RESEARCH ARTICLE 4437
Development 134, 4437-4447 (2007) doi:10.1242/dev.010983
Spermatocyte cytokinesis requires rapid membrane addition
mediated by ARF6 on central spindle recycling endosomes
Naomi Dyer1,2,*, Elena Rebollo3,*, Paloma Domínguez3, Nadia Elkhatib4, Philippe Chavrier4, Laurent Daviet5,
Cayetano González3 and Marcos González-Gaitán1,6,†
The dramatic cell shape changes during cytokinesis require the interplay between microtubules and the actomyosin contractile ring,
and addition of membrane to the plasma membrane. Numerous membrane-trafficking components localize to the central spindle
during cytokinesis, but it is still unclear how this machinery is targeted there and how membrane trafficking is coordinated with
cleavage furrow ingression. Here we use an arf6 null mutant to show that the endosomal GTPase ARF6 is required for cytokinesis in
Drosophila spermatocytes. ARF6 is enriched on recycling endosomes at the central spindle, but it is required neither for central
spindle nor actomyosin contractile ring assembly, nor for targeting of recycling endosomes to the central spindle. However, in arf6
mutants the cleavage furrow regresses because of a failure in rapid membrane addition to the plasma membrane. We propose that
ARF6 promotes rapid recycling of endosomal membrane stores during cytokinesis, which is critical for rapid cleavage furrow
ingression.
INTRODUCTION
Cytokinesis is the division of a cell into two following separation of
the chromosomes during anaphase. Central spindle microtubules,
the actomyosin contractile ring and their regulators, drive dramatic
cell shape changes during cytokinesis (Glotzer, 2005). Cytokinesis
requires coordination between the central spindle and the
actomyosin contractile ring (Adams et al., 1998; Jantsch-Plunger et
al., 2000; Somers and Saint, 2003). Recently, membrane trafficking
has also been implicated in cytokinesis (Albertson et al., 2005;
Glotzer, 2005). Membrane trafficking is necessary for the massive
increase in plasma membrane surface area, and can also locally
enrich specific components in the cleavage furrow plasma
membrane (Bluemink and de Laat, 1973, VerPlank and Li, 2005).
The centralspindlin complex, composed of Pavarotti (Pav),
RacGAP50C, and the associated Rho guanine nucleotide exchange
factor (GEF) Pebble, is essential for communication between central
spindle microtubules and the actomyosin contractile ring, probably
by regulating the activity of the small GTPase RhoA (Somers and
Saint, 2003). Active RhoA regulates actin polymerization, myosin
II and citron kinase (Amano et al., 1996; Matsui et al., 1996;
Yamashiro et al., 2003). Around 20 highly conserved proteins,
including central spindle, actin myosin ring and RhoA pathway
machinery are required for cytokinesis in multiple systems (Glotzer,
2005). However, recent RNAi screens have repeatedly identified
membrane-trafficking components necessary for cytokinesis
(Echard et al., 2004; Eggert et al., 2004; Skop et al., 2004).
1
Max Planck Institute of Molecular Cell Biology and Genetics, Pfotenhauerstrasse
108, 01307 Dresden, Germany. 2Liverpool School of Tropical Medicine, Pembroke
Place, Liverpool L3 5QA, UK. 3Institut de Recerca Biomèdica (IRB) and Institució
Catalana de Recerca i Estudis Avançats (ICREA), Parc Cientific Barcelona, Josep
Samitier 1-5, 08028 Barcelona, Spain. 4CNRS UMR144, Institut Curie, Membrane
and Cytoskeleton Dynamics Group, 26 Rue d’Ulm 75005 Paris, France. 5Hybrigenics
SA, 3-5 Impasse Reille, 75014 Paris, France. 6Département de biochimie, Sciences II,
30, Quai Ernest Ansermet CH-1211 Genève 4, Switzerland.
*These authors contributed equally to this work
†
Author for correspondence (e-mail: [email protected])
Accepted 20 September 2007
The three main classes of trafficking factors implicated in
cytokinesis are components of the secretory pathway, endocytic
and/or recycling factors and membrane fusion machinery. Golgi
proteins required for the secretory pathway such as Cog5 and
Syntaxin5 are required for cytokinesis (Farkas et al., 2003; Xu et al.,
2002). Endocytic recycling factors necessary for cytokinesis include
Rab11 and Rab11FIP3/Arfophilin, which associate with the central
spindle and furrow cortex (Skop et al., 2001; Wilson et al., 2005).
Fusion machinery such as the exocyst complex and t- and vSNAREs localizes at the mitotic midbody and furrow cortex, and is
necessary for cytokinesis (Fielding et al., 2005; Finger et al., 1998;
Gromley et al., 2005; Jantsch-Plunger and Glotzer, 1999; Low et al.,
2003).
One membrane-trafficking component implicated in cytokinesis
is the class III ADP ribosylation factor, ARF6. A constitutively
active, GTPase-defective ARF6 mutant, ARF6Q67L, concentrated
at the central spindle and midbody of HeLa cells, and ARF6Q67L
overexpression caused late cytokinesis defects (Schweitzer and
D’Souza-Schorey, 2002). Knockdown of ARF6 in HeLa cells using
siRNA caused a late cytokinesis block (Schweitzer and D’SouzaSchorey, 2005). Possible effectors for ARF6 during cytokinesis are
the Rab11/ARF6 binding proteins Rab11FIP3 and Rab11FIP4,
which ARF6 recruits to the central spindle in HeLa cells (Fielding
et al., 2005; Schweitzer and D’Souza-Schorey, 2002; Schweitzer
and D’Souza-Schorey, 2005). ARF6 regulates endocytosis,
recycling and actin remodelling (D’Souza-Schorey et al., 1995;
Radhakrishna and Donaldson, 1997; Song et al., 1998). Via these
mechanisms, ARF6 affects processes such as adherens junction
disassembly and cell migration, including the formation of cord-like
structures by hepatocytes in the mouse liver in response to
hepatocyte growth factor (D’Souza-Schorey and Chavrier, 2006;
Suzuki et al., 2006). In Drosophila, the ARF6-GEF Loner/Schizo is
necessary for myoblast fusion (Chen et al., 2003) and midline
crossing of axons (Onel et al., 2004).
In contrast to the central spindle microtubules and the actomyosin
contractile ring, little is known about temporal and spatial
coordination of membrane trafficking during cytokinesis. Many
membrane-trafficking components are localized to the central
DEVELOPMENT
KEY WORDS: Drosophila, Meiosis, Spermatogenesis, Testis
4438 RESEARCH ARTICLE
spindle (Skop et al., 2004), but the molecular machinery connecting
the central spindle to membrane trafficking is unclear. Here we show
that cytokinesis requires ARF6 in the Drosophila male germ line.
ARF6 localizes to the plasma membrane and a population of early
and recycling endosomes. In dividing cells, ARF6 is specifically
enriched on recycling endosomes associated with the Pav central
spindle. ARF6 is not required to target recycling endosomes to the
central spindle, but is required for rapid membrane addition during
cytokinesis. We suggest that ARF6 enrichment on recycling
endosomes at the central spindle increases the rate of recycling to
the plasma membrane, thus coordinating membrane recycling with
the central spindle and cleavage furrow invagination during
cytokinesis.
MATERIALS AND METHODS
Drosophila stocks
Imprecise excision of EP(2)2612 generated the deletions arf61, arf62 and
arf63. Thirty nucleotides flanking sequence on each side of the deletions and
the excision scar (italics) are shown, with asterisks indicating the boundaries
of arf6 sequence: arf61, TATACATGTGTATGTGTGTTACGGGCGTGT*TCATGATGAAATA*ACGTACATAAATTACAAATGTTAAAAATG;
arf62,
TATACATGTGTATGTGTGTTACGGGCGTGT*TCATGATGG*CGCGACGCCATCATACTGATATTTGCTAAC; arf63, TATACATGTGTATGTGTGTTACGGGCGTGT*TCATGACGCTCATGACG*TTACAACGATACCCACTGTGGGCTTTAATG. A linked lethal mutation in the
EP(2)2612 chromosome was cleaned by recombination. pavB200, pavA375
and chic13E were previously described (Adams et al., 1998; Giansanti et al.,
1998; Salzberg et al., 1994). Pav-GFP, GFP-␣-tubulin, His2AvDGFP and
DE-cad-GFP under polyubiquitin promoter control (Lee et al., 1988), and
Sqh-GFP with the sqh promoter were previously described (Clarkson and
Saint, 1999; Minestrini et al., 2003; Oda and Tsukita, 2001; Rebollo et al.,
2004; Royou et al., 2004). ␥-Tubulin GFP flies were a gift from S.
Llamazares (IRB and ICREA, Barcelona, Spain).
