RESEARCH ARTICLE
601
Development 134, 601-610 (2007) doi:10.1242/dev.02755
Hexamerin-based regulation of juvenile hormone-dependent
gene expression underlies phenotypic plasticity in a social
insect
Xuguo Zhou, Matthew R. Tarver and Michael E. Scharf*
Worker termites of the genus Reticulitermes are temporally-arrested juvenile forms that can terminally differentiate into adultsoldier- or reproductive-caste phenotypes. Soldier-caste differentiation is a developmental transition that is induced by high
juvenile hormone (JH) titers. Recently, a status quo hexamerin mechanism was identified, which reduces JH efficacy and maximizes
colony fitness via the maintenance of high worker-caste proportions. Our goal in these studies was to investigate more thoroughly
the influences of the hexamerins on JH-dependent gene expression in termite workers. Our approach involved RNA interference
(RNAi), bioassays and quantification of gene expression. We first investigated the expression of 17 morphogenesis-associated genes
in response to RNAi-based hexamerin silencing. Hexamerin silencing resulted in significant downstream impacts on 15 out of the 17
genes, suggesting that these genes are members of a JH-responsive genomic network. Next, we compared gene-expression profiles
in workers after RNAi-based hexamerin silencing to that of (i) untreated workers that were held away from the colony; and (ii)
workers that were also held away from the colony, but with ectopic JH. Here, although there was no correlation between
hexamerin silencing and colony-release effects, we observed a significant correlation between hexamerin silencing and JHtreatment effects. These findings provide further evidence supporting the hypothesis that the hexamerins modulate JH availability,
thus limiting the impacts of JH on termite caste polyphenism. Results are discussed in a context relative to outstanding questions on
termite developmental biology, particularly on regulatory gene networks that respond to JH-, colony- and environmental-cues.
INTRODUCTION
Termites are social insects that live in colonies, which, in turn,
function because of the complementary roles played by the different
castes (Wilson, 1971). As with all social insects, termite castes are
the result of an elaborate system of developmental polyphenism
(Evans and Wheeler, 2001; West-Eberhard, 2003). Termite colonies
produce worker, soldier and reproductive caste phenotypes that each
display unique suites of physiological-behavioral characteristics and
accomplish non-overlapping tasks. Specifically, workers assist
reproductives, build tunnels and feed the colony; soldiers defend the
colony; and reproductives pass genes to successive generations (via
the production of offspring). With respect to lower termites, the
worker caste is a temporally arrested immature form that retains the
ability to differentiate into terminally-developed soldier- or
reproductive-caste phenotypes (Buchli, 1958; Noirot, 1985; Noirot,
1990; Lainé and Wright, 2003).
While in their temporally arrested juvenile state, workers of the
more primitive lower termites display altruistic helping behaviors
that serve the colony and maximize its inclusive fitness (Myles and
Nutting, 1988; Nalepa, 1994). Under specific circumstances,
however, termite workers readily undergo caste differentiation. With
respect to worker-to-soldier differentiation, elevated titers of the
morphogenetic juvenile hormone (JH) drive this transition (Park and
Raina, 2004; Mao et al., 2005). To counter the effects of JH,
Reticulitermes flavipes workers produce hexamerin proteins that are
part of a status quo regulatory mechanism that serves to block the
Entomology and Nematology Department, University of Florida, Gainesville,
FL 32611-0620, USA.
*Author for correspondence (e-mail: [email protected])
Accepted 16 November 2006
irreversible worker-to-soldier transition (Zhou et al., 2006a; Zhou et
al., 2006b). Therefore, the hexamerins have been, at least in part, coopted through social evolution to meet the need for a numerically
dominant work force.
JH has been known to play a role in termite caste polyphenism for
several decades (Lüscher, 1960; Lüscher, 1976; Noirot, 1969;
Henderson, 1998). However, despite recent advances in the areas of
termite endocrinology (Park and Raina, 2004; Mao et al., 2005) and
gene-expression profiling (e.g. Miura et al., 1999; Scharf et al.,
2003a; Scharf et al., 2005a; Miura, 2005; Koshikawa et al., 2005;
Hojo et al., 2005; Cornette et al., 2006; Zhou et al., 2006c), our
collective understanding of the molecular basis of termite caste
regulation has remained limited. In this regard, the recent
identification of the hexamerin caste-regulatory mechanism
provided some of the first detailed molecular evidence of a casteregulating mechanism from a termite (Zhou et al., 2006a).
The question of exactly how does the hexamerins function in
termite caste regulation has not yet been answered. Hexamerins of
solitary insects are normally involved in nutrient storage and
nutritional signaling (Burmester and Scheller, 1999), but have also
been authenticated as bona fide JH-binding proteins (Braun and
Wyatt, 1996; Gilbert et al., 2000; Tawfik et al., 2006). One
hypothesis for termite hexamerins is that they serve as a signaling
mechanism for nutritional status and that pre-soldier differentiation
is suppressed when certain nutritional requirements are met (Zhou
et al., 2006a). An alternative hypothesis is that the hexamerins are
part of a mechanism that sequesters JH, thus preventing it from
eliciting downstream effects on developmental gene expression
(Zhou et al., 2006a). No evidence has yet been obtained that supports
a role for the termite hexamerins in caste regulation via nutritional
signaling. Evidence supporting the JH-sequestration hypothesis is
the observed increase in JH-dependent caste differentiation after the
DEVELOPMENT
KEY WORDS: Hexamerin, Sociogenomics, RNA interference, Short-interfering RNA, Juvenile hormone, Phenotypic plasticity, Reticulitermes
602
RESEARCH ARTICLE
Development 134 (3)
silencing of the R. flavipes hexamerins (Zhou et al., 2006a), as well
as JH-induction (Scharf et al., 2005b) and recognition of the R.
flavipes hexamerins by anti-JH antiserum (Zhou et al., 2006b).
Termite JH titers increase in response to a release from colony
conditions (Okot-Kotber et al., 1993; Mao et al., 2005). Thus,
because the hexamerins are both JH-responsive and attenuate JH
efficacy, they have apparently been selected during social evolution
to function as a proximate socio-regulatory mechanism (Zhou et al.,
2006a). The studies reported here were undertaken in an effort to
identify members of a hexamerin-controlled, JH-dependent casteregulatory gene network in developmentally plastic R. flavipes
workers. These studies used a combination of RNA interference
(RNAi), gene-expression profiling and regression analyses. The
specific objectives of these studies were as follows: (I) to examine
the downstream impacts of hexamerin gene silencing on a putative
network of 20 genes; as well as (II) to attempt to correlate
downstream impacts of hexamerin silencing with (i) colony-release
effects, and (ii) effects of ectopic JH treatment. These findings
revealed a significant correlation between hexamerin silencing and
ectopic JH treatment only, which provides additional evidence in
support of earlier conclusions that the hexamerins function, at least
in part, through the modulation of JH-mediated pleiotropy. These
experiments also revealed members of a putative JH-responsive gene
network, which, in addition to the hexamerins, includes
transcription/translation factors, signal transducers, cuticle proteins
and muscle proteins. Additionally, this research validates an
experimental framework for dissecting caste-regulatory gene
networks in social insects, and for investigating the ecological and
evolutionary significance of environmentally responsive socioregulatory mechanisms that exist specifically in termites.
MATERIALS AND METHODS
Experimental animals
Worker termites used in these experiments were from laboratory colonies
held at a constant 22°C. All colonies were collected on the University of
Florida campus (Gainesville, FL, USA). All caste phenotypes and
developmental stages were readily observable in the colonies, including
soldiers, nymphs, supplementary reproductives, larvae and eggs. Sampled
workers were from later instars; they possessed sclerotized heads, rich
symbiont communities and prominent fat bodies.
Genes
Extensive preliminary studies led to the identification of >300 housekeeping,
structural and candidate caste-regulatory genes from R. flavipes. These
preliminary investigations used a combination of random library sequencing
and cDNA arrays. Random sequencing allowed us to obtain housekeepinggene sequences for use as references in qRT-PCR (Wu-Scharf et al., 2002).
