RESEARCH ARTICLE 1279
Development 134, 1279-1289 (2007) doi:10.1242/dev.02813
Inca: a novel p21-activated kinase-associated protein
required for cranial neural crest development
Ting Luo1, Yanhua Xu1, Trevor L. Hoffman2,3, Tailin Zhang2, Thomas Schilling2 and Thomas D. Sargent1,*
Inca (induced in neural crest by AP2) is a novel protein discovered in a microarray screen for genes that are upregulated in Xenopus
embryos by the transcriptional activator protein Tfap2a. It has no significant similarity to any known protein, but is conserved
among vertebrates. In Xenopus, zebrafish and mouse embryos, Inca is expressed predominantly in the premigratory and migrating
neural crest (NC). Knockdown experiments in frog and fish using antisense morpholinos reveal essential functions for Inca in a
subset of NC cells that form craniofacial cartilage. Cells lacking Inca migrate successfully but fail to condense into skeletal primordia.
Overexpression of Inca disrupts cortical actin and prevents formation of actin ‘purse strings’, which are required for wound healing
in Xenopus embryos. We show that Inca physically interacts with p21-activated kinase 5 (PAK5), a known regulator of the actin
cytoskeleton that is co-expressed with Inca in embryonic ectoderm, including in the NC. These results suggest that Inca and PAK5
cooperate in restructuring cytoskeletal organization and in the regulation of cell adhesion in the early embryo and in NC cells
during craniofacial development.
INTRODUCTION
Neural crest (NC) is a uniquely vertebrate cell type that arises at the
boundary between neural plate and epidermis. During neural tube
closure, NC cells delaminate from the neuroepithelium and begin to
migrate as mesenchyme. This is accompanied by dramatic
remodeling of cytoarchitecture and cell-cell adhesion, as NC cells
migrate along predetermined pathways throughout the body
(Duband et al., 1995). When NC cells finish migrating they
differentiate into diverse derivatives including cartilage and bones
of the skull, neurons and glia of the peripheral nervous system,
melanocytes and many other cell types (Le Douarin and Kalcheim,
1999). Differentiation requires that many NC cells undergo second
transformations in which they stop moving and condense, as in the
formation of tightly packed cartilage elements or neuronal ganglia
(Duband, 2006; Knight and Schilling, 2006; Richman and Lee,
2003). Although intensive research has focused on early NC
induction, few studies have addressed the control of later NC
morphogenesis at a molecular level.
NC induction occurs through the combined effects of multiple
signaling pathways, including bone morphogenetic proteins (BMP),
Wnts, fibroblast growth factors and retinoic acid (Bastidas et al.,
2004; LaBonne and Bronner-Fraser, 1998; Monsoro-Burq et al.,
2005; Saint-Jeannet et al., 1997). These signals regulate expression
of transcription factors that specify the NC phenotype (Huang and
Saint-Jeannet, 2004; Meulemans and Bronner-Fraser, 2004; Sargent,
2006). Among these, Tfap2a, one member of a family encoding
three to five closely related transcriptional activators (Eckert et al.,
2005), plays an essential role in early specification of both epidermis
and NC in Xenopus (Luo et al., 2003), and in numerous aspects of
1
Laboratory of Molecular Genetics, National Institutes of Child Health and Human
Development, NIH, Bethesda, MD 20892, USA. 2Department of Developmental and
Cell Biology and 3Department of Pediatrics, Division of Human Genetics and Birth
Defects, University of California, Irvine, CA 92697-2300, USA.
*Author for correspondence (e-mail: [email protected])
Accepted 18 January 2007
NC development in zebrafish (Barrallo-Gimeno et al., 2004; Knight
et al., 2005; Knight et al., 2003) and mouse (Brewer et al., 2004). In
Xenopus, Tfap2a can substitute for BMP signaling in NC induction
(Luo et al., 2003). Several direct Tfap2a targets act in subsets of NC,
such as Hoxa2 in skeletal progenitors (Maconochie et al., 1999) and
C-kit (kita) in pigment cell precursors (Huang et al., 1998; Knight et
al., 2003), but other downstream NC effector genes are largely
unknown.
We previously identified several novel targets of Tfap2a
transactivation by microarray (Luo et al., 2005). One of these genes,
Inca, is conserved among vertebrates, lacks any known structural
domains (except for a 14-3-3 binding site of unknown significance)
and has no known function. Inca is expressed in early cranial NC
cells, and several other embryonic tissues including the presumptive
epidermis, suggesting that it could be an important downstream
effector of Tfap2a during embryogenesis.
Here we report that Inca is required for morphogenesis of NCderived cartilage. Expression of Inca in cranial NC is conserved
across multiple vertebrate species, including zebrafish, Xenopus and
mouse. Knockdown of Inca expression by antisense morpholino
oligonucleotides (MOs) in both Xenopus and zebrafish results in
dramatic reductions in cranial NC-derived cartilage formation. We
show that Inca interacts with PAK5, a p21-activated kinase
downstream of the Rho GTPases Cdc42 and Rac1, previously
implicated in cytoskeletal organization and apoptosis (Bokoch,
2003; Jaffer and Chernoff, 2002) as well as control of cell adhesion
and convergent extension movements in Xenopus (Cau et al., 2001;
Faure et al., 2005). Consistent with a role in cytoskeletal
organization, Inca overexpression disrupts both cortical
pigmentation in blastomeres and wound healing in Xenopus
embryos. Combined overexpression of PAK5 and Inca enhances
these phenotypes compared with either factor alone, suggesting that
their association has functional significance for the control of
cytoarchitecture. Taken together, our results suggest a novel
mechanism by which Inca functions in concert with PAK5 to
regulate the morphogenesis of cells in the early embryo, including
postmigratory NC that form the craniofacial skeleton.
DEVELOPMENT
KEY WORDS: Cartilage, PAK, Cortical actin, Cytoskeleton, Wound healing, Craniofacial, Tfap2a, Ectomesenchyme, Neural crest, Xenopus,
Zebrafish
Development 134 (7)
MATERIALS AND METHODS
Immunoprecipitation and western blotting
Embryo manipulation
HEK293 cells and CHO cells were transiently transfected with the
indicated plasmids using Lipofectamine 2000 (Invitrogen). For
coimmunoprecipitation, 24 hours after transfection, cells were lysed in lysis
buffer [50 mM Tris pH 7.4, 150 mM NaCl, 1% Nonidet P-40 (NP40) with
protease inhibitors (Roche)]. The lysates were incubated with a monoclonal
antibody for a Myc-epitope (9E-10; Santa Cruz) for 2 hours, followed by
protein-G Sepharose beads (Sigma) for another 2 hours at 4°C. The beads
were washed three times in lysis buffer and analyzed by western blotting. To
immunoprecipitate Inca protein from non-transfected Xenopus A6 cells, a
rabbit antibody to the IncaA peptide DLPSDVSPGSCGQRGLE conjugated
to keyhole limpet hemocyanin was produced by Open Biosystems.
Preimmune serum from the immunized rabbit was used as a negative control.
Xenopus PAK5 antibody was a generous gift from N. Morin. Additional
antibodies used were anti-phospho-Ser474-PAK4 (Cell Signaling
Technology), anti-FLAG (Sigma) and anti-GFP (Sigma). Appropriate
secondary antibodies were detected by enhanced chemiluminescence
(Pierce).
