From www.bloodjournal.org
by guest
on June
18, 2017.
For personal
use only.
Blood First Edition
Paper, prepublished
online
June
1, 2004;
DOI 10.1182/blood-2004-01-0247
1
Revised manuscript MS# 2004-01-0247
Roles of MITF for Development of Mast Cells in Mice: Effects on Both Precursors and
Tissue Environments
Eiichi Morii,1 Keisuke Oboki,1 Katsuhiko Ishihara,2 Tomoko Jippo,3 Toshio Hirano2 and
Yukihiko Kitamura1
Department of Pathology1 and Department of Molecular Oncology,2 Medical
School/Graduate School of Frontier Bioscience, Osaka University, Suita, Osaka, Japan, and
Department of Physiology, Senri Kinran University Faculty of Human Life Sciences, Suita,
Osaka, Japan3
Running title: Differentiation of mast cells in mice
Supported by grants from the Ministry of Education, Culture, Sports, Science and
Technology, and from the Osaka Cancer Society.
Corresponding author: Eiichi Morii, MD, Department of Pathology, Room C2, Osaka
University Medical School, Yamada-oka 2-2, Suita 565-0871, Japan
Phone: 81-6-6879-3721; FAX: 81-6-6879-3729
Copyright (c) 2004 American Society of Hematology
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
2
E-mail: [email protected]
Total Text Word Counts 3988 words
Abstract Word Counts 188 words
Scientific Heading: Hematopoiesis
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
3
Abstract
The mutant tg/tg mice, which do not express mi transcription factor (MITF), lack mast cells in
most tissues. Since MITF is expressed in both mast cells and tissues where mast cells
develop, there is a possibility that the tg/tg mice may show abnormalities in both mast cell
precursors and tissue environments. We examined this possibility by bone marrow and skin
transplantation. When bone marrow cells of tg/tg mice were transplanted to W/Wv mice that
possess normal tissue environment, mast cells did not develop in all tissues examined. The
number of developing mast cells in the skin of W/Wv mice was much lower when grafted to
tg/tgrecipients than when grafted to normal (+/+) recipients. These results indicated that mast
cell precursors of tg/tg mice were defective. When bone marrow cells of +/+ mice were
transplanted, the number of developing mast cells was significantly lower in examined tissues
of tg/tg recipients than in those of W/Wv recipients, suggesting that the tissue environment for
mast cell development was defective in tg/tg mice. MITF appeared essential for the function
of both mast cell precursors and tissue environments for their development.
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
4
Introduction
The products encoded by three mouse loci influence the development of mast cells. Kit
ligand (KitL) is the most important growth factor for mast cells and is encoded by Sl locus.1-4
KIT is the receptor for KitL and is encoded by W locus.1,5,6 The mutant Sl/Sld and W/Wv mice,
which are deficient in KitL and KIT respectively, lack mast cells in all examined tissues. The
third product is mi transcription factor (MITF) that is encoded bymi locus. MITF is a basic
helix-loop-helix leucine zipper transcription factor.7-9 The mutant tg/tg mice, which do not
express MITF due to a transgene insertion to the promoter region of MITF gene, lack mast
cells in the peritoneal cavity, mesentery, stomach and spleen.10 In spite of the lack of mast cells
in most tissues, the dermis of tg/tg mice has a decreased but recognizable number of mast
cells, i.e., one third that of normal (+/+) littermates.11,12
KitL is expressed in tissues where mast cells develop, and KIT is expressed in mast cells and
their precursors. Therefore, Sl/Sld mice have a defect in tissue environment for mast cell
development, whereas W/Wv mice have a defect in mast cell precursors.1,2,5 MITF is
expressed in both mast cells and tissues where mast cells develop.10 This suggested that MITF
regulated not only the transcription of genes expressed in mast cells or mast cell precursors but
also the transcription of genes expressed in the tissue environment. The tg/tg mice appear to
show abnormalities in both mast cell precursor and tissue environment. As for the mast cell
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
5
abnormality, we reported that the production of various molecules, including KIT and
SgIGSF, a new mast cell adhesion molucule, was deficient in mast cells of tg/tg mice.11-22 The
mast cell precursors of tg/tg mice have not been well characterized yet, especially in vivo
conditions. As for the tissue environment, we recently found the phenomenon suggesting
defects in tg/tg mice. When bone marrow-derived cultured mast cells (BMMCs) of +/+ mice
were intraperitoneally injected, mast cells survived in the mesentery of W/Wv mice but not in
that of tg/tg mice. In the present study, we investigated defects in mast cell precursors and
tissue environments of tg/tg mice by bone marrow and skin transplantation.