Development 134 (24)
after the addition of 0.2% Triton X-100. After washing with PBS,
subsequent staining and washing steps were performed in PBS containing
0.1% Triton X-100. A 2-hour block with 0.5% BSA was followed by
overnight incubation at 4°C with 0.5% BSA and primary antibodies: rat antiHA (clone 3F10, Roche), 1:500, rabbit anti-Pav 1:250 (Adams et al., 1998).
After three 20-minute washes, primary antibodies were detected using Alexa
Fluor 546-conjugated anti-rat (Molecular Probes) and Cy5-conjugated antirabbit (Jackson ImmunoResearch Laboratories) antibodies at 1:500, with
2% normal goat serum for 2 hours at room temperature.
Confocal images were acquired using Zeiss LSM 510 and LeicaDMIRE2,
TCS SP2 SP2 microscopes, with 63⫻ (NA 1.4) and 100⫻ (NA 1.4)
objective lenses. Colocalization (± s.e.m.) was quantified in unprocessed
images in the Zeiss LSM image browser by manually counting punctae. In
dividing cells, punctae within 3 ␮m of Pav staining were classified as
‘central spindle’ localized, other punctae as ‘non central spindle’. Images
were processed for contrast/brightness, levels and ‘dust and scratches’ with
Adobe Photoshop 7.0 (Adobe Systems).
Live imaging
Spermatocyte imaging was carried out as described (Rebollo and Gonzalez,
2004). Cell perimeter and diameter were measured in ImageJ
(http://rsb.info.nih.gov/ij/). Furrow ingression, perimeter and surface area
rates are linear regression line slopes. Four to six confocal sections were
maximally projected, except Sqh-GFP.
Germ line clones of arf6 mutants
Germline clones were generated using the flp/FRT systems described
(Chou and Perrimon, 1992). Females (genotype y w hsflp;
FRTG13OvoD1/FRTG13arf61) raised at 25°C were heat shocked for 2 hours
at 38°C as third instar larvae to activate the flippase, generating germ line
clones (genotype y w hsflp; FRTG13arf61/FRTG13arf61). y w hsflp;
FRTG13OvoD1/FRTG13arf61 females were crossed for 3 days to wild-type
males in vials supplemented with fresh yeast before collecting eggs. The
same procedure was used for arf63.
Yeast two-hybrid analysis
Transgenic flies were generated by injecting the following vectors:
P(Ubi:arf6-HA), a PCR product containing ARF6 coding sequence from the
LD22876 clone (BDGP EST Project) with SacI and XbaI sites in primer
overhangs and including a C-terminal HA epitope tag was cloned between
SacI and XbaI sites of pSRalpha. A SacI-XbaI fragment excised from
PSRalpha was ligated between SacI and XbaI sites of TOPO. A KpnI-XbaI
fragment from the resulting vector was cloned between the polyubiquitin
vector KpnI and SpeI sites. P(w+arf6+) arf6 rescue construct, a 3.8 kb PCR
product from genomic DNA containing arf6 and flanking sequences was
cloned into TOPO-XL. The 3.8 kb fragment from XbaI, NotI and SphI
digestion was inserted between NotI and XbaI sites of pCasper4. P(UbiGFPRab5) and P(UbiGFP-Rab11) were generated from pUAST-GFP-Rab5
(Wucherpfennig et al., 2003), and pUAST-GFP-Rab11 (Emery et al., 2005).
P(UbiGFP-Rab4), PCR product containing rab4-coding sequence from
pOT2-GH18176 with primer overhang XhoI-sites was cloned into the XhoI
site of pEGFP-C3. The NheI-XbaI fragment from pEGFP-C3-rab4 was
inserted in the pUAST XbaI-site. In all cases, GFP-Rab containing NotIXbaI fragments from pUAST were cloned between polyubiquitin vector
NotI and XbaI sites.
Antibodies and microscopy
A rabbit polyclonal antibody generated (Eurogentec) against amino acids
99-112 of Drosophila ARF6 (ARTELHRIINDREM) binds ARF6 at 20 kDa
in western blots. Rabbit anti actin (Sigma A2066) was used 1:400. AntiARF6 was used 1:50 for western blotting, but was unsuitable for
immunofluorescence.
Embryo immunofluorescence staining was performed using standard
techniques. Mouse antibody BP102 (Hybridoma Bank) was used 1:30, and
Rabbit anti MHC (Kiehart and Feghali, 1986) at 1:500. arf6 embryos
zygotically rescued by CyO, hb-lacZ were identified using rabbit anti ␤galactosidase (Cappel) 1:500. Testes dissected in PBS were fixed for 20
minutes in PBS containing 4% paraformaldehyde, and a further 20 minutes
PCR from clone LD22876 generated a Glu67-Leu substitution of the ARF6
ORF. NotI and SpeI overhang sites were generated by PCR and the resulting
fragment cloned into pB27 bait plasmid derived from pBTM116 (Vojtek and
Hollenberg, 1995). A random-primed cDNA library from 0-24 hour
Drosophila embryo poly(A+) RNA was constructed into the pP6 plasmid
derived from pGADGH (Bartel et al., 1993). The two-hybrid system was
used to detect protein-protein interactions (Bartel, 1993). The library was
transformed into the Y187 yeast strain. Around 10 million independent yeast
colonies were collected, pooled and stored at –80°C, and over 50 million
interactions tested using a previously described mating protocol (FromontRacine et al., 1997). Prey fragments of positive clones were PCR amplified
and sequenced at 5⬘ and 3⬘ junctions. Corresponding genes were identified
in the GenBank database (NCBI) using an automated procedure
(Formstecher et al., 2005).
Pav-binding assay
DNA encoding Pav655-865 was cloned into pGEX4T1 at the GST Cterminus. pGEX4T1Pav655-865 and pGEX4T1 were transformed into
E. coli strain B21, and expression induced by 1 mM isopropyl ␤-Dthiogalactopyranoside for 5 hours at 20°C. GST proteins were affinity
purified using glutathione-Sepharose beads (Amersham Biosciences), eluted
using glutathione, dialyzed against 20 mM Tris-HCl, pH 7.4, 150 mM NaCl,
2 mM EDTA, 2 mM ␤-mercaptoethanol and 10% glycerol, and stored at
–80°C. HeLa cells were transfected with pSRalpha(ARF6HA) and
pSRalpha(ARF6Q67LHA) using Effectene (Qiagen), lysed after 20-24
hours in 50 mM Tris-HCl pH 5.5, 137 mM NaCl, 1% Triton X-100, 10 mM
MgCl2, 10% glycerol (Buffer B) with complete protease inhibitor cocktail
tablets (Roche), and centrifuged for 15 minutes at 13,000 rpm (15,000 g) at
4°C. Supernatants were incubated with 20 ␮g of GST fusion protein for 15
minutes at 4°C with 0.5% BSA, and for 1-2 hours at 4°C after adding
glutathione-Sepharose beads. Beads were washed three times in Buffer B,
once in Buffer B containing 0.1% SDS and once in PBS. Bound proteins
were eluted using 4⫻ NuPage LDS sample buffer (Invitrogen) and assayed
DEVELOPMENT
Transgenics
ARF6 and cytokinesis
RESEARCH ARTICLE 4439
Fig. 1. Drosophila ARF6 is required for cytokinesis in
testes. (A) The portion of genomic region 51f encoding
Drosophila ARF6 (blue), and protein coding sequences of
arf6 (red). arf61, arf62 and arf63 (below) are deletions
produced by imprecise excision of EP(2)2612.
(B-D) Phase-contrast images of spermatids after the
second meiotic division, showing white nuclei (arrows)
and black mitochondrial derivatives (Nebenkerne,
arrowheads). (B) WT, (C) arf61 homozygotes: two or four
nuclei per cell. (D) A rescue construct expressing arf6
from the endogenous promoter restores a 1:1 ratio of
nucleus to Nebenkern per cell. Scale bars: 20 ␮m.
(E) Frequency of nuclei per cell in WT, arf61, arf61 rescued
by the arf6 endogenous rescue construct and arf63
rescued by expression of ARF6HA. n, number of cells
counted.
Perimeter and surface area measurement
To test the suitability of perimeter as a measure of surface area, six control
cells were cultured with 8 ␮M FM4-64 (Molecular Probes) in Schneider’s
medium with 10% fetal calf serum. In these conditions spermatocytes are
almost rotationally symmetrical. The cell outline of the mid confocal plane
of non-tilted cells was used to calculate surface area capitalizing on this
rotational symmetry, approximating the cell by a series of around 20 cone
segments. Software used to calculate the surface area from cell outlines
available upon request ([email protected]). For each cell, perimeter
was roughly linearly related to surface area:
P = mS + c ,
where P is perimeter; S, surface area; m, slope of the linear regression line;
and c, intercept on the perimeter axis. The value of m was similar for
different cells, whereas c was more variable (see Fig. S4C, Table S2 in the
supplementary material). Therefore, without making a complete set of
measurements on a cell, it is difficult to infer the surface area from the
perimeter. However, the rate of perimeter change indicates of the rate of
surface area change well.
