Digital Comprehensive Summaries of Uppsala Dissertations
from the Faculty of Science and Technology 1097
Diversity Underfoot
Systematics and Biogeography of the
Dictyostelid Social Amoebae
ALLISON L PERRIGO
ACTA
UNIVERSITATIS
UPSALIENSIS
UPPSALA
2013
ISSN 1651-6214
ISBN 978-91-554-8804-856
urn:nbn:se:uu:diva-210074
Dissertation presented at Uppsala University to be publicly examined in Lindahlsalen,
Norbyvägen 18D, Uppsala, Friday, 13 December 2013 at 10:00 for the degree of Doctor of
Philosophy. The examination will be conducted in English. Faculty examiner: Prof David
Bass (Natural History Museum, London).
Abstract
Perrigo, A. L. 2013. Diversity Underfoot. Systematics and Biogeography of the Dictyostelid
Social Amoebae. Digital Comprehensive Summaries of Uppsala Dissertations from the
Faculty of Science and Technology 1097. 56 pp. Uppsala: Acta Universitatis Upsaliensis.
ISBN 978-91-554-8804-856.
Dictyostelids (Amoebozoa) are a group of social amoebae consisting of approximately 150
species, which are found in terrestrial habitats worldwide. They are divided into eight major
clades based on molecular phylogeny, and within these clades are many species complexes.
Some species are seemingly cosmopolitan in distribution, while others are geographically
restricted. In this thesis dictyostelids were recovered from high latitude habitats (soils in Sweden
and Iceland) as well as from the soles of shoes. Morphological characters and DNA sequence
analyses were used to identify isolates that were recovered and delimit new species, as well as
to investigate the monophyly of Dictyostelium aureostipes. Nine species were reported from
Northern Sweden and four from Iceland. Among the isolates recorded in Sweden were two
new species, described as D. barbibulus and Polysphondylium fuscans. P. fuscans was among
the four species recovered from footwear, contributing evidence for anthropogenic transport of
dictyostelids. Ecological patterns were assessed using linear regression and generalized linear
models. The ecological analyses of dictyostelids recovered from Iceland indicate that these
organisms are most frequently found in soils of near-neutral pH, but also exhibit a species
richness peak in moderately acidic soils. These analyses indicate that in Iceland dictyostelid
species richness decreases with altitude, and in the northern hemisphere the species richness
increases with decreasing latitude. A three-region analysis of the D. aureostipes species
complex indicated that this species is in fact made up of at least five phylogenetically distinct
clades, and in light of this the group is in need of taxonomic revision. These results indicate
that the dictyostelid species richness is higher than previously known, especially in highlatitude regions, and that even seemingly well-defined species may harbour cryptic diversity.
Presently, species ranges may be expanding via anthropogenic dispersal but despite this, the
dictyostelids are found to exhibit biogeographic trends well known from macroorganisms, such
as a latitudinal gradient of species richness.
Keywords: Amoeba, biogeography, cryptic species, dictyostelid, latitudinal gradient,
multicellularity, protist, social amoeba, phylogenetics, systematics, new species
Allison L Perrigo, Department of Organismal Biology, Systematic Biology, Norbyv. 18 D,
Uppsala University, SE-75236 Uppsala, Sweden.
© Allison L Perrigo 2013
ISSN 1651-6214
ISBN 978-91-554-8804-856
urn:nbn:se:uu:diva-210074 (http://urn.kb.se/resolve?urn=urn:nbn:se:uu:diva-210074)
For Dad
List of Papers
This thesis is based on the following papers, which are referred to in the text
by their Roman numerals:
I
Perrigo, A.L., Romeralo, M., Baldauf, S.L. (2012) What’s on your
boots: an investigation into the role we play in protist dispersal.