Xenopus and zebrafish embryos were obtained and maintained according to
standard procedures (Sive, 1999; Westerfield, 1994). Injection and
dexamethasone treatments of Xenopus animal caps at the midblastula stage
with mRNA encoding chordin (Chd) (Sasai et al., 1994), Wnt3a (Wolda et
al., 1993), a glucocorticoid-responsive Tfap2a fusion protein (GR-AP2) or
dominant negative Tfap2a (dnTfap2a) (Luo et al., 2002) were performed as
described previously (Luo et al., 2005). Blastula wound healing assays and
rhodamine-conjugated phalloidin staining of animal caps were performed
similar to Kofron et al. (Kofron et al., 2002), with different healing times
(Lloyd et al., 2005). Analysis of NC cells in zebrafish embryos was
performed using a transgenic strain (sox10:eGFP) expressing enhanced
green fluorescent protein (eGFP) in cranial NC precursors (Wada et al.,
2005). Embryos were fixed, manually dissected, and imaged on a confocal
microscope.
DNA constructs and RNA synthesis for injection
Two Xenopus Inca pseudoalleles (IncaA and IncaB) and zebrafish inca1 and
inca2 were identified by BLAST searches and full-length expressed
sequence tag (EST) clones were obtained (Open Biosystems). GenBank
Accession Numbers are given in the legend to Fig. 1. Open reading frames
(ORF) of IncaA and IncaB were sub-cloned into the EcoRI-XhoI sites of
pCTS (Feledy et al., 1999). Full-length sense mRNAs were generated by
plasmid digestion with NotI and transcription by SP6 polymerase (Ambion
Message Machine). XIncaA-GFP and XPAK5-RFP were generated by PCR
and used to create in-frame N-terminal fusions to pCS2+eGFP and
pDSRed1-N1 (Clontech), respectively. Xenopus PAK5-GFP and related
constructs have been previously described (Cau et al., 2001).
Antisense MOs
Translation-blocking antisense MOs were used for both Xenopus and
zebrafish embryos (GeneTools). MO sequences (start codon underlined) for
Xenopus were: GCGCATCACCCAAGCGGAGGGAGAT (IncaA MO),
ATGCGATTTGTGCATCACCCAAGCG
(IncaB
MO),
CAGACAAGCGCAATGGTGCCCGG
(IncaA
MO2)
and
AGATGAGACTGGCGCAATGGTCCCC (IncaB MO2). A MO containing
five mismatched base pairs from the IncaA MO was used as a control
(GCcCATgACCgAAGCGGAGcGAcAT; mismatched nucleotides in
lowercase). MOs were injected into one or two blastomeres at the two-cell
stage, along with 200 pg lacZ mRNA as a lineage tracer when a single
blastomere was injected. The total in all cases was 10 ng of each MO. To
assay MO effectiveness in Xenopus, plasmids containing the MO binding
site and N-terminus of IncaA (base pairs –30 to +948) and IncaB (base pairs
–21 to +402) fused to the N-terminus of GFP were co-injected with MOs
into one- and two-cell stage Xenopus embryos. Zebrafish embryos were
injected with 10 ng of MO (5⬘-TGCAGACACAACATTATTCTTAATA-3⬘)
at the one- and two-cell stage.
In situ hybridization, Alcian Blue staining and TUNEL staining
Whole-mount in situ hybridization was performed as described previously
in Xenopus (Harland, 1991), zebrafish (Thisse et al., 1993) and mouse (Saga
et al., 1996). Digoxigenin-labeled antisense probes used for Xenopus were
IncaA, Tfap2a (Winning et al., 1991), Slug (Mayor et al., 1995), Sox2
(Mizuseki et al., 1998), Sox9 (Spokony et al., 2002), Sox10 (Aoki et al.,
2003) and Dlx2 (Papalopulu and Kintner, 1993), and for zebrafish inca1
(GenBank Accession Number, CK018555). Embryo sections in JB4
followed manufacturer instructions (Polysciences). Alcian Blue cartilage
staining was performed as described previously (Pasqualetti et al., 2000).
The TUNEL assay was performed on whole-mount embryos as described
(Hensey and Gautier, 1998), except that epidermis was manually removed
from tadpoles after fixation to facilitate reagent penetration.
Interaction of Xenopus Inca and PAK5 in yeast
The mouse Inca ORF was used as bait in a two-hybrid screen with a mouse
E11-stage cDNA library according to manufacturer instructions
(MatchmakerTM Two-Hybrid System; Clontech). Xenopus Inca and PAK5
ORFs were also cloned into pGBKT7 and pGADT7, respectively. Yeast
transformation was performed using standard procedures.
RESULTS
Tfap2a regulates Inca in developing NC
Inca expression is strongly activated in Xenopus animal caps by a
hormone-inducible Tfap2a (GR-AP2) (Luo et al., 2002). Animal
caps isolated from embryos injected with a mixture of Chd (5 ng
RNA per embryo), Wnt3a (250 pg per embryo) and GR-AP2 (600
pg RNA per embryo) differentiate as posterior neural plate if left
alone, but form NC if dexamethasone is added during blastula stages
(Luo et al., 2005). This upregulates expression of the NC marker
Sox9 (Spokony et al., 2002) and reduces expression of the neural
plate marker Sox2 (Mizuseki et al., 1998) (Fig. 1A). Inca expression
is also strongly induced by dexamethasone. Note that there is a
significant level of Inca expression in uninjected animal caps that
form epidermis.
Inca cannot be assigned to a tentative gene family or function
based on its protein sequence, but is the founding member of a group
of Inca-related proteins conserved across vertebrates, including fish,
frog, mouse and human. Sequence conservation averages 35-40%
across species, and clusters near the proteins’ center, including one
highly conserved domain of 38 residues, the ‘inca-box’ (Fig. 1B).
Incas also contain a highly conserved binding site for the scaffolding
protein 14-3-3 (Muslin et al., 1996), located immediately upstream
of the inca-box; however, preliminary evidence suggests that this site
is not required for its activity in overexpression assays (see below;
data not shown). Of two Inca-related genes in zebrafish, closely
linked on chromosome 11, inca1 resembles Xenopus Inca slightly
more than inca2 (Fig. 1C). In addition to one clear Inca ortholog in
mouse (chromosome 9) and human (chromosome 3), another
distantly related gene exists in fish (chromosome 8), frogs and
mammals (mouse chromosome 3; human chromosome 1), with
unknown function.
Fish, frog and mouse Inca orthologs have similar expression
patterns during embryogenesis. Xenopus Inca expression begins
shortly after midblastula transition (stage 9; Fig. 2A) and becomes
localized to deep mesodermal cells and the inner, sensorial ectoderm
layer during gastrulation (Fig. 2B). During neurulation, expression
becomes restricted to notochord, epidermis and NC cells but is
excluded from the neural plate or neural tube at later stages (Fig.
2C). Expression persists in NC cells during their migration into the
pharyngeal arches (Fig. 2D-G), where it is confined to NC-derived
head mesenchyme (Fig. 2F,G) (Hausen and Riebesell, 1991). By
early tadpole stages, Inca is expressed in cranial ganglia and in the
dorsal eye vesicle in addition to pharyngeal arch mesenchyme (Fig.
2H). Similarly, in zebrafish, inca1 expression is zygotic and
DEVELOPMENT
1280 RESEARCH ARTICLE
Inca required for craniofacial development
RESEARCH ARTICLE 1281
Fig. 1. Inca is a novel Tfap2a target in the NC. (A) Animal caps were
injected with Wnt3a, Chd and GR-AP2a mRNA, treated with 10 ␮M
dexamethasone (DEX+) or solvent alone (DEX-), and subjected to
northern blot analysis using probes as indicated, with 18S rRNA as a
loading control. UI, uninjected. (B) Predicted protein sequence
alignment for Xenopus (X), zebrafish (Z), mouse (M) and human (H)
Incas. Identical residues are shaded. The conserved 38-residue inca-box
is underlined, and the 14-3-3 binding site is indicated with star
underline. (C) Dendrogram generated using ClustalW
(http://clustalw.genome.jp). Accession Numbers are: Xenopus IncaA,
BJ092564. Mouse, AK076092. Human, NM_203370. Zebrafish inca1,
CK018555; inca2, BM071087. Human Inca-r, BC031558. Mouse Incar, NM_175398. Zebrafish inca-r, BI885065. Xenopus (tropicalis) Inca-r,
CR761080. chr, chromosome number.