Let P1 be the perimeter, and S1 the surface area at time t1, and P2 be the
perimeter and S2 the surface area at time t2.The perimeter change between t1
and t2 is:
P2 – P1 = (mS2 + c) – (mS1 + c) = m(S2 – S1) .
Therefore the rate of perimeter change for time period t1 to t2 is:
(P2 – P1)/ (t2 – t1) = m(S2 – S1)/ (t2 – t1) .
Therefore, rate of perimeter change can be used to indicate surface area rate
change, since the cell-specific c term is eliminated: only the slope of the
relationship between surface area and perimeter is relevant.
Cell volume was calculated as the product of the cell area in each slice
and the slice separation, from stacks of optical slices taken at 0.51 ␮m
intervals through spermatocytes expressing DE-cad-GFP.
RESULTS
Drosophila arf6 is a non-essential gene required
during spermatogenesis
To study ARF6-dependent endocytic trafficking, we generated
deletions in the arf6 gene by imprecise excision of the EP(2)2612
transposable element in intron 1 (Fig. 1A). A null mutation, arf61,
corresponding to a 1709-nucleotide deletion in the transcribed
region, entirely removed the ORF (Fig. 1A). Consistently, an
antibody against Drosophila ARF6 detected no ARF6 protein in
western blots from homozygous arf61 flies (see Fig. S1A in the
supplementary material).
ARF6 is not essential for fly viability. Homozygous arf61 progeny
from homozygous mutant mothers (maternal/zygotic mutants) were
viable until adulthood, presenting no overt external morphological
phenotype. Recent reports show that expression of a GDP-bound
dominant negative ARF6 protein (ARF6TN) impairs myoblast
fusion and axon path finding during embryogenesis (Chen et al.,
2003; Onel et al., 2004). Both developmental events occurred
normally in arf6 null mutant embryos (see Fig. S1B-E in the
supplementary material), indicating that the ARF6TN protein causes
secondary defects beyond the suppression of ARF6 function.
DEVELOPMENT
by western blotting with rabbit anti-HA antibody at 1:500 (Roche) and
affinity-purified polyclonal rabbit anti-GST at 1:10,000 (Protein Expression
and Purification Facility, MPI-CBG, Dresden).
4440 RESEARCH ARTICLE
Development 134 (24)
Female arf61 flies showed reduced fertility because of a partially
penetrant requirement for ARF6 during chorion formation in the
germ-line (see Fig. S2 and Table S1 in the supplementary material).
Male arf61 flies were completely sterile. Mutant spermatids showed
a ‘four-wheel-drive’ phenotype, indicating a cytokinesis defect during
spermatocyte meiosis (Fuller, 1993) (Fig. 1B-E): over 90% of
spermatids contained more than one nucleus, and 41% had four nuclei
per mitochondrial Nebenkern derivative (Fig. 1E), corresponding to
79% failure in cytokinesis during the two meiotic divisions (see Fig.
S3 in the supplementary material). 1.9% of cells showed 8:1 nucleito-Nebenkern ratios, suggesting that cytokinesis of gonial cell mitosis
prior to meiosis is also occasionally affected, as previously suggested
for other cytokinesis mutants (Brill et al., 2000; Giansanti et al., 2004).
arf62 and arf63 showed phenotypes indistinguishable from arf61. Male
sterility and the mutant cytokinesis phenotype are due to the arf61
mutation, because an arf6+ genomic transgene rescued the defects,
yielding fertile males (Fig. 1D,E).
ARF6 is required for cleavage furrow progression
Videomicroscopy of control and mutant cells during meiosis I was
performed to characterize the cytokinesis defect. arf6 mutant
spermatocytes expressing Histone2A-GFP and ␥-Tubulin GFP
showed that chromosome segregation and centrosome behavior
occurs normally (not shown). ␣-Tubulin GFP fusion (GFP–␣tubulin) indicated that spindle initially forms normally in arf61
mutant spermatocytes (see Movies 1, 2 in the supplementary
material). In arf6 mutant cells, a cleavage furrow was established,
but later regressed. We therefore analyzed furrow ingression kinetics
in wild-type and arf6 mutant spermatocytes.
In control cells, cell shape and diameter were constant until
anaphase onset (see Fig. 4B and Movies 1, 3, 4, 7 and 9 in the
supplementary material). After anaphase onset, cells elongated,
decreasing in equatorial diameter at 0.4 ␮m/minute (Fig. 3B, Fig.
4C). During anaphase B, which starts 2 minutes after anaphase
onset (min AA), Pav accumulated at the central spindle
(Minestrini et al., 2003) (Fig. 2A, Fig. 3A, Fig. 4C; see Movie 3
in the supplementary material). The centralspindlin complex
subsequently signals to the cortex, and the actomyosin contractile
ring forms. Myosin regulatory light chain (Sqh-GFP)
accumulated at the future cleavage furrow 1 minute after the onset
of Pav accumulation at the central spindle (Fig. 2D, Fig. 3A; see
Movie 4 in the supplementary material) (Adams et al., 1998;
Royou et al., 2004; Somers and Saint, 2003). Shortly after Pav
and Sqh accumulation, equator contraction accelerated to
DEVELOPMENT
Fig. 2. ARF6 is not required for central spindle or contractile ring formation. (A-E) Time-lapse images of Pav-GFP (A-C) and Sqh-GFP (D,E)
during cytokinesis in control (A,D), arf6 (B,E) and chic13E mutant spermatocytes (C). Times are minutes:seconds after anaphase onset (min AA). Scale
bars: 5 ␮m. (A) Control, Pav-GFP accumulates at the central spindle during anaphase B (arrowhead, 03:29). Central spindle microtubules labelled
with Pav-GFP bundle and compact into a dense midbody (arrowheads, 09:14-59:54). (B) arf61, anaphase B Pav-GFP central spindle accumulation
occurs (arrowhead, 06:54). Pav-GFP-labelled microtubules bundle (arrowhead, 15:20), a cleavage furrow initiates, but central spindle Pav-GFP signal
declines (arrowhead, 24:21). After furrow regression, only a tiny amount of Pav-GFP remains at the cortex (arrowhead 50:21). (C) chic13E, anaphase
B Pav-GFP central spindle accumulation occurs (arrowhead, 03:00, 06:54), but no furrow is initiated. 17:30 min AA: very little Pav-GFP remains at
the central spindle. (D) Control, Sqh-GFP transfers to the cortex (arrowhead, 04:55), accumulates at the future cleavage furrow site (arrowheads,
07:05, 08:11) which then invaginates (arrowhead, 22:14). (E) arf63, Sqh-GFP transfers to the cortex (arrowhead, 04:58) concentrating at the future
cleavage furrow site (arrowheads 07:01, 14:09). Sqh-GFP remains at the cortex during and after regression (arrowhead, 25:22). Genotypes: w;
arf61/CyO; Pav-GFP/TM6B (A), w; arf61/ arf61; Pav-GFP/TM6B (B), chic13E/chic13E; Pav-GFP/TM6B (C), y w sqhAX3; +; P (w+ sqh-gfp) (D), y w sqhAX3;
arf63/arf63; P (w+ sqh-gfp) (E).
ARF6 and cytokinesis
RESEARCH ARTICLE 4441
wide, the furrow regresses. After cleavage furrow collapse, Pav
dissociates from the central spindle, although Sqh remains at the
cortex during regression (Fig. 2E; see Movie 6 in the
supplementary material).
These observations indicate that ARF6 is not necessary for
targeting Pav to the central spindle, or for actomyosin ring
formation. The mutant phenotypes reveal two critical phases for
ARF6 function during cytokinesis: (1) an early role during cleavage
furrow progression after furrow initiation, and (2) a later role in ring
canal establishment at the end of cytokinesis. Since ring canal
stabilization may be a specialized event restricted to germ cells, and
may be due to the higher frequency of the early regressors, we
decided to concentrate on the early regressors and the early role of
ARF6 in furrow progression.
1 ␮m/minute (Fig. 3, Fig. 4C). Five minutes after Pav
accumulation, a plasma membrane indentation, the ‘cleavage
furrow’, appeared (Fig. 2A, Fig. 3A, Fig. 4C). The furrow
progressed at 1 ␮m/minute, finally decelerating to stop around 35
minutes after anaphase onset at width 3-5 ␮m (Fig. 2A, Fig. 3A,
Fig. 4C; see Fig. S4A in the the supplementary material). This
narrow opening between the two daughter cells differentiates into
the ring canal (Hime et al., 1996).