Methods
Mice and cells. The original stock of VGA-9-tg/tg mice, in which the mouse vasopressinEscherichia coli -galactosidase transgene was integrated at the promoter region of the MITF
gene, was given by Dr. H. Arnheiter (National Institutes of Health, Bethesda, MD).7 The
VGA-9-tg/tg mice were maintained by consecutive backcrosses to our own C57BL/6 (B6)
and WB inbred colonies more than 15 generations. B6-tg/+ mice were crossed together, and
WB-tg/+ mice were crossed to B6-tg/+ mice. The resulting B6-tg/tg and (WB x B6) F1
(WBB6F1)-tg/tg mice were selected by their white coat color. B6-+/+, WBB6F1-W/Wv and
WBB6F1-+/+ mice were purchased from the Japan SLC (Hamamatsu, Japan). BMMCs
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
6
were obtained from bone marrow cells of WBB6F1-+/+ and -tg/tg mice as described
previously.35
Bone marrow transplantation. Radioflex 350 X-ray machine (Rigaku, Tokyo, Japan)
operated at 180 kV and 15 mA with 1-mm aluminum filter (0.885 Gy/min) was used. Mice
were kept in a polypropylene box during irradiation. Bone marrow cells (1.0 x 107) were
suspended in -minimal essential medium ( -MEM, ICN Biomedicals, Costa Mesa, CA),
and were injected intravenously to 2 Gy-irradiated WBB6F1-W/Wv miceor to 8 Gy-irradiated
WBB6F1-tg/tg mice. Irradiation dose of WBB6F1-W/Wv mice was reduced because they
were remarkably radiosensitive.23
Estimation of the origin of blood cells other than mast cells. Ten weeks after bone marrow
transplantation, mice were killed by decapitation after ether anesthesia. The hemoglobin
pattern in celluloseacetate electrophoresis was easily distinguished between WBB6F1 mice
(diffuse, Hbbd/Hbbs) and B6 mice (sharp, Hbbs/Hbbs).24 Then, we used this to identify the
origin of erythrocytes. Heparinized blood sample was washed with saline 5 times, and the
twice volume of distilled water and a half volume of toluene were added. After centrifugation,
the lower layer of this solution was mixed with the same volume of cystamine solution
containing 333.5 mM cystamine and 6.65 mM dithioerythritol, and electrophoresed on
celluloseacetate membrane (Toyo Roshi Ltd, Tokyo, Japan) in the TBE buffer containing 180
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
7
mM Tris, 100 mM boric acid and 2 mM EDTA (pH 8.9). Hemoglobin of B6 mice showed
only fast-migrating single hemoglobin, whereas hemoglobin of WBB6F1 mice showed three
bands: single hemoglobin was fastest, d-major hemoglobin intermediate, and d-minor
hemoglobin slowest.
B lymphocytes (IgM+) and macrophages (CD11b+) were obtained from spleen by using
magnetic cell sorting system (MACS, Miltenyi Biotec GmbH, Bergisch Gladbach,
Germany) according to the manufacturer’s instructions. T lymphocytes (Thy1.2+) and
granulocytes (Gr-1+) were also obtained by MACS from lymph nodes and bone marrow,
respectively. Genomic DNA was extracted from the separated cells using Wizard SV
genomic DNA purification kit (Promega, Madison, WI). PCR was carried out with the
genomic DNA as a template. The primers were as follows; 5’CTTTCGCCAGCTGGCGTAATAGCGAAGAGG and 5’CATTAAATGTGAGCGAGTAACAACCCGTCG for
galactosidase transgene, and 5’-
TAAAGACCTCTATGCCAACAC and 5’-CTCCTGCTTGCTGATCCACAT for actin gene.
Staining and counting of mast cells. Mast cell numbers in the peritoneal cavity, skin,
glandular stomach and mesentery were estimated as described previously.10 In brief, Tyrode's
buffer containing 0.1% gelatin (Sigma Chemical Co, St Louis, MO) was injected into the
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
8
peritoneal cavity, and the fluid containing the peritoneal cells was aspirated with a Pasteur
pipette. After centrifugation, the pellet was resuspended with the Tyrode's buffer, and the
peritoneal cells were attached to microscope slide with a Cytospin 2 centrifuge (Shandon,
Pittsburgh, PA). Pieces of dorsal skin and glandular stomach were removed and smoothed
onto a piece of the filter paper to keep them flat. Mesentery was stretched onto a microscope
slide. All specimens were fixed in Carnoy’s solution. The cytospin preparation of peritoneal
cells, the sections (3 µm thick) of skin and glandular stomach and the stretch preparations of
mesentery were stained with alcian blue and nuclear fast red.
Limiting dilution analysis of mast cell precursors. The principle of the method has been
described in detail.25 Bone marrow cells of WBB6F1-+/+ and -tg/tg mice were suspended in
MEM, to which India ink was added to mark the injection sites. Various numbers of cells in
0.05 mL medium were directly injected into the dorsal skin of WBB6F1-W/Wv mice. Five
weeks after injection, mice were killed by decapitation, and dorsal skin was peeled off. Each
injection site was identified as a blotted black spot. The skins of injection sites were attached to
filter paper to keep them flat, fixed in Carnoy’s solution, and embedded in paraffin. Serial
sections (25µm thick, cut parallel to the skin surface) were cut from the subcutaneous tissue
to the epithelium, and stained with alcian blue and nuclear fast red. All serial sections were
examined, and the injection cells were assumed to contain mast cell precursor(s) when a
group of more than 100 mast cells was found in at least one section. Concentration of mast
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
9
cell precursors was calculated from the proportion of injection sites at which such a group of
mast cells did not appear (defined as “proportion of nonappearance”) for various cell doses by
limiting dilution analysis according to Porter and Berry,26 and Breivik.27
Skin transplantation. A piece of skin about 25 x 25 mm in its full thickness, including
paniculus carnosus, was removed. A small piece (about 25 x 3 mm) was cut from the skin to
determine the number of mast cells before grafting. The remaining part of the skin was
grafted onto the back of the recipient in the rotation of 180 degree, and was kept in place by
wound clips.28 At various times after transplantation, mice were killed by decapitation after
ether anesthesia. The skin was removed, smoothed onto a piece of the filter paper to keep
them flat and were fixed in Carnoy’s solution. The skin sections (3 µm thick)were stained
with alcian blue and nuclear fast red, and the number of mast cells was counted. The grafted
skin was identified by the direction of hair.