Conserved requirements for Inca in NC
development
To investigate the developmental requirements for Inca, MOs
were designed to inhibit translation in both Xenopus and zebrafish
embryos. These gave similar phenotypes. Two pseudoallelic Inca
mRNAs in Xenopus laevis required two Inca MOs, designated
IncaA MO and IncaB (GenBank Accession Number, DQ993180)
MO. Injection of 10 ng per embryo of either MO efficiently
blocked expression of synthetic mRNAs containing the cognate
MO-binding sites fused to enhanced GFP (eGFP), whereas a
mismatched IncaA control MO did not interfere with either fusion
protein (Fig. 4A). Injection of IncaA or IncaB MOs (20 ng per
embryo) individually had only a slight effect on 10-15% of
embryos (n=83 and n=79, respectively; Fig. 4P), whereas
combining the two MOs (10 ng per embryo of each MO) resulted
in a severe phenotype in 98% of embryos (Fig. 4P; n=156). This
allows us to rule out the possibility of artifacts owing to MO
toxicity. All subsequent experiments combined the IncaA and
IncaB MOs at equal concentration (Inca MO). Xenopus embryos
injected into both cells at the two-cell stage with a total of 20 ng
of Inca MO gastrulated normally, but formed smaller heads with
periocular swelling by late tadpole stages. Melanocytes, which are
NC-derived, were only slightly reduced (stage 45-47; Fig. 4B-E),
but later MO-injected larvae had dramatic reductions in all NCderived craniofacial cartilages (Sadaghiani and Thiebaud, 1987)
(Fig. 4F,G). These defects were not simply due to a general
developmental delay, because other structures, particularly in the
trunk region, developed normally in morphants. In addition, two
distinct Inca MOs (IncaA MO2 and IncaB MO2) that recognize
non-overlapping target sequences yielded indistinguishable
phenotypes (Fig. 4H,I). Injection of an inca1 MO into zebrafish
DEVELOPMENT
restricted to early ectoderm and notochord during gastrulation, as
well as later in the premigratory and migrating cranial NC (Fig. 2IN). Expression persists in the pharyngeal arches, ventral forebrain,
pituitary and olfactory epithelia. Expression was also seen in the
hypochord and ventral somites at this time point (data not shown).
Mouse Inca transcripts also localize to pharyngeal arch NC (E9.5;
Fig. 2O), and to the limb buds and somites by E11.5 (Fig. 2P).
Northern blot analysis of mouse tissue RNAs reveal essentially
ubiquitous Inca expression in the adult, with particularly high levels
in heart (Fig. 2Q). Thus, Inca orthologs all show conserved
expression in cranial NC at early stages that require Tfap2a function.
To determine whether Tfap2a is necessary and sufficient to
activate Inca expression, animal caps were isolated from Xenopus
embryos injected with one of three combinations of RNAs encoding:
(1) Chd (at a dose lower than that of Fig. 1A) to trigger neural
induction, (2) a mixture of Chd and Wnt3a at concentrations that
induce NC, or (3) Chd, Wnt3a and a truncated, dominant negative
Tfap2a (dnTfap2a) (Luo et al., 2002). Neural induction with Chd
inhibited Inca expression compared with baseline levels in
uninjected animal caps (which differentiate into epidermis),
consistent with the lack of Inca expression in the neural plate in
intact embryos (Fig. 3A). By contrast, NC induction by Chd+Wnt3a
strongly activated Inca expression, which was blocked by coinjection of dnTfap2a. A similar but less severe effect was observed
in zebrafish lockjaw (low) mutants, which lack a functional Tfap2a
and demonstrated reduced inca1 expression. low mutants have
defects in the NC-derived craniofacial skeleton and pigmentation
(Knight et al., 2003). This correlates with reduced inca1 expression
at the 10-somite stage in premigratory NC (Fig. 3B-F) and at 36 hpf
(Fig. 3D,G).
1282 RESEARCH ARTICLE
Development 134 (7)
caused a very similar, dose-dependent reduction in head size (Fig.
4J,K), as well as cranial cartilage formation in the pharyngeal
arches (Fig. 4L,M) and neurocranium (Fig. 4N,O).
To determine which NC cells require Inca and at what stages, we
examined molecular markers of premigratory and migrating NC in
MO-injected frog and fish embryos. Injection of 20 ng Inca MO into
one cell at the two-cell stage caused no defects in expression of
neural, epidermal or NC markers at early neurula stages (Fig. 5AD) or in markers of migrating cranial NC at tailbud stages (data not
shown). Both Dlx2 and Sox9 expression appeared slightly reduced
as late as stage 32 (Fig. 5E-H). Nevertheless, cartilage development
was severely impaired on the injected side (Fig. 5I). Similarly, Inca
morphant zebrafish displayed mild reductions in expression of dlx2
and sox9a at 24 hpf, but severe reductions in the pharyngeal arches
by 48 hpf (data not shown). These results suggest that cranial NC
cells deficient in Inca form and migrate normally but fail to
differentiate. TUNEL assays detected no differences in numbers of
apoptotic cells in Inca MO and control MO-injected embryos at
tailbud stages (Fig. 5K,L), but a significant increase by early tadpole
stages, primarily in the eye and epidermis (Fig. 5M,N). By late
tadpole stages, TUNEL signal was also detected in the jaw and
dorsal cranium (Fig. 5O-R). All of these tissues derive from regions
of earlier Inca expression (see Fig. 2).
These results in both fish and frog suggest that Inca is not required
for NC induction or early migration, but later in cranial NC cells that
form the head skeleton. To investigate requirements for Inca in NC
morphogenesis at these later stages, we injected the inca1 MO into
transgenic zebrafish that express eGFP under control of 5 kb of the
DEVELOPMENT
Fig. 2. Expression patterns in Xenopus, zebrafish and mouse embryos. (A) Developmental northern blot of Xenopus Inca, with 18S RNA as a
loading control. Nieuwkoop-Faber stages are indicated. (B-H) Whole-mount in situ hybridization for Inca in Xenopus embryos at stages 10.5-32.
(B) Stage 10.5, sagittal section. d, dorsal. v, ventral. (C) Stage 14, dorsal view of expression in cranial NC (nc) and notochord (n). a, anterior. p,
posterior. (D) Stage 19, dorsal view of expression in cranial NC migration streams, labeled as 1-3. (E) Stage 25, lateral view; arrowheads indicate
approximate section levels in F and G. NC migration streams into pharyngeal arches 1-3 as indicated. (F,G) Transverse sections of embryo in E show
Inca expression in head mesenchyme (hm) and NC (nc). (H) Stage 32, lateral view of the head. White and red arrowheads indicate expression in
trigeminal ganglion and eye, respectively. (I-N) Whole-mount in situ hybridization for inca1 in zebrafish embryos. (I) 6 hpf, lateral view, dorsal to the
right. Expression is restricted away from the margin (arrows), in future ectoderm (ecto). (J) 8 hpf, dorsal view. noto, notochord. (K,L) 13 hpf, lateral
and dorsal views, respectively, of inca1 expression in premigratory NC. Numbers indicate presumptive pharyngeal arches 1-3. (M,N) 36 hpf, dorsal
and face-on views, showing expression in the pharyngeal arches (1,2), diencephalon (di), pituitary (pi) and olfactory epithelia (oe). (O,P) Inca
expression in mouse embryos at E9.5 (O) and E11.5 (P) in pharyngeal arches (numbered 1-3), somites (s) and fore-limb (fl) and hind-limb buds (hl).
