RESEARCH ARTICLE
285
Development 134, 285-293 (2007) doi:10.1242/dev.02727
Ascl1 defines sequentially generated lineage-restricted
neuronal and oligodendrocyte precursor cells in the spinal
cord
James Battiste1, Amy W. Helms1, Euiseok J. Kim1, Trisha K. Savage1, Diane C. Lagace2, Chitra D. Mandyam2,
Amelia J. Eisch2, Goichi Miyoshi3 and Jane E. Johnson1,*
The neural basic helix-loop-helix transcription factor Ascl1 (previously Mash1) is present in ventricular zone cells in restricted
domains throughout the developing nervous system. This study uses genetic fate mapping to define the stage and neural lineages
in the developing spinal cord that are derived from Ascl1-expressing cells. We find that Ascl1 is present in progenitors to both
neurons and oligodendrocytes, but not astrocytes. Temporal control of the fate-mapping paradigm reveals rapid cell-cycle exit and
differentiation of Ascl1-expressing cells. At embryonic day 11, Ascl1 identifies neuronal-restricted precursor cells that become dorsal
horn neurons in the superficial laminae. By contrast, at embryonic day 16, Ascl1 identifies oligodendrocyte-restricted precursor cells
that distribute throughout the spinal cord. These data demonstrate that sequentially generated Ascl1-expressing progenitors give
rise first to dorsal horn interneurons and subsequently to late-born oligodendrocytes. Furthermore, Ascl1-null cells in the spinal
cord have a diminished capacity to undergo neuronal differentiation, with a subset of these cells retaining characteristics of
immature glial cells.
INTRODUCTION
Neurogenesis and gliogenesis in invertebrates and vertebrates is
characterized by a series of symmetric and asymmetric divisions that
result in the correct number of neurons and glia needed to form a
mature nervous system (reviewed by Huttner and Kosodo, 2005;
Roegiers and Jan, 2004). In vertebrate organisms, different neural
cell types are generated from ventricular zone cells sequentially,
with neurogenesis preceding gliogenesis. Recently, elegant timelapse imaging of cortical neurogenesis in mammals has revealed a
model in which mitosis at the ventricular surface is either symmetric,
yielding two progenitors, or asymmetric, yielding a progenitor cell
and either a neuron or a neuron-restricted precursor (Haubensak et
al., 2004; Miyata et al., 2004; Noctor et al., 2004). The restricted
precursor undergoes additional mitoses at non-surface locations,
usually symmetrically, yielding two postmitotic neuron daughter
cells. By contrast, non-cortical brain regions may have different
characteristic division patterns. This is suggested by studies in chick
and zebrafish hindbrain that demonstrate that neurons are
preferentially derived from symmetric terminal divisions rather than
asymmetric divisions (Lyons et al., 2003). Oligodendrocytes and
astrocytes are generated from dividing cells in the ventricular zone
at later stages. These precise descriptions of neural cell lineage are
important for providing a framework to address the molecular
control of neurogliogenesis and for understanding the transition of
neural stem cells as they differentiate into one of the three major
classes of cells in the central nervous system (CNS).
1
Center for Basic Neuroscience and 2Department of Psychiatry, UT Southwestern
Medical Center, Dallas, TX 75390, USA. 3Smilow Neuroscience Program and the
Department of Cell Biology, New York University School of Medicine, New York, NY
10016, USA.
*Author for correspondence (e-mail: [email protected])
Accepted 2 November 2006
Transcription factors of the Basic helix-loop-helix (bHLH) family
are one class of molecules essential in both neurogenesis and
gliogenesis from Drosophila to mammals (reviewed by Bertrand et
al., 2002; Rowitch, 2004). Here we use recombination-based lineage
tracing in vivo to identify the position within the neural lineage
marked by the bHLH factor, Ascl1 (previously Mash1). Ascl1 is a
vertebrate homolog of the Drosophila proneural genes of the
Achaete-scute complex (Johnson et al., 1990). Ascl1 is present
within the ventricular zone, in at least some mitotically active cells,
in distinct regions along the rostrocaudal and dorsoventral axes of
the neural tube (Guillemot et al., 1993; Helms et al., 2005; Ma et al.,
1997; Porteus et al., 1994; Torii et al., 1999). Over the past decade,
analyses of mice null for Ascl1 have demonstrated its essential role
in the generation of specific subsets of neurons in many regions,
including the forebrain, hindbrain, autonomic nervous system,
olfactory epithelium, retina and spinal cord (Akagi et al., 2004;
Blaugrund et al., 1996; Casarosa et al., 1999; Cau et al., 1997;
Guillemot et al., 1993; Helms et al., 2005; Hirsch et al., 1998; Pattyn
et al., 2004). Roles for Ascl1 in inducing neuronal differentiation
and in neuronal specification were revealed by combining results
from the mouse mutant with those from overexpression paradigms
in cell culture (Farah et al., 2000) or chick neural tube (Nakada et al.,
2004). For example, in the chick neural tube, high levels of Ascl1
induce cells to stop cycling, move laterally out of the ventricular
zone, and begin expressing both general neuronal markers and
neuronal-type-specific markers (Helms et al., 2005; Kriks et al.,
2005; Müller et al., 2005; Nakada et al., 2004). Loss of Ascl1
function results in loss or decrease of specific interneuron
populations in the mouse spinal cord (Helms et al., 2005; Li et al.,
2005). In addition to these specific losses, there is a more general
defect as cells stall in the ventricular zone and different aspects of
neuronal differentiation become uncoordinated (Casarosa et al.,
1999; Helms et al., 2005; Horton et al., 1999; Torii et al., 1999).
Together, these studies define Ascl1 as an essential player in
vertebrate neuronal differentiation and specification.
DEVELOPMENT
KEY WORDS: Mash1 (Ascl1), bHLH transcription factor, Spinal cord development, In vivo genetic fate mapping, Mouse
286
RESEARCH ARTICLE
Although not studied as extensively, there are accumulating data
that suggest Ascl1 is a player in oligodendrogenesis as well as
neurogenesis. Ascl1 was first described in oligodendrocyte progenitor
cells isolated from optic nerve (Kondo and Raff, 2000; Wang et al.,
2001), and more recently it was shown to overlap with markers of
oligodendrocyte precursors in the telencephalon (Gokhan et al., 2005)
although its requirement in these cells is not clear. At postnatal stages,
Ascl1 functions in the telencephalic subventricular zone (SVZ), the
source of replenishing neurons in the olfactory bulb and
oligodendrocytes in the cortex (Parras et al., 2004). In Ascl1 mutants,
there is a decrease in neurons and oligodendrocytes, with an increase
in astrocytes in cell cultures derived from telencephalic SVZ. It is not
clear from these studies whether Ascl1 is present and functions in a
progenitor common to both neurons and oligodendrocytes, or whether
it is present in precursors restricted to either of these two lineages.
We developed mouse models expressing Cre or the tamoxifeninducible Cre recombinase to identify lineages derived from Ascl1expressing cells at different stages of development. Using cervical
spinal cord as a model, we found that during neurogenic periods
[embryonic day (E) 9.5-13.5], Ascl1-expressing cells were lineagerestricted neuronal precursors, but later in embryogenesis, during
gliogenic periods in the dorsal neural tube (E14.5-early postnatal),
Ascl1-expressing cells were lineage-restricted oligodendrocyte
precursors. In this paradigm, Ascl1 is not detected in progenitors
common to both lineages, as the genetically marked cells rapidly exit
the cell cycle, move laterally out of the ventricular zone, and
differentiate. Analysis of lineage markers in Ascl1 mutant spinal
cords demonstrates a role for Ascl1 in efficient neuronal
differentiation; without Ascl1, the cells maintain characteristics of
immature oligodendrocytes and astrocytes.
Development 134 (2)
characterization of this transgenic strain will be published elsewhere. A NestinCreERT2;R26R-stop-lacZ E11.5 embryo induced with tamoxifen at E10.5
illustrates nervous system expression of the transgene along the rostrocaudal
axis (see Fig. S1B in the supplementary material). No expression was seen in
somites and no expression observed outside of the CNS. A cross section
through the neural tube reveals reporter gene expression in the ventricular and
mantle zones, and at this stage it is enriched ventrally (see Fig. S1C in the
supplementary material).