In time-lapse movies, cytokinesis failed in 89% of arf61 cells,
consistent with the frequency of multinucleated spermatids (see Fig.
S3B in the supplementary material). Cytokinesis failed early during
furrow progression in 55% of the failing cells. The remaining 45%
of failing cells were ‘late regressors’, in which cytokinesis proceeds
with normal kinetics of furrow formation and progression until the
furrow is less than 10 ␮m wide. The furrow stays at this diameter for
a variable time period before collapsing (Fig. 3A; see Fig. S4A in
the supplementary material). During furrow progression, plasma
membrane was also added with normal kinetics (see below; Fig. 4B;
see Fig. S4B in the supplementary material).
In ‘early regressors’, anaphase B-cell elongation occurred. The
equator contracted at 0.3 ␮m/minute, only slightly slower than in
the wild type (Fig. 3B, Fig. 4C). Pav and Sqh central spindle and
contractile ring targeting occurred only slightly later than in the
wild type (Fig. 2B,E, Fig. 4C; see Movies 5 and 6 in
supplementary material). However, fast equator contraction did
not occur, only accelerating to 0.5 ␮m/minute, and indentation
occurred 10 minutes, instead of 5 minutes after central spindle
Pav accumulation (Fig. 2B, Fig. 3A, Fig. 4C). Shortly after the
cleavage furrow indentation appeared, when it is around 15 ␮m
Membrane addition to the plasma membrane is
uncoupled from actomyosin ring contraction
The arf6 mutant phenotype reveals a link between cleavage furrow
progression and rapid membrane surface increase. To find out
whether cleavage furrow progression defects lead to a defect in
surface increase, or vice versa, we studied furrow progression and
membrane addition rates in profilin chickadee (chic) mutants
(Cooley et al., 1992; Giansanti et al., 1998). In chic13E mutants, the
DEVELOPMENT
Fig. 3. ARF6 is required for rapid cleavage furrow invagination.
(A) Representative results for control, arf6 mutant ‘early regressor’, ‘late
regressor’ and chic13E illustrate furrow progression, timing of Pavarotti
concentration at central spindle (arrowheads) and indented cleavage
furrow appearance (arrows). Diameter is measured at furrow tip or
future furrow site. (B) Furrow ingression rates in control (black), arf6
late regressors (blue) chic13E (green) and arf6 early regressors (red).
Furrow ingression is significantly impaired in arf6 mutants compared
with control cells: *P<0.01, Student’s t-test. min AA, minutes after
anaphase onset.
ARF6 is required for rapid plasma membrane
addition during cytokinetic cleavage furrow
progression
Spermatocytes divide, producing two daughter cells with half the
volume of the mother (volume change 0.8±1.4%, n=5 cells). For
spherical cells, this implies that the membrane surface increases by
26% during cytokinesis. We therefore investigated whether the arf6
phenotype is caused by a defect in membrane addition to the cell
surface. The absence of surface increase could lead to an increase in
membrane tension, which would counteract the forces generated by
the contractile ring. This hypothesis was prompted by the
established role of ARF6 during endocytic membrane recycling
(D’Souza-Schorey et al., 1998; Prigent et al., 2003; Radhakrishna
and Donaldson, 1997) which might be essential for rapid membrane
addition from an endosomal, ARF6-dependent membrane store.
The kinetics of plasma membrane increase during meiosis I was
studied by measuring cell perimeter of spermatocytes in confocal
images, as well as the total surface area calculated for 3Dreconstructed cells (Fig. 4; see Fig. S4 in the supplementary
material). Experiments on the relationship between perimeter and
surface area changes indicated that perimeter increase correlates
well with surface area increase (see Fig. S4C in the supplementary
material). Plasma membrane growth during meiosis I was negligible
prior to anaphase. Membrane increase started during anaphase B cell
elongation at 0.6 ␮m/minute. This ‘perimeter rate’ corresponds to a
membrane addition of around 8 ␮m2/minute (see models in the
supplementary material). The perimeter rate increased greatly (2.5fold, corresponding to around 22 ␮m2/minute) directly after the
onset of Pav accumulation, peaking around 15 min AA at the time
of maximum furrow ingression rate and the appearance of
membrane indentation (Fig. 4B,C). Subsequently, the rate decreased
until the completion of cytokinesis. In arf6 mutants, slow membrane
addition characteristic of early cytokinesis was maintained after
furrow membrane indentation, and the rapid membrane addition
phase never occurred (Fig. 4B,C; see Fig. S4B in the supplementary
material). These data suggest that ARF6 is involved in rapid
membrane addition to the plasma membrane, which is necessary
during the rapid contraction of the actin ring during cytokinesis.
4442 RESEARCH ARTICLE
Development 134 (24)
central spindle initially formed normally and Pav was targeted
properly (Fig. 2C), but actomyosin contractile ring formation fails
(Giansanti et al., 1998). As a consequence, furrow ingression
kinetics are even more affected than in arf6 mutants (Fig. 3).
However, in these chic13E cells, membrane addition initially
occurred with kinetics similar to control cells, until the premature
disassembly of the central spindle and Pav-GFP disappearance from
the central spindle area (Fig. 2C, Fig. 4A,B; see Fig. S4B in the
supplementary material).
These results imply that the actomyosin ring contraction and
cleavage furrow progression are not essential for the rapid
membrane-addition phase. Lack of rapid membrane addition is a
specific feature of the arf6 mutants, not a trivial consequence of
furrow ingression failure. The data leave open a possible role for the
Pav central spindle during the process.
ARF6 endosomes are associated with the Pav
central spindle during cytokinesis
We then studied the subcellular localization of ARF6, its possible
association with intracellular endosomal membranes, and the Pav
central spindle. We used GFP-Rab4 as a marker for early
endosomes along the fast recycling route to the plasma
membrane, and GFP-Rab11 to label recycling endosomes along
the kinetically slower recycling route (Sheff et al., 1999; van der
Sluijs et al., 1992). Functional HA-tagged ARF6 was expressed
from the polyubiquitin promoter. This expression rescued the arf6
mutant cytokinesis and chorion phenotypes (Fig. 1E; see Fig. S2D
in the supplementary material). ARF6-HA was present in the
cytosol and enriched at endosomes and the plasma membrane,
as previously reported in mammalian cells (Fig. 5; see Fig. S5 in
the supplementary material) (D’Souza-Schorey and Chavrier,
2006).
The results of the localization analysis are summarized in Table
1. Early during meiosis I cytokinesis, ARF6-positive endosomes
(66% of punctae) associated with Pav-positive central spindle
microtubules including the cortical microtubule population where
the cleavage furrow forms (Table 1, Fig. 5A-B,D, arrowheads; see
Fig. S5D in the supplementary material). This contrasts with 52%
of Rab4 endosomes and 40% of Rab5 endosomes associated with
the central spindle during meiosis I (Table 1). The ARF6 central
spindle endosomal population corresponds mainly (87%) to Rab4labelled endosomes.
Rab11 recycling endosomes are also recruited to the central
spindle and decorated with ARF6 (Table 1, Fig. 5B). Unlike
ARF6/Rab4 endosomes, Rab11/ARF6 endosomes are only enriched
at the central spindle late in cytokinesis when the cleavage furrow is
almost fully ingressed [4.9±0.4 ␮m across (mean ± s.e.m.), n=11
cells]. This suggests that both Rab4 and Rab11 recycling endosomes
participate in plasma membrane addition during cytokinesis.
However, the late appearance of Rab11 endosomes at the central
spindle in control cells, at a time when the furrow had already
collapsed in arf6 early regressors, instead suggests a role for Rab11
ring canal stabilization, which might be critically affected in the arf6
‘late regressors’.
In summary, recycling endosomes at the central spindle contain
ARF6. Is ARF6 specifically enriched in the central spindle
population of Rab4 and Rab11 recycling endosomes? Most central
spindle Rab4 endosomes (73%) were decorated by ARF6 whereas
only 22% of the Rab4 endosomes not localized to the central spindle
contained ARF6 (Table 1, Fig. 5C). Similarly, 85% of Rab11
endosomes at late central spindles contained ARF6, versus 10%
elsewhere in the cell (Table 1, Fig. 5C). These data indicate that
ARF6 targeting to recycling endosomes is specifically biased
towards the central spindle endosomal population.
Since central spindle recycling endosomes are enriched in ARF6,
we asked whether ARF6 itself targets recycling endosomes to the
central spindle. We therefore observed Rab4 and Rab11 endosome
distribution in time-lapse movies. In arf61 mutants, rab4 endosomes
were targeted to the central spindle as in wild-type controls (Fig.
6A,B; see Movies 7 and 8 in the supplementary material). Therefore,
ARF6 does not target endosomes to the spindle, but instead
functions downstream of endosomal targeting. ARF6 does not seem
DEVELOPMENT
Fig. 4. ARF6 is required for rapid growth of the
plasma membrane during cytokinesis.