Journal of Biogeography, 39(5):998–1003
II
Perrigo, A.L., Baldauf, S.L., Romeralo, M. (2013) Diversity of dictyostelid social amoebae in high latitude habitats of Northern Sweden. Fungal Diversity, 57(1):185–198
III Perrigo, A.L., Moya-Larano, J., Baldauf, S.L., Romeralo, M. (Submitted) Everything is not everywhere: a latitudinal gradient of protist diversity. Submitted
IV Perrigo, A.L., Romeralo, M., Baldauf, S.L. (Submitted) The yellow
slime mold is a red herring: hidden genetic diversity in one protist
morphospecies. Submitted
Reprints of published papers were made with permission from the respective
publishers.
Allison Perrigo conceived the ideas, collected and analyzed the data, and
was primarily responsible for the writing in Papers I and IV. In Paper II
she contributed to data analysis and writing the paper. In Paper III, she
collected the data, did the linear regression analysis for the latitudinal gradient and was primarily responsible for the writing.
Contents
Introduction .................................................................................................... 9 Protists ....................................................................................................... 9 Amoebozoa .............................................................................................. 13 Dictyostelids ............................................................................................ 13 Biogeography........................................................................................... 18 If everything is everywhere, where is everybody? .................................. 19 The taxonomic dilemma .......................................................................... 20 Aims......................................................................................................... 21 Materials and Methods ................................................................................. 22 Collections ............................................................................................... 22 Culture, isolation and DNA extraction .................................................... 23 Morphological diagnoses ......................................................................... 24 Genetic markers ....................................................................................... 27 Phylogenetic Analyses ............................................................................. 28 Summary of Papers ...................................................................................... 29 Paper I: The boots study .......................................................................... 29 Paper II: Northern Sweden and new species ........................................... 31 Paper III: Iceland and the latitudinal gradient ......................................... 33 Paper IV: Dictyostelium aureostipes species complex ............................ 34 Conclusions .................................................................................................. 37 Svensk Sammanfattning ............................................................................... 38 Acknowledgements ...................................................................................... 41 References .................................................................................................... 46 Abbreviations
AMP
BS
ca.
cf.
DNA
GPS
HI
ITS
mm
ml
MYA
NNA
OTU
PCR
PP
RAxML
rRNA
s.l.
SM
sp.
sp. nov.
SSU
µm
UU
var.
Adenosine monophosphate
Bootstrap
Circa
Confer
Deoxyribonucleic acid
Global positioning system
Hay infusion agar
Internal transcribed spacer
Millimeter
Milliliter
Million years ago
Non-nutrient agar
Operational Taxonomic Unit
Polymerase chain reaction
Posterior probability
Randomized Accelerated Maximum Likelihood
Ribosomal ribonucleic acid
Sensu lato
Standard media agar
Species
Species novum
Small subunit
Micrometer
Uppsala University
Variety
Introduction
“When a biologist studies a group of species, ranging anywhere from, say,
elephants with three living species to ants with fourteen thousand species, he
or she typically aims to learn everything possible over a large range of biological phenomena. Most researchers working this way… are properly called
scientific naturalists. … They will tell you, correctly, that there is infinite detail and beauty even in those that people at first find least attractive – slime
molds, for example, dung beetles, cobweb spiders, and pit vipers. Their joy is
in finding something new, the more surprising the better. They are the ecologists, taxonomists, and biogeographers.”
E.O. Wilson in Letters to a Young Scientist
This thesis is the compilation of four papers and manuscripts that broadly
aim to increase the collective knowledge about something many of us didn’t
even know existed: dictyostelid social amoebae, or cellular slime molds.
Over the course of these studies I have heard these amoebae likened to aliens
(or, ‘moon snot’), a microscopic forest, the mood slime from Ghost Busters,
an inverse fountain and many other strange and variously accurate images.
For now, I will not offer further comparisons. Instead I will focus on familiarizing you, my audience, with these creatures, such that you can develop
your own understanding and, possibly, analogies. So put up your feet, pour a
cup of coffee, and take a few minutes to enjoy the intricacies of these organisms that I have spent the last five years sometimes hating but more often
loving, and always in awe of.
Protists
The Earth is home to many extraordinary and wonderful creatures.