Cre reporter mouse strains R26R-stop-lacZ (Soriano, 1999) and R26Rstop-YFP (Srinivas et al., 2001) were genotyped by PCR using published
primers (Soriano, 1999): AAA GTC GCT CTG AGT TGT TAT; GCG AAG
AGT TTG TCC TCA ACC; GGA GCG GGA GAA ATG GAT ATG. Ascl1
mutant strain (Guillemot et al., 1993) was genotyped by PCR using:
CTCTTAGCCCAGAGGAAC; GCAGCGCATCGCCTTCTATC; CCAGGACTCAATACGCAGGG. Tamoxifen induction of Cre recombinase was
accomplished by interperitoneal injection of pregnant females at 9.5-15.5
days post-coitum (dpc) with 2-3 mg tamoxifen (Sigma, T55648) in
sunflower oil per 40 g body weight. Two injections of tamoxifen 6 hours
apart were used for experiments shown in Fig. 3.
Immunofluorescence, X-gal staining, and mRNA in situ
hybridization
Embryonic day 10.5-13.5 embryos were dissected and processed as previously
described for whole mount for GFP or X-gal staining (Gowan et al., 2001), or
for cryosectioning for immunofluorescence and mRNA in situ hybridization
(Helms et al., 2005). Briefly, for cryosectioning, embryos were fixed in 4%
87,100kb
Pah
87,000kb
Pah4
86,900kb
86,800kb
Ascl1
Chr 10
Ascl1
RPCI 428P21
MATERIALS AND METHODS
The Roswell Park Bacterial Artificial Chromosome (BAC) library was
screened to identify clones that contained the Ascl1 protein coding region.
RPCI-428P21 was chosen for further study as it contains a genomic insert
of 305 kb with 98 kb 5⬘ and 206 kb 3⬘ of the Ascl1 translation start codon
(Fig. 1). Homologous recombination in bacteria (Yang et al., 1997) was used
to replace the Ascl1 coding region precisely with coding sequence for EGFP
(Clontech) and Cre separated by an internal ribosomal entry site (IRES)
(Ascl1-GIC), or CreERTM (Hayashi and McMahon, 2002) with a
heterologous 3⬘ cassette from the bovine growth hormone (Ascl1-CreERTM).
Transgenic mice were generated by standard procedures (Hogan et al., 1986)
using fertilized eggs from B6D2F1 (C57B1/6 ⫻ DBA) crosses. Purified
BAC DNA was injected at 0.5-1 ng/␮l in 10 mmol/l Tris pH 7.5, 0.1 mmol/l
EDTA, 100 mmol/l NaCl. Two lines of each transgene type were examined.
Data in Fig. 2 are from Ascl1-GIC (B1A-2), and data in Figs 3, 4, 5 and 6 are
from Ascl1-CreERTM (B2C-6), while Ascl1-CreERTM (B2C-8) is shown in
Fig. S2 in the supplementary material. Transgenic animals were identified
by PCR analysis using tail or yolk sac DNA with primers to Cre:
GGACATGTTCAGGGATCGCCAGGCG; GCATAACCAGTGAAACAGCATTGCTG.
Nestin-CreERT2 was created by subcloning CreERT2 from pCreERT2 (Indra
et al., 1999) into the SalI and NheI site of Nestin Xh5 plasmid (gift from W.
Zhong, Yale University). The rat Nestin gene was initially identified to contain
four exons spanning three introns (Lendahl et al., 1990) and was recently
identified to contain five exons spanning four introns (Wiese et al., 2004). The
Xh5 plasmid contains ~5.4 kb upstream of the initiation codon, exons 1-4 and
adjacent introns 1-4, and part of the 5⬘ region of exon 5 of rat nestin (see Fig.
S1A in the supplementary material). The Xh5 plasmid has been previously
published in other mouse models and contains similar elements to Nes/PlacZ/3
introns (Beech et al., 2004; Petersen et al., 2002; Zimmerman et al., 1994). The
Nestin-CreERT2 founder mice were generated by pronuclear injection of SmaI
digest of Nes-CreERT2 into C57Bl/6J fertilized eggs. Five independent lines
were generated and the data presented here are from one line (K). A detailed
Ascl1-GIC
GFP-IRES-Cre
Ascl1-CreERTM
CreERTM pA
R26R-reporter
R26R
stop
loxP
lacZ or YFP pA
loxP
Cre recombinase
R26R
lacZ or YFP pA
loxP
Fig. 1. Diagram of modified Ascl1 BACs and fate-mapping
strategy. The Ascl1 gene is located on mouse chromosome 10. The
BAC RPCI 428P21 encompasses the Ascl1 coding sequence with ~100
kb 5⬘ and 200 kb 3⬘ (orientation 5⬘ to 3⬘ relative to Ascl1). The genes
encoding Pah4 (phenylalanine 4-hydroxylase) and Pah (phenylalanine
hydroxylase) are ~30 kb and ~78 kb 5⬘ of Ascl1, and are included in the
BAC RPCI 428P21. Ascl1-GIC and Ascl1-CreERTM are modifications of
RPCI 428P21 that replace the Ascl1 coding sequence with that
encoding GFP and Cre separated by an IRES, or a tamoxifen-inducible
Cre (Hayashi and McMahon, 2002) with a heterologous 3⬘ polyA
addition cassette from bovine growth hormone, respectively. The R26Rreporter mice were previously described (Soriano, 1999; Srinivas et al.,
2001). Protein from these reporters is only made after the STOP
sequence is recombined out by Cre recombinase activity.
DEVELOPMENT
BAC recombination and generation of transgenic mice
formaldehyde for 2 hours at 4°C, rinsed well in phosphate buffer,
cryoprotected in 30% sucrose, and embedded frozen in OCT. Spinal columns
were dissected from embryos older than E15 and fixed in 2% formaldehyde
for 16 hours at 4°C, before processing for cryosection as above. Spinal
columns were dissected from P14-P30 mice by ventral laminectomy after
anesthesia and trans-cardiac perfusion with 4% formaldehyde. Tissue was
fixed further for 2 hours at 4°C, vibratome sectioned and X-gal stained, or
fixed overnight at 4°C before processing as above for cryosection.
For immunofluorescence, slides were incubated in the appropriate
dilution of primary antibody in PBS/1% goat serum/0.1% Triton X-100,
followed by either goat anti-rabbit, mouse, or guinea pig IgG conjugated
with Alexa Fluor 488, 594 or 647 (Molecular Probes). Primary antibodies
used for this study include: rabbit (1:500, Molecular Probes, A6455) or
chicken (1:250, Chemicon, AB16901) anti-GFP, mouse anti-Lhx1/5 (1:100,
DSHB, 4F2), guinea pig anti-Lmx1b (1:8000, gift from T. Jessell), mouse
anti-BrdU (1:25, BD Biosciences, 347580), rabbit anti-␤gal (1:200,
Biogenesis, 4600-1505), mouse anti-APC (1:100, Calbiochem, clone CC1), mouse anti-NeuN (1:1000, Chemicon, MAB377), mouse anti-GFAP
(1:400, Sigma-Aldrich, G3893), rabbit anti-Olig2 (1:2000, gift from C.
Stiles and R. Lu), guinea pig anti-Sox10 (1:2000, gift M. Wegner), mouse
anti-Ki67 (1:100, Novacastra) and guinea pig anti-GLAST (Chemicon,
AB1784). The guinea pig anti-Ascl1 antibody was generated using
bacterially produced rAscl1 as antigen and used at 1:10,000. For BrdU
labeling, pregnant mothers were injected with 200 ␮g/g of body weight 1
hour before sacrifice. Fluorescence imaging was carried out on a Bio-Rad
MRC 1024 confocal microscope. For each experiment multiple sections
from at least three different animals were analyzed.
mRNA in situ hybridization was performed essentially as described using
a combined protocol (Birren et al., 1993; Ma et al., 1998). A detailed
protocol is available upon request. Ascl1 and Cre antisense probes were
made from plasmids containing the coding region of each gene.