In vitro colony formation. Methylcellulose culture was carried out according to the method
described by Nakahata et al.29 One mL of -MEM containing 4 x 104 bone marrow cells, 2 x
105 spleen or peripheral blood mononuculear cells or 5 x 102 BMMCs, 1% methylcellulose
(Sigma), 30% fetal calf serum (FCS, Nippon Bio-supp Center, Tokyo, Japan), 1% deionized
BSA, 10-4 M 2-mercaptoethanol (Sigma) was plated in 35 mm dishes. The medium
contained both 10 ng/mL IL-3 (recombinant mouse, R&D, Minneapolis, MN) and 50
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
10
ng/mL KitL (recombinant mouse, R&D), or 10 ng/mL IL-3 alone. Mast cell colonies were
counted on day 16. The colony forming assay using dispersed skin cells was described
previously.30 In brief, skin pieces were diced into fragments, and were incubated in Hanks’
balanced salt solution buffered with Hepes (10 mM, pH 7.4) containing collagenase (Sigma,
Type I, 1 mg/mL), hyaluronidase (Sigma, Type I, 1 mg/mL), and FCS (20%) for 2.5 hrs.
After the incubation, cell clusters were broken up by repeated aspiration through needles of
decreasing size. Then, the suspensions were passed through a nylon mesh, washed with MEM, and were plated in 35 mm dish as described above (1.0 x 105 cells per dish with the
medium containing 10 ng/mL IL-3 and 50 ng/mL KitL).
Flow cytometry. Mast cell colonies obtained from bone marrow cells or BMMCs were
harvested and washed once with cold phosphate buffered saline (PBS) containing 2% FCS
and 0.1% sodium azide. The cells were incubated with fluorescein isothiocyanate (FITC)conjugated rat anti-KIT antibody or its isotype control (BD Biosciences, San Jose, CA), and
then analyzed on a FACScan (BD Biosciences).
Proliferation assay. The response to KitL of BMMCs was determined by uptake of 3Hthymidine (TdT, Amersham Bioscience, Piscataway, NJ). BMMCs were cultured overnight
in 96 well-plate with various concentration of KitL and 10 ng/mL IL-3. Four hours before
harvesting, cells were pulsed with 1 µCi/well [3H]-TdT, harvested onto glass fiber filters, and
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
11
counted in a scintillation counter (Hewlett-Packerd Co, Palo Alto, CA).
Results
Bone marrow transplantation from and to tg/tg mice.
Bone marrow cells of B6-+/+ and B6-tg/tg mice were transplanted to irradiated WBB6F1W/Wv mice. Ten weeks after transplantation, we confirmed donor origin of erythrocytes in the
recipient WBB6F1-W/Wv mice. Hemoglobin of B6 mice showed a single band in
electrophoresis, whereas that of WBB6F1 mice showed three bands (Fig 1A). When bone
marrow cells of B6-+/+ mice were transplanted, the hemoglobin of WBB6F1-W/Wv
recipients showed a single band (Fig 1A). The hemoglobin of WBB6F1-W/Wv mice also
showed a single band after the transplantation of B6-tg/tg bone marrow cells (Fig 1A).
B lymphocytes (IgM+), T lymphocytes (Thy1.2+), macrophages (CD11b+) and granulocytes
(Gr-1+) were purified from recipient WBB6F1-W/Wv mice by the magnetic cell sorting
system, and the presence of -galactosidase transgene was examined. The separated B, T
lymphocytes, macrophages and granulocytes in the recipient WBB6F1-W/Wv mice contained
the transgene after the bone marrow transplantation from B6-tg/tg mice (Fig 1B).
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
12
Then, we examined the number of mast cells in various tissues of the recipient WBB6F1W/Wv mice. Although appreciable number of mast cells developed after the bone marrow
transplantation from B6-+/+ mice, no mast cells were detected in the peritoneal cavity,
mesentery, stomach, spleen and skin after the transplantation from B6-tg/tg mice (Table 1).
There was a possibility that the non-appearance of mast cells in WBB6F1-W/Wv mice after
the transplantation of B6-tg/tg bone marrow cells was due to the additive effect of strain
difference (B6 versus WBB6F1mice) and the lack of MITF (+/+ versus tg/tg). We
transplanted bone marrow cells from WBB6F1-tg/tg mice to irradiated WBB6F1-W/Wv mice.
As in the case of the transplantation from B6-tg/tg mice, no mast cells were detected in tissues
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
13
of the recipient WBB6F1-W/Wv mice after the transplantation from WBB6F1-tg/tg mice
(Table 2).
We also transplanted bone marrow cells from WBB6F1-+/+ mice to irradiated WBB6F1tg/tg mice. When compared to the case of transplantation from WBB6F1-+/+ mice to
irradiated WBB6F1-W/Wv mice, the number of mast cells was significantly lower in the
peritoneal cavity, stomach and skin when bone marrow cells were transplanted from
WBB6F1-+/+ mice to irradiated WBB6F1-tg/tg mice (Table 2). Moreover, no mast cells were
detected in the mesentery and spleen of the recipient WBB6F1-tg/tg mice.
Direct transplantation of bone marrow cells to the skin of WBB6F1-W/Wv mice.
Various numbers of WBB6F1-+/+ or WBB6F1-tg/tgbone marrow cells were directly injected
into the skin of WBB6F1-W/Wv mice. Five weeks after injection, the proportion of injection
sites where mast cell clusters appeared was determined. When 5.0 x 103 and 1.0 x 104 bone
marrow cells of WBB6F1-+/+ mice were injected, clusters of mast cells developed at
approximately half and two thirds of injection sites, respectively (Fig 2). Mast cell clusters
developed at most injection sites when 2.0 x 104 WBB6F1-+/+ bone marrow cells were
injected (Fig 2). In contrast, mast cell clusters did not develop when even 2 x 104 WBB6F1-
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
14
tg/tg bone marrow cells were injected (Fig 2).