(A) Representative cells for control, arf6 early regressor
and chic13E cells illustrate perimeter kinetics during
anaphase and cytokinesis. (B) Rate of perimeter change
in control, arf6 early and late regressors, and chic13E
cells. Membrane insertion is significantly impaired in
arf6 from 5 min AA onwards: *P<0.05 and #P<0.001,
Student’s t-test. Membrane insertion is not significantly
impaired in chic13E mutants until central spindle
disassembly (cf. 5-10 min AA with 10-20 min AA).
Error bars represent s.e.m. (C) Timeline of the events of
cytokinesis and the rates of cytokinesis furrow
ingression and perimeter change (membrane growth)
in control and arf6 early regressors, with respect to
central spindle Pav-GFP appearance. Black and white
bars represent 1-minute intervals. CS, central spindle;
CR, contractile ring.
ARF6 and cytokinesis
RESEARCH ARTICLE 4443
In summary: (1) Rab4 and Rab11 recycling endosomes are
targeted to the central spindle; (2) ARF6 targeting is biased towards
the central spindle population of recycling endosomes; but (3) ARF6
does not target recycling endosomes to the central spindle. Instead,
another machinery must target ARF6 to central spindle endosomes.
ARF6 could then endow the endosomal membrane stores with rapid
recycling kinetics necessary for rapid membrane addition during fast
cleavage furrow progression.
ARF6 binds the centralspindlin component
Pavarotti
What targets ARF6 to central spindle endosomes? Using a
Drosophila embryo cDNA library, Pav was identified in a twohybrid screen for proteins interacting with Drosophila ARF6Q67L
mutant (Fig. 7A). Five clones corresponding to the Pav ORF define
the ARF6-binding domain: a region adjacent to the coiled-coil
domain of Pav (amino acids 727-844; Fig. 7B). Binding assays
confirmed this interaction (Fig. 7C). These results suggest that Pav
might contribute to ARF6 recruitment to central spindle endosomes.
Fig. 5. ARF6 endosomes at the Pav central spindle during
cytokinesis. (A,B) Fixed primary spermatocytes. (A,B) ARF6HA (red)
and Pav (blue) immunostaining and Rab-GFP [green; Rab4 (A) and
Rab11 (B)]. ARF6HA colocalizes with GFP-Rab4 (A) and GFP-Rab11 (B)
at the central spindle (arrowheads). (C) Colocalization frequency of
GFP-Rab4 (n=17 cells) and GFP-Rab11 (n=13 cells) with ARF6HA at the
central spindle during cytokinesis (grey) or elsewhere in the cell (blue).
Error bars represent s.e.m. (D) Primary spermatocyte initiating furrow.
ARF6HA (red) is already partially localized to the central spindle
(arrowheads), labelled with Pav-GFP (green). DAPI labels chromosomes
(blue). Scale bars: 5 ␮m.
to play a direct role in Rab11 targeting either. In the arf6 late
regressors, the regression occurred around the time when Rab11
accumulation was clearly observed. However, we observed arf6 late
regressors in which Rab11 endosome localization does not appear
to be affected (Fig. 6C,D; see Movies 9 and 10 in the supplementary
material).
DISCUSSION
Dividing a sphere into two spheres that sum up to the same volume
requires a net surface area increase of 26%. During meiosis I
cytokinesis in Drosophila spermatocytes, 500 ␮m2 of plasma
membrane are added in around 20 minutes, posing a logistical
problem of adding plasma membrane at an average rate of over 0.4
␮m2/second. In this report, we have shown that ARF6 helps to solve
this problem by mediating the rapid mobilization of endocytic
membrane stores in recycling endosomes at the central spindle. This
is supported by two lines of evidence: (1) In arf6 null mutants,
cytokinesis failed in 80% meiotic divisions (Fig. 1; see Fig. S3 in the
supplementary material) owing to a defect in rapid plasma membrane
addition (Fig. 4; see Fig. S4 in the supplementary material) ultimately
causing furrow regression (Fig. 3; see Fig. S4 in the supplementary
material); and (2) Rab4 and Rab11 endosomes at the central spindle
are enriched in ARF6 (Fig. 5). Without ARF6, recycling endosomes
are still targeted to the central spindle, but membrane insertion is slow.
These data suggest that ARF6 modifies the membrane dynamics of
recycling endosomes to achieve a high recycling rate. The results pose
the following questions: why are recycling endosomes targeted to the
central spindle? How does ARF6 modify the membrane dynamics?
Why are there arf6 early and late regressors? Why is ARF6 only
required for male meiosis? We discuss these four issues below.
Plasma membrane addition during cytokinesis:
secretory versus endocytic trafficking
Four solutions exist to the demand for rapid surface area increase
during cytokinesis: (1) decreasing cell volume; (2) stretching
existing membrane; (3) resolving membrane microvilli; and (4)
Punctae at central spindle
Colocalising with ARF6 (central spindle)
Colocalising with ARF6 (not central spindle)
Colocalising with Rab4 (central spindle)
Colocalising with Rab4 (not central spindle)
Colocalising with Rab11 (central spindle)
Colocalising with Rab11 (not central spindle)
ARF6*
Rab4*
Rab5*
Rab11†
66±4 (n=41)
52±6 (n=17)
73±7 (n=17)
22±5 (n=17)
40±5 (n=10)
ND
ND
ND
ND
ND
ND
42±8 (n=13)
84±6 (n=13)
10±4 (n=13)
ND
ND
87±5 (n=17)
56±11 (n=17)
37±11 (n=12)
43±8 (n=12)
ND
ND
Data are presented as % of punctae ± s.e.m.; n, number of cells quantified; ND, not determined.
*Cells in all stages of cytokinesis after initiation of cleavage furrow invagination.
†
Only cells in late cytokinesis (maximum diameter at cleavage furrow 13.5 ␮m).
DEVELOPMENT
Table 1. Colocalization statistics of ARF6 with Rabs at endosomes
Fig. 6. ARF6 is not required for the localization of recycling
endosomes to the central spindle. (A-D) Live primary spermatocytes
in meiosis I, expressing GFP-Rab4 (A,B) or GFP-Rab11 (C,D) in control
(A,C) and arf6 early (B) or late regressor cells (D). Arrowheads, GFPRab4 and GFP-Rab11 at the central spindle in control and arf6 mutants.
Red, cell outlines determined by DIC. Scale bars: 5 ␮m.
delivering membrane to the surface. There are no reports of cell
volume decrease during cytokinesis. Under tension, the surface of
biological membranes stretches by only 2-3% before lysis,
(Needham and Hochmuth, 1989). In P815Y mastoma cells,
unfolding of microvilli accumulated during interphase is sufficient
to account for the surface area increase during cytokinesis (Knutton
et al., 1975). By contrast, microvilli in some ascidian eggs show the
converse behavior, increasing in number during cleavage furrow
progression and disappearing during interphase, suggesting that this
mechanism is not conserved (Satoh and Deno, 1984). Cells that do
not produce sufficient extra surface area between G1 and
cytokinesis, must increase membrane surface during cytokinesis by
delivering membrane to the surface.
Two trafficking systems control membrane addition to the plasma
membrane: the secretory pathway (ER-to-Golgi-to-plasma
membrane) and the endocytic pathway (recycling-endosome-to-
Development 134 (24)
plasma membrane). Golgi-to-endosome traffic represents a mix of
these two pathways (Ang et al., 2004). Both secretory and endocytic
factors are implicated in cytokinesis (Echard et al., 2004; Eggert et
al., 2004; Skop et al., 2004). The relative contribution of the
endocytic versus the secretory pathway to cytokinesis may depend
on the rate of membrane deposition that the pathway can deliver,
relative to the speed of cytokinesis. Meiosis I cytokinesis in
Drosophila spermatocytes is very demanding, requiring 500 ␮m2
expansion in 20 minutes. Endocytic recycling can make large stores
of membrane available rapidly without de novo synthesis (Pelissier
et al., 2003). Indeed, in BSC1 cells, endocytic recycling, but not the
addition of newly synthesised membrane from the Golgi, is
sufficient for the increase in plasma membrane surface during
cytokinesis (Boucrot and Kirchhausen, 2007).
The analysis of membrane addition kinetics in wild-type and arf6
cells reveals two components of membrane addition: a slow ARF6independent process and, after central spindle formation, a 2.5-fold
faster addition process boosted by ARF6 (Fig. 4). The accelerated
addition rate coincides with the positioning of Rab4/ARF6 endosomes
at the cleavage furrow early during cytokinesis. Rab11/ARF6
recycling endosomes might be involved later for stabilization of the
ring canals. The slow component might correspond to secretory
trafficking, or other ARF6-independent recycling routes. Indeed, in
addition to ARF6, Golgi factors such as Cog5 and Syntaxin 5 have
been implicated in the process of cytokinesis in Drosophila testes
(Farkas et al., 2003; Xu et al., 2002). It will be interesting to see the
rate effects of mutants of these factors in comparison to arf6.