RESULTS
Transgenic mice expressing GFP and Cre
recombinase recapitulate Ascl1 expression
To study the lineages derived from Ascl1-expressing cells, we
developed a mouse model that expresses Cre recombinase in these
cells. Transgenic mice were generated with a BAC containing the
Ascl1 locus that was modified to contain the coding sequence for Cre
recombinase in place of the Ascl1 coding sequence. The BAC,
RPCI-23 428P21, was chosen for these studies because it contains
100 kb 5⬘ and 200 kb 3⬘ of the Ascl1 start codon (Fig. 1). Thus, this
BAC has a high probability of containing all regulatory information
for gene expression mimicking endogenous Ascl1. Homologous
recombination in bacteria (Yang et al., 1997) was used to replace the
Ascl1 coding region with that for GFP and Cre transcribed as a
bicistronic message separated by an IRES (Fig. 1) (Helms et al.,
2005). This modified BAC was used to generate multiple transgenic
mouse lines that expressed the transgene in similar patterns at E11.5.
The Ascl1-GIC line used here has been maintained over multiple
generations.
Analysis of GFP fluorescence and Cre mRNA in situ in Ascl1GIC embryos demonstrated that the BAC sequences contain
sufficient information to direct expression specifically in Ascl1
domains, including those not detected when smaller genomic
sequences were used (Verma-Kurvari et al., 1996). GFP in whole
mount was detected in the ventral telencephalon, midbrain and
hindbrain, and dorsal neural tube (Fig. 2A). The activity of the Cre
recombinase was demonstrated by crossing Ascl1-GIC mice with
the Cre-reporter mouse line, R26R-stop-lacZ (Soriano, 1999).
Whole mount X-gal stained Ascl1-GIC;R26R-stop-LacZ embryos
permanently report the cells or their progeny that have expressed
active Cre any time before that stage. At E10.5, there was extensive
X-gal staining in midbrain (Fig. 2B). Staining in developing
sympathetic neurons was just beginning to be detected at E10.5 but
RESEARCH ARTICLE
287
Fig. 2. Ascl1-expressing cells give rise to neurons and
oligodendrocytes. (A) GFP fluorescence in a whole-mount E11.5
embryo from the Ascl1-GIC transgenic line. Inset is a cross section
showing expression in the sympathetic ganglia. (B-D⬘) X-gal staining of
Ascl1-GIC;R26R-lacZ E10.5, 11.5 and 12.5 embryos. Arrow in B indicates
barely detectable X-gal staining in the sympathetic ganglia.
(C⬘,D⬘) Vibratome sections through the neural tubes of embryos shown
in C-D. (E-J) mRNA in situ hybridization on cross sections of E11.5
embryos with Ascl1 (E,G,I) or Cre (F,H,J) probes. (K) X-gal staining of a
P30 spinal cord from an Ascl1-GIC;R26R-lacZ transgenic mouse showing
labeled cells in gray and white matter. (L-O) Immunofluorescence for
YFP (green) in P14 Ascl1-GIC;R26R-YFP transgenic spinal cords doublelabeled in red with a marker for neurons (L, NeuN), oligodendrocytes (M,
Olig2; N, APC) or astrocytes (O, GFAP). The images are from the dorsal
horn gray matter regions (L and right of dotted line in M), or white
matter region (left of dotted line in M,N,O). Note that YFP co-labels
(yellow) with neuronal and oligodendrocyte markers (arrowheads in L-N)
but not the astrocyte marker (O). di, diencephalon; dnt, dorsal neural
tube; ent, enteric neurons; hb, hindbrain; mes, mesencephalon; sym,
sympathetic neurons; vt, ventral telencephalon.
was clearly evident by E11.5 (Fig. 2B,C). E11.5 also revealed
expression in the enteric nervous system, diencephalon and
hindbrain, with low expression in the dorsal neural tube (Fig. 2C,C⬘).
By E12.5, expression in the dorsal neural tube was clearly detected
(Fig. 2D,D⬘). These temporal and spatial expression characteristics
reflect expression of endogenous Ascl1 (Guillemot and Joyner,
1993). Cre and Ascl1 detected by mRNA in situ hybridization
demonstrates that Cre was present in an Ascl1-specific pattern in the
dorsal neural tube at E11.5 (Fig. 2E,F), and in the enteric (Fig. 2G,H)
and sympathetic (Fig. 2I,J) nervous systems. Taken together, these
data demonstrate that GFP and Cre in the Ascl1-GIC transgenic
mouse strain are expressed in an Ascl1-restricted pattern.
Ascl1-expressing cells produce both neurons and
oligodendrocytes
Ascl1 is restricted to the ventricular zone in the neural tube and is
known to be required for neuronal differentiation and specification
of subsets of neurons in multiple regions of the nervous system.
DEVELOPMENT
Ascl1 defines lineage-restricted precursors
288
RESEARCH ARTICLE
Development 134 (2)
Ascl1 has also been reported in cells that will become
oligodendrocytes (Gokhan et al., 2005; Kondo and Raff, 2000;
Parras et al., 2004; Wang et al., 2001). As Ascl1 disappears as cells
exit the cell cycle and differentiate, the identity and extent of mature
neural cells that comprise the Ascl1 lineage is unknown. To assess
the neural cell types derived from the Ascl1 lineage we analyzed
lacZ expression in P30 spinal cords of Ascl1-GIC;R26R-stop-lacZ
mice. This revealed that the contribution of cells from the Ascl1
lineage was surprisingly broad in the spinal cord and included cells
located throughout gray and white matter tissue, and in cells
surrounding the central canal (Fig. 2K), a pattern seen at all spinal
cord levels.
The location of X-gal stained cells in both the gray and white
matter suggested that neurons and glia were labeled. To determine
the identity of these cells, P14 spinal cords of Ascl1-GIC;R26R-stopYFP mice (Srinivas et al., 2001) were analyzed by double-label
immunofluorescence. As expected, many YFP+ cells in the gray
matter co-labeled with the neuronal marker NeuN+ (Fig. 2L). In
addition, many YFP+ cells, particularly in white matter but also in
the gray matter, co-labeled with two oligodendrocyte markers,
Olig2+ and APC+ (Fig. 2M,N). However, no YFP+ cells co-labeled
with the astrocyte marker GFAP+ (Fig. 2O). This contrasts with
GFAP co-labeling with YFP from the nestin lineage (data not
shown). These results indicate that neurons and oligodendrocytes,
but not astrocytes, are derived from Ascl1-expressing cells.
Fig. 3. Stage-specific fate mapping of the Ascl1-lineage.
(A-D⬘,H) X-gal staining of Ascl1-CreERTM;R26R-lacZ embryos harvested
at the stages indicated and treated with tamoxifen 24 hours before
harvest. Whole-mount stained and cleared embryos (A-D) and
vibratome sections through the neural tube are shown (A⬘-D⬘,H).
Arrowheads in A,A⬘,B indicate X-gal staining in the sympathetic
ganglia. (E) Cross section of an E10.5 Ascl1-CreERTM;R26R-YFP embryo
treated with tamoxifen at ~E9.0. Triple-label immunofluorescence with
antibodies to YFP (green), Lmx1b (red) and Lhx1/5 (blue) identify the
YFP+ cells as interneurons dI3, dI5 and V2. (F,I,J) Immunofluorescence
showing Ascl1 in the dorsal neural tube at E11.5 (F) and broadly in the
ventricular zone as well as gray and white matter in E16.5 spinal cord
(I). The specificity of the Ascl1 antibody is illustrated by the absence of
signal in E16.5 spinal cords of an Ascl1 null embryo (J). (G) In situ
hybridization showing Cre mRNA in the neural tube at E11.5. cc,
central canal; di, diencephalon; dnt, dorsal neural tube; gm, gray
matter; hb, hindbrain; mes, mesencephalon; vt, ventral telencephalon;
wm, white matter.
3B-D). By contrast to X-gal staining in Ascl1-GIC, which reported
an accumulation of all Ascl1-derived cells, the Ascl1-CreERTM
reported a subset and illustrated the temporal control of Cre activity
in this transgenic line. For example, note the absence of sympathetic
neuron labeling at E11.5 and 12.5 in the Ascl1-CreERTM versus the
Ascl1-GIC (compare Fig. 2C,D with Fig. 3B,C). Vibratome sections
from the whole-mount stained embryos confirmed that Ascl1
lineage cells became sympathetic and ventral interneurons before
E10.5, and dorsal horn neurons at E11-13 (Fig. 3A⬘-D⬘) (Helms et
al., 2005; Li et al., 2005; Lo et al., 1991; Mizuguchi et al., 2006;
Wildner et al., 2006). Triple-label immunofluorescence on a cross
section of an E10.5 Ascl1- CreERTM;R26R-stop-YFP embryo treated
with tamoxifen at E9.0 demonstrated accurate expression of Cre in
the Ascl1 lineage in three populations of neurons at this stage (Fig.