The arrays allowed us to identify >100 differentially-expressed genes among
different caste phenotypes, including workers and soldiers (Scharf et al.,
2003a), nymphs (Scharf et al., 2005a), and pre-soldiers (Scharf et al., 2005c;
Zhou et al., 2006b) (X.Z. and M.E.S., unpublished). The 19 candidate genes
chosen for evaluation here have significant homology (i.e. e<1⫻10–10) to
well-defined developmental genes from Drosophila and other insects; in
particular, broad, nanos, bicaudal, COP9 complex homolog subunit 5, LIM
(Legs incomplete and malformed), troponin and PIP (phospho-inositol
phosphate) kinase. See Table 1 for identities and Genbank accession
numbers for the 19 target and three control genes investigated here.
RNA interference
Silencing of hexamerin expression by RNAi was accomplished as described
previously (Zhou et al., 2006a; Zhou et al., 2006b). Briefly, double-stranded
(ds) short-interfering (si) RNA was synthesized using a commercially
available kit (SilencerTM, Ambion, Austin, TX). The cDNA template from
which the dsRNA was synthesized corresponded to a ~500 bp portion from
Table 1. Gene identities, abbreviations, accession numbers and qRT-PCR primer sequences
Gene identity (abbreviation)
Accession no.
Forward primer (5⬘-3⬘)
Reverse primer (5⬘-3⬘)
Ligand-binding proteins
1. Hexamerin-1 (Hex-1)
2. Hexamerin-2 (Hex-2)
AY572858
AY572859
GATCCATTCCACAAGCACG
ACGGAAGACGTTGGACTCAG
ACATTCTCCACCGTCACTCC
GAGGACCTGCTGGATCTTGT
DN792534
CB518302
CB518303
CGTCGACACCGACTACGAC
CGACCTAGAATACGAAGTGG
GAAGAGTTGAAGAAGGAGCAGG
GGTCAGCGGTGTACTCGAC
TTCTTCTCCTTGTCCTCCTCC
TTGTTCACCAGGCTATTCAGG
BQ788190
DN792518
AY258590
AY572860
CK906357
AY258589
CB518301
CCACTGACTAAATGTATGGG
CTCGATCAGGAGGCACACTC
CTGGACCAGCATCTACATCTTC
TATCGATCCTTTTGGCTTGG
GCGAATGATTAGAGGCCTTG
GAGGCAAGTACGGATTGGAG
GTGCTTCAAGTGTGGCATGT
TTCAAGCCTCAACACTCTGT
TTGCTGCCTCAATGTATGCT
GGTTGAAGCCTGATTCACAAG
TCGCAATGATAGGAAGAGCC
ACAGCGCCAGTTCTGCTTAC
CTCTTCATGGTAACAACCAG
GTCCATGCTGAGACAACCAG
AY572861
CK906365
CK906364
CK906363
BQ788178
BQ788171
CB518513
GCTACCGGCGACTCTTAATC
AATTCTGCTGCCTTCTCTGG
CGTACATGTGTGAGCAGGTG
GTGACATGTGTGAGCTTGCC
TTCCAACAGCACAAGAGCAC
TCAGGAAGTCTTGGATTCGG
CGTGTTGCCAATGAGTTGAG
GAGGACACGCTGATTCCTTC
ACCTTGCTTGGTCAACCATC
ATCACCATCAGGTGGCAGAG
ACCAGCTACACCTTCCTTGG
TAACTGGTTGCGACAGGCAC
TACGAACTCTGGTGCGTCTG
ACAATCCTATTCGGCCATCC
DQ206832
BQ788175
BQ788164
AGAGGGAAATCGTGCGTGAC
GCTGGGGGTGTTATTCATTCCTA
AGAACCAAGTGGCCATGAAC
CAATAGTGATGACCTGGCCGT
GGCATACCACAAAGAGCAAAA
CCAATGCTTCATGTCTGCC
Cuticle and muscle proteins
3. Larval Cuticle Protein A3A-like (LCP)
4. Rf1 Troponin-1 [wup-like] (Trop-1)
5. Rf2 Troponin-1 [wap-like] (Trop-2)
Transcription and translation factors
6. nanos
7. COP9 Complex Homolog Subunit 5 (COP9)
8. BTB-POZ [broad-like]
9. 18S rRNA-like (18S)
10. 28S rRNA-like (28S)
11. bicaudal (bic)
12. LIM
13. Malonyl Co-A Decarboxylase (M-CoA)
14. Phospho-Inositol Phosphate (PIP) Kinase
15. Apoptosis Inhibitor (Apop)
16. AMP Deaminase (AMP-de)
17. GTPase Activating Protein (GAP)
18. ATPase
19. SH3 Domain Kinase (SH3)
Reference/control genes
20. ␤-actin
21. NADH-dh
22. HSP-70
DEVELOPMENT
Signal transduction factors
Caste regulation in termites
RESEARCH ARTICLE
the open reading frame of the Hexamerin-2 (Hex-2) gene, which shares
>50% identity with the Hexamerin-1 (Hex-1) gene across the same region.
Thus, our approach allowed for the silencing of both hexamerin genes by a
single dsRNA fragment (Zhou et al., 2006a). The template cDNAs were
amplified by PCR primers that had T7 RNA polymerase sequences (5⬘TAATACGACTCACTATAGGG-3⬘) appended to their 5⬘ ends. After
synthesis and purification, the 500 bp dsRNAs were digested into siRNAs
(15-25 bp) with RNase III. The siRNAs were diluted to 15 ng/␮l in nucleasefree water and injected into the side of the thorax. Each termite received a
35-nl injection that contained 0.5 ng siRNA. For injection, a micro-injector
that was fitted with custom-pulled borosilicate glass needles, and a custom
vacuum manifold that facilitated termite immobilization, was used. After
siRNA injection, groups of 15 workers were held for 24 hours, after which
time they were destructively sampled for RNA isolation. Control workers
received injections of nuclease-free water alone.
Bestkeeper (Pfaffl et al., 2004) and NormFinder (Andersen et al., 2004) as
described previously (Zhou et al., 2006a). From these analyses, ␤-actin was
determined to be the most reliable reference gene. Relative gene expression
was determined using the method of Livak and Schmittgen (Livak and
Schmittgen, 2001), as described in the next section.
Experimental design and data analysis
Downstream effects of hexamerin silencing were determined
independently from five individuals showing maximal silencing effects
at 24-36 hours after siRNA injection. The hexamerin silencing in these
five individuals averaged >85% relative to water-injected controls (Fig.
1A). In bioassay experiments comparing colony-release and ectopic JH
impacts on gene expression, two analysis procedures were used. In the
first procedure, gene expression on assay days 5, 10 and 15 was
determined relative to day-0 colony workers (see arrows at the top of Fig.
2A,B). In the second procedure, relative gene-expression levels in JHtreated individuals on each assay day were determined relative to colonyrelease controls on the same day (see diagram at the right in Fig. 2C). All
relative expression levels were calculated by the 2-⌬⌬CT normalization
algorithm (Livak and Schmittgen, 2001). Mean and standard error were
determined by averaging relative expression levels across three
independent replicates, each determined in triplicate. Mean expression
levels were compared statistically by pairwise Kruskal-Wallis tests in
SAS (P<0.05) (SAS Institute, Cary, NC, USA). Linear regressions
(shown in Fig. 3) were conducted using the PROC REG procedure in
SAS.
Bioassays
Replicated groups of 15 workers were held on one of two treatments that
included either 150 ␮g JH III (Sigma-Aldrich, Milwaukee, WI, USA) or
analytical-grade acetone (the solvent carrier for JH). Termites were held
within 5 cm diameter plastic Petri dishes on moistened filter papers that were
pre-treated with either JH dissolved in acetone or acetone alone. These
treatments allowed for the determination of JH-responsive gene expression
and the effects of colony-release on gene expression, respectively.
Additionally, four holding times were examined in the experiment (0, 5, 10
and 15 days); each was replicated three times with 15 workers. Using this
bioassay format, pre-soldier differentiation is typically first observed on day
15 of JH exposure, whereas pre-soldier differentiation is absent in control
treatments (Scharf et al., 2005b; Scharf et al., 2005c; Zhou et al., 2006a). At
each time point, workers were destructively sampled for RNA isolation and
cDNA synthesis (see below).
