anterior and Downloaded from http://physrev.physiology.org/ by 10.220.33.6 on July 4, 2017 92. CRH-POMC SIGNALING IN A CUTANEOUS STRESS RESPONSE 1012 125. 126. 127. 128. 129. 131. 132. 133. 134. 135. 136. 137. 138. 139. 140. 141. 142. 143. 144. intermediate lobe of the pituitary in male rats. Brain Res 772: 115–120, 1997. GEORGALA S, SCHULPIS KH, PAPACONSTANTINOU ED, AND STRATIGOS J. Raised -endorphin serum levels in children with atopic dermatitis and pruritus. J Dermatol Sci 8: 125–128, 1994. GESCHWIND II, HUSEBY RA, AND NISHIOKA R. The effect of melanocyte-stimulating hormone on coat color in the mouse. Recent Prog Horm Res 28: 91–130, 1972. GHANEM G, LIENARD D, HANSON P, LEJEUNE F, AND FRUHLING J. Increased serum ␣-melanocyte stimulating hormone (␣MSH) in human malignant melanoma. Eur J Cancer Clin Oncol 22: 535–536, 1986. GHANEM G, LOIR B, HADLEY M, ABDEL MALEK Z, LIBERT A, DEL MARMOL V, LEJEUNE F, LOZANO J, AND GARCIA-BORRON JC. Partial characterization of IR-␣-MSH peptides found in melanoma tumors. Peptides 13: 989 –994, 1992. GHANEM G, VERSTEGEN J, DE RIJCKE S, HANSON P, VAN ONDERBERGEN A, LIBERT A, DEL MARMOL V, ARNOULD R, VERCAMMEN-GRANDJEAN A, AND LEJEUNE F. Studies on factors influencing human plasma ␣-MSH. Anticancer Res 9: 1691– 1696, 1989. GHANEM G, COMUNALE G, LIBERT A, VERCAMMEN-GRANDJEAN A, AND LEJEUNE FJ. Evidence for alpha-melanocyte-stimulating hormone (␣-MSH) receptors on human malignant melanoma cells. Int J Cancer 41: 248 –255, 1988. GHANEM GE, VERSTEGEN J, LIBERT A, ARNOULD R, AND LEJEUNE F. ␣-Melanocyte-stimulating hormone immunoreactivity in human melanoma metastases extracts. Pigment Cell Res 2: 519 – 523, 1989. GIRALDI FP AND CAVAGNINI F. Corticotropin-releasing hormone is produced by rat corticotropes and modulates ACTH secretion in a paracrine/autocrine fashion. J Clin Invest 101: 2478 –2484, 1998. GIRARD JP AND SPRINGER TA. High endothelial venules (HEVs): specialized endothelium for lymphocyte migration. Immunol Today 16: 449 – 457, 1995. GJERDE EA, WOIE KA, WEI ET, AND REED RK. Corticotropinreleasing hormone inhibits lowering of interstitial fluid pressure in rat trachea induced by neurogenic inflammation. Eur J Pharmacol 352: 99 –102, 1998. GLINSKI W, BRODECKA H, GLINSKA-FERENZ M, AND KOWALSKI D. Neuropeptides in psoriasis: possible role of beta-endorphin in the pathomechanism of the disease. Int J Dermatol 33: 356 –361, 1994. GLINSKI W, BRODECKA H, GLINSKA-FERENZ M, AND KOWALSKI D. Increased concentration of beta-endorphin in the sera of patients with severe atopic dermatitis. Acta Derm Venereol 75: 9 –11, 1995. GOLDSMITH LA. Physiology, Biochemistry, and Molecular Biology of the Skin. New York: Oxford Univ. Press, 1991. GRABBE S, BHARDWAJ RS, MAHNKE K, SIMON MM, SCHWARZ T, AND LUGER TA. Alpha-melanocyte-stimulating hormone induces hapten-specific tolerance in mice. J Immunol 156: 473– 478, 1996. GRAMMATOPOULOS D, DAI Y, CHEN J, KARTERIS E, PAPADOPOULOU N, EASTON AJ, AND HILLHOUSE EW. Human corticotropin-releasing hormone receptor: differences in subtype expression between pregnant and nonpregnant myometria. J Clin Endocrinol Metab 83: 2539 –2544, 1998. GRANHOLM NH AND VAN AMERONGEN AW. Effects of exogenous MSH on the transformation from phaeo- to eumelanogenesis within C57BL/6J-Ay/ a hairbulb melanoctyes. J Invest Dermatol 96: 78 – 84, 1991. HADLEY M. Endocrinology. Englewood Cliffs, NJ: Prentice Hall, 1996. HAGAN P, POOLE S, AND BRISTOW AF. Immunosuppressive activity of corticotrophin-releasing factor. Biochem J 281: 251–254, 1992. HAKANISHI S, TERANISHI Y, WATANABI Y, NOTAKE M, NODA M, KAKIDANI H, INGAMI HJ, AND NUMA S. Isolation and characterization of the bovine corticotropin/betalipotropin precursor gene. Eur J Biochem 115: 429 – 434, 1981. HARBOUR DV, GALIN FS, HUGHES TK, SMITH EM, AND BLALOCK JE. Role of leukocyte-derived pro-opiomelanocortin peptides in endotoxic shock. Circ Shock 35: 181–191, 1991. Volume 80 145. HARBOUR DV, SMITH EM, AND BLALOCK JE. A novel processing pathway for proopiomelanocortin in lymphocytes: endotoxin induction of a new prohormone cleaving enzyme. J Neurosci Res 18: 95–101, 1987. 146. HARBOUR-MCMENAMIN D, SMITH EM, AND BLALOCK JE. Bacterial lipopolysaccharide induction of leukocyte-derived corticotropin and endorphins. Infect Immun 48: 813– 817, 1985. 147. HARTMEYER M, SCHOLZEN T, BECHER E, BHARDWAJ RS, SCHWARZ T, AND LUGER TA. Human dermal microvascular endothelial cells express the melanocortin receptor type 1 and produce increased levels of IL-8 upon stimulation with alpha-melanocytestimulating hormone. J Immunol 159: 1930 –1937, 1997. 148. HARTWIG AC. Peripheral -endorphin and pain modulation. Anesth Prog 38: 75–78, 1991. 149. HEDLEY SJ, GAWKRODGER DJ, WEETMAN AP, MORANDINI R, BOEYNAEMS J-M, GHANEM G, AND NEIL SM. ␣-Melanocyte stimulating hormone inhibits tumour necrosis factor-␣ stimulated intercellular adhesion molecule-1 expression in normal cutaneous human melanocytes and in melanoma cell lines. Br J Dermatol 138: 536 –543, 1998. 150. HEINRICH N, MEYER MR, FURKERT J, SASSE A, BEYERMANN M, BONIGK W, AND BERGER H. Corticotropin-releasing factor (CRF) agonists stimulate testosterone production in mouse leydig cells through CRF receptor-1. Endocrinology 139: 651– 658, 1998. 151. HELDWEIN KA, REDICK DL, RITTENBERG MB, CLAYCOMB WC, AND STENZEL-POORE MP. Corticotropin-releasing hormone receptor expression and functional coupling in neonatal cardiac myocytes and AT-1 cells. Endocrinology 137: 3631–3639, 1996. 152. HILTZ ME, CATANIA A, AND LIPTON JM. Alpha-MSH peptides inhibit acute inflammation induced in mice by rIL-1 beta, rIL-6, rTNF-alpha and endogenous pyrogen but not that caused by LTB4, PAF and rIL-8. Cytokine 4: 320 –328, 1992. 153. HILTZ ME AND LIPTON JM. Alpha-MSH peptides inhibit acute inflammation and contact sensitivity. Peptides 11: 979 –982, 1990. 154. HINNEY A, BECKER I, HEIBULT O, NOTTEBOM K, SCHMIDT A, ZIEGLER A, MAYER H, SIEGFRIED W, BLUM WF, REMSCHMIDT H, AND HEBEBRAND J. Systematic mutation screening of the proopiomelanocortin gene: identification of several genetic variants including three different insertions, one nonsense and two missense point mutations in probands of different weight extremes. J Clin Endocinol Metab 83: 3737–3741, 1998. 155. HIROBE T. Melanocyte stimulating hormone induces the differentiation of mouse epidermal melanocytes in serum-free culture. J Cell Physiol 152: 337–345, 1992. 156. HOGG N AND BERLIN C. Structure and function of adhesion receptors in leukocyte trafficking. Immunol Today 16: 327–330, 1995. 157. HOLTZMANN H, ALTMEYER P, AND SCHULTZ-AMLING W. Der einfluss ultravioletter strtahlen auf die hypothalamus-hypophysenachse des menschen. Acta Dermatol 8: 119 –123, 1982. 158. HOLTZMANN H, ALTMEYER P, STOHR L, AND CHILF GN. Die beemfussung des alpha-MSH durch UVA-bestrahlunger der hautein funktionstest. Hautarzt 34: 294 –297, 1983. 159. HORSCH D, DAY R, SEIDAH NG, WEIHE E, AND SCHAFER MK. Immunohistochemical localization of the pro-peptide processing enzymes PC1/PC3 and PC2 in the human anal canal. Peptides 18: 755–760, 1997. 160. HRUBY VJ, WILKES BC, HADLEY ME, AL-OBEIDI F, SAWYER TK, STAPLES DJ, DEVAUX AE, DYM O, CASTRUCCI AM, HINTZ MF, RIEHM JP, AND RAO KR. ␣-Melanotropin: the minimal active sequence in the frog skin bioassay. J Med Chem 30: 2126 –2130, 1987. 161. HUNT G. Melanocyte-stimulating hormone: a regulator of human melanocyte physiology. Pathobiology 63: 12–21, 1995. 162. HYATT P, BELL JB, BHATT K, CHU FW, TAIT JF, TAIT SA, AND WHITLEY GS. Effects of ␣-melanocyte-stimulating hormone on the cyclic AMP and phospholipid metabolism of rat adrenocortical cells. J Endocrinol 110: 405– 416, 1986. 163. IKEDA K, TOHO K, SATO S, EBISAWA T, TOKUDOME G, HOSOYA T, HARADA M, NAKAGAWA O, AND NAKAO K. Urocortin, a newly identified corticotropin-releasing factor-related mammalian peptide, stimulates atrial natriuretic peptide and brain natriuretic peptide secretions from neonatal rat cardiomyocytes. Biochem Biophys Res Commun 250: 298 –304, 1998. 164. IM S, MORO O, PENG F, MEDRANO EE, CORNELIUS J, BAB- Downloaded from http://physrev.physiology.org/ by 10.220.33.6 on July 4, 2017 130. SLOMINSKI, WORTSMAN, LUGER, PAUS, AND SOLOMON July 2000 165. 166. 167. 168. 169. 171. 172. 173. 174. 175. 176. 177. 178. 179. 180. 181. 182. 