DEVELOPMENT
Transgenic mice expressing a tamoxifen-inducible
Cre recombinase allow stage-specific fate
mapping of the Ascl1-lineage
During neural development, the ventricular zone of the neural tube
contains progenitor cells that will give rise to neurons during the
period of neurogenesis (~E9-14) and oligodendrocytes during
gliogenesis (~E13-postnatal). At E10.5, Ascl1 is present in
ventricular zone cells, a subset of which will incorporate BrdU
(Helms et al., 2005). Thus, although Ascl1 is best known for its
function in neuronal development, the fate-mapping data
demonstrate that it is present in cells that will give rise to both
neurons and oligodendrocytes. We could either be detecting Ascl1
present in early neural tube ventricular zone cells that will
differentiate to neurons early and then later to oligodendrocytes, or
we could be detecting precursors restricted to a neuronal lineage, and
then later, precursors restricted to an oligodendrocyte lineage. To
distinguish between these two possibilities, we generated additional
transgenic mice, Ascl1-CreERTM, that replaced the Ascl1 coding
sequence in the BAC transgene with that encoding the tamoxifeninducible Cre recombinase (CreERTM) (Hayashi and McMahon,
2002) carrying a heterologous 3⬘ UTR (Fig. 1). Two independent
lines were generated that express the CreTM transgene in a similar
pattern but at different levels (compare Fig. 3C and Fig. 4C with Fig.
S2 in the supplementary material). The line with the highest
expression in the spinal neural tube was used for studies reported
here.
Cre activity, detected using the R26R-stop-lacZ reporter line,
reflects known Ascl1 expression during neurogenesis in the
developing spinal cord. Ascl1-CreERTM;R26R-stop-lacZ embryos
treated with tamoxifen at E9.5, 10.5, 11.5 and 12.5 were harvested
24 hours later and stained with X-gal (Fig. 3A-D). In a similar way
to the Acsl1-GIC (Fig. 2), strong expression in midbrain regions was
initiated first in sympathetic neurons, with neural tube just beginning
to be detected at E10.5 (Fig. 3A,A⬘). At E11.5-13.5, X-gal staining
reflected Ascl1 expression and was detected in the ventral
telencephalon, midbrain and hindbrain, and dorsal neural tube (Fig.
3E). The position of the YFP+ cells relative to Lhx1+ and/or Lhx5+
cells and the overlap with Lmx1b identified these cells as dorsal
interneurons dI3 and dI5, and a ventral neuronal population (V2), as
has been previously reported for Ascl1 lineages (Helms et al., 2005;
Li et al., 2005). mRNA in situ hybridization of Cre in Ascl1CreERTM at E11.5 was restricted to the dorsal neural tube, as
expected for Ascl1 expression at this stage (compare Fig. 2E, Fig. 3F
with Fig. 3G). Interestingly, the precise distribution of the mRNA
accumulation in the mediolateral axis was distinct from endogenous
Ascl1, with the mRNA accumulating at the lateral edges of the
ventricular zone (Fig. 3G), suggesting a role for the 3⬘ UTR in
stabilization of the mRNA (Verma-Kurvari et al., 1998). Overall,
within the neural tube, the Cre activity in the Ascl1-CreERTM
transgenic line reflects expression recapitulating endogenous Ascl1.
Treatment of Ascl1-CreERTM;R26R-stop-lacZ embryos with
tamoxifen at E15.5 and harvest at E16.5 revealed X-gal stained cells
and demonstrated that the transgene was still being expressed at this
late embryonic stage (Fig. 3H). The presence of Ascl1 in the neural
tube at this stage has been reported in a limited number of cells in
the dorsal ventricular zone (Cai et al., 2005). Using a newly
produced anti-Ascl1 polyclonal antisera on E16.5 neural tube
sections, we detected much more Ascl1 in dorsal and ventral
ventricular zone cells, as well as in the gray and white matter,
revealing much more extensive expression at this late stage than
previously appreciated (Fig. 3I). The specificity of the antisera is
demonstrated by the well-documented pattern of labeling in E11.5
neural tube (Fig. 3F), and importantly, by the absence of labeling in
an E16.5 Ascl1 null neural tube (Fig. 3J). Thus, endogenous Ascl1
and the transgene-produced Cre are present in late-stage neural tubes
when gliogenesis is ongoing.
Ascl1 expression defines lineage-restricted
precursors
Results from the experiments described above suggest that Ascl1 is
present in lineage-restricted precursor cells, both during
neurogenesis and later during oligodendrogenesis. To further test
this idea, two experiments were performed. One examined the fate
of Ascl1-expressing cells from different stages in the mature spinal
cord (Fig. 4), and the other examined whether lineage-marked cells
could be found in cycling cells in the ventricular zone (Fig. 5).
In the first experiment, R26R-stop-lacZ females crossed to Ascl1CreERTM males were treated with tamoxifen at 10.5 dpc (embryos
undergoing neurogenesis), or 15.5 dpc (embryos undergoing
gliogenesis), and the resulting offspring were analyzed for lacZ
expression at P30. Activation of Cre at E10.5 resulted in restricted
and dense lacZ reporter activity in neurons of the dorsal horn
primarily in Lamina I-III, and a few scattered cells in other parts of
the gray matter (Fig. 4B). X-gal stained cells were noticeably absent
from the spinal cord white matter and central canal (compare Fig.
2K and Fig. 4B). Within the dorsal horn, coexpression of ␤-gal with
NeuN but not APC using double-label immunofluorescence
confirmed the identity of these cells as neurons (Fig. 4E,F). By
contrast, activating Cre recombinase with tamoxifen at E15.5
resulted in a majority of the X-gal stained cells scattered throughout
the white matter at P30 (Fig. 4C). The lineage-traced cells
coexpressed the oligodendrocyte marker APC (Fig. 4H) but not the
neuronal marker NeuN, even when located in the gray matter (Fig.
4C,G). The lacZ-expressing cells did not coexpress GFAP,
indicating that they were not astrocytes (data not shown). Additional
time points of tamoxifen treatment confirmed these findings (Fig.
4K-N). Tamoxifen treatment at E9.5 or 12.5 yielded neurons only,
while tamoxifen in early postnatal stages yielded oligdendrocytes
RESEARCH ARTICLE
289
only. In the absence of tamoxifen, there was no leaky expression of
the reporter detected. Thus, these results support the conclusion that
Ascl1 is present in oligodendrocyte-restricted precursors in the
spinal neural tube by E15.5.
To demonstrate that the experimental paradigm used here can
detect Cre activity in common neural progenitors in the ventricular
zone, a novel Nestin-CreERT2 mouse strain (see Materials and
methods and Fig. S1 in the supplementary material) that has a
tamoxifen-inducible Cre (Feil et al., 1996; Indra et al., 1999) under
the control of the promoter and enhancer sequences of the Nestin
gene (Lendahl et al., 1990; Zimmerman et al., 1994) was used.
Nestin is an intermediate filament protein that is transiently
expressed in progenitor cells common to neurons, oligodendrocytes
Fig. 4. Ascl1 defines lineage-restricted precursors of neurons and
oligodendrocytes. (A) Time line depicting major periods of
neurogenesis and gliogenesis during mouse embryonic spinal cord
development. Arrowheads indicate individual time points for tamoxifen
induction. (B-N) P30 spinal cords from Ascl1-CreERTM;R26R-lacZ (B,C,EH,K-N) or Nestin-CreERT2;R26R-lacZ (D,I,J) stained for ␤-gal activity (BD,K-N) or double-label immunofluorescence for ␤-gal (green) and NeuN
(red) (E,G,I) or APC (red) (F,H,J). In Ascl1-CreERTM;R26R-lacZ mice,
activation of Cre by tamoxifen at E10.5 results in X-gal labeled cells
largely restricted to the dorsal horn gray matter (B) in cells that co-label
with the neuronal marker NeuN (E, arrows). Activation of Cre at E15.5
results in X-gal labeled cells largely restricted to white matter regions
(C) in cells that co-label with the oligodendrocyte marker APC (H,
arrows). By contrast, in Nestin-CreERT2;R26R-lacZ, activation of Cre at
E10.5 results in X-gal labeled cells in both gray and white matter
throughout the dorsoventral axis (D) and cells co-label with both NeuN
and APC (I,J, arrows).