Why are some arf6 mutant cells impaired in the rate of plasma
membrane addition causing early regression of the cleavage furrow,
whereas other cells show a normal addition rates and only a late
regression phenotype? We favor the possibility that the lack of
ARF6 uncovers a natural variation in the activities of other
components involved in plasma membrane insertion, or in the
Fig. 7. Physical interaction of Pav and ARF6.
(A) Growth on medium lacking histidine (–His)
indicates a positive two-hybrid interaction of Pav
residues 583-865, in the yeast two-hybrid screen
with ARF6Q67L. pGAD, pLEX, empty vectors.
(B) Pav protein domains. Five pav clones
interacted with ARF6Q67L in yeast two-hybrid
analysis (black bars) defining a minimum
overlapping domain (ARF6 int, red). (C) Binding
assay of ARF6 with Pav. Purified GSTPav655-865,
but not GST alone (negative control) pulled down
ARF6HA and ARF6Q67LHA from HeLa cell lysates.
DEVELOPMENT
4444 RESEARCH ARTICLE
amount of endocytic membrane available for recycling. Late
regressors might be those cells in which these other components or
amounts of available membrane are above a certain threshold level
that, if not reached, would lead to early regression. In the late
regressors, although membrane addition proceeds at a normal rate,
the membrane inserted independently of ARF6 might lack key
components that are essential for the stability of the ring canal, and
thereby for completion of cytokinesis. Such a defect, which might
actually occur throughout cytokinesis, would only manifest itself
later by leading to late furrow regression,
Membrane recycling from the central spindle
Is central spindle targeting of recycling endosomes functionally
significant? In cleaving Xenopus embryos, most membrane insertion
occurs next to the furrow (Bluemink and de Laat, 1973). As in
Drosophila spermatocytes, machinery for fusion of intracellular
vesicles with the plasma membrane, including the exocyst complex
and syntaxin, is localized to the cleavage furrow and central spindle
in many cell types (Fielding et al., 2005; Gromley et al., 2005;
Jantsch-Plunger and Glotzer, 1999; Low et al., 2003; VerPlank and
Li, 2005). Central spindle proteins may assemble the relevant
endocytic and/or secretory factors to facilitate efficient membrane
addition. The central spindle might therefore function as a sensor
during cytokinesis, implementing membrane trafficking at the right
time and, perhaps, at the right place.
Our data showing that ARF6 binds to Pav suggest a possible
molecular link between the central spindle and the trafficking
machinery. If they are not at the central spindle, both Rab4 and
Rab11 recycling endosomes show low levels of ARF6
colocalization during cytokinesis, whereas most of them contain
ARF6 when at the spindle. Pav might ensure local enrichment of
ARF6 in central spindle endosomes. Indeed, mammalian ARFs bind
MKLP1, suggesting Pav-mediated ARF recruitment (Boman et al.,
1999). Yeast two-hybrid and GST pull-down experiments confirmed
this interaction in Drosophila, suggesting that this might be a
conserved mechanism in cytokinesis (Fig. 7).
Our data show that in the absence of ARF6, Rab4 recycling
endosomes are still targeted to the spindle. Similarly, Rab11
recycling endosomes also reach the central spindle in late arf6
regressors. It therefore seems that ARF6 and Rab11 are recruited
independently, with ARF6 acting downstream of Rab4/Rab11
endosome localization to mediate rapid membrane recycling. Rab11,
recruited late to the central spindle, may act in cytokinesis
completion as previously suggested (Fielding et al., 2005; Wilson et
al., 2005). It has been proposed that ARF6 recruits Rab11 recycling
endosomes to the central spindle (Fielding et al., 2005). The
contrasting situation in Drosophila spermatocytes may be due to the
fact that the interaction between ARF6 with human FIP3/4 is not
conserved for the Drosophila FIP3/4 homologue Nuclear fallout and
ARF6 (Wilson et al., 2005).
ARF6-dependent rapid recycling at the central
spindle
How does ARF6 boost the recycling rate? One possibility is that
ARF6 connects the recycling endosomes concentrated at the
central spindle with exocyst-defined fusion sites at the plasma
membrane of the cleavage furrow. The exocyst complex localizes
to vesicular structures at the central spindle and cleavage furrow,
which would be adjacent to the cortical central spindle ARF6
endosomes shown in this report (Fielding et al., 2005; Gromley et
al., 2005). ARF6-GTP interacts with the exocyst complex subunit
Sec10 (Prigent et al., 2003). ARF6 interaction with the exocyst
RESEARCH ARTICLE 4445
complex may therefore mediate targeted recycling of membrane
to discrete plasma membrane domains (D’Souza-Schorey and
Chavrier, 2006). ARF6 might alternatively influence recycling
endosome or plasma membrane phospholipid metabolism using
the effector phospholipase D, a mechanism frequently implicated
in regulated recycling and secretion (Brown et al., 1993; Caumont
et al., 1998; Jovanovic et al., 2006; Vitale et al., 2002). Our data
suggest that in the absence of ARF6, Rab4/Rab11 endosomes still
contribute to a basic rate of membrane recycling, but ARF6
recruitment contributes to more efficient membrane insertion by
endowing recycling vesicles with a label to perform directed
exocytosis.
Life without ARF6
ARF6 is essential for meiotic cytokinesis in the testes. Occasional
spermatids containing more than four nuclei in arf6 mutants are
consistent with cytokinesis failure during the mitosis prior to meiosis
in the spermatocytes (Fig. 1). Additionally, karyotyping of third
instar homozygous arf6 larval brains revealed a low but significant
frequency of tetraploidy: 4.2±2.2% (n=5 brains, 511 mitosis) in
arf6L51b/arf6L51b mutants versus 0% (n=4 brains, 385 mitosis) in
arf6L51b/+ heterozygotes and 0% (n=4 brains, 150 mitosis) in wildtype animals. This suggests a cytokinesis failure during mitosis in
this tissue. Furthermore, there is an incompletely penetrant germ line
ARF6 requirement during chorion morphogenesis (see Fig. S2 in the
supplementary material). However, most somatic mitosis and other
developmental processes occur normally in individuals completely
lacking ARF6.
Many other Drosophila cytokinesis mutants (e.g. fwd, gio, klp3A,
fws) preferentially affect spermatocyte cytokinesis, with little or no
effect on somatic cells (Brill et al., 2000; Farkas et al., 2003;
Giansanti et al., 2006; Williams et al., 1995). However, it is
surprising that many previously proposed ARF6-dependent
processes are not affected in arf6 maternal/zygotic null mutants. For
example, Loner/Schizo, which plays a role during myoblast fusion
and axon path finding in Drosophila has a specific GEF activity on
ARF6, but not ARF1 in vitro, and overexpression of a dominant
negative GDP-bound ARF6 mutant partially phenocopies
loner/schizo mutants (Chen et al., 2003; Onel et al., 2004). The lack
of myoblast/neuronal phenotypes of the arf6 null mutant suggests
that the real target of Loner/Schizo is another GTPase or second
redundantly acting target.
In mammalian cultured cells, ARF6 mediates essential processes
including cell migration, cell-cell adhesion and phagocytosis
(D’Souza-Schorey and Chavrier, 2006). The mouse arf6 knockout
shows a developmental phenotype consistent with impaired cell
migration during hepatic cord formation (Suzuki et al., 2006).
Although we have not analyzed cell adhesion, migration or
phagocytosis in detail, arf6 null mutants survive to the adult stage
with no overt morphological defects, which requires all these
processes. Drosophila has no second arf6 gene (Lee et al., 1994).
The closest homologue encoded in the genome, ARF1 (68%
identical), is involved in secretory, but not endocytic trafficking
(reviewed in D’Souza-Schorey and Chavrier, 2006). The mouse arf6
knockout (Suzuki et al., 2006) will tell us in the future whether these
functions of ARF6 are vertebrate specific.
The authors thank Peter Foster for writing programs for the cell division model
and surface area calculation, and Hybrigenics staff for the yeast two-hybrid
analysis. This work was supported by HFSP, DFG, VW and EU grants to M.G.G.,
RTN-HPRNCT 2002-00260 COMBIO 503568 and SAF 2003-07620 grants to
C.G., and a GenHomme Network Grant (02490-6088) to Hybrigenics and
Institut Curie.
DEVELOPMENT
ARF6 and cytokinesis
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/134/24/4437/DC1
References
Adams, R. R., Tavares, A. A., Salzberg, A., Bellen, H. J. and Glover, D. M.
(1998). pavarotti encodes a kinesin-like protein required to organize the central
spindle and contractile ring for cytokinesis. Genes Dev. 12, 1483-1494.