200
***
175
**
150
80
Fig. 1. Impacts of hexamerin silencing on
downstream gene expression. Downstream effects of
hexamerin silencing (A) on the expression of 17 putative
downstream genes, and the three reference/control
genes ␤-actin, NADH-dh and HSP-70 (B). Results were
determined from quantitative real-time PCR data. See
Table 1 for gene abbreviations. The y-axis represents the
percentage of gene expression relative to water-injected
controls 24 hours after treatment (bars represent the
mean of five individuals, each determined in triplicate).
Bars with asterisks represent significant differences from
water-injected controls at P<0.01 (***), P<0.05 (**) or
P<0.1 (*), obtained by pairwise Kruskal-Wallis tests. Error
bars represent standard error of the mean (s.e.m.).
A
60
40
***
20
***
0
Hex-1
125
Hex-2
100
*
*
75
**
** **
50
**
25
**
**
**
** **
***
***
Control
Genes
Cuticle Muscle
Proteins Proteins
Transcription / Translation
Factors
Signal
Transducers
SH3
GAP
ATPase
Apop
AMP-de
M-CoA
PIP
cop-9
bic
LIM
28S-like
18S-like
nanos
BTB/POZ
Trop-2
LCP
Trop-1
HSP-70
␤-actin
0
NADHdh
Gene Expression after RNAi
(% of Water-injected Control)
B
Gene Expression after RNAi
(% of Water-injected Control)
All quantitative real-time PCR (qRT-PCR) primer sequences and Genbank
accession numbers are presented in Table 1. qRT-PCR was performed using
an iCycler iQ real-time PCR detection system with iQTM SYBRTM Green
Supermix (Bio-Rad, Hercules, CA, USA). cDNA, which served as the
template for qRT-PCR, was synthesized independently from total RNA of
15 individuals. Total RNA and cDNA were obtained using the SV total RNA
Isolation System (Promega, Madison, WI, USA) and the iScriptTM cDNA
Synthesis Kit (Bio-Rad), respectively, following manufacturer protocols.
The suitability of the three reference/control genes ␤-actin, 70 kDa cognate
heat shock protein (HSP-70) and nicotinamide adenine dinucleotidedehydrogenase (NADH-dh) were evaluated using the two software packages
DEVELOPMENT
RESULTS
Apparent downstream members of a casteregulatory gene network
In our first experiment, we investigated the impacts of RNAi-based
hexamerin silencing on the expression of well-characterized
regulatory and structural genes with homologs that are linked to a
number of insect developmental processes. Following RNAi, the two
hexamerin genes were silenced 85-95%, whereas the control genes
cellulase-1, ␤-actin, NADH-dh and HSP-70 were unaffected (for
details, see Zhou et al., 2006a). In the same individuals, impacts of
hexamerin silencing on 15 out of 17 suspected downstream genes
were also observed (Fig. 1). Specifically, hexamerin silencing
impacts an apparent network of downstream genes/proteins that
include signal transduction factors, transcription/translation factors,
cuticle proteins and muscle proteins. The downstream genes that
RNA isolation, cDNA synthesis and quantitative real-time PCR
100
603
604
RESEARCH ARTICLE
Development 134 (3)
(A)
(B)
colony
release
control
JHtreated
(C)
JH-treated,
normalized
to colony
release
control
Colony Release Control (A)
JH Treatment (B)
DAY 5 DAY 10 DAY 15
DAY 5 DAY 10 DAY 15
Fig. 2. Temporal expression changes for 22 genes in R. flavipes workers across days 5, 10 and 15 of isolation experiments.
(A,B) Isolation away from the colony (A) and in the presence of 150 ␮g externally-applied JH III (B). Results are normalized to colony workers
at day 0 (shown by arrows at top of A and B). (C) JH III-treatment effects normalized to colony-release effects within each day (shown by
arrows in the right portion of C). Yellow and blue cells, respectively, indicate significant increases and decreases in gene expression (P<0.05),
whereas black cells indicate no change (P>0.05). Statistical analyses were made using the Kruskal-Wallis test from three independent
replications, each determined in triplicate. See Table 1 for gene abbreviations. Values presented in individual cells are means, with standard
error (s.e.m.) shown in parentheses.
and conducted experiments that tested the impacts of: (i) colonyrelease and (ii) ectopically-applied JH on a potential genomic
network that includes the 15 significantly impacted genes.
Release from colony conditions impacts
expression of hexamerin-responsive genes
The first step towards testing the hypothesis that the hexamerins
regulate JH-responsive gene networks was to determine the effects
of colony-release on worker gene expression. These experiments did
not involve RNAi, but simply examined gene expression in wildtype termites held away from the colony. The impetus for pursuing
this experiment is based on prior evidence showing that, in R.
flavipes, colony-release significantly influences the expression of
several cytochrome P450 genes (Zhou et al., 2006c), as well as that
of hexamerin and vitellogenin genes (Scharf et al., 2005c). These
experiments were conducted following the bioassay approach
presented by Scharf et al. (Scharf et al., 2003b; Scharf et al., 2005b;
Scharf et al., 2005c), in which workers are isolated in small groups
away from the colony. However, in the current experiments, we
evaluated the expression of the 17 genes noted above, as well as Hex1 and Hex-2 and the control genes ␤-actin, NADH-dh and HSP-70.
DEVELOPMENT
were most highly significantly impacted were a larval cuticle protein
(LCP) and the translation factor nanos. Additionally, 13 other genes
were impacted significantly. These genes encode four
transcription/translation factors (BTB/POZ, 18-S, 28-S, bicaudal),
seven signal transducers (PIP kinase, COP9, malonyl Co-A
decarboxylase, apoptosis inhibitor, AMP deaminase, GTPase
activating protein, ATPase), and two muscle troponin isoforms
(Trop-1 and Trop-2). In addition to the control genes noted above,
the two genes LIM and SH3 kinase were unaffected by hexamerin
silencing.
After observing these effects, we re-verified that no sequence
homology exists between the hexamerins and the members of the
apparent gene network that showed reduced expression. Thus, we
conclude that the observed downstream impacts are not the result of
off-target RNAi impacts. Rather, these results suggested that the
hexamerins function by regulating the expression of JH-responsive
genes, such as the 15 significantly-impacted genes described above.
Based on our observation of JH affinity by Hex-1 (Zhou et al.,
2006b), we hypothesized that, by binding JH and restricting its
availability, the hexamerins apparently influence JH-dependent caste
differentiation. To further investigate this possibility, we designed
Relative expression: colony release
Caste regulation in termites
DAY 5
DAY 10
20
BTB/POZ
20
r2 = 0.052
p > 0.1
r2 = 0.14
p < 0.1
r2 = 0.04
p > 0.1
15
15
10
10
5
5
5
0
0
0
0.2
0.4
0.6
0.8
1.0
1.2
1.4
1.6
1.8
2.0
20
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4
1.6
1.8
2.0
10
ATPase
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4
1.6
1.8
2.0
20
Full Model
r2 = 0.10
p < 0.1
Full Model
r2 = 0.46
p < 0.05
Reduced Model
r2 = 0.31
p < 0.05
15
Apoptosis
inhibitor
larval
cuticle
protein
10
BTB/POZ
Reduced Model
r2 = 0.54
p < 0.05
15
10
15
20
Full Model
r2 = 0.25
p < 0.05
605
DAY 15
20
0.0
Relative expression: JH treatment
RESEARCH ARTICLE
Reduced Model
r2 = 0.77
p < 0.05
15
larval
cuticle
protein
10
nanos
5
5
5
0
0
0
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4
1.6
Relative expression: Hex silencing
1.8
2.0
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4
1.6
Relative expression: Hex silencing
1.8
2.0
SH3
kinase
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4
1.6
1.8
2.0
Relative expression: Hex silencing
The isolation of workers away from colony conditions has
pronounced impacts on the expression of the majority of genes at 5,
10 and 15 days of isolation, relative to day 0 (Fig. 2A). For the sake
of brevity, we only focus on day 5 results here. In total, seven genes
were significantly up-regulated on day 5 of colony-release. These upregulated genes include Hex-2 (1.86⫻), nanos (6.38⫻), COP9
(2.22⫻), BTB/POZ (18.67⫻), bicaudal (5.79⫻), apoptosis inhibitor
(2.15⫻) and GTPase-activating protein (3.90⫻). A total of four
genes were significantly downregulated on day 5 of colony-release.