183. COCK G, NORDLUND JJ, AND ABDEL-MALEK ZA. Activation of the cyclic AMP pathway by ␣-melanotropin mediates the response of human melanocytes to ultraviolet B radiation. Cancer Res 58: 47– 54, 1998. INUI A. Feeding and body-weight regulation by hypothalamic neuropeptides: mediation of the actions of leptin. Trends Neurosci 22: 62– 67, 1999. ITOI K, SEASHOLTZ AF, AND WATSON SJ. Cellular and extracellular regulatory mechanisms of hypothalamic corticotropin-releasing hormone neurons. Endocr J 45: 13–33, 1998. JEANNOTTE L, BURBACH JP, AND DROUIN J. Unusual proopiomelanocortin ribonucleic acids in extra pituitary tissues: intronless transcripts in testes and long poly A tails in hypothalamus. Mol Endocrinol 1: 749 –757, 1987. JOHANSSON O AND LIU PY. ␣-Melanocyte stimulating hormone (␣-MSH)-like immunoreactivity is present in certain normal human keratinocytes. Exp Dermatol 2: 204 –208, 1993. JOHANSSON O, LJUNGBERG A, HAN SW, AND VAALASTI A. Evidence for ␣-melanocyte stimulating hormone containing nerves and neutrophilic granulocytes in the human skin by indirect immunofluorescence. J Invest Dermatol 96: 852– 856, 1991. JONES MT AND GILLHAM B. Factors involved in the regulation of adrenocorticotropic hormone/-lipotropic hormone. Physiol Rev 68: 743– 818, 1988. JORDAN SA AND JACKSON IJ. Melanocortin receptors and antagonists regulate pigmentation and body weight. Bioessays 20: 603– 606, 1998. KALDEN DH, FASTRICH M, BRZOSKA T, SCHOLZEN T, HARTMEYER M, SCHWARZ T, AND LUBER TA. Alpha-melanocyte-stimulating hormone reduces endotoxin-induced activation of nuclear factor-B in endothelial cells. J Invest Dermatol 110: 495, 1998. KALDEN DH, FASTRICH M, SCHOLZEN T, BRZOSKA T, AND LUBER TA. ␣-MSH modulates the expression of LPS-induced adhesion molecules. Exp Dermatol 7: 225, 1999. KALDEN DH, SCHOLZEN T, BRZOSKA T, AND LUGER TA. Mechanisms of the anti-inflammatory effects of ␣-MSH: role of transcription factor NF-B and adhesion molecule expression. Ann NY Acad Sci 885: 254 –261, 1999. KAMEYAMA K, MONTAGUE PM, AND HEARING VJ. Expression of melanocyte stimulating hormone receptors correlates with mammalian pigmentation, and can be modulated by interferons. J Cell Physiol 137: 35– 44, 1988. KAMEYAMA K, TANAKA S, ISHIDA Y, AND HEARING VJ. Interferons modulate the expression of hormone receptors on the surface of murine melanoma cells. J Clin Invest 83: 213–221, 1989. KAPAS S, ORFORD CD, BARKER S, VINSON GP, AND HINSON JP. Studies on the intracellular mechanism of action of ␣-melanocytestimulating hormone on rat adrenal zona glomerulosa. J Mol Endocrinol 9: 47–54, 1992. KAPAS S, PURBRICK A, BARKER S, VINSON GP, AND HINSON JP. ␣-Melanocyte-stimulating hormone-induced inhibition of angiotensin II receptor-mediated events in the rat adrenal zona glomerulosa. J Mol Endocrinol 13: 95–104, 1994. KAPAS S, PURBRICK A, AND HINSON JP. Role of tyrosine kinase and protein kinase C in the steroidogenic actions of angiotensin II, ␣-melanocyte-stimulating hormone and corticotropin in the rat adrenal cortex. Biochem J 305: 433– 438, 1995. KARALIS K, SANO H, REDWINE J, LISTWAK S, WILDER RL, AND CHROUSOS GP. Autocrine or paracrine inflammatory actions of corticotropin-releasing hormone in vivo. Science 254: 421– 423, 1991. KARTERIS E, GRAMMATOPOULOS D, DAI Y, OLAH KB, GHOBARA TB, EASTON A, AND HILLHOUSE EW. The human placenta and fetal membranes express the corticotropin-releasing hormone receptor 1␣ (CRH-1␣) and the CRH-C variant receptor. J Clin Endocrinol Metab 83: 1376 –1379, 1998. KATAHIRA M, IWASAKI Y, AOKI Y, OISO Y, AND SAITO H. Cytokine regulation of the rat proopio-melanocortin gene expression in AtT-20 cells. Endocrinology 139: 2414 –2422, 1998. KAVELAARS A, BERKENBOSCH F, CROISET G, REBALLIEUX RE, AND HEIJNEN CJ. Induction of -endorphin secretion by lymphocytes after subcutaneous administration of corticotropin-releasing factor. Endocrinology 126: 759 –764, 1990. 1013 184. KAWAHITO Y, SANO H, MUKAI S, ASAI K, KIMURA S, YAMAMURA Y, KATO H, CHROUSOS GP, WILDER RL, AND KONDO M. Corticotropin releasing hormone in colonic mucosa in patients with ulcerative colitis. Gut 37: 544 –551, 1995. 185. KEMP CF, WOODS RJ, AND LOWRY PJ. The corticotrophin-releasing factor-binding protein: an act of several parts. Peptides 19: 1119 –1128, 1997. 186. KIANG JG. Corticotropin-releasing factor increases [Ca2⫹]; via receptor-mediated Ca2⫹ channels in human epidermoid A-431 cells. Eur J Pharmacol 267: 135–142, 1994. 187. KIANG JG. Mystixin-7 and mystixin-11 increase cytosolic free Ca2⫹ and inositol trisphosphates in human A-431 cells. Eur J Pharmacol 291: 107–113, 1995. 188. KIANG JG. Corticotropin-releasing factor-like peptides increase cytosolic [Ca2⫹] in human epidermoid A-431 cells. Eur J Pharmacol 329: 237–244, 1997. 189. KIPPENBERGER S, BERNDS A, LOITSCH AS, RAMIREZ-BOSCA A, BEREITER-HAHN J, AND HOLZMANN H. ␣-MSH is expressed in cultured human melanocytes and keratinocytes. Eur J Dermatol 5: 395–397, 1995. 190. KISHIMOTO T, PEARSE RV II, LIN CR, AND ROSENFELD MG. A sauvagine/corticotropin-releasing factor receptor expressed in heart and skeletal muscle. Proc Natl Acad Sci USA 92: 1108 –1112, 1995. 191. KISS M, WLASCHEK M, BRENNEISEN P, MICHEL G, HOMMEL C, LANGE T, PEUS D, KEMENY L, DOBOZY A, SCHARFFETTERKOCHANEK K, AND RUZICKA T. ␣-Melanocyte stimulating hormone induces collagenase/matrix metalloproteinase-1 in human dermal fibroblasts. J Biol Chem 376: 425– 430, 1995. 192. KJAER A, LARSEN PJ, KNIGGE U, JORGENSEN H, AND WARBERG J. Neuronal histamine and expression of corticotropin-releasing hormone, vasopressin and oxytocin in the hypothalamus: relative importance of H1 and H2 receptors. Eur J Endocrinol 139: 238 –243, 1998. 193. KORNER A AND PAWELEK J. Activation of melanoma tyrosinase by a cyclic AMP-dependent protein kinase in a cell-free system. Nature 267: 444 – 447, 1977. 194. KOSTICH WA, CHEN A, SPERLE K, AND LARGENT BL. Molecular identification and analysis of a novel human corticotropin-releasing factor (CRF) receptor: the CRF2gamma receptor. Mol Endocrinol 12: 1077–1085, 1998. 195. KRAVCHENCO IV AND FURALEV VA. Secretion of immunoreactive corticotropin releasing factor and adrenocorticotropic hormone by T- and B-lymphocytes in response to cellular stress factors. Biochem Biophy Res Commun 204: 828 – 834, 1994. 196. KRUDE H, BIEBERMANN H, LUCK W, HORN R, BRABANT G, AND GRUTERS A. Severe early-onset obesity, adrenal insufficiency and red hair pigmentation caused by POMC mutations in humans. Nature Genet 19: 155–157, 1998. 197. KUCHLER K AND THORNER J. Secretion of peptides lacking hydrophobic signal sequence: the role of adenosine triphosphatedriven membranes translocators. Endocr Rev 13: 499 –514, 1992. 198. KURYSHEV YA, CHILDS GV, AND RITCHIE AK. Corticotropin-releasing hormone stimulates Ca2⫹ entry though L- and P-type channels in rat corticotropes. Endocrinology 137: 2269 –2277, 1996. 199. LAFLAMME N, FEUVRIER E, RICHARD D, AND RIVEST S. Involvement of serotonergic pathways in mediating the neuronal activity and genetic transcription of neuroendocrine corticotropin-releasing factor in the brain of systemically endotoxin-challenged rats. Neuroscience 88: 223–240, 1999. 200. LEITCH IM, BOURA ALA, BOTTI C, READ MA, WALTERS WA, AND SMITH R. Vasodilator actions of urocortin and related peptides in the human perfused placenta in vitro. J Clin Endocrinol Metab 83: 4510 – 4513, 1998. 201. LERNER AB. The discovery of the melanotropins: a history of pituitary endocrinology. Ann NY Acad Sci 680: 1–12, 1993. 202. LERNER AB AND MCGUIRE J. Effect of alpha- and beta-melanocyte stimulating hormones on the skin color of man. Nature 189: 176 – 179, 1961. 203. LEVINE N, LEMUS-WILSON A, WOOD SH, ABDEL-MALEK ZA, AL-OBEIDI F, HRUBY VJ, AND HADLEY ME. Stimulation of follicular melanogenesis in the mouse by topical and injected melanotropins. J Invest Dermatol 89: 269 –273, 1987. Downloaded from http://physrev.physiology.org/ by 10.220.33.6 on July 4, 2017 170. CRH-POMC SIGNALING IN A CUTANEOUS STRESS RESPONSE 1014 SLOMINSKI, WORTSMAN, LUGER, PAUS, AND SOLOMON 224. LYONS PD AND BLALOCK JE. The kinetics of ACTH expression in rat leukocyte subpopulations. J Neuroimmunol 63: 103–112, 1995. 225. LYONS PD AND BLALOCK JE. Proopiomelanocortin gene expression and protein processing in rat mononuclear leukocytes. J Neuroimmunol 78: 47–56, 1997. 