Skin transplantation to and from tg/tg mice.
When skin pieces of WBB6F1-W/Wv mice were grafted onto the back of WBB6F1-+/+ mice,
mast cell number in the grafts gradually increased and reached to levels comparable to the
number observed in the surrounding skin of recipient WBB6F1-+/+ mice, within 5 weeks
after transplantation (Fig 3). In contrast, when skin pieces of WBB6F1-W/Wv mice were
grafted onto the back of WBB6F1-tg/tgmice, the number of mast cells in the grafts remained
in significantly lower levels than those of the surrounding skin of WBB6F1-tg/tg recipients
even at 10 week after the transplantation (Fig 3). Fig 3 also shows that the number of
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
15
developing mast cells in the WBB6F1-W/Wv grafted skin was much lower when transplanted
to WBB6F1-tg/tgrecipients than when transplanted to WBB6F1-+/+ recipients.
Next, we grafted skin tissues from WBB6F1-+/+ or WBB6F1-tg/tgmice onto the back of
WBB6F1-W/Wv mice. The number of mast cells in WBB6F1-+/+ grafts dropped to one sixth
a week after the transplantation, and then increased over the values observed in the skin of
intact WBB6F1-+/+ mice (Fig 4). The number of mast cells decreased and remained in the
low levels in the skin tissues grafted from WBB6F1-tg/tgmice (Fig 4).
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
16
We also compared the change of mast cell number in skin grafts transplanted from WBB6F1W/Wv mice or from WBB6F1-tg/tg mice to the back of WBB6F1-+/+ mice. Skin grafts from
WBB6F1-W/Wv mice did not contain mast cells before the transplantation, but the mast cell
number in grafts remarkably increased after transplantation to WBB6F1-+/+ mice (Fig 5).
Skin grafts from WBB6F1-tg/tg mice contained mast cells before the transplantation to
WBB6F1-+/+ mice. Although the mast cell number gradually increased in skin tissues grafted
from WBB6F1-tg/tg mice, the magnitude of increase was significantly lower than that
observed in skin tissues grafted from WBB6F1-W/Wv mice (Fig 5).
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
17
In vitro colony formation.
Since KitL is rich in skin tissues, the number of mast cell colonies obtained in the presence of
KitL was supposed to reflect the number of mast cell precursors that could differentiate in the
skin. Then, in various hematopoietic tissues, we examined the number of mast cell precursors
that could differentiate in the skin. Bone marrow, spleen and peripheral blood mononuclear
cells were obtained from WBB6F1-+/+and WBB6F1-tg/tgmice, and were cultured in
methylcellulose containing IL-3 alone or both IL-3 and KitL. When cultured with IL-3 alone,
numbers of mast cell colonies per plated cells were comparable between WBB6F1-+/+and
WBB6F1-tg/tgmice (Table 3). In contrast, when cultured with both IL-3 and KitL, the
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
18
number of mast cell colonies developed from WBB6F1-+/+ cells was much higher than the
number of mast cell colonies from WBB6F1-tg/tgcells (Table 3).
Since the number of mast cell colonies derived from WBB6F1-+/+cells was higher when
cultured with both IL-3 and KitL than when cultured with IL-3 alone, there was a possibility
that the two conditions, IL-3 alone and IL-3 + KitL, detected different progenitors. To rule out
this, we plated BMMCs that were considered to be the progenitor of mast cells,1 and
compared the colony number obtained with IL-3 alone to that obtained with IL-3 + KitL. As
observed in the culture derived from bone marrow, spleen and peripheral blood mononuclear
cells, the number of mast cell colonies developed from WBB6F1-+/+and WBB6F1-tg/tg
BMMCs was comparable when cultured with IL-3, but that developed from WBB6F1-+/+
BMMCs was greater than that developed from WBB6F1-tg/tgBMMCs when cultured with
both IL-3 and KitL (Table 3). The expression level of KIT protein was lower in mast cells of
colonies developed from WBB6F1-tg/tgbone marrow cells than in mast cells of colonies
developed from WBB6F1-+/+bone marrow cells (Fig 6A). The expression level of KIT was
also lower in WBB6F1-tg/tg BMMCs than in WBB6F1-+/+BMMCs when cultured with
either IL-3 alone or IL-3 + KitL (Fig 6A). In consistent with the expression level of KIT, the
response to KitL was defective in WBB6F1-tg/tg BMMCs (Fig 6B). The lower number of
mast cell colonies developed from WBB6F1-tg/tg cells in the presence of KitL appeared to be
due to the lower expression of KIT in WBB6F1-tg/tg mast cells.
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
19
Skin cell suspensions obtained from WBB6F1-+/+and WBB6F1-tg/tgmice were cultured in
methylcellulose containing IL-3 and KitL. The number of mast cell colonies developed from
suspended skin cells of WBB6F1-+/+mice was much higher than that of mast cell colonies
from suspended skin cells of WBB6F1-tg/tgmice (Table 4).
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
20
Discussion
When bone marrow cells of B6-tg/tg mice were transplanted to the irradiated WBB6F1W/Wv mice, hemoglobin pattern was completely changed from recipient type to donor type.