DEVELOPMENT
Ascl1 defines lineage-restricted precursors
RESEARCH ARTICLE
and astrocytes (reviewed by Wiese et al., 2004). By contrast to what
was seen with the Ascl1-CreERTM strain, activation of Cre in Nestinexpressing cells at E10.5 and analysis at P30 resulted in X-gal
stained cells in both gray and white matter (Fig. 4D). Consistent with
the presence of Nestin in neural progenitor cells in the ventricular
zone, the lineage-traced cells co-labeled with the neuronal marker
NeuN, the oligodendrocyte marker APC or the astrocytic marker
GFAP (Fig. 4I,J and data not shown).
The second experimental paradigm examined early time points
after tamoxifen induction to determine if labeled cells could be
detected within cycling ventricular zone cells. R26R-stop-YFP
females crossed to Ascl1-CreERTM or Nestin-CreERT2 were treated
with tamoxifen at 10.5 dpc and embryos were harvested 24 hours
later. Using Nestin-CreERT2, YFP+ cells were found scattered
throughout the neural tube, present both in mitotically active cells in
the ventricular zone, as assessed by the cell cycle protein (Ki67+),
and postmitotic cells in the mantle zone (Ki67–) (Fig. 5C,C⬘). By
contrast, using Ascl1-CreERTM, YFP+ cells were found almost
exclusively in the mantle zone, and they never co-labeled with Ki67
or incorporated BrdU (Fig. 5A,A⬘; data not shown). The absence of
labeled cells in the ventricular zone was also noted in the Ascl1CreERTM; R26R-stop-LacZ timecourse (see Fig. 3A⬘-D⬘). Thus,
within the activation and detection limits of these Cre reporter
systems, cells expressing Ascl1, and thus, CreERTM, rapidly lose
progenitor cell identity. Taken together, these results are consistent
with the hypothesis that Ascl1+ cells, at least cells with high levels
of Ascl1, do not define progenitors in the ventricular zone common
to both neurons and oligodendrocytes but rather define neuronalrestricted precursors during neurogenic periods, and
oligodendrocyte-restricted precursors later during gliogenesis.
Ascl1 facilitates restriction of progenitor cells to
the neuronal lineage during neurogenesis
It is known that Ascl1 functions in neuron differentiation and
neuron specification in mouse and chick spinal neural tubes
(Helms et al., 2005; Nakada et al., 2004; Torii et al., 1999). Here
we address the role of Ascl1 in neuron-restricted precursors (~E11
marked cells) by following their fate in an Ascl1 null background.
or
Ascl1Ascl1-CreERTM;R26R-stop-YFP;Ascl1+/+
CreERTM;R26R-stop-YFP;Ascl1–/–embryos were treated with
tamoxifen at E10.5 and the characteristics of the YFP+ cells were
examined at E11.5 and 17.5 (Figs 5, 6). As reported in the previous
section, the recombined cells expressing YFP were postmitotic and
found lateral to the ventricular zone as soon as they could be
detected (Fig. 5A,A⬘). By contrast, in the Ascl1 mutant, the YFP+
cells aberrantly persisted in the ventricular zone, and some of these
cells remained in the cell cycle (Fig. 5B,B⬘). We next examined
whether the fate of these cells was altered in later development. As
the Ascl1 null is neonatal lethal (Guillemot et al., 1993), we
harvested embryos at E17.5. Normally most YFP+ cells generated
from the E10.5 tamoxifen treatment coexpressed NeuN, a neuronal
marker (88%; Fig. 6A, graph). Only rarely, if at all, did the YFP+
cells express markers for oligodendrocytes (Sox10+ or Olig2+; Fig.
6B,E, graph), astrocytes (GFAP+ or Glast+; Fig. 6C,D) or
mitotically active cells (BrdU+ or Ki67+; Fig. 6F, and data not
shown). By contrast, YFP+ cells in the Ascl1 null were less likely
to become neurons (54% NeuN+; Fig. 6A⬘) and more likely to
coexpress markers of the other cell identities (Fig. 6B⬘-F⬘). The
percentage of YFP+ cells coexpressing Olig2 and Glast increased
from essentially zero to 16 and 22%, respectively (Fig. 6D⬘,E⬘).
The Olig2 cells probably represent immature oligodendrocytes, as
there was no increase in Sox10 (Fig. 6B⬘). Likewise, the increase
Development 134 (2)
Fig. 5. Ascl1-expressing cells rapidly exit the cell cycle and move
laterally out of the ventricular zone. Immunofluorescence with
antibodies to YFP (green) and the cell cycle marker Ki67 (red) on neural
tube sections from Ascl1-CreERTM;R26R-YFP transgenic embryos with
either Ascl1 wild-type (A,A⬘) or Ascl1 null (B,B⬘), or NestinCreERT2;R26R-YFP transgenic embryos (C,C⬘). Tamoxifen induction was
initiated at E10.5 and expression was examined 24 hours later at E11.5.
A⬘-C⬘ are higher magnification images of comparable regions boxed in
A-C. (A,A’) YFP labeled cells in Ascl1-CreERTM;R26R-YFP do not co-label
with Ki67. (B,B⬘) In the absence of Ascl1, YFP and Ki67 co-labeled cells
are found in the ventricular zone (B⬘, arrowheads). (C,C⬘) By contrast,
some YFP labeled cells in Nestin-CreERT2;R26R-YFP co-label with Ki67
and are found in the ventricular zone (C⬘, arrowheads).
in YFP+ cells expressing Glast probably represents immature
astrocytes, as they are largely postmitotic, and thus not progenitor
cells (only 1.8 and 0.63% of YFP+ cells were BrdU+ or Ki67+,
respectively; Fig. 6F⬘, graph), and only a small percentage of YFP+
cells labeled with the astrocyte marker GFAP+ (2%; Fig. 6C⬘). This
shift in the fate of cells in the Ascl1 null from mature neurons to
cells expressing immature glia markers supports a role for Ascl1
for efficient differentiation of progenitors to a neuronal lineage
during neurogenesis.
DISCUSSION
There have been tremendous advances in the past few years using
time-lapse imaging to describe the behavior of cells in the vertebrate
neural tube as they proliferate and differentiate into neurons
(Haubensak et al., 2004; Miyata et al., 2004; Noctor et al., 2004).
These elegant studies have identified radial glia as neuronal
progenitor cells, and have characterized division patterns, migration
properties and cell-type identity of daughter cells in vivo. The next
advances must be in identifying the molecules controlling these
processes. It is within this context that we now place the neural
differentiation gene Ascl1. Ascl1 is crucial for regulating neural
differentiation in multiple regions of the central and peripheral
nervous systems. The function for Ascl1 in neuronal differentiation
and specification during embryonic stages has been clearly
demonstrated (reviewed by Bertrand et al., 2002). Because of the
sequential nature of neurogenesis and gliogenesis, and the existence
of common progenitor cells for neurons and oligodendrocytes, an
independent role for Ascl1 in oligodendrogenesis in neural tube has
not been demonstrated. Here we take advantage of the temporal
separation of neurogenesis and gliogenesis in the embryonic spinal
cord to gain more precision in identifying the stage that Ascl1 is
present. We found that Ascl1-expressing cells detected early in the
Ascl1-CreERTM transgenic line did not mark common progenitor
cells but rather were restricted to neuronal lineages. Later, Ascl1-
DEVELOPMENT
290
expressing cells were generated that were restricted to the
oligodendrocyte lineage. Our results do not eliminate the possibility
that there is an earlier, possibly lower level, expression of Ascl1 in
cells that are retained in the ventricular zone but are not detected by
our genetic marking strategy. Nevertheless, our conclusions for
Ascl1 are analogous to that made for Olig1-expressing cells in the
ventral neural tube (Wu et al., 2006). In that case, ablating Olig1expressing cells early eliminated motoneurons but did not preclude
the appearance of Olig2 progenitor cells in the ventricular zone,
suggesting that these cells are newly born. Thus, newly generated
Ascl1 and Olig1 cells arise within the ventricular zone of the neural
tube over extended embryonic periods.