226. MAKRIGIANNAKIS A, MARGIORIS A, MARKOGIANNAKIS E, STOURNARAS C, AND GRAVANIS A. Steroid hormones regulate the release of immunoreactive -endorphin from the Ishikawa human endometrial cell line. J Clin Endocrinol Met 75: 584 –589, 1992. 227. MANNA SK AND AGGARHWAL BB. Alpha-melanocyte-stimulating hormone inhibits the nuclear transcription factor NF-Kappa-B activation induced by various inflammatory agents. J Immunol 161: 2873–2880, 1998. 228. MAURER M, FISCHER E, HANDJISKI B, VON STEBUT E, ALGERMISSEN B, BAVANDI A, AND PAUS R. Activated skin mast cells are involved in murine hair follicle regression (catagen). Lab Invest 77: 319 –332, 1997. 229. MAY MJ AND GHOSH S. Signal transduction through NF-kappa B. Immunol Today 19: 80 – 88, 1998. 230. MAZURKIEWICZ JE, CORLISS D, AND SLOMINSKI AT. Differential temporal and spatial expression of POMC mRNA and of the production of POMC peptides during the murine hair cycle. Ann NY Acad Sci 885: 427– 429, 1999. 231. MAZURKIEWICZ JE, ERMAK G, HWANG J, CHHIAP V, CORLISS D, AND SLOMINSKI A. Towards identification of cells expressing POMC in the skin. J Invest Dermatol 104: 636, 1995. 232. MCCUBBIN JA, KAUFFMANN PG, AND NEMEROFF CB. Stress, Neuropeptides, and Systemic Disease. San Diego, CA: Academic, 1991. 233. MCLANE J, OSBER M, AND PAWELEK JM. Phosphorylated isomers of L-dopa stimulate MSH binding capacity and responsiveness to MSH in cultured melanoma cells. Biochem Biophys Res Commun 145: 719 –725, 1987. 234. MCLANE JA AND PAWELEK JM. Receptors for ␣-MSH in synchronized Cloudman melanoma cells exhibit positive cooperative in the late S and G2 phase of the cell cycle. Biochemistry 27: 3743–3747, 1988. 235. MCLEAN M, BISITS A, DAVIES J, WOODS R, LOWRY P, AND SMITH R. A placental clock controlling the length of human pregnancy. Nature Med 1: 460 – 463, 1995. 236. MCLEOD SD, SMITH C, AND MASON RS. Stimulation of tyrosinase in human melanocytes by pro-opiomelanocortin-derived peptides. J Endocrinol 146: 439 – 447, 1995. 237. MCLOON LK AND WIRTSCHAFTER J. Local injections of corticotropin releasing factor reduce doxorubicin-induced acute inflammation in the eyelid. Invest Ophthalmol Visual Sci 38: 834 – 841, 1997. 238. MECHANICK JI, LEVIN N, ROBERTS JL, AND AUTELITANO DJ. Proopiomelanocortin gene expression in a distinct population of rat spleen and lung leukocytes. Endocrinology 131: 518 –525, 1992. 239. MELZIG MF. Corticotropin releasing factor inhibits proliferation of AtT-20 cells. In Vitro Cell Dev Biol 30: 741–743, 1994. 240. MEYER WJ III, SMITH EM, RICHARDS GE, CAVALLO A, MORRILL AC, AND BLALOCK JE. In vivo immunoreactive adrenocorticotropin (ACTH) production by human mononuclear leukocytes from normal and ACTH-deficient individuals. J Clin Endocrinol Metab 64: 98 –105, 1987. 241. MILLINGTON WR, EVANS VR, BATTIE CN, BAGASRA O, AND FORMAN LJ. Proopiomelanocortin-derived peptides and mRNA are expressed in rat heart. Ann NY Acad Sci 680: 575–578, 1993. 242. MIYATA I, SHIOTA C, IKEDA Y, OSHIDA Y, CHAKI S, OKUYAMA A, AND INAGAMI T. Cloning and characterization of a short variant of the corticotropin-releasing factor receptor subtype from rat amgdala. Biochem Biophys Res Commun 24: 692– 696, 1999. 243. MIZUNO TM, KLEOPOULOS SP, BERGEN TH, ROBERTS JL, PRIEST CA, AND MOBBS CV. Hypothalamic proopio-melanocortin mRNA is reduced by fasting and (corrected) in ob/ob and db/db mice, but is stimulated by leptin. Diabetes 47: 294 –297, 1998. 244. MOELLMANN G, SLOMINSKI A, KUKLINSKA E, AND LERNER AB. Regulation of melanogenesis in melanocytes. Pigment Cell Res 79 – 87, 1988. 245. MOODY TW, ZIA F, AND VENUGOPAL R. Corticotropin-releasing Downloaded from http://physrev.physiology.org/ by 10.220.33.6 on July 4, 2017 204. LEVINE N, SHEFTEL SN, EYTAN T, DORR RT, HADLEY ME, WEINRACH JC, ERTL GA, TOTH K, MCGEE DL, AND HRUBY VJ. Induction of skin tanning by subcutaneous administration of a potent synthetic melanotropin. JAMA 266: 2730 –2736, 1991. 205. LEVINS PC, CARR DB, FISHER JE, MOMTAZ K, AND PARRISH JA. -Endorphin and -lipotropin response to ultraviolet radiation. Lancet 2: 166, 1983. 206. LI HE, HEDGER MP, CLEMENTS JA, AND RISBRIDGER GP. Localization of immunoreactive beta-endorphin and adrenocorticotropic hormone and pro-opiomelanocortin mRNA to rat testicular interstitial tissue macrophages. Biol Reprod 45: 282–289, 1991. 207. LIAW CW, LOVENBERG TW, BARRY G, OLTERSDORF T, DEGRIGORIADIS, AND DE SOUZA EB. Cloning and characterization of the human corticotropin-releasing factor-2 receptor complementary deoxyribonucleic acid. Endocrinology 137: 72–77, 1996. 208. LICINIO J, GOLD PW, AND WONG ML. A molecular mechanism for stress-induced alterations in susceptibility to disease. Lancet 346: 104 –106, 1995. 209. LIPTON JM AND CATANIA A. Mechanisms of anti-inflammatory action of the neuroimmunomodulatory peptide alpha-MSH. Ann NY Acad Sci 840: 373–380, 1998. 210. LIPTON JM, CERIANI G, MACALUSO A, MCCOY D, CARNES K, BILTZ J, AND CATANIA A. Anti-inflammatory effects of the neuropeptide alpha-MSH in acute, chronic, and systemic inflammation. Ann NY Acad Sci 741: 137–148, 1994. 211. LIU P-Y AND JOHANSSON O. Immunohistochemical evidence of ␣-, -, and ␥3-melanocyte stimulating hormone expression in cutaneous malignant melanoma of nodular type. J Dermatol Sci 10: 203–212, 1998. 212. LIU P-Y, LONTZ W, BONDESSON L, AND JOHANSSON O. The possible role of ␣,  and ␥3 melanocyte stimulating hormonecontaining keratinocytes in the initiation of vitiligo vulgaris. Eur J Dermatol 5: 625– 630, 1995. 213. LOGAN A AND WEATHERHEAD B. Effects of ␣-melanocyte-stimulating hormone and [8-arginine] vasotocin upon melanogenesis in vitro. J Endocrinol 91: 501–507, 1981. 214. LOIR B, BOUCHARD B, MORANDINI R, DEL MARMOL V, DERAEMAECKER R, GARCIA-BORRON JC, AND GHANEM G. Immunoreactive ␣-melanotropin as an autocrine effector in human melanoma cells. Eur J Biochem 244: 923–930, 1997. 215. LOIR B, SALES F, DERAEMAECKER R, MORANDINI R, GARCIABORRON JC, AND GHANEM G. ␣-Melanotropin immunoreactivity in human melanoma exudate is related to necrosis. Eur J Cancer 34: 424 – 426, 1998. 216. LOLAIT SJ, CLEMENTS JA, MARKWICK AJ, CHENG C, MCNALLY M, SMITH A, AND FUNDER JW. Pro-opiomelanocortin messenger ribonucleic acid and posttranslational processing of beta endorphin in spleen macrophages. J Clin Invest 77: 1776 –1779, 1986. 217. LOVENBERG TW, LIAW CW, GRIGORIADIS DE, CLEVENGER W, CHALMERS DT, DE SOUZA EB, AND OLTERSDORF T. Cloning and characterization of a functionally distinct corticotropin-releasing factor receptor subtype from rat brain. Proc Natl Acad Sci USA 92: 836 – 840, 1995. 218. LOWRY PJ, WOODS RJ, AND BAIGENT S. Corticotropin releasing factor and its binding protein. Pharmacol Biochem Behav 54: 305– 308, 1996. 219. LUGER TA, SCHAUER E, TRAUTINGER F, KRUTMANN J, ANSEL J, SCHWARZ A, AND SCHWARZ T. Production of immunosuppressing melanotropins by human keratinocytes. Ann NY Acad Sci 680: 567–570, 1993. 220. LUGER TA, SCHOLZEN T, BRZOSKA T, BECHER E, SLOMINSKI A, AND PAUS R. Cutaneous immunomodulation and coordination of skin stress responses by alpha-melanocyte-stimulating hormone. Ann NY Acad Sci 840: 381–394, 1998. 221. LUGER TA, SCHWARZ T, KALDEN H, SCHOLZEN T, SCHWARZ A, AND BRZOSKA T. Role of epidermal cell derived ␣-melanocyte stimulating hormone in ultraviolet light mediated local immunosuppression. Ann NY Acad Sci 885: 209 –216, 1999. 222. LUNDBLAD JR AND ROBERTS JL. Regulation of propiomelanocortin gene expression in pituitary. Endocr Rev 9: 135–158, 1988. 223. LUNEC J, PIERON JC, SHERBET GV, AND THODY AJ. Alphamelanocortin-stimulating hormone immunoreactivity in melanoma cell. Pathobiology 58: 193–197, 1990. Volume 80 July 2000 246. 247. 248. 249. 250. 252. 253. 254. 255. 256. 257. 258. 259. 260. 261. 262. 263. 