(Q) Northern analysis of adult mouse tissue RNAs probed with Inca and beta-actin as control. Scale bars: 500 ␮m in O; 1 mm in P.
Fig. 3. Inca expression in NC depends on Tfap2a. (A) Northern
analysis of animal cap RNA from embryos injected with Chd,
Chd+Wnt3a, or Chd+Wnt3a+dnTfap2a (Chd+Wnt+⌬AD) and probed
for Xenopus Inca, with 18S rRNA as a loading control. Expression
induced by Chd+Wnt is blocked by dnTfap2a. (B-G) Whole-mount in
situ hybridizations showing zebrafish inca1 expression in wild type (B-D)
and low mutants (E-G). B,E are lateral views and C,F dorsal views at the
10-somite stage. D,G are lateral views at 36 hpf. inca1 expression is
reduced at 10 somites and 36 hpf. Numbers indicate presumptive
pharyngeal arches. oe, olfactory epithelia.
sox10 promoter (sox10:egfp), and used confocal microscopy to
follow NC behaviors (Wada et al., 2005). Similar to inca1,
sox10:egfp expression begins in premigratory cranial NC adjacent
to the hindbrain during early somitogenesis, and persists in
migrating NC cells (Fig. 5S,U), and craniofacial cartilage in the
larvae (Fig. 5W,Y). With injection of 10 ng inca1 MO per embryo,
NC cells migrated into the pharyngeal arches (Fig. 5T,V) but failed
to condense and extend anteriorly to form normal cartilage (Fig.
5X,Z). These results demonstrate conserved requirements for Inca
in NC cells after they migrate.
Inca interacts with PAK5
Because Inca shows no sequence similarity to other gene families,
we performed a yeast two-hybrid screen to identify potential binding
partners that might link Inca to one or more cellular processes.
Mouse Inca was used to screen a library of cDNAs from mouse
embryos at E11, when Inca is abundantly expressed. Among several
candidates, we repeatedly isolated the p21-activated kinase 4
(PAK4). Several truncated cDNAs isolated in this screen indicate
that Inca binds to the C-terminal half of PAK4, which contains the
kinase domain. Xenopus PAK5, a close relative of mammalian
PAK4 (Cau et al., 2001), was similarly cotransfected into yeast with
Xenopus Inca, and this also allowed robust growth on selective
RESEARCH ARTICLE 1283
media, indicating similar physical interactions between Inca and
PAK4/5 conserved from frog to mouse (Fig. 6A). This interaction
was independently confirmed by co-immunoprecipitation (co-IP) of
epitope-tagged Xenopus Inca and PAK5 co-expressed in HEK293
cells (Fig. 6B).
Both the two-hybrid and co-IP experiments involve expressing
exogenous Inca and PAK4/5 at levels that may exceed
physiologically meaningful concentrations, allowing spurious
binding. To address this issue, antiserum directed against a synthetic
peptide from Xenopus Inca and shown by western blotting to be
specific for this protein (Fig. 6C), along with preimmune serum as
a negative control, were used to immunoprecipitate proteins from an
extract of Xenopus A6 cells, which express both PAK5 and Inca.
Western blotting using an antibody for Xenopus PAK5 showed that
endogenous Inca protein will co-IP with PAK5 (Fig. 6D). Therefore,
Inca and PAK5 naturally exist as a complex in untransfected
Xenopus cells.
PAK proteins are effectors of the Rho GTPases Rac1 and Cdc42,
and have been implicated in control of cytoskeletal dynamics,
including microfilament and microtubule polymerization and
stability (Bokoch, 2003; Jaffer and Chernoff, 2002). PAK5 interacts
with both microfilaments and microtubules in the Xenopus embryo,
and interference with PAK5 function affects cell adhesion and
convergent extension movements, both of which depend upon
cytoskeletal integrity and Rho GTPase signaling (Faure et al., 2005;
Kofron et al., 2002; Wunnenberg-Stapleton et al., 1999). To
determine whether the Inca-PAK5 complex is also associated with
the cytoskeleton, CHO cells were transiently cotransfected with Inca
fused to GFP and PAK5 fused to red fluorescent protein (RFP) and
observed with a confocal microscope. As shown in Fig. 6E, Inca and
PAK5 colocalized in punctate bodies and fibers. Some of the
endogenous PAK5 distribution pattern is in similar punctate bodies
(Cau et al., 2001), but could also be due in part to overexpression
artifacts. The fibers are likely to be microtubules, because they are
sensitive to nocodazole (Fig. 6F).
Ectopic expression of Inca modifies
cytoarchitecture
To determine whether misexpression of Inca outside of its normal
domains in the NC and epidermis can alter cellular morphogenesis,
synthetic IncaA mRNA was injected into Xenopus embryos at the
one-cell stage. This disrupted body shape, including a shortened
anteroposterior axis, open neural tube and multiple tissue
protrusions (Fig. 7A,B). At blastula stages, pigment granules in
individual blastomeres of Inca-injected embryos redistributed to the
cell periphery, accenting cell-cell boundaries (Fig. 7C,D). These
changes suggest a disruption in the cortical actin cytoskeleton in
which these granules are embedded.
Inca misexpression also disrupted another process highly
dependent on cytoskeletal rearrangements in Xenopus, wound
healing. In low to moderate salt concentrations, an embryo from
which an ectodermal explant was excised (vegetal explant) healed
within approximately 15-20 minutes. This involves changes in cell
movements and adhesion that depend on Rho GTPase signaling,
plakoglobin and other components (Davidson et al., 2002; Kofron et
al., 2002; Tao et al., 2005). Vegetal explants from embryos injected
with Inca mRNA healed much more slowly and to a lesser extent
than uninjected controls (Fig. 7E,F). Healing explants normally
formed a ‘purse string’ of actin filaments at the edge of the wound a
few minutes after excision from the blastula (Merriam and
Christensen, 1983), which is under the control of the Rho GTPases
Rac1 (Brock et al., 1996) or Cdc42 (Kofron et al., 2002). Phalloidin
DEVELOPMENT
Inca required for craniofacial development
1284 RESEARCH ARTICLE
Development 134 (7)
Fig. 4. Inca is required to form the NCderived head skeleton in both frog and
fish. (A) Western blot analysis showing that
Xenopus Inca MOs efficiently inhibit
translation of injected Inca-GFP mRNA.
(B-I) Stage 45 Xenopus tadpoles injected
with control MO (B,D,F) or Inca MO (C,E,G)
and shown in dorsal (B,C) and ventral (D-I)
views either live (B-E) or stained with Alcian
Blue for cartilage (F-I). Similar results were
obtained with two independent, nonoverlapping sets of Inca MOs (H, 20 ng
control MO; I, 20 ng IncaA MO2+IncaB
MO2). (J-O) 5-day-old control zebrafish
larvae (J,L,N) or inca1 MO morphants
(K,M,O) shown live in lateral view (J,K) or
Alcian Blue-stained in ventral view (L-O). All
cartilage elements are reduced by Inca
knockdown in both species. ba, basihyal; br,
branchial/gills; cb, ceratobranchial; ch,
ceratohyal; ep, ethmoid plate; hs,
hyosymplectic; m, Meckel’s; nc, notochord;
pq, palatoquadrate; t, trabeculae.
(P) Frequency of head cartilage phenotype
with Xenopus IncaA MO or IncaB MO alone
or combined IncaA+IncaB, and Zebrafish
inca1-MO injected embryos.
that the PAK-Inca synergism is not because of activation of the
PAK5 kinase by Inca. Further evidence for this is that Inca-PAK5
interaction does not enhance PAK5 kinase activity in
cotransfected HEK293 cells (Fig. 7Q). PAK5 expression is
widespread during early and late development, overlapping with
Inca, so both proteins are likely to be present in NC from early
stages onward (Fig. 7R). These results indicate that the interaction
of Inca and PAK5 has profound effects on adhesive and
cytoskeletal functions.