This indicated that erythrocytes normally developed from the hematopoietic stem cells of B6tg/tg mice. B and T lymphocytes, macrophages and granulocytes in the recipient WBB6F1W/Wv mice contained transgene after the bone marrow transplantation from B6-tg/tg mice,
indicating that hematopoietic stem cells of B6-tg/tg mice also differentiated to these cells in
irradiated WBB6F1-W/Wv mice. In contrast, mast cells did not develop in all examined tissues
after the transplantation of bone marrow cells of B6-tg/tg or WBB6F1-tg/tg mice. The
hematopoietic stem cells in the bone marrow appeared to require MITF for differentiation to
mast cells but not for differentiation to other blood cells.
Roundy et al31 reported that the number of mature B cells decreased in B6-mi/mi mice, in
which abnormal MITF was present instead of normal MITF. B6-mi/mi mice showed more
severe phenotype than B6-tg/tg mice due to an inhibitory effect of abnormal MITF.32
However, the development of B cells may not be deficient in B6-tg/tg mice. In fact, our
preliminary experiment showed that the proportion of IgM+ and IgD+ B cells in the spleen
was comparable between B6-tg/tg and B6-+/+ mice (Morii et al, unpublished data).
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
21
The number of developing mast cells in the skin tissues grafted from WBB6F1-W/Wv donors
was much lower when transplanted to WBB6F1-tg/tgrecipients than when transplanted to
WBB6F1-+/+ recipients. This was consistent with the result of bone marrow transplantation
that no mast cells were detected in the recipient WBB6F1-W/Wv mice after the transplantation
from WBB6F1-tg/tg mice. Since WBB6F1-W/Wv mice possess normal tissue environment
for mast cell development,1,5 mast cell precursors in the bloodstream of WBB6F1-tg/tg mice
appeared to have defects. There was a possibility that the precursor cells had a defect in
migration from blood to tissues. This possibility was not plausible, since the direct injection of
WBB6F1-tg/tg bone marrow cells into the skin did not result in development of mast cell
clusters. Although mast cell precursors of WBB6F1-tg/tg mice possessed the potential to form
mast cell colonies in methylcellulose containing IL-3 (Table 3), they lacked the potential for
differentiating into mast cells within tissues.
Morphologically identifiable mast cells can proliferate in the skin of WBB6F1-W/Wv mice.33
Matsuda et al28 also reported that mast cells settled in the skin proliferate when the skin is
transplanted to the back of another mouse. We transplanted the skin tissues of WBB6F1-+/+
and WBB6F1-tg/tg mice to the back of WBB6F1-W/Wv mice. Since in vitro mast cell colonyforming cells of WBB6F1-W/Wv mice do not differentiate to mast cells in their own skin
tissue,1,34 mast cells developing in the skin tissues grafted to WBB6F1-W/Wv mice appeared to
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
22
be of graft origin. As reported by Matsuda et al,28 mast cell number decreased just after the
transplantation, and increased thereafter in the grafts from WBB6F1-+/+ mice. In contrast,
mast cell number did not increase in the grafts from WBB6F1-tg/tg mice. Although
morphologically identifiable mast cells were present in the skin tissue of WBB6F1-tg/tg mice,
their proliferative potential appeared to be deficient.
When the skin tissues were grafted to WBB6F1-+/+ mice, the magnitude of the increase of
mast cell number was lower in the grafts from WBB6F1-tg/tg mice than in the grafts from
WBB6F1-W/Wv mice. Since mast cells in the skin grafts from WBB6F1-tg/tg mice remained
in very low levels in WBB6F1-W/Wv recipients, mast cells developing in the skin grafts
appeared to be of the recipient WBB6F1-+/+ mouse origin. Precursor cells migrating in blood
of WBB6F1-+/+ recipients appeared to develop more easily in the grafts from WBB6F1W/Wv mice than in the grafts from WBB6F1-tg/tg mice. These results suggested that the
microenvironment for mast cell development was defective in the skin tissue of WBB6F1tg/tg mice. This was consistent with the present result that the number of mast cells in various
tissues was significantly lower in WBB6F1-tg/tg mice than in WBB6F1-W/Wv mice after
transplantation of WBB6F1-+/+ bone marrow cells (Table 2). This was also consistent with
our previous result that the intraperitoneally injected BMMCs derived from WBB6F1-+/+
mice survived in the mesentery and spleen of WBB6F1-W/Wv mice but not in the mesentery
and spleen of WBB6F1-tg/tg mice.10 Roundy et al31 suggested that the tissue environments for
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
23
development of B cells and mast cells were defective in another MITF mutant, B6-mi/mi
mice.
Since KitL is present in skin tissue,1,35 the number of mast cell colonies developing in
methylcellulose containing KitL appeared to reflect partly the number of mast cell precursors
that could differentiate in the skin tissue. When cultured in the presence of KitL, the number
of mast cell colonies which developed from WBB6F1-tg/tg bone marrow, spleen and
peripheral blood cells was approximately one third to one sixth that of mast cell colonies
which developed from WBB6F1-+/+ cells. In contrast, the number of mast cell colonies
which developed from suspended skin of WBB6F1-tg/tg mice was one thirtieth that of
WBB6F1-+/+ mice. This also suggests the presence of defects in both precursor cells and skin
tissue environment of WBB6F1-tg/tg mice.
In addition to deficient transcription of KIT and SgIGSF which may explain the defect of
mast cell precursors, transcription of molecule(s) regulating development of mast cells may
be deficient in tissues of WBB6F1-tg/tg mice. Our previous RT-PCR results using whole
tissues of mesentery and spleen suggested that the expression level of KitL appeared to be
comparable between the mesentery and spleen of WBB6F1-tg/tg mice and those of
WBB6F1-W/Wv mice.10 Therefore, KitL is not considered to be such a regulating molecule.