264. factor stimulates cyclic AMP, arachidonic acid release, and growth of lung cancer cells. Peptides 15: 281–285, 1994. MORANDINI R, BOEYNAEMS JM, HEDLEY SJ, MACNEIL S, AND GHANEM G. Modulation of ICAM-1 expression by alpha-MSH in human melanoma cells and melanocytes. J Cell Physiol 175: 276 – 282, 1998. MORHENN VB. The physiology of scratching: involvement of proopiomelanocortin gene-coded proteins in Langerhans cells. Prog Neurol Endocrinol Immunol 4: 265–267, 1991. MOUNTJOY KG. The human melanocyte stimulating hormone receptor has evolved to become “super-sensitive” to melanocortin peptides. Mol Cell Endocrinol 102: R7–R11, 1994. MOUNTJOY KG, BIRD IM, RAINEY WE, AND CONE RD. ACTH induces up-regulation of ACTH receptor mRNA in mouse and human adrenocortical cell lines. Mol Cell Endocrinol 99: R17–R20, 1994. MOUNTJOY KG, ROBBINS LS, MORTRUD MT, AND CONE RD. The cloning of a family of genes that encode the melanocortin receptors. Science 257: 1248 –1251, 1992. MOUNTJOY KG AND WONG J. Obesity, diabetes and functions for proopiomelanocortin-derived peptides. Mol Cell Endocrinol 128: 171–177, 1997. MOZZANICA N, VILLA ML, FOPPA S, VIGNATI G, CATTANEO A, DIOTTI R, AND FINZI AF. Plasma alpha-melanocyte-stimulating hormone, beta-endorphin, met-enkephalin, and natural killer cell activity in vitiligo. J Am Acad Dermatol 26: 693–700, 1992. MUGLIA LJ, JENKINS NA, GILBERT DJ, COPELAND NG, AND MAJZOUB JA. Expression of the mouse corticotropin-releasing hormone gene in vivo and targeted inactivation in embryonic stem cells. J Clin Invest 93: 2066 –2072, 1994. MUGRIDGE KG, PERRETTI M, GHIARA P, AND PARENTE L. Alpha-melanocyte-stimulating hormone reduces interleukin-1 beta effects on rat stomach preparations possibly through interference with a type I receptor. Eur J Pharmacol 197: 151–155, 1991. NAGAHAMA M, FUNASAKA Y, FERNANDEZ-FREZ ML, OHASHI A, CHAKRABORTY AK, UEDA M, AND ICHIHASHI M. Immunoreactivity of ␣-melanocyte-stimulating hormone, adrenocorticotrophic hormone and -endorphin in cutaneous malignant melanoma and benign melanocytic naevi. Br J Dermatol 138: 981–985, 1998. NAVILLE D, BARJHOUX L, JAILLARD C, SAEZ JM, DURAND P, AND BEGEOT M. Stable expression of normal and mutant human ACTH receptor study of ACTH binding and coupling to adenylate cyclase. Mol Cell Endocrinol 129: 83–90, 1997. NORDLUND JJ, BOISSY RE, HEARING VJ, KING RA, AND PORTONNE J. The Pigmentary System: Physiology and Pathophysiology. New York: Oxford Univ. Press, 1998. OATES EL, ALLAWAY GP, ARMSTRONG GR, BOYAJIAN RA, KEHRL JH, AND PRABHAKAR BS. Human lymphocytes produce pro-opiomelanocortin gene-related transcripts. Effects of lymphotropic viruses. J Biol Chem 263: 10041–10044, 1988. OATES EL, ALLAWAY GP, AND PRABHAKAR BS. A potential for mutual regulation of proopiomelanocortin gene and Epstein-Barr virus expression in human lymphocytes. Ann NY Acad Sci 594: 60 – 65, 1990. ODONOHUE TL AND DORSA DM. The opiomelanotropinergic neuronal and endocrine system. Peptides 3: 353–395, 1982. OHMORI N, ITOI K, TOZAWA F, SAKAI Y, SAKAI K, HORIBA N, DEMURA H, AND SUDA T. Effect of acetylcholine on corticotropine-releasing factor gene expression in the hypothalamic paraventricular nucleus of conscious rats. Endocrinology 136: 4858 – 4863, 1995. OKI Y, IWABUCHI M, MASUZAWA M, WATANABE F, OZAWA M, IINO K, TOMINAGA T, AND YOSHIMI T. Distribution and concentration of urocortin and effect of adrenalectomy on its content in rat hypothalamus. Life Sci 62: 807– 812, 1998. OKOSI A, BRAR BK, CHAN M, SOUZA LDE, SMITH E, STEPHANOU A, LATCHMAN DS, CHOWDREY HS, AND KNIGHT RA. Expression and protective effects of urocortin in cardiac myocytes. Neuropeptides 32: 167–171, 1998. OREL L, SIMON MM, KARLSEDER J, BHARDWAJ R, TRAUTINGER F, SCHWARZ T, AND LUGER TA. ␣-Melanocyte-stimulating hormone down-regulates differentiation-driven heat shock protein 1015 70 expression in keratinocytes. J Invest Dermatol 108: 401– 405, 1997. 265. ORLOW SJ, CHAKRABORTY AK, AND PAWELEK JM. Retinoic acid is a potent inhibitor of inducible pigmentation in mouse and hamster melanoma cells. J Invest Dermatol 94: 461– 464, 1990. 266. ORLOW SJ, HOTCHKISS S, AND PAWELEK JM. Internal binding sites for MSH in wild type and variant Cloudman melanoma cells. J Cell Physiol 142: 129 –136, 1990. 267. ORTH DN. Corticotropin-releasing hormone in humans. Endocr Rev 13: 164 –191, 1992. 268. OWENS A AND NEMEROFF CB. Physiology and pharmacology of corticotropin releasing factor. Pharmacol Rev 43: 425– 473, 1991. 268a.PAEZ PEREDA M, SAUER J, PEREZ CASTRO C, FINKIELMAN S, STALLA GK, HOLSBOER F, AND ARZT E. Corticotropin-releasing hormone differentially modulates the interleukin-1 system according to the level of monocyte activation by endotoxin. Endocrinology 136: 5504 –5510, 1995. 269. PANERAI AE AND SACERDOTE P. Beta-endorphin in the immune system: a role at last? Immunol Today 18: 317–319, 1997. 270. PAQUET L, ZHOU A, CHANG EY, AND MAINS RE. Peptide biosynthetic processing: distinguishing prohormone convertases PC1 and PC2. Mol Cell Endocrinol 120: 161–168, 1996. 271. PARK HY, RUSSAKOVSKY V, AO Y, FERNANDEZ E, AND GILCHREST BA. ␣-Melanocyte stimulating hormone-induced pigmentation is blocked by depletion of protein kinase C. Exp Cell Res 227: 70 –79, 1996. 272. PAUS R. Control of the hair cycle and hair diseases as cycling disorders. Curr Opin Dermatol 3: 248 –258, 1996. 273. PAUS R, BOTCHKAREV VA, BOTCHKAREVA NV, FECHNER K, FURKERT J, ROLOFF B, AND SLOMINSKI A. The skin POMC system (SPS): leads and lessons from the hair follicle. Ann NY Acad Sci 885: 350 –363, 1999. 274. PAUS R, HANDJISKI B, CZARNETZKI BM, AND EICHMULLER S. A murine model for inducing and manipulating hair follicle regression (catagen): effects of dexamethasone and cyclosporin A. J Invest Dermatol 103: 143–147, 1994. 275. PAUS R, MAURER M, SLOMINSKI A, AND CZARNETZKI BM. Mast cell involvement in murine hair growth. Dev Biol 163: 230 –240, 1994. 276. PAUS R, PETERS EM, EICHMUELLER S, AND BOTCHKAREV VA. Neural mechanisms of hair growth control. J Invest Dermatol Symp Proc 2: 61– 68, 1998. 277. PAWELEK JM. A cyclic AMP requirement for proliferation of Cloudman S91 melanoma cells. Pigment Cell Res 4: 167–176, 1979. 278. PAWELEK JM. Evidence suggesting that a cyclic AMP-dependent protein kinase is a positive regulator of proliferation in Cloudman S91 melanoma cells. J Cell Physiol 98: 619 – 625, 1979. 279. PAWELEK JM. Studies on the Cloudman melanoma cell line as a model for the action of MSH. Yale J Biol Med 58: 571–578, 1985. 280. PAWELEK JM. Is human melanogenesis stimulated by cyclic AMP? J Invest Dermatol 94: 499 –500, 1990. 281. PAWELEK JM. After dopachrome? Pigment Cell Res 4: 53– 62, 1991. 282. PAWELEK JM. Proopiomelanocortin in skin: new possibilities for regulation of skin physiology. J Lab Clin Med 122: 627– 628, 1993. 283. PAWELEK JM, CHAKRABORTY AL, OSBER MP, ORLOW SJ, MIN KK, ROSENZWEIG KE, AND BOLOGNIA JL. Molecular cascades in UV-induced melanogenesis: a central role for melanotropins? Pigment Cell Res 5: 348 –356, 1992. 284. PAWELEK JM, FLEISCHMANN R, MCLANE J, GUILLETTE B, EMANUEL J, KORNER A, BERGSTROM A, AND MURRAY M. Studies on growth and pigmentation of Cloudman S91 melanoma cells. Pigment Cell Res 6: 521–533, 1984. 285. PAWELEK JM, HALABAN R, AND CHRISTIE G. Melanoma cells with a cyclic AMP growth requirement. Nature 258: 539 –540, 1975. 286. PAWELEK JM, KORNER A, BERGSTROM A, AND BOLOGNIA J. New regulators of melanin biosynthesis and the autodestruction of melanoma cells. Nature 286: 617– 619, 1980. 287. PAWELEK JM, SANSONE M, KOCH N, CHRISTIE G, HALABAN R, HENDEE J, LERNER AB, AND VARGA JM. Melanoma cells resistant to inhibition of growth by melanocyte-stimulating hormone. Proc Natl Acad Sci USA 72: 951–956, 1975. 288. PAWELEK JM, SANSONE M, MOROWITZ J, MOELLMANN G, AND Downloaded from http://physrev.physiology.org/ by 10.220.33.6 on July 4, 2017 251. CRH-POMC SIGNALING IN A CUTANEOUS STRESS RESPONSE 1016 289. 290. 291. 293. 294. 296. 297. 298. 299. 300. 301. 302. 303. 304. 305. 306. 307. 