DISCUSSION
In view of the essential functions of Tfap2a in embryonic vertebrate
development, it is important to identify genes that lie downstream
from this transcriptional activator. Using a microarray screen based
on inducible Tfap2a (Luo et al., 2005), we have identified a novel
protein, Inca, required for NC development in both Xenopus and
zebrafish. Inca interacts with PAK5 to control cytoskeletal
rearrangements in the early embryo. Our results lead us to propose
that Inca-PAK5 interactions mediate Tfap2a-dependent NC cell
behaviors at least in part by regulating their cytoskeleton.
Our screen for Tfap2a targets has also yielded a novel
protocadherin, named PCNS, that is required for NC migration
(Rangarajan et al., 2006), and a surprisingly high proportion of
epidermal genes also expressed in the NC (Luo et al., 2005). From
these results and earlier work, a picture emerges in which Tfap2a
DEVELOPMENT
staining never detected purse-string structures in explants from
embryos injected with Inca mRNA (Fig. 7G,H). Thus, ectopic Inca
in the blastula disrupts multiple cell behaviors dependent on
rearrangements of cortical actin.
To test possible roles for Inca-PAK5 interactions in wound
healing, RNAs encoding Inca, and PAK5, as well as a kinase-dead
form of PAK5 (PAK5/KR) and a constitutively active form
(PAK5/EN), all as eGFP fusions (Cau et al., 2001), were injected
individually and in combination into Xenopus embryos. Vegetal
explants derived from these embryos were cultured for 25 minutes
and examined for wound closure. Whereas expression of Inca
inhibited healing (Fig. 7M), wild-type PAK5 and PAK5/KR
injections had minimal effects (Fig. 7J,K). PAK5/EN injections
resulted in some inhibition (Fig. 7L), but less than observed with
Inca. By contrast, when Inca and wild-type PAK5 were coinjected, there was a dramatic failure of wounds to heal,
accompanied by extensive loss of cell adhesion (Fig. 7N). This
effect depended upon the kinase activity of PAK5, because coinjection of Inca and PAK5/KR had a much weaker effect
compared with co-injection of Inca and wild-type PAK5 (Fig.
7O). Inca- and PAK5-eGFP fusions allowed simultaneous
monitoring of protein levels using anti-GFP antibody (Fig. 7P).
PAK5 protein levels were comparable, as were the Inca levels, but
in significant molar excess over Inca. The contrast in phenotype
between PAK5/EN and PAK5 overexpression with Inca suggests
Inca required for craniofacial development
RESEARCH ARTICLE 1285
mediates BMP signaling, functioning in concert with and
downstream of other transcription factors that initiate NC and
epidermal specification. In the case of cranial NC, however, Tfap2a
appears more important as an early regulator of other ‘effector’
genes that control cell specification and terminal differentiation
(Meulemans and Bronner-Fraser, 2004). In the NC, these include
Tfap2a-dependent genes such as Inca, PCNS, Hoxa2 and C-kit, all
of which may control certain aspects of cellular morphogenesis. For
example, suppression of both TFAP2A and C-KIT in humans
correlates with an invasive, metastatic melanoma phenotype (Huang
et al., 1998).
Inca regulates craniofacial cartilage
morphogenesis
Knockdown of Inca expression with morpholinos has equivalent
endpoints – craniofacial cartilage hypoplasia – in both Xenopus and
zebrafish embryos. Controls strongly argue against MO toxicity or
off-target effects. Inca morphants show no defects in gene
expression during NC induction or early migration, but only later as
chondrocytes differentiate. In zebrafish, chondrocyte precursors in
the NC condense into cartilage primordia and then stack into linear
arrays (Kimmel et al., 2001). Our analysis of sox10:egfp has
revealed that NC cells migrate into the arches successfully in Inca
morphants but fail to condense or organize into stacks, and
eventually begin to undergo apoptosis.
Given the early requirements for Tfap2a in NC and the early NC
expression of Inca, this relatively late phenotype is unexpected. The
skeletal defects seen in low embryos are not as severe as in inca1morphants, which is consistent with the observed reduction, but not
complete loss, of inca1 expression in NC cells that form craniofacial
cartilage in low embryos. We argue that the relatively late phenotype
reflects requirements for Inca in cytoskeletal regulation in NC cells
later in migration. Although morphants may retain some low-level
Inca expression masking a complete null phenotype, we have injected
much higher doses of Inca MO in Xenopus embryos (up to 80 ng per
embryo; data not shown), which gives an identical phenotype.
Alternatively, Inca could share redundant functions with other proteins
during early NC formation and migration. Vertebrates have an Incarelated gene (Inca-r), but our preliminary analyses suggest that this
gene is not expressed in early development (data not shown).
Defects in NC morphogenesis in the absence of Inca function
coincide with elevated cell death in tissues that express Inca, including
the eye, the epidermis and the NC. By the tadpole stage, cartilage cells
become TUNEL+, suggesting that they undergo apoptosis when they
would normally differentiate as chondrocytes. PAK4, the mammalian
homolog of Xenopus PAK5, can inhibit apoptosis, for example by
blocking caspase action (Gnesutta et al., 2001). PAK4 also plays an
important role in cell survival (Li and Minden, 2005). Thus, elevated
cell death in Inca morphants may result, in part, from interference with
PAK5 function.
DEVELOPMENT
Fig. 5. Inca is required for cranial NC specification and
survival after migration into the arches in Xenopus
and zebrafish. Embryos were co-injected into one cell at
the two-cell stage with Inca MO, together with lacZ RNA
as a lineage tracer and assayed for gene expression by
whole-mount in situ hybridization at stage 14 (A-D,
injected sides are on the left) and stage 32 (E-H; E,G,
injected sides) with probes indicated in the panels. In no
case was any change in gene expression observed on the
injected side [(A) Slug, n=83; (B) Sox9, n=42; (C) Sox2,
n=47; (D) AP2a, n=54; (E) Dlx2, n=63; (G) Sox9, n=78]. At
tadpole stage, cranial cartilage was eliminated on the
injected side (left side in I). Control MO injection had no
effect (J). (K-R) TUNEL staining of embryos injected with
control MO (K,M,O) or Inca MO (L,N,P-R), cultured to stage
21 (K,L), stage 30 (M,N) or stage 45 (O-R). Q and R are
dorsal and ventral views, respectively, of the tadpole
shown in P. Black arrowheads indicate strong TUNEL signal
in neurocranium (Q) and jaw cartilage (R). (S-Z) Confocal
images of sox10:egfp expression in cranial NC cells of
controls (S,U,W,Y) and inca1 morphants (T,V,X,Z). Lateral
views, anterior to the left. Stages are indicated in the
panels. First and second pharyngeal arches are indicated in
S,T, and derived cartilage elements by arrowheads in Y,Z.
Asterisks indicate expression of sox10:eGFP in the otic
vesicle.
1286 RESEARCH ARTICLE
Development 134 (7)
Inca modulates cytoskeletal dynamics in
association with PAK5
Ectopic overexpression of Inca causes defects in Xenopus
blastula-stage embryos that occur much earlier than the loss-offunction phenotypes, probably because of disruption of the
microfilament cytoskeleton. Cortical pigment becomes
redistributed away from the apical surface of Inca-injected
blastomeres. These pigment granules depend specifically on Factin, as shown by treatment with cytochalasin B, and show no
response to anti-microtubule drugs such as taxol or nocodazole
(Moreau et al., 1999). The Inca-induced pigment redistribution
resembles embryos overexpressing FRIED, a protein tyrosine
phosphatase that interacts with Frizzled-8 (Itoh et al., 2005).