These downregulated genes include larval cuticle protein (0.46⫻),
28S rRNA (0.55⫻), AMP deaminase (0.16⫻), and SH3 kinase
(0.13⫻). Finally, seven genes showed no significant changes by day
5 of colony-release. These findings illustrate the strong influence of
the colony on worker gene expression, and emphasize the importance
of controlling for colony-release effects when investigating the
impacts of experimental treatments on gene expression.
Ectopic JH treatment also impacts the expression
of hexamerin-responsive genes
The next step towards testing the hypothesis that the hexamerins
regulate JH-responsive gene networks was to compare the effects of
ectopic JH treatment to the effects of colony-release on gene
expression. In this experiment, wild-type (non-RNAi treated)
workers were isolated in groups as in the previous experiment;
however, filter paper substrates were treated with a concentration of
ectopic JH that is capable of inducing pre-soldier differentiation in
the majority of individuals (150 ␮g) (Scharf et al., 2005b). This
combination of worker isolation plus JH treatment resulted in more
pronounced changes in gene expression relative to worker isolation
(Fig. 2B). With JH treatment, the majority of evaluated genes had
significantly increased expression on days 5 and 10 of isolation,
relative to day 0. Of these, the most significantly upregulated genes
on day 5 were Hexamerin-1 and Hexamerin-2 (6.06⫻ and 12.93⫻,
respectively), BTB/POZ (50.32⫻), bicaudal (15.27⫻), apoptosis
inhibitor (22.36⫻), GTPase A.P. (11.74⫻) and both troponin
isoforms (Trop-1, 4.87⫻; and Trop-2, 8.24⫻). The expression of
other genes, such as LCP, AMP-deaminase, ATPase and SH3 kinase,
either changed insignificantly or were slightly downregulated.
When observing JH impacts in this manner, however, we
suspected that gene expression would probably be exaggerated
because of the dual effects of colony-release and JH-induction. In an
effort to control for colony-release effects, JH-impacted gene
expression (see Fig. 2B) was normalized within day, to colonyrelease-associated gene expression from Fig. 2A (see Fig. 2C).
These results revealed more modest expression changes. For
example, expression of Hexamerin-1 and Hexamerin-2 were still
significantly induced, but at reduced levels of 2.69- to 2.75-fold
greater than at day O. Other genes, such as nanos and COP9 – which
showed pronounced JH-induction relative to colony workers,
reversed from significant induction to significant repression when
normalizing to colony-release controls. Additionally, other highly
JH-induced genes, such as BTB/POZ, bicaudal, apoptosis inhibitor
and both troponins, showed reduced induction levels when
normalizing to colony-release controls. Thus, by controlling for
colony-release effects on gene expression, the impacts of excess JH
on gene expression can be more realistically estimated.
DEVELOPMENT
Fig. 3. Comparison of gene expression by linear regression analysis. Linear regressions comparing the expression of 17 genes between
hexamerin silencing experiments and experiments involving (top row) isolation away from the colony, and (bottom row) isolation on JH III deposits
at days 5 (left), 10 (middle) and 15 (right) of isolation. Correlation coefficients and P-values were determined using PROC REG in the SAS software
package. Colony-release results shown across the top row indicate no significant correlation with hexamerin silencing, whereas JH-dependent
results in the bottom row show significant correlations with hexamerin silencing for all days (P<0.05). Also, all JH regressions in the bottom row
improve after the removal of the apparent outlier genes apoptosis inhibitor, ATPase, larval cuticle protein, nanos and SH3 kinase (compare full and
reduced models). See Fig. 1 and Fig. 2A,C for original data presentations and standard error (s.e.m.) estimates that correspond to each data point.
RESEARCH ARTICLE
A
JH
HEXAMERIN
Signal
Transducers
Transcription
Factors
Translation
Factors
Cuticle
Proteins
Muscle
Proteins
Development 134 (3)
Extrinsic
Factors
Intrinsic
Factors
• Food quality/quantity
• Season
• Temperature
• Moisture
• Colony↓↓
• Primer
pheromones
• Caste composition
• Auditory stimuli
B
Nutritional status
•
• JH titers
• Allatostatins
• Sex
• Instar
dependent gene expression on assay days 5, 10 and 15 (Fig. 2C),
significant correlations were observed for all days (Fig. 3, bottom
row). Furthermore, when apparent outlier genes were removed
from the analysis (day 5: apoptosis inhibitor and ATPase; day 10:
larval cuticle protein and nanos; day 15: SH3 kinase), the
regressions improved considerably (see reduced models in bottom
row of Fig. 3). These latter results are highly interesting, in that
they suggest temporal changes in the JH-responsive gene network
throughout pre-soldier development.
JH
HEXAMERIN
Gene
Network
Fig. 4. Diagrams depicting developmental gene networks and
proposed gene relationships, as suggested by the current
research. (A) Organization of a gene network involving JH-responsive
genes from the signal transduction, transcription and translation
factors, and the cuticle and muscle ontogeny categories. Solid arrows
represent a simple hierarchical cascade, whereas dotted arrows
represent the more complex feedback between levels that probably
occurs. (B) Apparent relationship between hexamerin titer and JH
availability (Zhou et al., 2006a; Zhou et al., 2006b), as well as other
putative intrinsic and extrinsic caste-regulatory factors. Solid arrows
represent what is known from prior and current research, whereas
dotted arrows illustrate the proposed relationships. In this scheme, the
hexamerins can be considered an environmentally-responsive switching
mechanism (Wheeler, 1986) that modulates JH-dependent
morphogenesis.
Downstream impacts of hexamerin silencing
correlate significantly with JH-dependent changes
in gene expression
Regression analyses were conducted to specifically test the
hypothesis that the hexamerins regulate JH-dependent gene
expression (Fig. 3). These analyses tested for correlations between
gene expression after RNAi-based hexamerin silencing versus (i)
baseline colony-release effects, and (ii) JH-dependent effects. These
regressions included only the 17 cytoskeletal, transcription/
translation and signal transduction genes compared in Fig. 1. The
three reference genes and the two hexamerins were not included in
the regression analyses. In the first regression, which compared
downstream effects after hexamerin silencing to colony-release
effects at days 5, 10 and 15 of isolation, no correlations were
significant (Fig. 3, top row). Although not significant, the colonyrelease regressions showed apparently important outlier trends for
the BTB/POZ and larval cuticle protein genes, respectively, on days
5-10 and 15. Specifically, these results for BTB/POZ and LCP
suggest that these genes may play roles in suppressing the
expression of other network members in response to the release from
colony-based suppression.
Regressions comparing gene expression after hexamerin
silencing to day-0-normalized JH-associated gene expression
(Fig. 2B) showed no significant correlations (graphs not shown).
Here, correlation coefficients (r2) for days 5, 10 and 15 were
0.009, 0.049 and 0.022. respectively. In regressions comparing
downstream effects after hexamerin silencing with true JH-
DISCUSSION
This study revealed members of a putative genomic network of
JH-responsive genes with links to termite soldier-caste
differentiation. The majority of these network members share
significant homology to well-characterized developmental genes
of both holo- and hemi-metabolous insects. Although other
network members probably await discovery, the current list of JHresponsive genes includes 13 genes from the signal transduction,
transcription/translation, integumental and cytoskeletal/structural
ontogeny categories. These findings also provide novel lines of
evidence supporting the idea that the hexamerins modulate JH
availability, and therefore regulate JH-mediated phenotypic
plasticity.