308. GODAWSKA E. Genetic control of melanization: isolation and analysis of amelanotic variants from cultured melanotic melanoma cells. Proc Natl Acad Sci USA 71: 1073–1077, 1974. PEARS JS, JUNG RT, BARTLETT W, BROWNING MC, KENICER K, AND THODY AJ. A case of skin hyperpigmentation due to ␣-MSH hypersecretion. Br J Dermatol 126: 286 –289, 1992. PENG PJ, SAHM UG, DOHERTY RV, KINSMAN RG, MOSS SH, AND POUTON CW. Binding and biological activity of C-terminally modified melanocortin peptides: a comparison between their actions at rodent MC1 and MC3 receptors. Peptides 7: 1001–1008, 1997. PENHOAT A, JAILLARD C, AND SAEZ JM. Corticotropin positively regulates its own receptors and cAMP response in cultured bovine adrenal cells. Proc Natl Acad Sci USA 86: 4978 – 4981, 1989. PERKINS AV, WOLFE CD, EBEN F, SOOTHILL P, AND LINTON EA. Corticotropin-releasing hormone-binding protein in human fetal plasma. J Endocrinol 146: 395– 401, 1995. PERONE MJ, MURRAY CA, BROWN OA, GIBSON S, WHITE A, LINTON EA, PERKINS AV, LOWENSTEIN PR, AND CASTRO MG. Procorticotropin-releasing hormone: endoproteolytic processing and differential release of its derived peptides within AtT20 cells. Mol Cell Endocrinol 142: 191–202, 1998. PERONE M, WINDEATT S, MORRISON E, SHERING A, TOMASEC P, LINTON E, LOWENSTEIN P, AND CASTRO M. Intracellular retention of the corticotropin-releasing hormone (CRH) precursors within COS-7 cells. J Histochem Cytochem 46: 1193–1197, 1998. PERRIN M, DONALDSON C, CHEN R, BLOUNT A, BERGGREN T, BILEZIKJIAN L, SAWCHENKO P, AND VALE W. Identification of a second corticotropin-releasing factor receptor gene and characterization of a cDNA expressed in heart. Proc Natl Acad Sci USA 92: 2969 –2973, 1995. PETRAGLIA F, FLORIO P, NAPPI C, AND GENAZZANI AR. Peptide signaling in human placenta and membranes: autocrine, paracrine, and endocrine mechanisms. Endocr Rev 17: 156 –186, 1996. PETRAGLIA F, FLORIA P, GALLO R, SIMONCINI T, SAVIOZZI M, DI BLASIO AM, VAUGHAN J, AND VALE W. Human placenta and fetal membranes express human urocortin mRNA and peptide. J Clin Endocrinol Metab 81: 3807–3810, 1996. PETRAGLIA F, GARUTI GC, DE RAMUNDO B, ANGIONI S, GENAZZANI AR, AND BILEZIKJIAN LM. Mechanism of action of interleukin-1 in increasing corticotropin-releasing factor and adrenocorticotropin hormone release from cultured human placental cells. Am J Obstet Gynecol 163: 1307–1312, 1990. PETRAGLIA F, POTTER E, CAMERON VA, SUTTON S, BEHAN DP, WOODS RJ, SAWCHENKO PE, LOWRY PJ, AND VALE W. Corticotropin-releasing factor-binding protein is produced by human placenta and intrauterine tissues. J Clin Endocrinol Metab 77: 919 –924, 1993. PETRAGLIA F, SANTUZ M, FLORIO P, SIMONCINI T, LUISI S, PLAINO L, GENASSANI AR, GENAZZANI AD, AND VOLPE A. Paracrine regulation of human placenta: control of hormonogenesis. J Reprod Immunol 39: 221–233, 1998. PETRAGLIA F, SAWCHENKO PE, RIVIER J, AND VALE W. Evidence for local stimulation of ACTH secretion by corticotropinreleasing factor in human placenta. Nature 328: 717–719, 1987. PETRAGLIA F, TABANELLI S, GALASSI MC, GARUTI GC, MANCINI AC, GENAZZANI AR, AND GURPIDE E. Human decidua and in vitro decidualized endometrial stromal cells at term contain immunoreactive corticotropin-releasing factor (CRF) and CRF messenger ribonucleic acid. J Clin Endocrinol Metab 74: 1427–1431, 1992. PFROMMER C, KUNZ C, LUGER TA, AND HENZ BM. Proopiomelanocortin products enhance histamine and LTC4 release from the human cell line HMC 1 and human cutaneous mast cells in vitro. J Invest Dermatol 107: 507, 1996. PLOTNIKOFF NP, FAITH RE, MURGO AJ, AND GOOD RA. Cytokines: Stress and Immunity. Boca Raton, FL: CRC, 1999. POMERANTZ SH AND HUANG LC. Effects of -MSH, cortisol and ACTH on tyrosinase in the skin of newborn hamsters and mice. Endocrinology 87: 302–310, 1970. POTTER E, BEHAN DP, FISCHER WH, LINTON EA, LOWRY PJ, AND VALE WW. Cloning and characterization of the cDNA for human and rat corticotropin releasing factor-binding proteins. Nature 349: 423– 426, 1991. POTTER E, SUTTON S, DONALDSON C, CHEN R, PERRIN M, 309. 310. 311. 312. 313. 314. 315. 316. 317. 318. 319. 320. 321. 322. 323. 324. 325. 326. 327. 328. Volume 80 LEWIS K, SAWCHENKO PE, AND VALE W. Distribution of corticotropin-releasing factor receptor mRNA expression in the rat brain and pituitary. Proc Natl Acad Sci USA 91: 8777– 8781, 1994. POZZOLI G, BILEZIKJIAN LM, PERRIN MH, BLOUNT AL, AND VALE WW. Corticotropin-releasing factor (CRF) and glucocorticoids modulate the expression of type 1 CRF receptor messenger ribonucleic acid in rat anterior pituitary cell cultures. Endocrinology 137: 65–71, 1996. PRIMUS RJ, YEVICH E, BALTAZAR C, AND GALLAGER DW. Autoradiographic localization of CRF1 and CRF2 binding sites in adult rat brain. Neuropsychopharmacology 17: 308 –316, 1997. QUILLAN JM AND SADEE W. Dynorphin peptides: antagonists of melanocortin receptors. Pharm Res 14: 713–719, 1997. RAJORA N, CERIANI G, CATANIA A, STAR RA, MURPHY MT, AND LIPTON JM. alpha-MSH production, receptors, and influence on neopterin in a human monocyte/macrophage cell line. J Leukoc Biol 59: 248 –253, 1996. RAY D AND MELMED S. Pituitary cytokine and growth factor expression and action. Endocr Rev 18: 206 –228, 1997. REDONDO P, GARCIA-FONCILLAS J, OKROUJNOV I, AND BANDRES E. Alpha-MSH regulates interleukin-10 expression by human keratinocytes. Arch Dermatol Res 290: 425– 428, 1998. RHEINS LA, COTLEUR AL, KLEIER RS, HOPPENJANS WB, SAUNDER DN, AND NORDLUND JJ. Alpha-melanocyte stimulating hormone modulates contact hypersensitivity responsiveness in C57BL6 mice. J Invest Dermatol 93: 511–517, 1989. RICHTER RM AND MULVANY MJ. Comparison of hCRF and oCRF effects on cardiovascular responses after central, peripheral, and in vitro application. Peptides 16: 843– 849, 1995. ROBBINS LS, NADEAU JH, JOHNSON KR, KELLY MA, ROSELLIREHFUSS L, EBAACK, MOUNTJOY KG, AND CONE RD. Pigmentation phenotypes of variant extension locus alleles result from point mutations that alter MSH receptor function. Cell 72: 827– 834, 1993. RODRÍGUEZ-LIÑARES B, LINTON EA, AND PHANEUF S. Expression of corticotrophin-releasing hormone receptor mRNA a protein in the human myometrium. J Endocrinol 156: 15–21, 1998. ROE CM, LEITCH IM, BOURA AL, AND SMITH R. Nitric oxide regulation of corticotropin-releasing hormone release from the human perfused placenta in vitro. J Clin Endocrinol Metab 81: 763–769, 1996. ROHDE E, FURDERT J, FECHNER K, BEYERMANN M, MULVANY MJ, RICHTER RM, DENEF C, BIENERT M, AND BERGER H. Corticotropin releasing hormone (CRH) receptors in the mesenteric small arteries of rats resemble the (2)-subtype. Biochem Pharmacol 52: 829 – 833, 1996. ROLOFF B, FECHNER K, SLOMINSKI A, FURKERT J, BOTCHKAREV VA, BULFONE-PAUS S, ZIPPER J, KRAUSE E, AND PAUS R. Hair cycle-dependent expression of corticotropin releasing factor (CRF) and CRF receptors (CRF-R) in murine skin. FASEB J 12: 287–297, 1998. ROSE J. Bilateral adrenalectony induces early onset of summer fur growth in mink (Mustela vison). Comp Biochem Physiol 111: 243– 247, 1995. ROSE J. Adrenocorticotropic hormone (ACTH) but not alpha-melanocyte stimulating hormone (␣-MSH) as a mediator of adrenalectomy induced hair growth in mink. J Invest Dermatol 110: 456 – 457, 1998. ROSE J AND STERNER M. The role of the adrenal glands in regulating onset of winter fur growth in mink (Mustela vison). J Exp Zool 262: 469 – 473, 1992. RUST CC AND MEYER RK. Effect of pituitary autografts on hair color in the short-tailed weasel. Gen Comp Endocrinol 11: 548 –551, 1968. RUST CC, SHACKELFORD RM, AND MEYER RK. Hormonal control of pelage cycles in the mink. J Mammal 46: 549 –565, 1965. SAHU A. Evidence suggesting that galanin (GAL), melanin-concentrating hormone (MCH), neurotensin (NT), proopiomelanocortin (POMC) and neuropeptide Y(NPY) are targets of leptin signalling in the hypothalamus. Endocr Rev 139: 795–798, 1998. SAHU SN, EDWARDS-PRASAD J, AND PRASAD KN. Alpha tocopherol succinate inhibits melanocyte-stimulating hormone (MSH)sensitive adenylate cyclase activity in melanoma cells. J Cell Physiol 133: 585–589, 1987. Downloaded from http://physrev.physiology.org/ by 10.220.33.6 on July 4, 2017 295. SLOMINSKI, WORTSMAN, LUGER, PAUS, AND SOLOMON July 2000 CRH-POMC SIGNALING IN A CUTANEOUS STRESS RESPONSE 348. SHIBAHARA S, MORIMOTO Y, FURUTANI Y, NOTAKE M, TAKAHASHI H, SHIMIZU S, HORIKAWA S, AND NUMA S. Isolation and sequence analysis of the human corticotropin-releasing factor precursor gene. EMBO J 2: 775–779, 1983. 349. SHIMIZU T AND STREILEIN JW. Influence of alpha-melanocyte stimulating hormone on induction of contact hypersensitivity and tolerance. J Dermatol Sci 8: 187–193, 1994. 350. SHIZUME K, LERNER AB, AND FITZPATRICK TB. In vitro bioassay for the melanocyte stimulating hormone. Endocrinology 54: 553– 560, 1954. 351. SIEGRIST W AND EBERLE AN. Homologous regulation of the MSH receptor in melanoma cells. J Receptor Res 13: 263–281, 1993. 352. SIEGRIST W AND EBERLE AN. Melanocortin and their implication in melanoma. Trends Endocrinol Metab 6: 115–120, 1995. 353. SLOMINSKI A. POMC gene expression in hamster and mouse melanoma cells. FEBS Lett 291: 165–168, 1991. 354. SLOMINSKI A. Identification of -endorphin, ␣-MSH and ACTH peptides in cultured human melanocytes, melanoma and squamous cell carcinoma cells by RP-HPLC. Exp Dermatol 7: 213–216, 1998. 