Fig. 6. Ascl1 facilitates restriction of progenitor cells to the
neuronal lineage during neurogenesis. Ascl1-CreERTM;R26R-YFP
transgenic spinal cords, either Ascl1 wild-type (A-F) or Ascl1 null (A⬘F⬘), were examined at E17.5 after tamoxifen induction of Cre at E10.5.
Double-label immunofluorescence for YFP (green) and for markers of
neurons (NeuN; A,A⬘), oligodendrocytes (Sox10; B,B⬘), astrocytes (GFAP;
C,C⬘), neural progenitors or astrocytes (Glast; D,D⬘), oligodendrocyte
progenitors (Olig2; E,E⬘) or proliferation (BrdU incorporation; F,F⬘). The
fate of E10.5 Ascl1-expressing cells shifts from almost exclusively
neurons (A, arrowheads) to cells with astrocytic or immature markers
such as GFAP, Glast, Olig2 and BrdU in the Ascl1 null (C⬘-F⬘,
arrowheads). Quantification of these experiments is shown in the graph
as the percentage of the total YFP-expressing cells that coexpress each
marker. At least nine sections from three different embryos of each
genotype were used. This resulted in over 350 total YFP+ cells counted
in experiments for each marker.
RESEARCH ARTICLE
291
Ascl1 in neuronal lineage-restricted precursor
cells
Progenitor cells in the ventricular zone of the vertebrate neural tube
undergo a growth phase to increase the population of progenitor cells
followed by divisions that begin to generate neurons. This process
involves asymmetric divisions that give rise to differentiated cells
and a progenitor, and symmetric divisions that give rise to two
differentiated cells (Roegiers and Jan, 2004; Wodarz and Huttner,
2003). However, the contribution of these distinct modes of division
to different regions of the developing vertebrate nervous system is
not clear in many cases, with most studies focusing only on cortical
development (Miyata et al., 2004; Noctor et al., 2004; Qian et al.,
1998; Qian et al., 2000). In more caudal regions of the CNS such as
hindbrain, there is little evidence for asymmetric divisions, but rather
a majority of neurons are derived from symmetric divisions yielding
two neurons (Lyons et al., 2003). Our data suggest that during
neurogenesis Ascl1 is present in cells undergoing their final division,
and this division is symmetrical with respect to neural cell fate, with
both daughters becoming neurons. This is demonstrated by
activation of Cre in Ascl1-CreERTM mice during neurogenesis
(E10.5). Analysis of these animals within 24 hours of tamoxifen
treatment revealed that the lineage-marked cells were located lateral
to the ventricular zone and did not label with Ki67 (Fig. 5), and at
P30 the lineage reporter only labeled neurons (Fig. 4). As Ascl1
overlaps with BrdU-incorporating cells in the ventricular zone
(Helms et al., 2005), these results are consistent with Ascl1 being
present in cells that are undergoing terminal symmetrical divisions
to give rise to neurons.
We demonstrate that Ascl1 is required for efficient neuronal
differentiation. This supports conclusions from previous studies
(Casarosa et al., 1999; Horton et al., 1999; Torii et al., 1999), but
here we follow the fate of the mutant cell into the late-stage embryo.
Ascl1 mutant cells identified at E10.5 were less likely to become
neurons (30% reduction) than if Ascl1 was present. The neurons
that did develop may have used an alternative neural bHLH factor
such as Neurog1, Neurog2 and Neurod4 (previously Ngn1, Ngn2
and Math3, respectively) and if so the specification of neuronal type
may be altered, as suggested by previous studies (Helms et al.,
2005; Kriks et al., 2005; Mizuguchi et al., 2006; Nakada et al.,
2004; Wildner et al., 2006). In addition to the reduction in the
percentage of YFP+ cells that became neurons, in the Ascl1 null
some cells were maintained in an aberrant progenitor state – as
defined by BrdU incorporation and expression of Ki67, and
expression of Olig2 in the absence of Sox10 – or aberrantly became
astrocytic as defined by Glast and GFAP expression (Fig. 6). The
simplest interpretation of these data is that the mutant cells have a
diminished capacity to differentiate properly. However, this
interpretation is complicated by the fact that the loss of Ascl1
results in an increase in expression from the Ascl1 locus due to
negative feedback (Horton et al., 1999; Meredith and Johnson,
2000). Thus, in the Ascl1 null, we may be detecting upregulation of
Cre in cells not normally expressing Ascl1.
The specific pathways controlled by Ascl1 continue to be an open
question. The best-characterized downstream effect of Ascl1 activity
is the increase in expression of the Notch ligands Delta1 and Delta3,
which should activate Notch signaling in adjacent cells and suppress
differentiation (reviewed by Yoon and Gaiano, 2005). What other
changes in gene expression are controlled by Ascl1 to induce the cell
to differentiate? The transcriptional targets for Ascl1 may be the
same in both neurogenesis and oligodendrogenesis; however, it is
also possible that the downstream targets change during these two
processes based on the context-dependent co-factors.
DEVELOPMENT
Ascl1 defines lineage-restricted precursors
RESEARCH ARTICLE
Ascl1 in oligodendrocyte lineage-restricted
precursor cells
Our results demonstrate Ascl1-expressing cells in the spinal
neural tube give rise to oligodendrocytes throughout the spinal
cord dorsally and ventrally, with an enrichment in the dorsal
funiculus. Furthermore, the Ascl1-derived oligodendrocytes begin
appearing after E14.5, suggesting that they may represent the latedeveloping oligodendrocytes originating from the dorsal neural
tube rather than the early oligodendrocytes generated as early as
E12.5 from more ventral regions (reviewed by Cai et al., 2005;
Fogarty et al., 2005; Richardson et al., 2006; Vallstedt et al.,
2005). Expression of Pax7 and Ascl1 in a subset of the Olig2 cells
at E14.5 suggested that the dorsal oligodendrocytes originate from
dP3, dP4 and dP5 (Cai et al., 2005), progenitor domains defined
by Ascl1 (Gross et al., 2002; Helms et al., 2005; Müller et al.,
2002). We used a newly generated antibody to demonstrate that at
E16.5 Ascl1 was not restricted to dorsal domains but rather was
detected throughout the ventricular zone and in scattered cells of
the gray and white matter. This suggests that the oligodendrocytes
derived from these cells are late formed but are not necessarily
restricted to a dorsal origin. However, genetic fate mapping of
another gene, Msx3, which is restricted to the dorsal neural tube,
resulted in oligodendrocytes concentrated in the dorsal funiculus
(M. Fogarty, Thesis, University of London, 2005), similar to that
seen here for Ascl1. This contrasts with the distribution of
oligodendrocytes derived from nestin-expressing cells from ~E11
(Fig. 4C,D), illustrating the distinct temporal and spatial origins
of these populations.
The function of Ascl1 in the oligodendrocyte lineage in the spinal
cord has not been addressed in the Ascl1 mutant. Discerning the
phenotype in the oligodendrocyte population is complicated by the
disruption of the progenitor domain at earlier stages (Figs 5, 6).
However, a role for Ascl1 in the development of the oligodendrocyte
lineage in the postnatal brain has recently been examined (Parras et
al., 2004). The SVZ in the postnatal forebrain is the source for the
rostral migratory stream (RMS), which supplies the olfactory bulb
with neurons and oligodendrocytes (Marshall et al., 2003; Pencea
and Luskin, 2003). Recently, it was demonstrated using a short-term
lineage-tracing method that Ascl1 in the SVZ and RMS identifies
the transit amplifying cells that give rise to these cells (Parras et al.,
2004). Furthermore, in the Ascl1 mutant, neurosphere cultures
derived from this region are altered in their potential; they have a
decreased ability to generate both the neurons and oligodendrocytes,
whereas there is an increase in generation of astrocytes (Parras et al.,
2004). The precise function of Ascl1 in the oligodendrocyte lineage
in embryonic and postnatal stages remains to be determined.
Understanding the full repertoire of Ascl1 function in nervous
system development will require dissection of these functions in a
conditional Ascl1 knockout paradigm.