Although JH signaling is a process that remains poorly
understood in insects, JH is widely recognized as the pleiotropic
master regulator of insect development and metamorphosis
(Truman and Riddiford, 1999; Gilbert et al., 2000; Flatt et al.,
2005). In higher holometabolous insects, such as Manduca sexta,
JH functions in suppressing adult-tissue differentiation by
inhibiting intrinsic signaling independently of nutritional state and
ecdysteroids (Truman et al., 2006). In this respect, JH has been
proposed to function as a lipid-signaling system parallel to
retinoic acid of mammals and protein prenylation in yeast and
fungi (Wheeler and Nijhout, 2003). In termites, which are
hemimetabolous insects that display complex and highly derived
developmental plasticity, JH has adopted broader functions
(Henderson, 1998). Two of the most well-defined of these
functions are soldier differentiation at high JH titers and status
quo worker-to-worker molts at lower JH titers (Park and Raina,
2004; Mao et al., 2005).
The removal of worker termites from the colony leads to
increases in JH titers (Okot-Kotber et al., 1993; Mao et al., 2005),
which can result in soldier-caste differentiation in Coptotermes
termites (Mao et al., 2005). In Reticulitermes, however, the
hexamerins have apparently been co-opted to counter the effects
of JH and retain a status quo work force (Zhou et al., 2006a). This
also explains why, in Reticulitermes, worker removal from
colonies does not lead to pre-soldier differentiation (Okot-Kotber
et al., 1993; Scharf et al., 2005b). To overcome the effects of the
hexamerins in blocking colony-release-associated caste
differentiation, we adopted the model system employed in the
current study (Scharf et al., 2003b; Scharf et al., 2005b). Our
model system relies on ectopic JH exposure to overwhelm the
attenuating effects of the hexamerins and synchronize worker
differentiation. Thus, whereas colony-release effects are modest
and do not normally permit soldier-caste differentiation in a short
time frame, ectopic JH exposure is an effective alternative to
induce high levels of soldier-caste differentiation (Scharf et al.,
2005b). In this respect, results of the current study provide
further evidence supporting the involvement of termite
hexamerins in blocking JH-dependent gene expression and
morphogenesis.
DEVELOPMENT
606
Caste regulation in termites
Signal transducers
Signal transduction is the process by which extracellular signals are
transmitted through the cytoplasm, both to and from the nucleus. In
the JH-responsive network, our findings suggest that these factors
may be acting both upstream and downstream of the transcription
and translation factors, but upstream of cuticle and muscle proteins.
As proposed by Wheeler and Nijhout (Wheeler and Nijhout, 2003),
the possibility should also be considered that some or all of these
gene products may directly participate in JH signaling.
The signal transducers malonyl-CoA, PIP kinase, apoptosis
inhibitor, AMP-deaminase and ATPase were identified from
previous nymphal arrays (Scharf et al., 2005a), whereas the GTPase
activating protein (GAP) was identified from soldier arrays (Scharf
et al., 2003a). The COP9 gene was identified from pre-soldier arrays
(Genbank Accession No. DN792518). Of these signal-transduction
factors, most have multiple functions that can vary widely between
organisms. Thus, we do not elaborate on their potential roles in
termite caste regulation/differentiation. However, the numerous
kinase-associated factors apparently play very interconnected roles
in myogenesis and cytoskeletal assembly. In particular, the central
role of the COP9 gene in these processes is discussed below.
Of the signal transducers investigated here, the COP9 complex
homolog subunit 5 gene appears to be very important. Specifically,
COP9 expression increases 10- to 20-fold on days 5 and 10 of
worker isolation, but remains unchanged with ectopic JH treatment.
These findings suggest an important role for COP9 in the
suppression of other developmental genes in response to natural,
low-level increases in JH titer. The COP9 complex homolog is a
complex of eight subunits (termed CSN1-CSN8) that play key roles
in development (Harari-Steinberg and Chamovitz, 2004). The
termite COP9 subunit investigated here shares significant homology
with the Drosophila subunit 5 (blastx e-value: 4⫻10–137), which
plays key roles in Drosophila development by participating in
hormonal signaling and by regulating the degradation of gene
products that control tissue differentiation and body plan (Freilich
607
et al., 1999; Oron et al., 2002; Björklund et al., 2006). The COP9
complex homolog is a central component of kinase-mediated signaltransduction pathways, with direct impacts on transcriptional
regulation (Harari-Steinberg and Chamovitz, 2004; Björklund et al.,
2006). The recognized link between the COP9 complex homolog,
kinases and transcriptional regulation is very much in-line with our
identification of multiple genes related to kinase-signaling and
transcriptional regulation. These commonalities, coupled with the
highly phosphorylated nature of the hexamerin proteins and their
function in endocytosis-based transport, suggest that COP9 and the
other signal transducers play highly interconnected developmental
roles.
Transcription and translation factors
The translation factors bicaudal and nanos, and the transcription
factor BTB/POZ were identified from previous soldier array studies
(Scharf et al., 2003a), whereas the translation factor-like 18S- and
28S-rRNA genes were identified from arrays investigating gene
expression in immature reproductives (i.e. ‘nymphs’) (Scharf et al.,
2005a). Based on their well-defined functions in other organisms,
these genes most probably play roles in the transcription and/or
translation of downstream structural genes; but also possibly of
signal-transduction factors and other transcription/translation factors
(Fig. 4A). At the present time, it is not clear if the 18S- and 28S-like
genes are true ribosomal RNAs, or if they are pseudo-rRNAs buried
in the coding region other genes that participate in ribosomal
filtering (Mauro and Edelman, 1997; Mauro and Edelman, 2002;
Chappell et al., 2006). The fact that the rRNA-like sequences contain
poly-A tails supports the latter possibility (Scharf et al., 2005a).
Although the nanos and bicaudal genes are highly interesting,
BTB/POZ-like genes have a far-more conserved importance in insect
development (Riddiford et al., 2003; Erezyilmaz et al., 2006). The
termite BTB/POZ gene is similar to transcriptional regulators, which
contain conserved zinc-finger motifs that participate in DNA
binding. BTB/POZ is so named because it contains a conserved
BTB/POZ domain in its N-terminal region (Scharf et al., 2003a).
The termite BTB/POZ gene product shares significant homology
with the broad gene identified from numerous insects; for example,
the hemimetabolous insect Oncopeltus fasciatus (blastx e-value:
1.0⫻10–33). Broad, which participates in ecdysone signaling, is a
transcription factor from the BTB/POZ family that is characterized
by an N-terminal BTB domain and a C-terminal pair of zinc-finger
motifs (Zhou and Riddiford, 2002; Riddiford et al., 2003). In
Oncopeltus, RNAi-based silencing of broad results in pronounced
pigmentation and wing malformations, but has no effect on
anisometric growth or molting (Erezyilmaz et al., 2006).
Interestingly, the Oncopeltus deformities resulting from the
silencing of broad are highly consistent with regressive molts that
occur in nymphal Reticulitermes (Buchli, 1958; Lainé and Wright,
2003), as well as with aberrations to adult imago termites noted after
ectopic ecdysone treatment during immature nymphal instars
(Lüscher, 1960).
Cuticle and muscle proteins
Consistent with impacts on cytoskeletal assembly and myogenesis
noted above for the signal transducers, we previously identified a
larval cuticle protein (Genbank Accession No. DN792534) and two
troponin isoforms (Scharf et al., 2003a). These three genes are
apparently the furthest downstream members of the putative JHresponsive gene network (Fig. 4A). Cuticle proteins occur in
differentiating tissues that are extremely sensitive to JH and
ecdysone (e.g. imaginal disks); they are involved in processes related
DEVELOPMENT
JH-responsive genes and putative gene networks
Fig. 4A illustrates how members of a JH-responsive genomic
network may be interconnected, as inferred from findings of the
present study, gene identities, sequence features and homology to
other genes with defined functions. At the top of the network are the
two hexamerin genes, which are known to respond to JH (present
study) (Scharf et al., 2005b; Zhou et al., 2006b) and environmental
conditions (M.E.S. et al., unpublished). Immediately downstream, in
a manner similar to that proposed by Wheeler and Nijhout (Wheeler
and Nijhout, 2003), are downstream network genes that mediate JH
signaling. These genes include five signal transducers, seven
transcription/translation factors, one cuticle protein and two muscle
proteins. At the present time, we propose that these genes are
arranged in simple cascades, whereby the genes are sequentially
connected in a simple hierarchical fashion (Tapscott, 2005). However,
other configurations are certainly possible, such as feed-forward
signaling, in which early genes differentially influence multiple later
genes, or a single-input cascade, where JH directly influences each
network member independently through pleiotropy (Tapscott, 2005).