355. SLOMINSKI A, BAKER J, ERMAK G, CHAKRABORTY A, AND PAWELEK J. Ultraviolet B stimulates production of corticotropin releasing factor (CRF) by human melanocytes. FEBS Lett 399: 175–176, 1996. 356. SLOMINSKI A, BOTCHKAREV NV, BOTCHKAREV VA, CHAKRABORTY A, LUGER T, UENALAN M, AND PAUS R. Hair cycle dependent production of ACTH in mouse skin. Biochim Biophys Acta 1448: 147–152, 1998. 357. SLOMINSKI A, BOTCHKAREV V, CHOUDHRY M, FAZAL N, FECHNER K, FURKERT J, KRAUSE E, ROLOFF B, SAYEED M, WEI E, ZBYTEK B, ZIPPER J, WORTSMAN J, AND PAUS R. Cutaneous expression of CRH and CRH-R: is there a “skin stress response system?”. Ann NY Acad Sci 885: 287–311, 1999. 358. SLOMINSKI A, COSTANTINO R, WORTSMAN J, PAUS R, AND LING N. Melanotropic activity of gamma MSH peptides in melanoma cells. Life Sci 50: 1103–1108, 1992. 359. SLOMINSKI A, ERMAK G, HWANG J, CHAKRABORTY A, MAZURKIEWICZ JE, AND MIHM M. Proopiomelanocortin, corticotropin releasing hormone and corticotropin releasing hormone receptor genes are expressed in human skin. FEBS Lett 374: 113–116, 1995. 360. SLOMINSKI A, ERMAK G, HWANG J, MAZURKIEWICZ JE, CORLISS D, AND EASTMAN A. The expression of proopiomelanocortin (POMC) and of corticotropin releasing hormone receptor (CRH-R) genes in mouse skin. Biochim Biophys Acta 1289: 247–251, 1996. 361. SLOMINSKI A, ERMAK G, MAZURKIEWICZ JE, BAKER J, AND WORTSMAN J. Characterization of corticotropin releasing hormone (CRH) in human skin. J Clin Endocrinol Metab 83: 1020 – 1024, 1998. 362. SLOMINSKI A, ERMAK G, AND MIHM M. ACTH receptor, CYP11A1, CYP17 and CYP21A2 genes are expressed in skin. J Clin Endocrinol Metab 81: 2746 –2749, 1996. 363. SLOMINSKI A, HEASLEY D, MAZURKIEWICZ JE, ERMAK G, BAKER J, AND CARLSON JA. Expression of proopiomelanocortin (POMC) derived melanocyte stimulating hormone (MSH) and ACTH peptides in skin of basal cell carcinoma patients. Hum Pathol 30: 208 –215, 1999. 364. SLOMINSKI A, JASTREBOFF P, AND PAWELEK J. L-Tyrosine stimulates induction of tyrosinase activity by MSH and reduces cooperative interactions between MSH receptors in hamster melanoma cells. Biosci Rep 9: 579 –586, 1989. 365. SLOMINSKI A AND MIHM M. Potential mechanism of skin response to stress. Int J Dermatol 35: 849 – 851, 1996. 366. SLOMINSKI A, MOELLMANN G, AND KUKLINSKA E. MSH inhibits growth in a line of amelanotic hamster melanoma cells and induces increases in cAMP levels and tyrosinase activity without inducing melanogenesis. J Cell Sci 92: 551–559, 1989. 367. SLOMINSKI A AND PAUS R. Bomirski melanomas: a versatile and powerful model for pigment cell and melanoma research. Int J Oncol 2: 21–228, 1993. 368. SLOMINSKI A AND PAUS R. Melanogenesis is coupled to murine anagen: toward new concepts for the role of melanocytes and the regulation of melanogenesis in hair growth. J Invest Dermatol 101: 90S–97S, 1993. Downloaded from http://physrev.physiology.org/ by 10.220.33.6 on July 4, 2017 329. SAIARDI A AND BORRELLI E. Absence of dopaminergic control on melanotrophs leads to Cushing’s-like syndrome in mice. Mol Endocrinol 12: 1133–1139, 1998. 330. SAKAI K, YAMADA M, HORIBA N, WAKUI M, DEMURA H, AND SUDA T. The genomic organization of the human corticotropinreleasing factor type-1 receptor. Gene 219: 125–130, 1998. 331. SAPERSTEIN A, BRAND H, AUDHYA T, NABRISKI D, HUTCHINSON B, ROSENZWEIG S, AND HOLLANDER CS. Interleukin 1 mediates stress-induced immunosuppression via corticotropin-releasing factor. Endocrinology 130: 152–158, 1992. 332. SCATENA C AND ADLER S. Characterization of a human-specific regulator of placental corticotropin-releasing hormone. Mol Endocrinol 12: 1228 –1240, 1998. 333. SCHAFER M, CARTER L, AND STEIN C. Interleukin 1 and corticotropin-releasing factor inhibit pain by releasing opioids from immune cells in inflamed tissue. Pharmacology 91: 4219 – 4223, 1994. 334. SCHAFER M, MOUSA SA, AND STEIN C. Corticotropin-releasing factor in antinociception and inflammation. Eur J Pharmacol 323: 1–10, 1997. 335. SCHAFER M, MOUSA SA, ZHANG Q, CARTER L, AND STEIN C. Expression of corticotropin-releasing factor in inflamed tissue is required for intrinsic peripheral opioid analgesia. Proc Natl Acad Sci USA 93: 6096 – 6100, 1996. 336. SCHALLREUTER K, SLOMINSKI A, PAWELEK JM, JIMBOW K, AND GILCHREST BA. What control melanogenesis? Exp Dermatol 7: 143–150, 1998. 337. SCHAUER E, TRAUTINGER F, KOCK A, SCHWARZ A, BHARDWAI R, ANSEL JC, SCHWARZ T, AND LUGER TA. Proopiomelanocortin derived peptides are synthesized and released by human keratinocytes. J Clin Invest 93: 2258 –2262, 1994. 338. SCHILLING L, KANZLER C, SCHMIEDEK P, AND EHRENREICH H. Characterization of the relaxant action of urocortin, a new peptide related to corticotropin-releasing factor in the rat isolated basilar artery. Br J Pharmacol 125: 1164 –1171, 1998. 339. SCHIOTH HB, MUCENIECE R, LARSSON M, AND WIKBERG JE. The melanocortin 1, 3, 4 or 5 receptors do not have a binding epitope for ACTH beyond the sequence of alpha-MSH. J Endocrinol 155: 73–78, 1997. 340. SCHIOTH HB, MUTULIS F, MUCENIECE R, PRUSIS P, AND WIKBERG JE. Selective properties of C- and N-terminals and core residues of the melanocyte-stimulating hormone on binding to the human melanocortin receptor subtypes. Eur J Pharmacol 2–3: 359 –366, 1998. 341. SCHOLZEN TE, BRZOSKA T, KALDEN DH, HARTMEYER M, LUGER TA, ARMSTRONG CA, AND ANSEL JC. Expression of proopiomelanocortin peptides and prohormone convertases by human dermal microvascular endothelial cells. Ann NY Acad Sci 885: 444 – 447, 1999. 342. SCHOLZEN TE, BRZOSKA T, KALDEN DH, HARTMEYER M, FASTRICH M, LUGER TA, ARMSTRONG CA, AND ANSEL JC. Expression of functional melanocortin receptors and proopiomelanocortin peptides by human dermal microvascular endothelial cells. Ann NY Acad Sci 885: 239 –253, 1999. 343. SCOTT AP AND LOWRY PJ. Adrenocorticotrophic- and melanocytestimulating peptides in the human pituitary. Biochem J 139: 593– 602, 1974. 344. SEASHOLTZ A, BOURBONAIS F, HARNDEN C, AND CAMPER S. Nucleotide sequence and expression of the mouse corticotropinreleasing hormone gene. Mol Cell Neurosci 2: 266 –273, 1991. 345. SEIDAH NG, FOURNIER H, BOILEAU G, BENJANNET S, RONDEAU N, AND CHRETIEN M. The cDNA structure of the porcine pro-hormone convertase PC2 and the comparative processing by PC1 and PC2 of the N-terminal glycopeptide segment of porcine POMC. FEBS Lett 310: 235–239, 1992. 346. SHAHABI AN, BURTNESS MZ, AND SHARP BM. N-acetyl--endorphin1–31 antagonized the suppressive effect of -endorphin1–31 on murine splenocyte proliferation via a noloxone-resistant receptor. Biochem Biophys Res Commun 175: 936 –942, 1991. 347. SHALTS E, FENG JY, FERIN M, AND WARDLAW SL. ␣-Melanocytestimulating hormone antagonized the neuroendocrine effects of corticotropin-releasing factor and interleukin-1 in the primate. Endocrinology 131: 132–138, 1992. 1017 1018 SLOMINSKI, WORTSMAN, LUGER, PAUS, AND SOLOMON 391. 392. 393. 394. 395. 396. 397. 398. 399. 400. 401. 402. 403. 404. 405. 406. 407. 408. 409. nitric oxide synthase by alpha-MSH. Proc Natl Acad Sci USA 92: 8016 – 8020, 1995. STENZEL P, KESTERSON R, YEUNG W, CONE RD, RITTENBERG MB, AND STENZEL-POORE MP. Identification of a novel murine receptor for corticotropin-releasing hormone expressed in the heart. Mol Endocrinol 9: 637– 645, 1995. STENZEL-POORE M, VALE WW, AND RIVIER C. Relationship between antigen-induced immune stimulation and activation of the hypothalamic-pituitary-adrenal axis in the rat. Endocrinology 132: 1313–1318, 1993. STEPHANOU A, FITZHARRIS P, KNIGHT RA, AND LIGHTMAN SL. Characteristics and kinetics of proopiomelanocortin mRNA expression by human leucocytes. Brain Behav Immun 5: 319 –327, 1991. STEPHANOU A, JESSOP DS, KNIGHT RA, AND LIGHTMAN SL. Corticotropin-releasing factor-like immunoreactivity and mRNA in human leukocytes. Brain Behav Immun 4: 67–73, 1990. STEPHANOU A, OKOSI A, KNIGHT RA, CHOWDREY HS, AND LATCHMAN DS. C/EBP activates the human corticotropin-releasing hormone gene promoter. Mol Cell Endocrinol 134: 41–50, 1997. STEVENS MY, CHALLIS JR, AND LYE SJ. Corticotropin-releasing hormone receptor subtype 1 is significantly up-regulated at the time of labor in the human myometrium. J Clin Endocrinol Metab 83: 4107– 4115, 1998. STURM RA, BOX NF, AND RAMSAY M. Human