The results presented here place Ascl1 distinctly in cells that
are transitioning from cycling progenitor or stem cells to
progenitors with limited potential for cell division and restrictions
on the cell types formed. Importantly, oligodendrocytes derived
from the Ascl1 lineage may be more extensive than previously
appreciated. Indeed, Ascl1 cannot be thought of as simply a
neuronal differentiation factor, but rather as a more general
differentiation factor, and the cell type that arises depends on the
stage at which Ascl1 is expressed.
We thank Drs C. Stiles and R. Lu for anti-Olig2 antisera, and Dr M. Wegner for
anti-Sox10 antisera. We acknowledge the outstanding technical assistance
from Mr A. Omer-Abdalla for generating the Ascl1-GIC and Ascl1-CreERTM
transgenic mice, and from Ms C. Weldon and J. Dumas for genotyping. We
Development 134 (2)
are grateful to Drs R. Lu, G. Fishell and F. Guillemot for helpful discussions and
critical reading of the manuscript. This work was supported by the NIH (RO1
NS32817 to J.E.J., RO1 DA016765 to A.J.E.) and CIHR (D.C.L.).
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/134/2/285/DC1
References
Akagi, T., Inoue, T., Miyoshi, G., Bessho, Y., Takahashi, M., Lee, J. E.,
Guillemot, F. and Kageyama, R. (2004). Requirement of multiple basic helixloop-helix genes for retinal neuronal subtype specification. J. Biol. Chem. 279,
28492-28498.
Beech, R. D., Cleary, M. A., Treloar, H. B., Eisch, A. J., Harrist, A. V., Zhong,
W., Greer, C. A., Duman, R. S. and Picciotto, M. R. (2004). Nestin
promoter/enhancer directs transgene expression to precursors of adult
generated periglomerular neurons. J. Comp. Neurol. 475, 128-141.
Bertrand, N., Castro, D. S. and Guillemot, F. (2002). Proneural genes and the
specification of neural cell types. Nat. Rev. Neurosci. 3, 517-530.
Birren, S. J., Lo, L. and Anderson, D. J. (1993). Sympathetic neuroblasts undergo
a developmental switch in trophic dependence. Development 119, 597-610.
Blaugrund, E., Pham, T. D., Tennyson, V. M., Lo, L., Sommer, L., Anderson, D.
J. and Gershon, M. D. (1996). Distinct subpopulations of enteric neuronal
progenitors defined by time of development, sympathoadrenal lineage markers
and Mash-1-dependence. Development 122, 309-320.
Cai, J., Qi, Y., Hu, X., Tan, M., Liu, Z., Zhang, J., Li, Q., Sander, M. and Qiu, M.
(2005). Generation of oligodendrocyte precursor cells from mouse dorsal spinal
cord independent of Nkx6 regulation and Shh signaling. Neuron 45, 41-53.
Casarosa, S., Fode, C. and Guillemot, F. (1999). Mash1 regulates neurogenesis
in the ventral telencephalon. Development 126, 525-534.
Cau, E., Gradwohl, G., Fode, C. and Guillemot, F. (1997). Mash1 activates a
cascade of bHLH regulators in olfactory neuron progenitors. Development 124,
1611-1621.
Farah, M. H., Olson, J. M., Sucic, H. B., Hume, R. I., Tapscott, S. J. and Turner,
D. L. (2000). Generation of neurons by transient expression of neural bHLH
proteins in mammalian cells. Development 127, 693-702.
Feil, R., Brocard, J., Mascrez, B., LeMeur, M., Metzger, D. and Chambon, P.
(1996). Ligand-activated site-specific recombination in mice. Proc. Natl. Acad.
Sci. USA 93, 10887-10890.
Fogarty, M., Richardson, W. D. and Kessaris, N. (2005). A subset of
oligodendrocytes generated from radial glia in the dorsal spinal cord.
Development 132, 1951-1959.
Gokhan, S., Marin-Husstege, M., Yung, S. Y., Fontanez, D., CasacciaBonnefil, P. and Mehler, M. F. (2005). Combinatorial profiles of
oligodendrocyte-selective classes of transcriptional regulators differentially
modulate myelin basic protein gene expression. J. Neurosci. 25, 8311-8321.
Gowan, K., Helms, A. W., Hunsaker, T. L., Collisson, T., Ebert, P. J., Odom, R.
and Johnson, J. E. (2001). Crossinhibitory activities of Ngn1 and Math1 allow
specification of distinct dorsal interneurons. Neuron 31, 219-232.
Gross, M. K., Dottori, M. and Goulding, M. (2002). Lbx1 specifies
somatosensory association interneurons in the dorsal spinal cord. Neuron 34,
535-549.
Guillemot, F. and Joyner, A. (1993). Expression of murine Achaete-Scute and
Notch homologues in the developing central nervous system. Mech. Dev. 42,
171-185.
Guillemot, F., Lo, L. C., Johnson, J. E., Auerbach, A., Anderson, D. J. and
Joyner, A. L. (1993). Mammalian achaete-scute homolog 1 is required for the
early development of olfactory and autonomic neurons. Cell 75, 463-476.
Haubensak, W., Attardo, A., Denk, W. and Huttner, W. B. (2004). Neurons
arise in the basal neuroepithelium of the early mammalian telencephalon: a
major site of neurogenesis. Proc. Natl. Acad. Sci. USA 101, 3196-3201.
Hayashi, S. and McMahon, A. P. (2002). Efficient recombination in diverse
tissues by a tamoxifen-inducible form of Cre: a tool for temporally regulated
gene activation/inactivation in the mouse. Dev. Biol. 244, 305-318.
Helms, A. W., Battiste, J., Henke, R. M., Nakada, Y., Simplicio, N.,
Guillemot, F. and Johnson, J. E. (2005). Sequential roles for Mash1 and Ngn2
in the generation of dorsal spinal cord interneurons. Development 132, 27092719.
Hirsch, M. R., Tiveron, M. C., Guillemot, F., Brunet, J. F. and Goridis, C.
(1998). Control of noradrenergic differentiation and Phox2a expression by
MASH1 in the central and peripheral nervous system. Development 125, 599608.
Hogan, B., Costantini, F. and Lacy, E. (1986). Manipulating the Mouse Embryo:
A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory
Press.
Horton, S., Meredith, A., Richardson, J. A. and Johnson, J. E. (1999). Correct
coordination of neuronal differentiation events in ventral forebrain requires the
bHLH factor MASH1. Mol. Cell. Neurosci. 14, 355-369.
Huttner, W. B. and Kosodo, Y. (2005). Symmetric versus asymmetric cell division
DEVELOPMENT
292
during neurogenesis in the developing vertebrate central nervous system. Curr.
Opin. Cell Biol. 17, 648-657.
Indra, A. K., Warot, X., Brocard, J., Bornert, J. M., Xiao, J. H., Chambon, P.
and Metzger, D. (1999). Temporally-controlled site-specific mutagenesis in the
basal layer of the epidermis: comparison of the recombinase activity of the
tamoxifen-inducible Cre-ER(T) and Cre-ER(T2) recombinases. Nucleic Acids Res.
27, 4324-4327.
Johnson, J. E., Birren, S. J. and Anderson, D. J. (1990). Two rat homologues of
Drosophila achaete-scute specifically expressed in neuronal precursors. Nature
346, 858-861.
Kondo, T. and Raff, M. (2000). Basic helix-loop-helix proteins and the timing of
oligodendrocyte differentiation. Development 127, 2989-2998.
Kriks, S., Lanuza, G. M., Mizuguchi, R., Nakafuku, M. and Goulding, M.
(2005). Gsh2 is required for the repression of Ngn1 and specification of dorsal
interneuron fate in the spinal cord. Development 132, 2991-3002.
Lendahl, U., Zimmerman, L. B. and McKay, R. D. G. (1990). CNS stem cells
express a new class of intermediate filament protein. Cell 60, 585-595.
Li, S., Misra, K., Matise, M. P. and Xiang, M. (2005). Foxn4 acts synergistically
with Mash1 to specify subtype identity of V2 interneurons in the spinal cord.
Proc. Natl. Acad. Sci. USA 102, 10688-10693.
Lo, L.-C., Johnson, J. E., Wuenschell, C. W., Saito, T. and Anderson, D. J.
(1991). Mammalian achaete-scute homolog 1 is transiently expressed by
spatially-restricted subsets of early neuroepithelial and neural crest cells. Genes
Dev. 5, 1524-1537.