Additionally, at the present time, we have no basis for knowing if
responsive genes are members of single or multiple gene networks,
or if there is inter- or cross-talk between levels, such as between
transcriptional and translational factors. Studies to define network
hierarchy are in progress. Details relating to what is known regarding
the function of some of the JH-dependent genes, as well as their
suspected interconnections, are provided in the following paragraphs.
RESEARCH ARTICLE
RESEARCH ARTICLE
to chitin binding and cuticle hardening, among others (Willis, 1999;
Takeda et al., 2001). Because of the high degree of sclerotization of
the termite soldier head, and because soldier differentiation is
induced by JH, it is logical to suspect that cuticle proteins would be
JH-responsive. In this regard, the R. flavipes cuticle protein gene was
only significantly induced on day 10 of JH exposure, and was
markedly down regulated on days 5 and 15. This cuticle protein gene
was also significantly upregulated on day 15 of colony-release;
possibly reflecting a slower rise in JH titers after colony-release
and/or other undefined primer pheromone effects. Here, it is
noteworthy that four similar cuticle proteins were identified during
juvenoid-induced soldier differentiation in the termite
Hodotermopsis sjostedti (Koshikawa et al., 2005). The translated
cuticle protein sequence of R. flavipes is most similar to the H.
sjostedti cuticle protein HsjCP1 (86% identity; e-value: 4⫻10–17).
Most interesting here is that three of the four H. sjostedti cuticle
proteins showed identical induction trends to that observed for the
R. flavipes cuticle protein (see Fig. 2C).
JH-induced differentiation of the soldier caste is associated with
a large increase in body mass and musculature, especially in the head
where a large muscle mass is required to drive the enlarged soldier
mandibles. The two troponin I isoforms that were evaluated here
share similarities with heldup-mutant alleles that occur in
Drosophila; specifically wings-up and wings-apart (Beall and
Fryberg, 1991). Our findings showed consistent JH-induction of
both forms of troponin across all 15 bioassay days. Originally, it was
proposed that the expression of these troponin isoforms in soldiers
might be associated with flight-muscle degeneration, as occurs in
heldup mutants of Drosophila (Scharf et al., 2003a). Although the
results of the present study do verify that both troponin forms are
members of a putative JH-responsive gene network, their true
functions remain unknown. Nonetheless, it is logical to deduce that
troponin muscle proteins, as well as other muscle proteins not
investigated here (Scharf et al., 2003a), are probably the most
downstream members of the genomic network. Future studies that
work to dissect this apparent gene network will investigate a number
of cytoskeletal/muscle protein-encoding genes not included in the
present analysis.
Termite hexamerins and impending issues
Evidence from anti-JH blotting studies suggests that the
hemolymph-soluble Hexamerin-1 protein is capable of covalent JH
binding. Alternatively, the hemolymph-soluble Hexamerin-2 protein
exhibits no such JH affinity, but it does have membrane-binding
characteristics much like the well-studied hexamerin receptors of
higher solitary insects (Zhou et al., 2006b). The R. flavipes
hexamerins, which constitute a major percentage of total worker
protein, also have highly unique sequence features relative to most
other known hexamerins. For example, Hex-1 has a completely
unique hydrophobic tail and prenylation motif that is similar to noninsect sesquiterpene-binding motifs (Zhou et al., 2006b).
Furthermore, Hex-2 has a long hydrophilic insertion plus several
protease-cleavage-like sites that are consistent with hexamerin
receptors (Zhou et al., 2006b). Thus, when taking these
characteristics into consideration, along with previous RNAi results
(Zhou et al., 2006a) and JH-binding functions known for other insect
hexamerins (Braun and Wyatt, 1996; Tawfik et al., 2006), it is not
unreasonable to hypothesize that these two proteins cooperate to
sequester JH and modulate its efficacy. In a broader context, these
unique proximate characteristics support the idea that hexamerins
have been co-opted in termites to ultimately inhibit irreversible
morphogenesis towards the soldier caste.
Development 134 (3)
The hexamerins apparently modulate JH-dependent gene
expression both by being JH-inducible and by sequestering JH (Fig.
4B). Thus, when hexamerin titers are high, JH availability (not
necessarily JH titer) is presumably low and pre-soldier
differentiation is attenuated. Evidence in support of the JH
sequestration hypothesis came from previous RNAi studies in which
it was observed that, when worker hexamerin levels are attenuated
by RNAi, JH-dependent pre-soldier differentiation is significantly
elevated (Zhou et al., 2006a). As shown in the present study, colonyrelease also has pronounced impacts on hexamerin and affiliated
downstream gene expression, apparently as a result of rising JH
titers and/or a release from other primer pheromone influences that
result from a removal of colony-based suppression (Okot-Kotber et
al., 1993). To conclusively test the hypothesis that the hexamerins
are capable of JH-sequestration, JH-binding studies will be
necessary. Other studies, such as those measuring JH titers after
hexamerin silencing, might also be informative, but this might also
yield confusing results because of competing colony-releasedependent increases in JH titer. Regardless, despite a lack of
conclusive JH-binding data, evidence obtained to date shows a clear
responsiveness by the hexamerins to JH treatment as well as
attenuation of JH-dependent caste differentiation.
More importantly, the growing body of evidence discussed above
points towards an important question: what are the socio-regulatory
factors that impact relative titers of both JH and hexamerins? (Fig.
4B). Because solitary-insect hexamerins play a very welldocumented role in nutrient storage (Burmester and Scheller, 1999),
one possibility is that food quality/quantity and nutritional status are
important extrinsic and intrinsic factors that impact hexamerin titers
(Nalepa, 1994). Colony conditions, such as caste composition
(reviewed in Wilson, 1971), auditory stimuli (Evans et al., 2005) and
primer pheromones (Wilson and Bossert, 1963; Lefevue and
Bordereau, 1984; Vander Meer et al., 1998; Korb et al., 2003), may
also have either direct or indirect impacts on hexamerin titers. With
respect to environmental influences on JH, conditions such as
season, temperature and moisture must also certainly play a role
(Huang and Robinson, 1995; Liu et al., 2005a; Liu et al., 2005b;
Suzuki and Nijhout, 2006). Finally, other intrinsic factors, such as
sex, developmental instar and the JH-modulating allatostatin
peptides (Yagi et al., 2005), are also likely to play roles in
influencing hexamerin titers via the modulation of JH synthesis. To
characterize this system more fully, future research should be aimed
towards more than hexamerin-JH interactions alone; such studies
should also be aimed towards understanding the elaborate
interactions of these potential intrinsic and extrinsic socio-regulatory
factors. As discussed below, the current study provides important
insights into how to proceed in addressing these questions.
Future research considerations and conclusions
In addition to elucidating a mechanism responsible for regulating the
JH-dependent expression of developmental genes, the findings of
this research have refined questions and approaches for future
investigations into eusocial polyphenism. Most notably, we observed
significant effects of colony-release on gene expression. This
suggests that colony-release effects must be taken into account when
conducting any experiments that involve the isolation of colony
members away from colony influences. For this purpose, we found
that normalization of gene expression for treated individuals to
colony-release-control individuals provides for a more realistic
assessment of gene expression. Also, in a broader context, our
observation of significant colony-release effects suggests interesting
and readily approachable ecological-developmental research
DEVELOPMENT
608
questions (Gilbert, 2001); specifically, how is gene expression
influenced under variable extrinsic conditions such as caste
composition, food quality and seasonality? Finally, as also shown
here, the use of RNAi to quantify downstream effects by upstream
regulatory genes is a useful approach for delineation of casteregulatory gene networks. This approach is being applied further in
ongoing investigations that will define the hierarchy of JHresponsive networks and how their members are interconnected.