Albertson, R., Riggs, B. and Sullivan, W. (2005). Membrane traffic: a driving
force in cytokinesis. Trends Cell Biol. 15, 92-101.
Amano, M., Ito, M., Kimura, K., Fukata, Y., Chihara, K., Nakano, T., Matsuura,
Y. and Kaibuchi, K. (1996). Phosphorylation and activation of myosin by Rhoassociated kinase (Rho-kinase). J. Biol. Chem. 271, 20246-20249.
Ang, A. L., Taguchi, T., Francis, S., Folsch, H., Murrells, L. J., Pypaert, M.,
Warren, G. and Mellman, I. (2004). Recycling endosomes can serve as
intermediates during transport from the Golgi to the plasma membrane of
MDCK cells. J. Cell Biol. 167, 531-543.
Bartel, P. L. (1993). Using the two-hybrid system to detect protein-protein
interactions. In Cellular Interactions in Development: A Practical Approach (ed. D.
A. Hartley), pp. 153-179. Oxford: Oxford University Press.
Bartel, P., Chien, C. T., Sternglanz, R. and Fields, S. (1993). Elimination of false
positives that arise in using the two-hybrid system. Biotechniques 14, 920-924.
Bluemink, J. G. and de Laat, S. W. (1973). New membrane formation during
cytokinesis in normal and cytochalasin B-treated eggs of Xenopus laevis. I.
Electron microscope observations. J. Cell Biol. 59, 89-108.
Boman, A. L., Kuai, J., Zhu, X., Chen, J., Kuriyama, R. and Kahn, R. A. (1999).
Arf proteins bind to mitotic kinesin-like protein 1 (MKLP1) in a GTP-dependent
fashion. Cell Motil. Cytoskeleton 44, 119-132.
Boucrot, E. and Kirchhausen, T. (2007). Endosomal recycling controls plasma
membrane area during mitosis. Proc. Natl. Acad. Sci. USA 104, 7939-7944.
Brill, J. A., Hime, G. R., Scharer-Schuksz, M. and Fuller, M. T. (2000). A
phospholipid kinase regulates actin organization and intercellular bridge
formation during germline cytokinesis. Development 127, 3855-3864.
Brown, H. A., Gutowski, S., Moomaw, C. R., Slaughter, C. and Sternweis, P. C.
(1993). ADP-ribosylation factor, a small GTP-dependent regulatory protein,
stimulates phospholipase D activity. Cell 75, 1137-1144.
Caumont, A. S., Galas, M. C., Vitale, N., Aunis, D. and Bader, M. F. (1998).
Regulated exocytosis in chromaffin cells. Translocation of ARF6 stimulates a
plasma membrane-associated phospholipase D. J. Biol. Chem. 273, 1373-1379.
Chen, E. H., Pryce, B. A., Tzeng, J. A., Gonzalez, G. A. and Olson, E. N. (2003).
Control of myoblast fusion by a guanine nucleotide exchange factor, loner, and
its effector ARF6. Cell 114, 751-762.
Chou, T. B. and Perrimon, N. (1992). Use of a yeast site-specific recombinase to
produce female germline chimeras in Drosophila. Genetics 131, 643-653.
Clarkson, M. and Saint, R. (1999). A His2AvDGFP fusion gene complements a
lethal His2AvD mutant allele and provides an in vivo marker for Drosophila
chromosome behavior. DNA Cell Biol. 18, 457-462.
Cooley, L., Verheyen, E. and Ayers, K. (1992). chickadee encodes a profilin
required for intercellular cytoplasm transport during Drosophila oogenesis. Cell
69, 173-184.
D’Souza-Schorey, C. and Chavrier, P. (2006). ARF proteins: roles in membrane
traffic and beyond. Nat. Rev. Mol. Cell Biol. 7, 347-358.
D’Souza-Schorey, C., Li, G., Colombo, M. I. and Stahl, P. D. (1995). A regulatory
role for ARF6 in receptor-mediated endocytosis. Science 267, 1175-1178.
D’Souza-Schorey, C., van Donselaar, E., Hsu, V. W., Yang, C., Stahl, P. D. and
Peters, P. J. (1998). ARF6 targets recycling vesicles to the plasma membrane:
insights from an ultrastructural investigation. J. Cell Biol. 140, 603-616.
Echard, A., Hickson, G. R., Foley, E. and O’Farrell, P. H. (2004). Terminal
cytokinesis events uncovered after an RNAi screen. Curr. Biol. 14, 1685-1693.
Eggert, U. S., Kiger, A. A., Richter, C., Perlman, Z. E., Perrimon, N., Mitchison,
T. J. and Field, C. M. (2004). Parallel chemical genetic and genome-wide RNAi
screens identify cytokinesis inhibitors and targets. PLoS Biol. 2, e379.
Emery, G., Hutterer, A., Berdnik, D., Mayer, B., Wirtz-Peitz, F., Gaitan, M. G.
and Knoblich, J. A. (2005). Asymmetric Rab 11 endosomes regulate delta
recycling and specify cell fate in the Drosophila nervous system. Cell 122, 763773.
Farkas, R. M., Giansanti, M. G., Gatti, M. and Fuller, M. T. (2003). The
Drosophila Cog5 homologue is required for cytokinesis, cell elongation, and
assembly of specialized Golgi architecture during spermatogenesis. Mol. Biol. Cell
14, 190-200.
Fielding, A. B., Schonteich, E., Matheson, J., Wilson, G., Yu, X., Hickson, G. R.,
Srivastava, S., Baldwin, S. A., Prekeris, R. and Gould, G. W. (2005). Rab11FIP3 and FIP4 interact with Arf6 and the exocyst to control membrane traffic in
cytokinesis. EMBO J. 24, 3389-3399.
Finger, F. P., Hughes, T. E. and Novick, P. (1998). Sec3p is a spatial landmark for
polarized secretion in budding yeast. Cell 92, 559-571.
Formstecher, E., Aresta, S., Collura, V., Hamburger, A., Meil, A., Trehin, A.,
Reverdy, C., Betin, V., Maire, S., Brun, C. et al. (2005). Protein interaction
mapping: a Drosophila case study. Genome Res. 15, 376-384.
Development 134 (24)
Fromont-Racine, M., Rain, J. C. and Legrain, P. (1997). Toward a functional
analysis of the yeast genome through exhaustive two-hybrid screens. Nat. Genet.
16, 277-282.
Fuller, M. T. (1993). Spermatogenesis. In The Development of Drosophila
melanogaster (ed. A. Martinez-Arias and M. Bate), pp. 71-147. Cold Spring
Harbor: Cold Spring Harbour Laboratory Press.
Giansanti, M. G., Bonaccorsi, S., Williams, B., Williams, E. V., Santolamazza,
C., Goldberg, M. L. and Gatti, M. (1998). Cooperative interactions between the
central spindle and the contractile ring during Drosophila cytokinesis. Genes Dev.
12, 396-410.
Giansanti, M. G., Farkas, R. M., Bonaccorsi, S., Lindsley, D. L., Wakimoto, B.
T., Fuller, M. T. and Gatti, M. (2004). Genetic dissection of meiotic cytokinesis in
Drosophila males. Mol. Biol. Cell 15, 2509-2522.
Giansanti, M. G., Bonaccorsi, S., Kurek, R., Farkas, R. M., Dimitri, P., Fuller, M.
T. and Gatti, M. (2006). The class I PITP giotto is required for Drosophila
cytokinesis. Curr. Biol. 16, 195-201.
Glotzer, M. (2005). The molecular requirements for cytokinesis. Science 307, 17351739.
Gromley, A., Yeaman, C., Rosa, J., Redick, S., Chen, C. T., Mirabelle, S., Guha,
M., Sillibourne, J. and Doxsey, S. J. (2005). Centriolin anchoring of exocyst
and SNARE complexes at the midbody is required for secretory-vesicle-mediated
abscission. Cell 123, 75-87.
Hime, G. R., Brill, J. A. and Fuller, M. T. (1996). Assembly of ring canals in the
male germ line from structural components of the contractile ring. J. Cell Sci.
109, 2779-2788.
Jantsch-Plunger, V. and Glotzer, M. (1999). Depletion of syntaxins in the early
Caenorhabditis elegans embryo reveals a role for membrane fusion events in
cytokinesis. Curr. Biol. 9, 738-745.
Jantsch-Plunger, V., Gonczy, P., Romano, A., Schnabel, H., Hamill, D.,
Schnabel, R., Hyman, A. A. and Glotzer, M. (2000). CYK-4: A Rho family
gtpase activating protein (GAP) required for central spindle formation and
cytokinesis. J. Cell Biol. 149, 1391-1404.