WBB6F1-tg/tg mice may be useful for identifying new microenvironmental factors other
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
24
than KitL that regulate development of mast cells.
Acknowledgement
The authors thank Ms. C. Murakami, Ms. K. Hashimoto, Mr. M. Kohara and Ms. T.
Sawamura for technical assistance.
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
25
References
1. Kitamura Y. Heterogeneity of mast cells and phenotypic change between subpopulations.
Annu Rev Immunol. 1989;7:59-76.
2. Kitamura Y, Go S. Decreased production of mast cells in S1/S1d anemic mice. Blood.
1979;53:492-497.
3. Zsebo KM, Williams DA, Geissler EN, et al. Stem cell factor is encoded at the Sl locus of
the mouse and is the ligand for the c-kit tyrosine kinase receptor. Cell. 1990;63:213-224.
4. Huang E, Nocka K, Beier DR, et al. The hematopoietic growth factor KL is encoded by
the Sl locus and is the ligand of the c-kit receptor, the gene product of the W locus. Cell.
1990;63:225-233.
5. Kitamura Y, Go S, Hatanaka K. Decrease of mast cells in W/Wvmice and their increase by
bone marrow transplantation. Blood. 1978;52:447-452.
6. Chabot B, Stephenson DA, Chapman VM, Besmer P, Bernstein A. The proto-oncogene
c-kit encoding a transmembrane tyrosine kinase receptor maps to the mouse W locus. Nature.
1988;335:88-89.
7. Hodgkinson CA, Moore KJ, Nakayama A, et al. Mutations at the mouse microphthalmia
locus are associated with defects in a gene encoding a novel basic-helix-loop-helix-zipper
protein. Cell. 1993;74:395-404.
8. Kitamura Y, Morii E, Jippo T, Ito A. Regulation of mast cell phenotype by MITF. Int Arch
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
26
Allergy Immunol. 2002;127:106-109.
9. Kitamura Y, Morii E, Jippo T, Ito A. Effect of MITF on mast cell differentiation. Mol
Immunol. 2002;38:1173-1176.
10. Jippo T, Morii E, Ito A, Kitamura Y. Effect of anatomical distribution of mast cells on
their defense function against bacterial infections: demonstration using partially mast celldeficient tg/tg mice. J Exp Med. 2003;197:1417-1425.
11. Morii E, Ogihara H, Kim DK, et al. Importance of leucine zipper domain of mi
transcription factor (MITF) for differentiation of mast cells demonstrated using mice/mice
mutant mice of which MITF lacks the zipper domain. Blood. 2001;97:2038-2044.
12. Morii E, Ogihara H, Oboki K, et al. Effect of a large deletion of the basic domain of mi
transcription factor on differentiation of mast cells. Blood. 2001;98:2577-2579.
13. Tsujimura T, Morii E, Nozaki M, et al. Involvement of transcription factor encoded by the
mi locus in the expression of c-kit receptor tyrosine kinase in cultured mast cells of mice.
Blood. 1996;88:1225-1233.
14. Morii E, Tsujimura T, Jippo T, et al. Regulation of mouse mast cell protease 6 gene
expression by transcription factor encoded by the mi locus. Blood. 1996;88:2488-2494.
15. Morii E, Jippo T, Tsujimura T, et al. Abnormal expression of mouse mast cell protease 5
gene in cultured mast cells derived from mutant mi/mi mice. Blood. 1997;90:3057-3066.
16. Jippo T, Lee YM, Katsu Y, et al. Deficient transcription of mouse mast cell protease 4
gene in mutant mice of mi/mi genotype. Blood. 1999;93:1942-1950.
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
27
17. Ito A, Morii E, Maeyama K, et al. Systematic method to obtain novel genes that are
regulated by mi transcription factor: impaired expression of granzyme B and tryptophan
hydroxylase in mi/mi cultured mast cells. Blood. 1998;91:3210-3221.
18. Kim DK, Morii E, Ogihara H, et al. Impaired expression of integrin alpha-4 subunit in
cultured mast cells derived from mutant mice of mi/mi genotype. Blood. 1998;92:1973-1980.
19. Ogihara H, Morii E, Kim DK, Oboki K, Kitamura Y. Inhibitory effect of the transcription
factor encoded by the mutant mi microphthalmia allele on transactivation of mouse mast cell
protease 7 gene. Blood. 2001;97:645-651.
20. Morii E, Ogihara H, Oboki K, et al. Inhibitory effect of the mi transcription factor
encoded by the mutant mi allele on GAbinding protein-mediated transcript expression in
mouse mast cells. Blood. 2001;97:3032-3039.
21. Morii E, Ogihara H, Oboki K, Kataoka TR, Jippo T, Kitamura Y. Effect of MITF on
transcription of transmembrane tryptase gene in cultured mast cells of mice. Biochem
Biophys Res Commun. 2001;289:1243-1246.
22. Ito A, Jippo T, Wakayama T, et al. SgIGSF: a new mast-cell adhesion molecule used for
attachment to fibroblasts and transcriptionally regulated by MITF. Blood. 2003;101:26012608.
23. Bernstein SE. Acute radiosensitivity in mice of differing W genotype. Science.
1962;137:428-429.
24. Nakano T, Sonoda T, Hayashi C, et al. Fate of bone marrow-derived cultured mast cells
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
28
after intracutaneous, intraperitoneal, and intravenous transfer into genetically mast celldeficient W/Wv mice. Evidence that cultured mast cells can give rise to both connective tissue
type and mucosal mast cells. J Exp Med. 1985;162:1025-1043.