In conclusion, we have shown here that, in R. flavipes workers,
targeted hexamerin silencing results in extensive downstream
impacts on an apparent genomic network of developmental and
structural genes. Of the findings reported here, the most important
is that downstream impacts of hexamerin silencing correlate
significantly with JH-dependent changes in gene expression. This
determination provides strong evidence to support the idea that the
hexamerins modulate JH availability, thereby attenuating true JHdependent impacts on developmental gene expression (and
ultimately on development). These findings are significant in that
they make it possible to now ask highly focused questions relating
to extrinsic and intrinsic influences on the hexamerins, as well as on
a number of other downstream developmental genes. Building a
deeper understanding of the functions of such a JH-responsive
genomic network will not only improve our understanding of termite
caste polyphenism, but also of JH-signaling in insects.
We thank Daniel Hahn for providing a critical reading and valuable comments
to the revised manuscript draft. This work was supported by the Florida
Agricultural Experiment Station, by a gift from Procter and Gamble Inc., and
with start-up funds provided to M.E.S. by the Institute of Food and Agricultural
Sciences of the University of Florida.
References
Andersen, C. L., Jensen, J. L. and Ørntoft, T. F. (2004). Normalization of realtime quantitative reverse transcription-PCR data: a model-based variance
estimation approach to identify genes suited for normalization, applied to
bladder and colon cancer data sets. Cancer Res. 64, 5245-5250.
Beall, C. J. and Fryberg, E. (1991). Muscle abnormalities in Drosophila
melanogaster heldup mutants are caused by missing or aberrant troponin-I
isoforms. J. Cell Biol. 114, 941-951.
Björklund, M., Taipale, M., Varjosalo, M., Saharinen, J., Lahdenepera, J. and
Taipale, J. (2006). Identification of pathways regulating cell size and cell-cycle
progression by RNAi. Nature 439, 1009-1013.
Braun, R. P. and Wyatt. G. W. (1996). Sequence of the hexameric juvenile
hormone-binding protein from the hemolymph of Locusta migratoria. J. Biol.
Chem. 6, 31756-31762.
Buchli, H. (1958). L’origine des castes et les poetntialitiés ontogéniques des
termites européens du genre Reticulitermes Holmgren. Ann. Sci. Nat. Zool. Biol.
Anim. 20, 261-429.
Burmester, T. and Scheller, K. (1999). Ligands and receptors: common theme in
insect storage protein transport. Naturwissenschaften 86, 468-474.
Chappell, S. A., Dresios, J., Edelman, G. M. and Mauro, V. P. (2006). Ribosomal
shunting mediated by a translational enhancer that base pairs to 18S rRNA.
Proc. Natl. Acad. Sci. USA 103, 9488-9493.
Cornette, R., Koshikawa, S., Hojo, M., Matsumoto, T. and Miura, T. (2006).
Caste-specific cytochrome P450 in the damp-wood termite Hodotermopsis
sjostedti. Insect Mol. Biol. 15, 235-244.
Erezyilmaz, D. F., Riddiford, L. M. and Truman, J. W. (2006). The pupal specifier
broad directs progressive morphogenesis in a direct-developing insect. Proc.
Natl. Acad. Sci. USA 103, 6925-6930.
Evans, J. D. and Wheeler, D. E. (2001). Gene expression and the evolution of
insect polyphenisms. BioEssays 23, 62-68.
Evans, T. A., Lai, J. C., Toledano, E., McDowall, L., Rakotonarivo, S. and Lenz,
M. (2005). Termites assess wood size by using vibration signals. Proc. Natl. Acad.
Sci. USA 102, 3732-3737.
Flatt, T., Tu, M. P. and Tatar, M. (2005). Hormonal pleiotrypy and the juvenile
hormone regulation of Drosophila development and life history. BioEssays 27,
999-1010.
Freilich, S., Oron, E., Kapp, Y., Nevo-Caspi, Y., Orgad, S., Segal, D. and
Chamovitz, D. A. (1999). The COP9 signalsome is essential for development of
Drosophila melanogaster. Curr. Biol. 9, 1187-1190.
Gilbert, L. I., Granger, N. A. and Roe, R. M. (2000). The juvenile hormones:
historical facts and speculations on future research directions. Insect Biochem.
Mol. Biol. 30, 617-644.
RESEARCH ARTICLE
609
Gilbert, S. F. (2001). Ecological developmental biology: developmental biology
meets the real world. Dev. Biol. 233, 1-12.
Harrari-Steinberg, O. and Chamovitz, D. A. (2004). The COP9 signalsome:
mediating between kinase signaling and protein degradation. Curr. Protein Pept.
Sci. 5, 185-189.
Henderson, G. (1998). Primer pheromones and possible soldier caste influence on
the evolutionary of sociality in lower termites. In Pheromone Communication in
Social Insects (ed. R. K. Vander Meer, M. D. Breed, K. E. Espelie and M. L.
Winston), pp. 314-329. Boulder: Westview Press.
Hojo, M., Koshikawa, S., Cornette, R., Matsumoto, T. and Miura, T. (2005).
Identification of soldier-specific genes in the nasute termite Nasutitermes
takasagoensis. Entomol. Sci. 8, 379-387.
Huang, Z. Y. and Robinson, G. E. (1995). Seasonal changes in juvenile hormone
titers and rates of biosynthesis in honey bees. J. Comp. Physiol. B 165, 18-28.
Korb, J., Roux, E. A. and Lenz, M. (2003). Proximate factors influencing soldier
development in the basal termite Cryptotermes secundus. Insectes Soc. 50, 299303.
Koshikawa, S., Cornette, R., Hojo, M., Maekawa, K., Matsumoto, T. and
Miura, T. (2005). Screening of genes expressed in developing mandibles during
soldier differentiation in the termite Hodotermopsis sjostedti. FEBS Lett. 579,
1365-1370.
Lainé, L. V. and Wright, D. J. (2003). The life cycle of Reticulitermes spp.: what
do we know? Bull. Entomol. Res. 93, 267-278.
Lefevue, P. and Bordereau, C. (1984). Soldier formation regulated by a primer
pheromone from the soldier frontal gland in a higher termite, Nasutitermes
lujae. Proc. Natl. Acad. Sci. USA 81, 7665-7668.
Liu, Y., Henderson, G., Mao, L. and Laine, R. A. (2005a). Effects of temperature
and nutrition on juvenile hormone titers of Coptotermes formosanus. Ann.
Entomol. Soc. Am. 98, 732-737.
Liu, Y., Henderson, G., Mao, L. and Laine, R. (2005b). Seasonal variation of
juvenile hormone titers of the Formosan subterranean termite, Coptotermes
formosanus. Environ. Entomol. 34, 557-562.
Livak, K. J. and Schmittgen, T. D. (2001). Analysis of relative gene expression
data using real-time quantitative PCR and the 2–⌬⌬CT method. Methods 25, 402408.
Lüscher, M. (1960). Hormonal control of caste differentiation in termites. Ann.
N.Y. Acad. Sci. 89, 549-563.
Lüscher, M. (1976). Evidence for an endocrine control of caste determination in
higher termites. In Phase and Caste Determination in Insects: Endocrine Aspects
(ed. M. Lüscher), pp. 91-103. Oxford: Pergamon Press.
Mao, L., Henderson, G., Liu, Y. and Laine, R. (2005). Formosan subterranean
termite soldiers regulate juvenile hormone levels and caste differentiation in
workers. Ann. Entomol. Soc. Am. 98, 340-345.
Mauro, V. P. and Edelman, G. M. (1997). rRNA-like sequences occur in diverse
primary transcripts: implications for the control of gene expression. Proc. Natl.
Acad. Sci. USA 94, 422-427.
Mauro, V. P. and Edelman, G. M. (2002). The ribosome filter hypothesis. Proc.
Natl. Acad. Sci. USA 99, 12031-12036.
Miura, T. (2005). Developmental regulation of caste-specific characters in social
insect polyphenism. Evol. Dev. 7, 122-129.