Lyons, D. A., Guy, A. T. and Clarke, J. D. (2003). Monitoring neural progenitor
fate through multiple rounds of division in an intact vertebrate brain.
Development 130, 3427-3436.
Ma, Q., Sommer, L., Cserjesi, P. and Anderson, D. J. (1997). Mash1 and
neurogenin1 expression patterns define complementary domains of
neuroepithelium in the developing CNS and are correlated with regions
expressing notch ligands. J. Neurosci. 17, 3644-3652.
Ma, Q., Chen, Z., del Barco Barrantes, I., de la Pompa, J. L. and Anderson, D.
J. (1998). neurogenin1 is essential for the determination of neuronal precursors
for proximal cranial sensory ganglia. Neuron 120, 469-482.
Marshall, C. A., Suzuki, S. O. and Goldman, J. E. (2003). Gliogenic and
neurogenic progenitors of the subventricular zone: who are they, where did they
come from, and where are they going? Glia 43, 52-61.
Meredith, A. and Johnson, J. E. (2000). Negative regulation of Mash1 expression
in CNS development. Dev. Biol. 222, 336-346.
Miyata, T., Kawaguchi, A., Saito, K., Kawano, M., Muto, T. and Ogawa, M.
(2004). Asymmetric production of surface-dividing and non-surface-dividing
cortical progenitor cells. Development 131, 3133-3145.
Mizuguchi, R., Kriks, S., Cordes, R., Gossler, A., Ma, Q. and Goulding, M.
(2006). Ascl1 and Gsh1/2 control inhibitory and excitatory cell fate in spinal
sensory interneurons. Nat. Neurosci. 9, 770-778.
Müller, T., Brohmann, H., Pierani, A., Heppenstall, P. A., Lewin, G. R., Jessell,
T. M. and Birchmeier, C. (2002). The homeodomain factor Lbx1 distinguishes
two major programs of neuronal differentiation in the dorsal spinal cord. Neuron
34, 551-562.
Müller, T., Anlag, K., Wildner, H., Britsch, S., Treier, M. and Birchmeier, C.
(2005). The bHLH factor Olig3 coordinates the specification of dorsal neurons in
the spinal cord. Genes Dev. 19, 733-743.
Nakada, Y., Hunsaker, T. L., Henke, R. M. and Johnson, J. E. (2004). Distinct
domains within Mash1 and Math1 are required for function in neuronal
differentiation versus cell-type specification. Development 131, 1319-1330.
Noctor, S. C., Martinez-Cerdeno, V., Ivic, L. and Kriegstein, A. R. (2004).
Cortical neurons arise in symmetric and asymmetric division zones and migrate
through specific phases. Nat. Neurosci. 7, 136-144.
Parras, C. M., Galli, R., Britz, O., Soares, S., Galichet, C., Battiste, J., Johnson,
J. E., Nakafuku, M., Vescovi, A. and Guillemot, F. (2004). Mash1 specifies
neurons and oligodendrocytes in the postnatal brain. EMBO J. 23, 4495-4505.
Pattyn, A., Simplicio, N., van Doorninck, J. H., Goridis, C., Guillemot, F. and
Brunet, J. F. (2004). Ascl1/Mash1 is required for the development of central
serotonergic neurons. Nat. Neurosci. 7, 589-595.
RESEARCH ARTICLE
293
Pencea, V. and Luskin, M. B. (2003). Prenatal development of the rodent rostral
migratory stream. J. Comp. Neurol. 463, 402-418.
Petersen, P. H., Zou, K., Hwang, J. K., Jan, Y. N. and Zhong, W. (2002).
Progenitor cell maintenance requires numb and numblike during mouse
neurogenesis. Nature 419, 929-934.
Porteus, M. H., Bulfone, A., Liu, J.-K., Puelles, L., Lo, L.-C. and Rubenstein, J.
L. R. (1994). DLX-2, MASH-1, and MAP-2 expression and bromodeoxyuridine
incorporation define molecularly distinct cell populations in the embryonic
mouse forebrain. J. Neurosci. 14, 6370-6383.
Qian, X., Goderie, S. K., Shen, Q., Stern, J. H. and Temple, S. (1998). Intrinsic
programs of patterned cell lineages in isolated vertebrate CNS ventricular zone
cells. Development 125, 3143-3152.
Qian, X., Shen, Q., Goderie, S. K., He, W., Capela, A., Davis, A. A. and
Temple, S. (2000). Timing of CNS cell generation: a programmed sequence of
neuron and glial cell production from isolated murine cortical stem cells. Neuron
28, 69-80.
Richardson, W. D., Kessaris, N. and Pringle, N. (2006). Oligodendrocyte wars.
Nat. Rev. Neurosci. 7, 11-18.
Roegiers, F. and Jan, Y. N. (2004). Asymmetric cell division. Curr. Opin. Cell Biol.
16, 195-205.
Rowitch, D. H. (2004). Glial specification in the vertebrate neural tube. Nat. Rev.
Neurosci. 5, 409-419.
Soriano, P. (1999). Generalized lacZ expression with the ROSA26 Cre reporter
strain. Nat. Genet. 21, 70-71.
Srinivas, S., Watanabe, T., Lin, C. S., William, C. M., Tanabe, Y., Jessell, T. M.
and Costantini, F. (2001). Cre reporter strains produced by targeted insertion
of EYFP and ECFP into the ROSA26 locus. BMC Dev. Biol. 1, 4.
Torii, M., Matsuzaki, F., Osumi, N., Kaibuchi, K., Nakamura, S., Casarosa, S.,
Guillemot, F. and Nakafuku, M. (1999). Transcription factors Mash-1 and
Prox-1 delineate early steps in differentiation of neural stem cells in the
developing central nervous system. Development 126, 443-456.
Vallstedt, A., Klos, J. M. and Ericson, J. (2005). Multiple dorsoventral origins of
oligodendrocyte generation in the spinal cord and hindbrain. Neuron 45, 55-67.
Verma-Kurvari, S., Savage, T., Gowan, K. and Johnson, J. E. (1996). Lineagespecific regulation of the neural differentiation gene MASH1. Dev. Biol. 180,
605-617.
Verma-Kurvari, S., Savage, T., Smith, D. and Johnson, J. E. (1998). Multiple
elements regulate Mash1 expression in the developing CNS. Dev. Biol. 197, 106116.
Wang, S., Sdrulla, A., Johnson, J. E., Yokota, Y. and Barres, B. A. (2001). A
role for the helix-loop-helix protein Id2 in the control of oligodendrocyte
development. Neuron 29, 603-614.
Wiese, C., Rolletschek, A., Kania, G., Blyszczuk, P., Tarasov, K. V., Tarasova,
Y., Wersto, R. P., Boheler, K. R. and Wobus, A. M. (2004). Nestin expression
– a property of multi-lineage progenitor cells? Cell. Mol. Life Sci. 61, 25102522.
Wildner, H., Muller, T., Cho, S. H., Brohl, D., Cepko, C. L., Guillemot, F. and
Birchmeier, C. (2006). dILA neurons in the dorsal spinal cord are the product of
terminal and non-terminal asymmetric progenitor cell divisions, and require
Mash1 for their development. Development 133, 2105-2113.
Wodarz, A. and Huttner, W. B. (2003). Asymmetric cell division during
neurogenesis in Drosophila and vertebrates. Mech. Dev. 120, 1297-1309.
Wu, S., Wu, Y. and Capecchi, M. R. (2006). Motoneurons and oligodendrocytes
are sequentially generated from neural stem cells but do not appear to share
common lineage-restricted progenitors in vivo. Development 133, 581-590.
Yang, X. W., Model, P. and Heintz, N. (1997). Homologous recombination based
modification in Escherichia coli and germline transmission in transgenic mice of
a bacterial artificial chromosome. Nat. Biotechnol. 15, 859-865.
Yoon, K. and Gaiano, N. (2005). Notch signaling in the mammalian central
nervous system: insights from mouse mutants. Nat. Neurosci. 8, 709-715.
Zimmerman, L., Lendahl, U., Cunningham, M., McKay, R., Parr, B., Gavin, B.,
Mann, J., Vassileva, G. and McMahon, A. (1994). Independent regulatory
elements in the nestin gene direct transgene expression to neural stem cells or
muscle precursors. Neuron 12, 11-24.
DEVELOPMENT
Ascl1 defines lineage-restricted precursors