Activated GTPase Rac1 rescues effects of FRIED overexpression,
consistent with the hypothesis that this restores cortical actin
organization. Likewise, ectodermal wound healing in Xenopus
embryos depends on restructuring of the cortical actin
cytoskeleton. This is regulated by the small GTPase Cdc42
(Kofron et al., 2002), and Inca overexpression interferes with
assembly of the actin purse-string around wounds. These results
suggest that Inca might be involved in the regulation of the Rho
GTPase signaling pathway.
The PAKs are serine-threonine protein kinases that associate with
Rac and Cdc42. Xenopus PAK5 is expressed maternally and, by the
gastrula stages, expression overlaps that of Inca in the ectoderm,
although it is not restricted to the inner, sensorial layer (Faure et al.,
2005). At later stages, PAK5 expression appears ubiquitous (Fig.
7R). Our results suggest that the tissue-specific distribution of Inca
and PAK5, particularly their co-expression in ectoderm, has a
significant impact on cytoskeletal organization.
PAK5 localizes to microtubules and actin filaments, in patterns
that shift during the cell cycle and do not depend on kinase activity.
Constitutive activation of PAK5 prevents its interactions with
microtubules (Cau et al., 2001). However, PAK5 kinase activity
plays an essential role in early Xenopus gastrulation, because
overexpression of a kinase-dead mutant form (PAK5/KR) acts as a
dominant negative to inhibit convergent extension movements in
dorsal mesoderm (Faure et al., 2005). PAK5/KR overexpression also
enhances calcium-dependent adhesion of ectodermal cells, whereas
a constitutively active kinase reduces adhesion. Inca synergizes with
an intact PAK5 to disrupt wound healing and cell adhesion when
overexpressed in Xenopus embryos. PAK5/KR shows no synergy,
suggesting that this interaction requires kinase activity (Fig. 7).
However, Inca does not activate the PAK5 kinase, because coexpression of Xenopus Inca and PAK5 in mammalian cells does not
increase phosphorylation of the regulatory Ser533 residue (Fig. 7Q).
Furthermore, overexpression of constitutively active PAK5 does not
mimic combined overexpression of Inca and wild-type PAK5. This
suggests the possibility that kinase targets for PAK5 may exist in
microtubule or microfilament cytoskeletal components that are only
DEVELOPMENT
Fig. 6. Inca interacts with PAK5.
(A) Selective medium streaks of yeast cells
expressing Xenopus Inca and PAK5, either
alone or together, as indicated. Inca+PAK5
allows growth on medium lacking leucine,
tryptophan, histidine and adenine. Positive
controls include transfection with vectors
containing T antigen and p53 (Clontech).
Streaks on -leu/-trp (lower panel) shown as a
control for transfection. (B) Extracts prepared
from HEK293 cells transfected with
expression plasmids encoding a PAK5-GFP
fusion or a Myc epitope-tagged Inca
separately or together, immunoprecipitated
with anti-Myc, followed by western blot with
antibody for GFP or Myc. Lanes labeled as
total are from lysates prior to
immunoprecipitation. PAK5-GFP precipitates
with the anti-Myc antibody, but only when
Myc-tagged Inca is present in the extract.
(C) Anti-IncaA peptide antibody specificity.
Fertilized eggs were injected with 1 ng of
synthetic mRNA encoding XInca-GFP, and
cultured to stage 20. Detergent (1% NP40)solubilized protein was extracted with 1,1,2trichlorotrifluoroethane (Freon) to remove
yolk and the equivalent of two embryos
analyzed by SDS-PAGE/western blot. Both
anti-GFP and anti-Inca recognized a single
band of the correct molecular weight
(~63 kDa). (D) Extract from untransfected
Xenopus A6 cells immunoprecipitated with
preimmune serum or anti-Inca, followed by western blot using antiserum raised against PAK5 (residues 122-224, a generous gift of N. Morin).
Immunoprecipitation with anti-Inca enriches the PAK5 signal several-fold compared with preimmune serum, indicating Inca-PAK5 interaction.
(E) Fluorescent images of a CHO cell cotransfected with plasmids encoding a PAK5-RFP fusion and Xenopus Inca-GFP fusion showing extensive
overlap. (F) Fibrous structures positive for Inca and PAK5 are nocodazole-sensitive. CHO cells transiently transfected with PAK5-RFP and XInca-GFP
were treated for 1 hour with 3 ng/ml nocodazole (Sigma), then fixed with methanol and photographed using an inverted fluorescence microscope.
The fibers visible without nocodazole treatment (E) have disappeared.
Inca required for craniofacial development
RESEARCH ARTICLE 1287
Fig. 7. Inca misexpression disrupts gastrulation,
pigmentation and wound healing in Xenopus. (A)
Uninjected stage 25 control embryo. (B) Siblings injected
with 250 pg IncaA mRNA have shorter body axes and
numerous protuberances. (C,D) High-magnification views
of ectoderm at stage 8 from uninjected (C) and IncaA
mRNA-injected (250 pg; D) embryos showing relocation of
cortical pigment to the cell periphery. Scale bar: 100 ␮m.
(E,F) Vegetal explants after animal cap removal and culture
for 5 (E) or 25 (F) minutes in 0.3⫻MMR. Upper row,
uninjected; lower row injected with 250 pg IncaA mRNA,
showing delayed healing. (G,H) Confocal z-stack images of
animal caps from uninjected (G) and IncaA mRNA-injected
(H) embryos after 5 minutes of healing in 0.3⫻MMR.
White arrowheads in G indicate purse-string actin-filament
structures missing in embryos overexpressing Inca. (I-O)
Synergistic effect on wound healing of PAK5 and Inca.
Embryos injected with mRNA encoding wild-type PAK5GFP (J), kinase-dead PAK5-GFP (PAK5/KR; K), constitutively
active PAK5-GFP (PAK5/EN; L), IncaA-GFP (M), a mixture of
IncaA-GFP and PAK5-GFP (N) or a mixture of IncaA-GFP
and PAK5/KR-GFP (O). All PAK5-GFP mRNAs injected at 1
ng, IncaA-GFP mRNA at 250 pg. Vegetal explants were
allowed to heal for 25 minutes. Combining Inca+wild-type
PAK5 greatly delays wound healing and leads to
dissociation (N). PAK5/KR does not exhibit this synergistic
effect (O). (I) Uninjected control embryo. Results from these
experiments are summarized in Table 1. (P) PAK5-GFP
mRNAs were equally translated, as judged by western blot
using antibody to GFP. (Q) Co-expression with Inca does
not increase PAK5 phosphorylation. Western blots of
extracts made from HEK293 cells transfected with 0.5 ␮g
FLAG-tagged XPAK5 plasmid and 0, 0.5 or 1.0 ␮g of Myctagged Xenopus Inca. The ratio of total XPAK5 signal
(FLAG antibody) to the level of phosphorylation of
regulatory serine residue 474 (phospho-PAK4) was not
significantly different in any of the samples. (R) Xenopus
PAK5 expression. Whole-mount in situ hybridization at
stages 10, 13 and 25. Stage 10 embryos were bisected in
the sagittal plane prior to hybridization. PAK5 expression is
broad in ectoderm and mesoderm at early stages and
essentially ubiquitous later in development.
accessible when Inca is associated with the kinase. In other words,
Inca might provide a mechanism for regulation of PAK5, which, like
other Class II PAKs (PAK 4-6), binds to Cdc42 or Rac1 but is not
catalytically activated by this association.