Miura, T., Kamikouchi, A., Sawata, M., Takeuchi, H., Natori, S., Kubo, T. and
Matsumoto, T. (1999). Soldier caste-specific gene expression in the
mandibular glands of Hodotermopsis japonica. Proc. Natl. Acad. Sci. USA. 96,
13874-13879.
Myles, T. G. and Nutting, W. L. (1988). Termite eusocial evolution: a reexamination of Bartz’s hypotheses and assumptions. Q. Rev. Biol. 63, 1-23.
Nalepa, C. A. (1994). Nourishment and the evolution of termite eusociality. In
Nourishment and Evolution in Insect Societies (ed. J. H. Hunt and C. A. Nalepa),
pp. 57-104. Boulder: Westview Press.
Noirot, C. (1969). Glands and secretions. In Biology of Termites (ed. K. Krishna and
F. Weesner), pp. 89-119. New York: Academic Press.
Noirot, C. (1985). Pathways of caste development in the lower termites. In Caste
Determination in Social Insects (ed. J. A. L. Watson, M. Okot-Kotber and C.
Noirot), pp. 59-74. New York: Pergamon.
Noirot, C. (1990). Sexual castes and reproductive strategies in termites. In Social
Insects: An Evolutionary Approach to Castes and Reproduction (ed. W. Engels),
pp. 5-35. Berlin: Springer-Verlag.
Okot-Kotber, M., Prestwich, G. D., Strambi, A. and Strambi, C. (1993).
Changes in morphogenetic hormone titers in isolated workers of the termite
Reticulitermes flavipes (Kollar). Gen. Comp. Endocrinol. 90, 290-295.
Oron, E., Mannervik, M., Rencus, S., Harari-Steinberg, O., NeumanSilberberg, S., Segal, S. and Chamovitz, D. A. (2002). COP-9 signalsome
subunits 4 and 5 regulate downstream pathways in Drosophila melanogaster.
Development 129, 4399-4409.
Park, Y. I. and Raina, A. K. (2004). Juvenile hormone III titers and regulation of
soldier caste in Coptotermes formosanus. J. Insect Physiol. 50, 561-566.
Pfaffl, M. W., TIchopad, A., Progmet, C. and Neuvians, T. P. (2004).
Determination of stable housekeeping genes, differentially regulated target
genes and sample integrity: BestKeeper–Excel-based tool using pair-wise
correlations. Biotechnol. Lett. 26, 509-515.
DEVELOPMENT
Caste regulation in termites
RESEARCH ARTICLE
Riddiford, L. M., Hiruma, K., Zhou, X. and Nelson, C. A. (2003). Insights into
the molecular basis of the hormonal control of molting and metamorphosis
from Manduca sexta and Drosophila melanogaster. Insect Biochem. Mol. Biol.
33, 1327-1338.
Scharf, M. E., Wu-Scharf, D., Pittendrigh, B. R. and Bennett, G. W. (2003a).
Caste- and development-associated gene expression in a lower termite. Genome
Biol. 4, R62.
Scharf, M. E., Ratliff, C. R., Hoteling, J. T., Pittendrigh, B. R. and Bennett, G.
W. (2003b). Caste differentiation responses of two sympatric Reticulitermes
termite species to juvenile hormone homologs and synthetic juvenoids in two
laboratory assays. Insectes Soc. 50, 346-354.
Scharf, M. E., Wu-Scharf, D., Zhou, X., Pittendrigh, B. R. and Bennett, G. W.
(2005a). Gene expression profiles among immature and adult reproductive
castes of the lower termite R. flavipes. Insect Mol. Biol. 14, 31-44.
Scharf, M. E., Ratliff, C. R., Wu-Scharf, D., Zhou, X., Pittendrigh, B. R. and
Bennett, G. W. (2005b). Effects of juvenile hormone III on Reticulitermes
flavipes: changes in hemolymph protein composition and gene expression.
Insect Biochem. Mol. Biol. 35, 207-215.
Scharf, M. E., Zhou, X. and Bennett, G. W. (2005c). Application of molecular
genomics in addressing questions on termite biology. In Proceedings of the Fifth
International Conference on Urban Pests (ed. C. Y. Lee and W. H. Robinson), pp.
19-27. Malaysia: P&Y Design Network.
Suzuki, Y. and Nijhout, H. F. (2006). Evolution of a polyphenism by genetic
accommodation. Science 311, 650-652.
Takeda, M., Mita, K., Quan, G. X., Shimada, T., Okano, K., Kanke, E. and
Kawasaki, H. (2001). Mass isolation of cuticle protein cDNAs from wing discs
of Bombyx mori and their characterizations. Insect Biochem. Mol. Biol. 31, 10191028.
Tapscott, S. J. (2005). The circuitry of a master switch: Myod and the regulation of
skeletal muscle gene transcription. Development 132, 2685-2695.
Tawfik, A. I., Kellner, L., Hoffman, K. H. and Lorenz, M. W. (2006).
Purification, characterization and titre of the haemolymph juvenile hormone
binding proteins from Schistocerca gragaria and Gryllus bimaculatus. J. Insect
Physiol. 52, 255-268.
Truman, J. W. and Riddiford, L. M. (1999). The origins of insect metamorphosis.
Nature 401, 447-452.
Truman, J. W., Hiruma, K., Allee, J. P., MacWhinnie, S. G. B., Champlin, D. T.
Development 134 (3)
and Riddiford, L. M. (2006). Juvenile hormone is required to couple imaginal
disc formation with nutrition in insects. Science 312, 1385-1388.
Vander Meer, R. K., Breed, M. D. and Winston, M. L. (1998). Pheromone
Communication in Social Insects. Boulder: Westview Press.
West-Eberhard, M. J. (2003). Developmental Plasticity and Evolution. New York:
Oxford University Press.
Wheeler, D. E. (1986). Development and physiological determinants of caste in
social hymenoptera: evolutionary implications. Am. Nat. 128, 13-34.
Wheeler, D. E. and Nijhout, H. F. (2003). A perspective for understanding the
modes of juvenile hormone action as a lipid signaling system. BioEssays 25, 9941001.
Willis, J. (1999). Cuticular proteins in insects and crustaceans. Am. Zool. 39, 600609.
Wilson, E. O. (1971). The Insect Societies. Cambridge, MA: The Belknap Press of
Harvard University.
Wilson, E. O. and Bossert, W. H. (1963). Chemical communication among
animals. Recent Prog. Horm. Res. 19, 673-716.
Wu-Scharf, D., Scharf, M. E., Pittendrigh, B. R. and Bennett, G. W. (2003).
Expressed sequence tags from a polyphenic Reticulitermes flavipes cDNA library.
Sociobiology 41, 479-490.
Yagi, K. J., Kwok, R., Chan, K. K., Setter, R. R., Myles, T. G., Tobe, S. S. and
Stay, B. (2005). Phe-Gly-Leu amide allatostatin in the termite Reticulitermes
flavipes: content in brain and corpus allatum and effect on juvenile hormone
synthesis. J. Insect Physiol. 51, 357-365.
Zhou, X. F. and Riddiford, L. M. (2002). Broad specifies pupal development and
mediates the ‘status quo’ action of juvenile hormone on the pupal-adult
transformation of Drosophila and Manduca. Development 129, 2259-2269.
Zhou, X. G., Oi, F. M. and Scharf, M. E. (2006a). Social exploitation of
hexamerin: RNAi reveals a major caste-regulatory factor in termites. Proc. Natl.
Acad. Sci. USA 103, 4499-4504.
Zhou, X. G., Tarver, M. R., Bennett, G. W., Oi, F. and Scharf, M. E. (2006b).
Two hexamerin genes from the termite Reticulitermes flavipes: sequence,
expression, and proposed functions in caste regulation. Gene 376, 47-58.
Zhou, X. G., Song, C., Grzymala, T. L., Oi, F. M. and Scharf, M. E. (2006c).
Juvenile hormone and colony conditions differentially influence cytochrome
P450 gene expression in the termite Reticulitermes flavipes. Insect Mol. Biol. 15,
749-761.
DEVELOPMENT
610