Jovanovic, O. A., Brown, F. D. and Donaldson, J. G. (2006). An effector domain
mutant of Arf6 implicates phospholipase D in endosomal membrane recycling.
Mol. Biol. Cell 17, 327-335.
Kiehart, D. P. and Feghali, R. (1986). Cytoplasmic myosin from Drosophila
melanogaster. J. Cell Biol. 103, 1517-1525.
Knutton, S., Sumner, M. C. and Pasternak, C. A. (1975). Role of microvilli in
surface changes of synchronized P815Y mastocytoma cells. J. Cell Biol. 66, 568576.
Lee, F. J., Stevens, L. A., Hall, L. M., Murtagh, J. J., Jr, Kao, Y. L., Moss, J. and
Vaughan, M. (1994). Characterization of class II and class III ADP-ribosylation
factor genes and proteins in Drosophila melanogaster. J. Biol. Chem. 269, 2155521560.
Lee, H. S., Simon, J. A. and Lis, J. T. (1988). Structure and expression of ubiquitin
genes of Drosophila melanogaster. Mol. Cell. Biol. 8, 4727-4735.
Low, S. H., Li, X., Miura, M., Kudo, N., Quinones, B. and Weimbs, T. (2003).
Syntaxin 2 and endobrevin are required for the terminal step of cytokinesis in
mammalian cells. Dev. Cell 4, 753-759.
Matsui, T., Amano, M., Yamamoto, T., Chihara, K., Nakafuku, M., Ito, M.,
Nakano, T., Okawa, K., Iwamatsu, A. and Kaibuchi, K. (1996). Rhoassociated kinase, a novel serine/threonine kinase, as a putative target for small
GTP binding protein Rho. EMBO J. 15, 2208-2216.
Minestrini, G., Harley, A. S. and Glover, D. M. (2003). Localization of PavarottiKLP in living Drosophila embryos suggests roles in reorganizing the cortical
cytoskeleton during the mitotic cycle. Mol. Biol. Cell 14, 4028-4038.
Needham, D. and Hochmuth, R. M. (1989). Electro-mechanical permeabilization
of lipid vesicles. Role of membrane tension and compressibility. Biophys. J. 55,
1001-1009.
Oda, H. and Tsukita, S. (2001). Real-time imaging of cell-cell adherens junctions
reveals that Drosophila mesoderm invagination begins with two phases of apical
constriction of cells. J. Cell Sci. 114, 493-501.
Onel, S., Bolke, L. and Klambt, C. (2004). The Drosophila ARF6-GEF Schizo
controls commissure formation by regulating Slit. Development 131, 25872594.
Pelissier, A., Chauvin, J. P. and Lecuit, T. (2003). Trafficking through Rab11
endosomes is required for cellularization during Drosophila embryogenesis. Curr.
Biol. 13, 1848-1857.
Prigent, M., Dubois, T., Raposo, G., Derrien, V., Tenza, D., Rosse, C., Camonis,
J. and Chavrier, P. (2003). ARF6 controls post-endocytic recycling through its
downstream exocyst complex effector. J. Cell Biol. 163, 1111-1121.
Radhakrishna, H. and Donaldson, J. G. (1997). ADP-ribosylation factor 6
regulates a novel plasma membrane recycling pathway. J. Cell Biol. 139, 49-61.
Rebollo, E. and Gonzalez, C. (2004). Time-lapse imaging of male meiosis by
phase-contrast and fluorescence microscopy. Methods Mol. Biol. 247, 77-87.
Rebollo, E., Llamazares, S., Reina, J. and Gonzalez, C. (2004). Contribution of
noncentrosomal microtubules to spindle assembly in Drosophila spermatocytes.
PLoS Biol. 2, E8.
Royou, A., Field, C., Sisson, J. C., Sullivan, W. and Karess, R. (2004).
DEVELOPMENT
4446 RESEARCH ARTICLE
Reassessing the role and dynamics of nonmuscle myosin II during furrow
formation in early Drosophila embryos. Mol. Biol. Cell 15, 838-850.
Salzberg, A., D’Evelyn, D., Schulze, K. L., Lee, J. K., Strumpf, D., Tsai, L. and
Bellen, H. J. (1994). Mutations affecting the pattern of the PNS in Drosophila
reveal novel aspects of neuronal development. Neuron 13, 269-287.
Satoh, N. and Deno, T. (1984). Periodic appearance and disappearance of
microvilli associated with cleavage cycles in the egg of the ascidian, Halocynthia
roretzi. Dev. Biol. 102, 488-492.
Schweitzer, J. K. and D’Souza-Schorey, C. (2002). Localization and activation of
the ARF6 GTPase during cleavage furrow ingression and cytokinesis. J. Biol.
Chem. 277, 27210-27216.
Schweitzer, J. K. and D’Souza-Schorey, C. (2005). A requirement for ARF6
during the completion of cytokinesis. Exp. Cell Res. 311, 74-83.
Sheff, D. R., Daro, E. A., Hull, M. and Mellman, I. (1999). The receptor recycling
pathway contains two distinct populations of early endosomes with different
sorting functions. J. Cell Biol. 145, 123-139.
Skop, A. R., Bergmann, D., Mohler, W. A. and White, J. G. (2001). Completion
of cytokinesis in C. elegans requires a brefeldin A-sensitive membrane
accumulation at the cleavage furrow apex. Curr. Biol. 11, 735-746.
Skop, A. R., Liu, H., Yates, J., 3rd, Meyer, B. J. and Heald, R. (2004). Dissection
of the mammalian midbody proteome reveals conserved cytokinesis
mechanisms. Science 305, 61-66.
Somers, W. G. and Saint, R. (2003). A RhoGEF and Rho family GTPase-activating
protein complex links the contractile ring to cortical microtubules at the onset of
cytokinesis. Dev. Cell 4, 29-39.
Song, J., Khachikian, Z., Radhakrishna, H. and Donaldson, J. G. (1998).
Localization of endogenous ARF6 to sites of cortical actin rearrangement and
involvement of ARF6 in cell spreading. J. Cell Sci. 111, 2257-2267.
Suzuki, T., Kanai, Y., Hara, T., Sasaki, J., Sasaki, T., Kohara, M., Maehama, T.,
Taya, C., Shitara, H., Yonekawa, H. et al. (2006). Crucial role of the small
RESEARCH ARTICLE 4447
GTPase ARF6 in hepatic cord formation during liver development. Mol. Cell. Biol.
26, 6149-6156.
van der Sluijs, P., Hull, M., Webster, P., Male, P., Goud, B. and Mellman, I.
(1992). The small GTP-binding protein rab4 controls an early sorting event on
the endocytic pathway. Cell 70, 729-740.
VerPlank, L. and Li, R. (2005). Cell cycle-regulated trafficking of Chs2 controls
actomyosin ring stability during cytokinesis. Mol. Biol. Cell 16, 2529-2543.
Vitale, N., Chasserot-Golaz, S. and Bader, M. F. (2002). Regulated secretion in
chromaffin cells: an essential role for ARF6-regulated phospholipase D in the late
stages of exocytosis. Ann. N. Y. Acad. Sci. 971, 193-200.
Vojtek, A. B. and Hollenberg, S. M. (1995). Ras-Raf interaction: two-hybrid
analysis. Meth. Enzymol. 255, 331-342.
Williams, B. C., Riedy, M. F., Williams, E. V., Gatti, M. and Goldberg, M. L.
(1995). The Drosophila kinesin-like protein KLP3A is a midbody component
required for central spindle assembly and initiation of cytokinesis. J. Cell Biol.
129, 709-723.
Wilson, G. M., Fielding, A. B., Simon, G. C., Yu, X. Andrews, P. D., Hames, R.
S., Frey, A. M., Peden, A. A., Gould, G. W. and Prekeris, R. (2005). The FIP3Rab11 protein complex regulates recycling endosome targeting to the cleavage
furrow during late cytokinesis. Mol. Biol. Cell 16, 849-860.
Wucherpfennig, T., Wilsch-Brauninger, M. and Gonzalez-Gaitan, M. (2003).
Role of Drosophila Rab5 during endosomal trafficking at the synapse and
evoked neurotransmitter release. J. Cell Biol. 161, 609-624.
Xu, H., Brill, J. A., Hsien, J., McBride, R., Boulianne, G. L. and Trimble, W. S.
(2002). Syntaxin 5 is required for cytokinesis and spermatid differentiation in
Drosophila. Dev. Biol. 251, 294-306.
Yamashiro, S., Totsukawa, G., Yamakita, Y., Sasaki, Y., Madaule, P., Ishizaki,
T., Narumiya, S. and Matsumura, F. (2003). Citron kinase, a Rho-dependent
kinase, induces di-phosphorylation of regulatory light chain of myosin II. Mol.
Biol. Cell 14, 1745-1756.
DEVELOPMENT
ARF6 and cytokinesis