Interactions of Inca with PAK5 and the cytoskeleton may also
help explain why Inca morphants have defects in NC
morphogenesis. Requirements for PAK4/5 in later embryogenesis
remains unclear because dominant-negative PAK5 in Xenopus
disrupts gastrulation (Faure et al., 2005), and the mouse PAK4
knockout dies by E11.5 (Qu et al., 2003). However, PAK5 modifies
cytoskeletal architecture and physically associates with Inca, and
both proteins are co-expressed in Xenopus NC cells. The
rearrangement of NC cells from the pharyngeal arches into linear
arrays that extend anteriorly prior to cartilage differentiation
(Kimmel et al., 2001) resemble the convergent extension movements
that depend on PAK5 (Faure et al., 2005) and Rho GTPases during
RNA
IncaA
PAK5
PAK5/KR
PAK5/EN
IncaA
IncaA+PAK5
IncaA+PAK5/KR
Amount injected
Total number of embryos (n)
Percentage with phenotype (%)
250 pg
250 pg
250 pg
1 ng
1 ng
1 ng
250 pg
250 pg+1 ng
250 pg+1 ng
84
126
48
24
24
24
24
24
24
95
100
100
100
100
100
100
100
100
Phenotype
Short axis, abnormal shape
Cortical pigment dispersal
Inhibited wound healing
Normal wound healing
Normal wound healing
Inhibited wound healing (minor)
Inhibited wound healing (moderate)
Inhibited wound healing (severe)
Inhibited wound healing (moderate)
Part
B
D
E,F
J
K
L
M
N
O
DEVELOPMENT
Table 1. Summary of data from Fig. 7
gastrulation (for a review, see Nikolaidou and Barrett, 2005). It is
attractive to hypothesize that skeletogenic NC cells require Inca to
control PAK5-dependent cytoskeletal restructuring and NC cell
behaviors that are essential for proper craniofacial morphogenesis.
Special thanks to Nathalie Morin for generously providing Xenopus PAK
plasmids and antibody, and to Maria Morasso for mouse embryo samples and
northern blot. Thanks to Vincent Shram at the NICHD Microscopy and Imaging
Core Facility for assistance with Xenopus confocal microscopy. This work was
supported in part by the Intramural Research Program of the National Institute
of Child Health and Human Development, NIH, and by grants from the NIH
(DE-13828, NS-41353) and March of Dimes (1-FY01-198) to T.F.S. T.L.H. was
supported by a postdoctoral fellowship from the American Cancer Society.
References
Aoki, Y., Saint-Germain, N., Gyda, M., Magner-Fink, E., Lee, Y. H., Credidio,
C. and Saint-Jeannet, J. P. (2003). Sox10 regulates the development of neural
crest-derived melanocytes in Xenopus. Dev. Biol. 259, 19-33.
Barrallo-Gimeno, A., Holzschuh, J., Driever, W. and Knapik, E. W. (2004).
Neural crest survival and differentiation in zebrafish depends on mont
blanc/tfap2a gene function. Development 131, 1463-1477.
Bastidas, F., De Calisto, J. and Mayor, R. (2004). Identification of neural crest
competence territory: role of Wnt signaling. Dev. Dyn. 229, 109-117.
Bokoch, G. M. (2003). Biology of the p21-activated kinases. Annu. Rev. Biochem.
72, 743-781.
Brewer, S., Feng, W., Huang, J., Sullivan, S. and Williams, T. (2004). Wnt1Cre-mediated deletion of AP-2alpha causes multiple neural crest-related defects.
Dev. Biol. 267, 135-152.
Brock, J., Midwinter, K., Lewis, J. and Martin, P. (1996). Healing of incisional
wounds in the embryonic chick wing bud: characterization of the actin pursestring and demonstration of a requirement for Rho activation. J. Cell Biol. 135,
1097-1107.
Cau, J., Faure, S., Comps, M., Delsert, C. and Morin, N. (2001). A novel p21activated kinase binds the actin and microtubule networks and induces
microtubule stabilization. J. Cell Biol. 155, 1029-1042.
Davidson, L. A., Ezin, A. M. and Keller, R. (2002). Embryonic wound healing by
apical contraction and ingression in Xenopus laevis. Cell Motil. Cytoskeleton 53,
163-176.
Duband, J. L. (2006). Neural crest cell delamination and migration: integrating
regulations of cell interactions, locomotion, survival and fate. In Neural Crest
Induction and Differentiation (ed. J. Saint-Jeannet), pp. 45-71. Georgetown, TX:
Landes Bioscience.
Duband, J. L., Monier, F., Delannet, M. and Newgreen, D. (1995). Epitheliummesenchyme transition during neural crest development. Acta Anat. Basel 154,
63-78.
Eckert, D., Buhl, S., Weber, S., Jager, R. and Schorle, H. (2005). The AP-2
family of transcription factors. Genome Biol. 6, 246.
Faure, S., Cau, J., de Santa Barbara, P., Bigou, S., Ge, Q., Delsert, C. and
Morin, N. (2005). Xenopus p21-activated kinase 5 regulates blastomeres’
adhesive properties during convergent extension movements. Dev. Biol. 277,
472-492.
Feledy, J. A., Morasso, M. I., Jang, S. I. and Sargent, T. D. (1999).
Transcriptional activation by the homeodomain protein distal-less 3. Nucleic
Acids Res. 27, 764-770.
Gnesutta, N., Qu, J. and Minden, A. (2001). The serine/threonine kinase PAK4
prevents caspase activation and protects cells from apoptosis. J. Biol. Chem. 276,
14414-14419.
Harland, R. M. (1991). In situ hybridization: an improved whole-mount method
for Xenopus embryos. Methods Cell Biol. 36, 685-695.
Hausen, P. and Riebesell, M. (1991). The Early Development of Xenopus laevis:
An Atlas of the Histology. Berlin, New York: Springer-Verlag.
Hensey, C. and Gautier, J. (1998). Programmed cell death during Xenopus
development: a spatio-temporal analysis. Dev. Biol. 203, 36-48.
Huang, S., Jean, D., Luca, M., Tainsky, M. A. and Bar-Eli, M. (1998). Loss of
AP-2 results in downregulation of c-KIT and enhancement of melanoma
tumorigenicity and metastasis. EMBO J. 17, 4358-4369.
Huang, X. and Saint-Jeannet, J. P. (2004). Induction of the neural crest and the
opportunities of life on the edge. Dev. Biol. 275, 1-11.
Itoh, K., Lisovsky, M., Hikasa, H. and Sokol, S. Y. (2005). Reorganization of
actin cytoskeleton by FRIED, a Frizzled-8 associated protein tyrosine
phosphatase. Dev. Dyn. 234, 90-101.
Jaffer, Z. M. and Chernoff, J. (2002). p21-activated kinases: three more join the
Pak. Int. J. Biochem. Cell Biol. 34, 713-717.
Kimmel, C. B., Miller, C. T. and Keynes, R. J. (2001). Neural crest patterning and
the evolution of the jaw. J. Anat. 199, 105-120.
Knight, R. D. and Schilling, T. F. (2006). Cranial neural crest and development of
the head skeleton. In Neural Crest Induction and Differentiation (ed. J. SaintJeannet), pp. 120-133. Georgetown, TX: Landes Bioscience.
Development 134 (7)
Knight, R. D., Nair, S., Nelson, S. S., Afshar, A., Javidan, Y., Geisler, R., Rauch,
G. J. and Schilling, T. F. (2003). lockjaw encodes a zebrafish tfap2a required for
early neural crest development. Development 130, 5755-5768.
Knight, R. D., Javidan, Y., Zhang, T., Nelson, S. and Schilling, T. F. (2005).
AP2-dependent signals from the ectoderm regulate craniofacial development in
the zebrafish embryo. Development 132, 3127-3138.
Kofron, M., Heasman, J., Lang, S. A. and Wylie, C. C. (2002). Plakoglobin is
required for maintenance of the cortical actin skeleton in early Xenopus embryos
and for cdc42-mediated wound healing. J. Cell Biol. 158, 695-708.
LaBonne, C. and Bronner-Fraser, M. (1998). Neural crest induction in Xenopus:
evidence for a two-signal model. Development 125, 2403-2414.