We are all familiar with animals, plants and fungi. Bacteria and viruses are
9
also in our repertoire. However, there is a massive diversity of organisms
that are eukaryotic (with a nucleus) that are not animals, plants or fungi.
These microorganisms are lumped together into a refuse bin and are collectively known as ‘protists’. They are often, but not always, unicellular and
they inhabit nearly every environment on earth, from the deepest sea vents
right up into the atmosphere. A select few we know: the alveolate Plasmodium causes malaria, the foraminiferans are a long-favored workhorse of paleontologists, and single-celled oceanic phytoplankton are among the most
productive primary producers on Earth. Furthermore, no Gary Larson compilation would be complete without a pair of the familiar amoebae on armchairs thoughtfully reflecting on the mundane facets of middle-American
suburban life (Larson, 2003).
These organisms, the protists, were first acknowledged taxonomically
as neither plants nor animals when they were assigned to the kingdom Protozoa by Owen in 1860. Scamardella (1999) outlines the history of protist
taxonomy, highlighting the names and taxa included within this ‘group’,
which over time has been made up of any and all organisms that could not
be confidentially called a plant or an animal at the time. Over the last two
centuries various biologists have weighed in with their definition of the
“kingdom of primitive forms”. The kingdoms Protoctista (Hogg, 1860),
Protozoa (Owen, 1860) and Protista (Haeckel, 1866) have all been proposed
and defended - each including an oft-overlapping array of non-plant and
non-animal taxa. Haeckel (1866) draws an early representation of the tree
of life, showing one theory explaining the relationships within and among all
living organisms (Figure 1).
More recent classifications and phylogenies have confirmed that protists are not only morphologically diverse, but they are also phylogenetically
divergent, belonging to a variety of eukaryotic super-groups (Whittaker,
1969; Levine et al., 1980; Corliss, 1984; Schlegel, 1991; Cavalier-Smith,
1998, 2003; Adl et al., 2005, 2007, 2012). As such, there is a movement to
stress that protists should not be regarded as only the array of ‘primitive
forms’ as the name implies. Figure 2 shows a schematic representation of the
relationships among eukaryotes.
Throughout this thesis the term ‘protist’ is used not to indicate a monophyletic group, but to collectively refer to all eukaryotic organisms that are
not plants, animals or fungi. Although the term does not depite a natural
group, the field of protistology remains coherent in its aim to better understand these often overlooked organisms.
10
Figure 1. The tree of life, as illustrated by Ernst Haeckel in Generelle Morphologie
der Organismen (1866). Hackel divides life into three sections in this ‘genealogy’:
Plantae, Protista and Animalia. The dictyostelids are absent from the tree, but their
sister clade, the Myxomycetes, are found towards the top of the figure, along with
Spongiae, indicating that they are relatively ‘advanced’ compared to the other Protista. Likewise, Mammalia is found at the apex of the Animalia branch, in line with
Haeckel’s belief that man is the peak of evolution.
11
Figure 2. The filose amoeba of life. The relationships among major eukaryotes are
represented schematically as the filose pseudopodia of an amoeba. This amoeba of
life is schematic and only includes a representative selection of taxa. Like an amoeba, this phylogeny is inherently without roots, or ‘unrooted’. For more detailed phylogenies of the eukaryotic super-groups, discussions on the relationships among taxa
and the position of the root see Baldauf, 2003; Parfrey et al., 2006, 2010; and Adl et
al., 2007, 2012.
12
Amoebozoa
Amoebozoa is one of the eukaryotic ‘super-groups’ (Figure 2). It is
the sister taxon to Opisthokonts, which comprises the animals and fungi
(Baldauf, 2003). The Amoebozoa is made up of amoebae that are either
naked (lacking a shell or covering) or testate (with a shell-like covering,
called a ‘test’) (Adl et al., 2012). The relationships among the taxa within
Amoebozoa are not well understood and phylogenies vary significantly depending on which taxa and data are included in the analyses (Cavalier-Smith
et al., 2004; Kudryavtsev, 2005; Tekle et al., 2008; Pawlowski & Burki,
2009; Shadwick et al., 2009).