25. Sonoda T, Ohno T, Kitamura Y. Concentration of mast-cell progenitors in bone marrow,
spleen, and blood of mice determined by limiting dilution analysis. J Cell Physiol.
1982;112:136-140.
26. Porter EH, Berry RJ. The Efficient Design of Transplantable Tumour Assays. Br J
Cancer. 1963;17:583-595.
27. Breivik H. Haematopoietic stem cell content of murine bone marrow, spleen, and blood.
Limiting dilution analysis of diffusion chamber cultures. J Cell Physiol. 1971;78:73-78.
28. Matsuda H, Kitamura Y, Sonoda T, Imori T. Precursor of mast cells fixed in the skin of
mice. J Cell Physiol. 1981;108:409-415.
29. Nakahata T, Kobayashi T, Ishiguro A, et al. Extensive proliferation of mature connectivetissue type mast cells in vitro. Nature. 1986;324:65-67.
30. Kanakura Y, Sonoda S, Nakano T, et al. Formation of mast-cell colonies in
methylcellulose by mouse skin cells and development of mucosal-like mast cells from the
cloned cells in the gastric mucosa of W/Wvmice. Am J Pathol. 1987;129:168-176.
31. Roundy K, Kollhoff A, Eichwald EJ, Weis JJ, Weis JH. Microphthalmic mice display a
B cell deficiency similar to that seen for mast and NK cells. J Immunol. 1999;163:6671-6678.
32. Ito A, Morii E, Kim DK, et al. Inhibitory effect of the transcription factor encoded by the
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
29
mi mutant allele in cultured mast cells of mice. Blood. 1999;93:1189-1196.
33. Sonoda T, Kanayama Y, Hara H, et al. Proliferation of peritoneal mast cells in the skin of
W/Wv mice that genetically lack mast cells. J Exp Med. 1984;160:138-151.
34. Suda T, Suda J, Spicer SS, Ogawa M. Proliferation and differentiation in culture of mast
cell progenitors derived from mast cell-deficient mice of genotype W/Wv. J Cell Physiol.
1985;122:187-192.
35. Morii E, Oboki K, Jippo T, Kitamura Y. Additive effect of mouse genetic background
and mutation of MITF gene on decrease of skin mast cells. Blood. 2003;101:1344-1350.
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
30
Figure legends
Fig 1. Origin of blood cells in the 2 Gy-irradiated WBB6F1-W/Wv mice 10 weeks after
the bone marrow transplantation from B6-+/+ and B6-tg/tg mice. (A) Hemoglobin
electrophoresis. Hemoglobin of WBB6F1-W/Wv recipients after the bone marrow
transplantation from B6-+/+ or B6-tg/tg mice was electrophoresed in celluloseacetate
membrane. Five mice in each group were examined, and the results of three in five were
shown. Hemoglobin of B6-tg/tg mice and that of WBB6F1-W/Wv mice were also
electrophoresed as controls. (B) Detection of transgene by genomic PCR. Genomic DNAs
were purified from B and T lymphocytes, macrophages and granulocytes, and the presence
of the transgene, which was contained only in cells of B6-tg/tg mouse origin, was examined.
Five mice in each group were examined with similar results (the result of a mouse is shown
here). The presence of actin gene was examined as a control.
Fig 2. Limiting dilution analysis of mast cell precursors present in bone marrow cells.
Various numbers of bone marrow cells derived from WBB6F1-+/+ and -tg/tg mice were
directly injected into the dorsal skin of WBB6F1-W/Wv mice. Five weeks after injection, the
proportion of injection sites at which mast cell clusters did not appear (proportion of nonappearance) was determined, and plotted to the number of injected cells. The calculated
concentration of mast cell precursors in the WBB6F1-+/+ bone marrow was 10 (8 to 13 in
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
31
95% confidence intervals) among 105 cells. No apparent clusters develop even when 2.0 x
104 bone marrow cells of WBB6F1-tg/tg mice were injected into the skin of WBB6F1-W/Wv
mice.
Fig 3. Effect of host genotypes on the number of mast cells which developed in the skin
tissues grafted from WBB6F1-W/Wv mice. The skin of WBB6F1-W/Wv mice was
grafted to WBB6F1-+/+ mice or WBB6F1-tg/tg mice. The number of mast cells in the skin
graftand the surrounding host skin was counted various days after transplantation.The bars
represent the mean ዊ standard error (SE) of five mice. In some cases, the SE was too small
to be shown by bars.*p <.01by t-test when compared to the values of host skin.
Fig 4. Number of mast cells in skin tissues of WBB6F1-+/+ or WBB6F1-tg/tg mice
grafted to WBB6F1-W/Wv mice. The bars represent the mean ዊ SE of five mice. In
some cases, the SE was too small to be shown by bars.*p < .01by t-test when compared to
the values of skin tissues grafted from WBB6F1-+/+ mice.
Fig 5. Number of mast cells in skin tissues of WBB6F1-W/Wv or WBB6F1-tg/tg mice
grafted to WBB6F1-+/+ recipients. The bars represent the mean ዊ SE of five mice. In
some cases, the SE was too small to be shown by bars.*p < .01by t-test when compared to
the value of skin graft from WBB6F1-W/Wv mice.