Le Douarin, N. and Kalcheim, C. (1999). The Neural Crest. London: Cambridge
University Press.
Li, X. and Minden, A. (2005). PAK4 functions in tumor necrosis factor (TNF)
alpha-induced survival pathways by facilitating TRADD binding to the TNF
receptor. J. Biol. Chem. 280, 41192-41200.
Lloyd, B., Tao, Q., Lang, S. and Wylie, C. (2005). Lysophosphatidic acid signaling
controls cortical actin assembly and cytoarchitecture in Xenopus embryos.
Development 132, 805-816.
Luo, T., Matsuo-Takasaki, M., Thomas, M. L., Weeks, D. L. and Sargent, T. D.
(2002). Transcription factor AP-2 is an essential and direct regulator of epidermal
development in Xenopus. Dev. Biol. 245, 136-144.
Luo, T., Lee, Y. H., Saint-Jeannet, J. P. and Sargent, T. D. (2003). Induction of
neural crest in Xenopus by transcription factor AP2alpha. Proc. Natl. Acad. Sci.
USA 100, 532-537.
Luo, T., Zhang, Y., Khadka, D., Rangarajan, J., Cho, K. W. and Sargent, T. D.
(2005). Regulatory targets for transcription factor AP2 in Xenopus embryos. Dev.
Growth Differ. 47, 403-413.
Maconochie, M., Krishnamurthy, R., Nonchev, S., Meier, P., Manzanares, M.,
Mitchell, P. J. and Krumlauf, R. (1999). Regulation of Hoxa2 in cranial neural
crest cells involves members of the AP-2 family. Development 126, 1483-1494.
Mayor, R., Morgan, R. and Sargent, M. G. (1995). Induction of the prospective
neural crest of Xenopus. Development 121, 767-777.
Merriam, R. W. and Christensen, K. (1983). A contractile ring-like mechanism in
wound healing and soluble factors affecting structural stability in the cortex of
Xenopus eggs and oocytes. J. Embryol. Exp. Morphol. 75, 11-20.
Meulemans, D. and Bronner-Fraser, M. (2004). Gene-regulatory interactions in
neural crest evolution and development. Dev. Cell 7, 291-299.
Mizuseki, K., Kishi, M., Matsui, M., Nakanishi, S. and Sasai, Y. (1998).
Xenopus Zic-related-1 and Sox-2, two factors induced by chordin, have distinct
activities in the initiation of neural induction. Development 125, 579-587.
Monsoro-Burq, A. H., Wang, E. and Harland, R. (2005). Msx1 and Pax3
cooperate to mediate FGF8 and WNT signals during Xenopus neural crest
induction. Dev. Cell 8, 167-178.
Moreau, J., Lebreton, S., Iouzalen, N. and Mechali, M. (1999).
Characterization of Xenopus RalB and its involvement in F-actin control during
early development. Dev. Biol. 209, 268-281.
Muslin, A. J., Tanner, J. W., Allen, P. M. and Shaw, A. S. (1996). Interaction of
14-3-3 with signaling proteins is mediated by the recognition of phosphoserine.
Cell 84, 889-897.
Nikolaidou, K. K. and Barrett, K. (2005). Getting to know your neighbours; a
new mechanism for cell intercalation. Trends Genet. 21, 70-73.
Papalopulu, N. and Kintner, C. (1993). Xenopus Distal-less related homeobox
genes are expressed in the developing forebrain and are induced by planar
signals. Development 117, 961-975.
Pasqualetti, M., Ori, M., Nardi, I. and Rijli, F. M. (2000). Ectopic Hoxa2
induction after neural crest migration results in homeosis of jaw elements in
Xenopus. Development 127, 5367-5378.
Qu, J., Li, X., Novitch, B. G., Zheng, Y., Kohn, M., Xie, J. M., Kozinn, S.,
Bronson, R., Beg, A. A. and Minden, A. (2003). PAK4 kinase is essential for
embryonic viability and for proper neuronal development. Mol. Cell. Biol. 23,
7122-7133.
Rangarajan, J., Luo, T. and Sargent, T. D. (2006). PCNS: a novel protocadherin
required for cranial neural crest migration and somite morphogenesis in
Xenopus. Dev. Biol. 295, 206-218.
Richman, J. M. and Lee, S. H. (2003). About face: signals and genes controlling
jaw patterning and identity in vertebrates. BioEssays 25, 554-568.
Sadaghiani, B. and Thiebaud, C. H. (1987). Neural crest development in the
Xenopus laevis embryo, studied by interspecific transplantation and scanning
electron microscopy. Dev. Biol. 124, 91-110.
Saga, Y., Hata, N., Kobayashi, S., Magnuson, T., Seldin, M. F. and Taketo,
M. M. (1996). MesP1: a novel basic helix-loop-helix protein expressed in the
nascent mesodermal cells during mouse gastrulation. Development 122, 27692778.
Saint-Jeannet, J. P., He, X., Varmus, H. E. and Dawid, I. B. (1997). Regulation
of dorsal fate in the neuraxis by Wnt-1 and Wnt-3a. Proc. Natl. Acad. Sci. USA
94, 13713-13718.
Sargent, T. D. (2006). Transcriptional regulation and the neural plate border. In
Neural Crest Induction and Differentiation (ed. J. Saint-Jeannet), pp. 32-44.
Georgetown, TX: Landes Bioscience.
DEVELOPMENT
1288 RESEARCH ARTICLE
Sasai, Y., Lu, B., Steinbeisser, H., Geissert, D., Gont, L. K. and De Robertis, E.
M. (1994). Xenopus chordin: a novel dorsalizing factor activated by organizerspecific homeobox genes. Cell 79, 779-790.
Sive, H. (1999). Early Development of Xenopus laevis: A Laboratory Manual. Cold
Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
Spokony, R. F., Aoki, Y., Saint-Germain, N., Magner-Fink, E. and SaintJeannet, J. P. (2002). The transcription factor Sox9 is required for cranial neural
crest development in Xenopus. Development 129, 421-432.
Tao, Q., Lloyd, B., Lang, S., Houston, D., Zorn, A. and Wylie, C. (2005). A
novel G protein-coupled receptor, related to GPR4, is required for assembly of
the cortical actin skeleton in early Xenopus embryos. Development 132, 28252836.
Thisse, C., Thisse, B., Schilling, T. F. and Postlethwait, J. H. (1993). Structure of
the zebrafish snail1 gene and its expression in wild-type, spadetail and no tail
mutant embryos. Development 119, 1203-1215.
RESEARCH ARTICLE 1289
Wada, N., Javidan, Y., Nelson, S., Carney, T. J., Kelsh, R. N. and Schilling, T. F.
(2005). Hedgehog signaling is required for cranial neural crest morphogenesis
and chondrogenesis at the midline in the zebrafish skull. Development 132,
3977-3988.
Westerfield, M. (1994). The Zebrafish Book: A Guide for the Laboratory Use of
Zebrafish (Danio Rerio). Eugene, OR: University of Oregon Press.
Winning, R. S., Shea, L. J., Marcus, S. J. and Sargent, T. D. (1991).
Developmental regulation of transcription factor AP-2 during Xenopus laevis
embryogenesis. Nucleic Acids Res. 19, 3709-3714.
Wolda, S. L., Moody, C. J. and Moon, R. T. (1993). Overlapping expression of
Xwnt-3A and Xwnt-1 in neural tissue of Xenopus laevis embryos. Dev. Biol. 155,
46-57.
Wunnenberg-Stapleton, K., Blitz, I. L., Hashimoto, C. and Cho, K. W. (1999).
Involvement of the small GTPases XRhoA and XRnd1 in cell adhesion and head
formation in early Xenopus development. Development 126, 5339-5351.
DEVELOPMENT
Inca required for craniofacial development