pigmentation genetics: the difference is only skin deep. Bioessays 20: 712–721, 1998. SUDA T, TOZAWA F, DOBASHI I, HORIBA N, OHMORI N, YAMAKADO M, YAMADA M, AND DEMURA H. Corticotropin-releasing hormone, proopiomelanocortin, and glucocorticoid receptor gene expression in adrenocorticotropin-producing tumors in vitro. J Clin Invest 92: 2790 –2795, 1993. SUKHANOV VA, VORONKOVA IM, SHVETS SV, DYAKOV VL, AND MOROZOVA LF. Melanocyte-stimulating hormone (␣-MSH) inhibits the growth of human malignant melanoma cells with the induction of phosphatidylinositol and myo-inositol phosphate levels. Biochem Int 24: 625– 632, 1991. SUZUKI I, CONE RD, IM S, NORDLUND J, AND ABDEL-MALEK ZA. Binding of melanotropin hormones to the melanocortin receptor MC1R on human melanocytes stimulates proliferation and melanogenesis. Endocrinology 137: 1627–1633, 1996. SUZUKI I, TADA A, OLLMANN MM, BARSH GS, IM S, LAMOREUX ML, HEARING VJ, NORDLUND JJ, AND ABDEL-MALEK ZA. Agouti signaling protein inhibits melanogenesis and the response of human melanocytes to alpha-melanotropin. J Invest Dermatol 108: 838 – 842, 1997. TAKAHASHI A, AMEMIYA Y, SARASHI M, SOWER SA, AND KAWAUCHI H. Melanotropin and corticotropin are encoded on two distinct genes in the lamprey, the earliest evolved extant vertebrate. Biochem Biophy Res Commun 213: 490 – 498, 1995. TAKAHASHI K, TOTSUNE K, SONE M, MURAKAMI O, SATOH F, ARIHARA Z, SASANO H, IINO K, AND MOURI T. Regional distribution of urocortin-like immunoreactivity and expression of urocortin mRNA in the human brain. Peptides 19: 643– 647, 1998. TAKEUCHI S AND TAKAHASHI S. Melanocortin receptor genes in the chicken: tissue distributions. Gen Comp Endocrinol 112: 220 – 231, 1998. TAMATE HB AND TAKEUCHI T. Action of the e locus of mice in the response of phaeomelanic hair follicles to ␣-melanocyte-stimulating hormone in vitro. Science 24: 1241–1242, 1984. TATRO JB AND REICHLIN S. Specific receptors for ␣-melanocytestimulating hormone are widely distributed in tissues of rodents. Endocrinology 121: 1900 –1907, 1987. TAYLOR AW, STREILEIN JW, AND COUSINS SW. Identification of alpha-melanocyte stimulating hormone as a potential immunosuppressive factor in aqueous humor. Curr Eye Res 11: 1199 –1206, 1992. TEOFOLI P, MOTOKI K, LOTTI TM, UITTO J, AND MAUVIEL A. Proopiomelanocortin (POMC) gene expression by normal skin and keloid fibroblasts in culture: modulation by cytokines. Exp Dermatol 6: 111–115, 1997. THEOHARIDES T, SINGH L, BOUCHER W, PANG X, LETOURNEAU R, WEBSTER E, AND CHROUSOS G. Corticotropin-releasing hormone induces skin mast cell degranulation and increased vas- Downloaded from http://physrev.physiology.org/ by 10.220.33.6 on July 4, 2017 369. SLOMINSKI A, PAUS R, AND COSTANTINO R. Differential expression and activity of melanogenesis-related proteins during induced hair growth in mice. J Invest Dermatol 96: 172–179, 1991. 370. SLOMINSKI A, PAUS R, AND MAZURKIEWICZ JE. Proopiomelanocortin expression and potential function during induced hair growth in C57BL6 mouse. Ann NY Acad Sci 642: 459 – 461, 1991. 371. SLOMINSKI A, PAUS R, AND MAZURKIEWICZ JE. Proopiomelanocortin expression in the skin during induced hair growth in mice. Experientia 48: 50 –54, 1992. 372. SLOMINSKI A, PAUS R, PLONKA P, HANDJINSKI B, MAURER M, CHAKRABORTY A, AND MIHM MC JR. Pharmacological disruption of hair follicle pigmentation as a model for studying the melanocyte response to and recovery from cytotoxic damage in situ. J Invest Dermatol 106: 1203–1211, 1996. 373. SLOMINSKI A, PAUS R, PLONKA P, MAURER M, CHAKRABORTY A, PRUSKI D, AND LUKIEWICZ S. Melanogenesis during the anagen-catagen-telogen transformation of the murine hair cycle. J Invest Dermatol 102: 862– 869, 1994. 374. SLOMINSKI A, PAUS R, AND SCHADERDORF D. Melanocytes are sensory and regulatory cells of epidermis. J Theor Biol 164: 103– 120, 1993. 375. SLOMINSKI A, PAUS R, AND WORTSMAN J. Can some melanotropins modulate keratinocyte proliferation? J Invest Dermatol 97: 747, 1991. 376. SLOMINSKI A, PAUS R, AND WORTSMAN J. On the potential role of proopiomelanocortin in skin physiology and pathology. Mol Cell Endocrinol 93: C1–C6, 1993. 377. SLOMINSKI A AND PAWELEK J. MSH binding in Bomirski amelanotic hamster melanoma cells is stimulated by L-tyrosine. Biosci Rep 7: 949 –954, 1987. 378. SLOMINSKI A AND PAWELEK J. Animals under the sun: effects of UV radiation on mammalian skin. Clin Dermatol 16: 503–515, 1998. 379. SLOMINSKI A, ROLOFF B, ZBYTEK B, WEI ET, FECHNER K, CURRY J, AND WORTSMAN J. Corticotropin releasing hormone (CRH) and related peptides can act as bioregulatory factors in human keratinocytes. In Vitro Cell Dev Biol 36: 211–216, 2000. 380. SLOMINSKI A, ROLOFF B, CURRY J, DAHIYA M, SZCZESNIEWSKI A, AND WORTSMAN J. The skin produces urocortin. J Clin Endocrinol Metab 85: 815– 823, 2000. 381. SLOMINSKI A, WORTSMAN J, MAZURKIEWICZ JE, MATSUOKA L, DIETRICH J, LAWRENCE K, GORBANI A, AND PAUS R. Detection of the proopiomelanocortin-derived antigens in normal and pathologic human skin. J Lab Clin Med 122: 658 – 666, 1993. 382. SMITH A, BARCLAY C, QUABA A, SEDOWOFIA K, STEPHEN R, THOMPSON M, WATSON A, AND MCINTOSH N. The bigger the burn, the greater the stress. Burns 23: 291–294, 1997. 383. SMITH AI AND FUNDER JW. Proopiomelanocortin processing in the pituitary, central nervous system, and peripheral tissues. Endocr Rev 9: 159 –179, 1988. 384. SMITH EM, HUGHES TK, HASHEMI F, AND STEFANO GB. Immunosuppressive effects of corticotropin and melanotropin and their possible significance in human immunodeficiency virus infection. Proc Natl Acad Sci USA 89: 782–786, 1992. 385. SMITH EM, MORRILL AC, MEYER WJ, AND BLALOCK JE. Corticotropin releasing factor induction of leukocyte-derived immunoreactive ACTH and endorphins. Nature 321: 881– 882, 1986. 386. SMITH R, HEALY E, SIDDIQUI S, FLANAGAN N, STEIJLEN PM, ROSDAHL I, JACQUES JP, ROGERS S, TURNER R, JACKSON IJ, BIRCH-MACHIN MA, AND REES JE. Melanocortin 1 receptor variants in an Irish population. J Invest Dermatol 111: 119 –122, 1998. 387. SMITH R, MESIANO S, CHAN E, BROWN S, AND JAFFE RB. Corticotropin-releasing hormone directly and preferentially stimulates dehydroepiandrosterone sulfate secretion by human fetal adrenal cortical cells. J Clin Endocrinol Metab 83: 2916 –2920, 1998. 388. SPIESS J, DAUTZENBERG FM, SYDOW S, HAUGER RL, RUHMANN A, BLANK T, AND RADULOVIC J. Molecular properties of the CRF receptor. Trends Endocrinol Metab 9: 140 –145, 1998. 389. SPIRO J, PARKER S, OLIVER I, FRASER C, MARKS JM, AND THODY AJ. Effect of PUVA on plasma and skin immunoreactive alpha-melanocyte stimulating hormone concentrations. Br J Dermatol 117: 703–707, 1987. 390. STAR RA, RAJORA N, HUANG J, STOCK RC, CATANIA A, AND LIPTON JM. Evidence of autocrine modulation of macrophage Volume 80 July 2000 410. 411. 412. 413. 414. 416. 417. 418. 419. 420. 421. 422. 423. 424. 425. 426. 427. 428. 429. 430. cular permeability, a possible explanation for its proinflammatory effects. Endocrinology 139: 403– 413, 1998. THEOHARIDES T, SPANOS C, PANG X, ALFERES L, LIGRIS K, LETOURNEAU R, ROZNIECKI J, WEBSTER E, AND CHROUSOS G. Stress-induced intracranial mast cell degranulation: a corticotropin-releasing hormone-mediated effect. Endocrinology 136: 5745– 5750, 1995. THODY AJ, RIDLEY K, PENNY RJ, CHALMERS R, FISHER C, AND SHUSTER S. MSH peptides are present in mammalian skin. Peptides 4: 813– 816, 1983. THODY AJ AND SHUSTER S. Control and function of sebaceous glands. Physiol Rev 69: 383– 416, 1989. THOMPSON RC, SEASHOLTZ AF, AND HERBERT E. Rat corticotropin-releasing hormone gene: sequence and tissue-specific expression. Mol Endocrinol 1: 363–390, 1987. THORNTON JE, CHEUNG CC, CLIFTON DK, AND STEINER RA. Regulation of hypothalamic proopiomelanocortin mRNA by leptin in ob/ob mice. Endocrinology 138: 5063–5066, 1997. TIMPL P, SPANGEL R, SILLABER I, KRESSE A, REUL JM, STALLA GK, BLANQUET V, STECKLER T, HOLSBOER F, AND WURST W. Impaired stress response and reduced anxiety in mice lacking a functional corticotropin-releasing hormone receptor 1. Nature Genet 19: 162–166, 1998. TINAJERO JC, FABBRI A, AND DUFAU ML. Regulation of corticotropin-releasing factor secretion from Leydig cells by serotonin. Endocrinology 130: 1780 –1788, 1992. TJUVAJEV J, KOLESNIKOV Y, JOSHI R, SHERINSKI J, KOUTCHER L, YZHOU, MATEI C, KOUTCHER J, KREEK