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
32
Fig 6. Defective KIT expression and response to KitL in mast cells of WBB6F1-tg/tg
mice. (A) Flow cytometry of the surface expression of KIT in mast cells obtained from
colonies and BMMCs. Mast cell colonies developed from bone marrow cells (a,b), and
BMMCs cultured in the presence of IL-3 alone (c,d) or IL-3 + KitL (e,f) were harvested, and
incubated with FITC-conjugated anti-KIT antibody or isotype control. The staining profiles
with anti-KIT antibody (thick line) and with isotype control (thin line) were shown. The data
were representative of three independent experiments. (B)Response to KitL of BMMCs
derived from WBB6F1-+/+ or WBB6F1-tg/tg mice. BMMCs were incubated in the medium
containing 10 ng/mL IL-3 and various concentration of KitL, and the response to KitL was
detected with uptake of 3H-TdT. The bars represent the mean ዊ SE of three experiments. In
some cases, the SE was too small to be shown by bars.
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
33
Table 1. Number of Mast Cells in Various Tissues at 10 week after Bone Marrow
Transplantation
Number of mast cells in each combination of
donors and recipientsa,b
Tissue examined
B6-+/+ to WBB6F1-W/Wvc
B6-tg/tg to WBB6F1-W/Wvc
Peritoneal Cavity
49 ዊ 5
< 0.1d
Mesentery
7.1 ዊ 0.4
< 0.1d
Stomach
412 ዊ 31
< 0.1d
Spleen
2.3 ዊ 0.9
< 0.1d
Skin
119 ዊ 10
< 0.1d
a
Mean ዊ SE of 5 mice.
b
Number per 103 peritoneal cells, number per mm2 mesentery and spleen, and number per
cm stomach and skin.
c
Before the transplantation, WBB6F1-W/Wvmice were irradiated with 2 Gy.
d
p < .01 by t-test when compared to the values observed in WBB6F1-W/Wvmice
transplanted from B6-+/+ donors.
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
34
Table 2. Number of Mast Cells in Various Tissues at 10 week after Bone Marrow
Transplantation
Number of mast cells in each combination of
donors and recipientsa,b
WBB6F1-+/+ to
WBB6F1-tg/tg to
WBB6F1-+/+ to
Tissue examined
WBB6F1-W/Wvc
WBB6F1-W/Wvc
WBB6F1-tg/tgc
Peritoneal Cavity
59 ዊ 5
< 0.1d
3.3 ዊ 0.2d
Mesentery
9.1 ዊ 0.2
< 0.1d
< 0.1d
Stomach
466 ዊ 41
< 0.1d
253 ዊ 27d
Spleen
2.9 ዊ 0.6
< 0.1d
< 0.1d
Skin
150 ዊ 12
< 0.1d
93 ዊ 10d
a
Mean ዊ SE of 5 mice.
b
Number per 103 peritoneal cells, number per mm2 mesentery and spleen, and number per
cm stomach and skin.
c
Before the transplantation, WBB6F1-W/Wvmice were irradiated with 2 Gy, and WBB6F1-
tg/tg mice with 8 Gy.
d
p < .01 by t-test when compared to the values observed in WBB6F1-W/Wvmice
transplanted from WBB6F1-+/+ donors.
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
35
Table 3. Number of Mast Cell Colonies that Developed after Plating Bone Marrow, Spleen
and Peripheral Blood Mononuclear Cells of WBB6F1-+/+ or WBB6F1-tg/tg Mice in the
Presence of IL-3 Alone or of Both IL-3 and KitL
No. of Colonies in Each Culture Conditiona,b
IL-3c
IL-3 + KitLd
Cells
WBB6F1-+/+
WBB6F1-tg/tg
WBB6F1-+/+
WBB6F1-tg/tg
Bone Marrow
2.8 ዊ 0.5
2.7 ዊ 0.5
8.0 ዊ 0.8
3.0 ዊ 0.5e
Spleen
17.8 ዊ 5.4
11.5 ዊ 3.1
Blood
1.3 ዊ 0.5
0.8 ዊ 0.3
CMC
4.3 ዊ 1.4
3.2 ዊ 0.9
29.8 ዊ 6.1
5.8 ዊ 1.4
16.2 ዊ 3.4
10.0 ዊ 4.8e
1.0 ዊ 0.7e
5.5 ዊ 0.8
a
Mean ዊ SE of 6 mice (bone marrow, spleen and blood) or of 3 cultures (CMC).
b
Number per 4 x 104 bone marrow cells, 2 x 105 spleen and peripheral blood mononucleaer
cells and 5 x 102 CMCs.
c
Culture medium containing10 ng/mL IL-3.
d
Culture medium containing 10 ng/mL IL-3 and 50 ng/mL KitL.
e
p < .01 by t-test when compared to the value of WBB6F1-+/+ mice.
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
36
Table 4. Number of Mast Cell Colonies that Developed after Plating Dispersed Skin Cells
Mice
No. of Coloniesa,b
WBB6F1-+/+
152 ዊ 11
WBB6F1-tg/tg
5.3 ዊ 1.9c
a
Mean ዊ SE of 7 mice.
b
Number per 1 x 105mononuclear cells, cultured in methylcellulose containing 10 ng/mL IL-
3 and 50 ng/mL KitL.
c
p < .01 by t-test when compared to the value of WBB6F1-+/+ mice.
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
Prepublished online June 1, 2004;
doi:10.1182/blood-2004-01-0247
Roles of MITF for Development of Mast Cells in Mice: Effects on Both
Precursors and Tissue Environments
Eiichi Morii, Keisuke Oboki, Katsuhiko Ishihara, Tomoko Jippo, Toshio Hirano and Yukihiko Kitamura
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Advance online articles have been peer reviewed and accepted for publication but have not
yet appeared in the paper journal (edited, typeset versions may be posted when available
prior to final publication). Advance online articles are citable and establish publication
priority; they are indexed by PubMed from initial publication. Citations to Advance online
articles must include digital object identifier (DOIs) and date of initial publication.
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society
of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.