MJ, AND BLASBERG R. Anti-neoplastic properties of human corticotropin releasing factor: involvement of the nitric oxide pathway. In Vivo 12: 1–10, 1998. TORPY DJ AND CHROUSOS GP. The three-way interactions between the hypothalamic-pituitary-adrenal and gonadal axes and the immune system. Baillieres Clin Rheumatol 10: 181–198, 1996. TSAI-MORRIS CH, BUCZKO E, GENG Y, GAMBOA-PINTO A, AND DUFAU ML. The genomic structure of the rat corticotropin releasing factor receptor. J Biol Chem 271: 14519 –14525, 1996. TURNBULL A, SMITH G, LEE S, VALE WW, LEE K, AND RIVIER C. CRF type I receptor-deficient mice exhibit a pronounced pituitaryadrenal response to local inflammation. Endocrinology 140: 1013– 1017, 1999. TURNBULL AV AND RIVIER CL. Regulation of the hypothalamicpituitary-adrenal axis by cytokines: actions and mechanisms of action. Physiol Rev 79: 1–71, 1999. TURNBULL AV, VALE W, AND RIVIER C. Urocortin, a corticotropinreleasing factor-related mammalian peptide, inhibits edema due to thermal injury in rats. Eur J Pharmacol 303: 213–216, 1996. UEHARA Y, SHIMIZU H, SATO N, TANAKA Y, SHIMOMURA Y, AND MORI M. Carboxyl-terminal tripeptide of ␣-melanocyte-stimulating hormone antagonized interleukin-1-induced anorexia. Eur J Pharmacol 220: 119 –122, 1992. UHLER M AND HERBERT E. Complete amino acid sequence of mouse pro-opiomelanocortin derived from the nucleotide sequence of pro-opiomelanocortin cDNA. J Biol Chem 258: 257–261, 1983. UHLER M, HERERT E, DEUSTACHIO P, AND RUDDLE FD. The mouse genome contains two nonallelic pro-opiomelanocortin genes. J Biol Chem 258: 9444 –9453, 1983. VALDENAIRE O, GILLER T, BREU V, GOTTOWIK J, AND KILPATRICK G. A new functional isoform of the human CRF2 receptor for corticotropin-releasing factor. Biochim Biophys Acta 1352: 129 –132, 1997. VALE W, SPIESS J, RIVER C, AND RIVER J. Characterization of a 41-residue ovine hypothalamic peptide that stimulates secretion of corticotropin and -endorphin. Science 213: 1394 –1397, 1981. VALVERDE P, HEALY E, JACKSON I, REES JL, AND THODY AJ. Variants of the melanocyte-stimulating hormone receptor gene are associated with red hair and fair skin in humans. Nature Genet 11: 328 –330, 1995. VALVERDE P, HEALY E, SIKKINK S, HALDANE F, THODY AJ, CAROTHERS A, JACKSON IJ, AND REES JL. The Asp84Glu variant of the melanocortin 1 receptor (MC1R) is associated with melanoma. Hum Mol Genet 5: 1663–1666, 1996. VAMVAKOPOULOS NC AND CHROUSOS GP. Hormonal regulation 431. 432. 433. 434. 435. 436. 437. 438. 439. 440. 441. 442. 443. 444. 445. 446. 447. 448. 449. 450. 1019 of human corticotropin-releasing hormone gene expression: implications for the stress response and immune/inflammatory reaction. Endocr Rev 15: 409 – 420, 1994. VAN DER KRAAN M, ADAN R, ENTWISTLE M, GISPEN W, BURBACH JP, AND TATRO J. Expression of melanocortin-5 receptor in secretory epithelia supports a functional role in exocrine and endocrine glands. Endocrinology 139: 2348 –2355, 1998. VAN TOL EA, PETRUZA P, LUND PK, YAMAUCHI M, AND SARTOR RB. Local production of corticotropin releasing hormone is increased in experimental intestinal inflammation in rats. Gut 39: 385–392, 1996. VAN WIJK PA, VAN NECK JW, RIJNBERK A, CROUGHS RH, AND MOL HA. Proliferation of the murine corticotropic tumor cell line AtT20 is affected by hypophysiotrophic hormones, growth factors and glucocorticoids. Mol Cell Endocrinol 111: 13–19, 1995. VARGA J, MOELLMANN G, FRITSCH P, GODAWSKA E, AND LERNER A. Association of cell surface receptors for melanotropin with the Golgi region in mouse melanoma cells. Proc Natl Acad Sci USA 73: 559 –562, 1976. VARGA JM, DIPASQUALE A, PAWELEK J, MCGUIRE J, AND LERNER A. Regulation of melanocyte-stimulating hormone (MSH) action at the receptor level: discontinuous binding of MSH to synchronized mouse melanoma cells during the cell cycle. Proc Natl Acad Sci USA 71: 1590 –1593, 1974. VAUGHAN J, DONALDSON C, BITTENCOURT J, PERRIN MH, LEWIS K, SUTTON S, CHAN R, TURNBULL AV, LOVEJOY D, RIVIER C, RIVIER J, SAWCHENKO PE, AND VALE W. Urocortin, a mammalian neuropeptide related to fish urotensin I and to corticotropin-releasing factor. Nature 378: 287–292, 1995. VITA N, LAURENT P, LEFORT S, CHALON P, LELIAS JM, KAGHAD M, LEFUR G, CAPUT D, AND FERRARA P. Primary structure and functional expression of mouse pituitary and human corticotropin releasing factors receptors. FEBS Lett 335: 1–5, 1993. WAKAMATSU K, GRAHAM A, COOK D, AND THODY JH. Characterization of ACTH peptides in human skin and their activation of melanocortin-1 receptor. Pigment Cell Res 10: 288 –297, 1997. WARDLAW SL, MCCARTHY KC, AND CONWELL IM. Glucocorticoid regulation of hypothalamic proopiomelanocortin. Neuroendocrinology 67: 51–57, 1998. WEI ET, GAO GC, AND THOMAS HA. Peripheral anti-inflammatory actions of corticotropin-releasing factor. Ciba Found Symp 172: 258 –268, 1993. WEI ET AND THOMAS HA. Correlation of neuroendocrine and anti-edema activities of alanine-corticotropin-releasing factor analogs. Eur J Pharmacol 263: 319 –321, 1994. WEI ET, THOMAS HA, CHRISTIAN HC, BUCKINGHAM JC, AND ISHIMOTO TK. D-Amino acid-substituted analogs of corticotropinreleasing hormone (CRH) and urocortin with selective agonist activity at CRH1 and CRH2-beta receptors. Peptides 19: 1183–1190, 1998. WESTLY HJ, KLEISS AJ, KELLEY KW, WONG PK, AND YUEN PH. Newcastle disease virus-infected splenocytes express the proopiomelanocortin gene. J Exp Med 163: 1589 –1594, 1986. WILSON JD, FOSTER DW, KRONENBERG HM, AND LARSEN PR. Williams Textbook of Endocrinology (9th ed.). Philadelphia, PA: Saunders, 1998. WINTZEN M AND GILCHREST BA. Proopiomelanocortin, its derived peptides, and the skin. J Invest Dermatol 106: 3–10, 1996. WINTZEN M, YAAR M, BURBACK JP, AND GILCHREST BA. Proopiomelanocortin gene product regulation in keratinocytes. J Invest Dermatol 106: 673– 678, 1996. WONG G AND PAWELEK J. Control of phenotypic expression of cultured melanoma cells by melanocyte-stimulating hormones. Nature New Biol 241: 213–215, 1973. WONG G AND PAWELEK J. Melanocyte-stimulating hormone activates preexisting tyrosinase molecules in mouse melanoma cells. Nature 255: 644 – 646, 1975. WONG G, PAWELEK J, SANSONE M, AND MOROWITZ J. Response of mouse melanoma cells to melanocyte-stimulating hormone. Localization in the G-2 phase of the cell cycle. Nature 248: 351–354, 1974. YAWSEN L, DIEHL N, BRENNAN MB, AND HOCHGESCHWENDER U. Obesity in the mouse model of pro-opiomelanocortin deficiency Downloaded from http://physrev.physiology.org/ by 10.220.33.6 on July 4, 2017 415. CRH-POMC SIGNALING IN A CUTANEOUS STRESS RESPONSE 1020 451. 452. 453. 454. SLOMINSKI, WORTSMAN, LUGER, PAUS, AND SOLOMON responds to peripheral melanocortin. Nature Med 5: 1066 –1070, 1999. YAMAZAKI T, KIMOTO T, HIGUCHI K, OHTA Y, KAWATO S, AND KOMINAMI S. Calcium ion as a second messenger for o-nitrophenylsulfenyl-adrenocorticotropin (NPS-ACTH) and ACTH in bovine adrenal steroidogenesis. Endocrinology 139: 4765– 4771, 1998. YANG Y, THOMPSON DA, DICKINSON CJ, WILKEN J, BARSH GS, KENT SB, AND GANTZ I. Characterization of agouti-related protein binding to melanocortin receptors. Mol Endocrinol 13: 148 –155, 1999. ZAGON IS, WU Y, AND MCLAUGHLIN PG. The opioid growth factor, met-enkephalin, and the zeta opioid receptor are present in human and mouse skin and tonically act to inhibit DNA synthesis in the epidermis. J Invest Dermatol 106: 490 – 497, 1996. ZHAO L, DONALDSON CJ, SMITH GW, AND VALE WW. The struc- Volume 80 tures of the mouse and human urocortin genes (Ucn and UCN). Genomics 50: 23–33, 1998. 455. ZHOU A, BLOOMQUIST BT, AND MAINS RE. The prohormone convertases PC1 and PC2 mediate district endorproteolytic cleavages in a strict temporal order during proopiomelanocortin biosynthetic processing. J Biol Chem 268: 1763–1769, 1993. 456. ZOUMAKIS E, MARGIORIS AN, MAKRIGIANNAKIS A, STOURNARAS C, AND GRAVANIS A. Human endometrium as a neuroendocrine tissue: expression, regulation and biological roles of endometrial corticotropin-releasing hormone (CRH) and opioid peptides. J Endocrinol Invest 20: 158 –167, 1997. 457. ZUBAIR A, LAKSHMI MS, AND SHERBET GV. Expression of alphamelanocyte stimulating hormone and the invasive ability of the B16 murine melanoma. Anticancer Res 12: 399 – 402, 1992. Downloaded from http://physrev.physiology.org/ by 10.220.33.6 on July 4, 2017
© Copyright 2026 Paperzz