Although the within-group relationships are not universally agreed
upon at present, there are a series of taxa that have been confidently identified as major lineages within Amoebozoa. Most conservatively, Adl et al.
(2012) have suggested to divide the Amoebozoa into 13 constituent taxa.
Alternately, Pawlowski and Burki (2009) divided Amoebozoa into six major
taxa: Conosea, Thecamoebida, Variosea, Flabellinea, Acanthopodida and
Tubulinea. Another recent phylogeny suggests a two-subphyla system under
which Amoebozoa is divided into Conosa (made up of Mycetozoa, Variosea
and Archamoebea) and Lobosa (consisting of Tubulinea, Flabillinea and
Longamoebia) (Smirnov et al., 2011). Due to the clear discrepancies among
phylogenies it has been proposed that further data, including full genomes
from a broad sampling of Amoebozoa species, will be required to confidently delimit the branching patterns among these taxa (Glöckner & Noegel,
2013).
It is important to point out that while the Amoebozoa is made up exclusively of amoeboid organisms, it is not the only group with amoebae in it.
Amoeboid organisms are also found in several other eukaryotic supergroups. A large majority of the non-Amoebozoa amoeboid organisms are
found within Rhizaria (including radularians and foraminifera), but further
instances are also found in Stramenopiles (Actinophryida), Excavata (Heterolobosea) and Opisthokonts (Nuclearia) (Pawlowski & Burki, 2009).
Dictyostelids
Dictyostelids (Amoebozoa) were originally known as the ‘cellular
slime molds,’ but they are now more frequently referred to by the common
name ‘social amoebae.’ The latter term serves to both clear up confusion
regarding the taxonomic placement of the group (as slime molds implies
they are fungi, not amoebae) and also highlights a striking features in their
life cycle: multicellularity, which is the result of a unique form of sociality.
13
Dictyostelids, along with myxogastrids (plasmodial slime molds) and
protostelids, make up the Mycetozoa, which is one of the major divisions
within the Conosea (Amoebozoa) (Olive, 1970; Baldauf & Doolittle, 1997;
Pawlowski & Burki, 2009; Fiore-Donno et al., 2010). Unlike dictyostelids,
which are relatively small throughout their life cycle (usually <1.0 centimeters), myxogastrids have the ability to produce a giant (up to several decimeters across), multi-nucleate amoeba that will produce fruiting structures
(Fiore-Donno et al., 2013). The protostelids, one the other hand, are a polyphyletic group of amoebae that produce microscopic sorphores each bearing
a single spore, but are otherwise morphologically diverse (Olive, 1975;
Fiore-Donno et al., 2010).
Sexual and asexual reproduction
Under normal conditions, dictyostelid amoebae reproduce asexually
by binary fission. They feed on bacteria and grow until a certain size has
been reached, at which point the amoeba divides into two daughter cells.
However, under ‘crisis-conditions’ the amoebae respond by producing one
of three alternate life phases: multicellular fructifications, macrocysts or
microcysts.
The best studied of these three alternate phases is the formation of
the multicellular fruiting bodies, which is a direct response to starvation.
When starvation conditions arise, dictyostelid amoebae respond by producing a chemoattractant, known as an acrasin. Cyclic AMP was the first acrasin identified, and later the peptides glorin, folate and neopterin were added to the list (Konijn et al., 1968; Haastert, 1982; Shimomura, 1982; de
Wit & Konijn, 1983). Once an acrasin has been secreted the surrounding
amoebae will respond by moving towards the chemoattractant and giving
off their own acrasin pulse. The amoebae form streams, moving towards a
central aggregation point. Upon aggregating the amoebae organize into a
slug-shaped mass, which may migrate towards more favorable conditions
(such as light, pH or temperature). The slug will then begin to differentiate
into a sorocarpic structure, in which about 20% of the amoebae will vacuolate to form a stalk and the remaining amoebae will become spores in a
slimy mass known as a sorus (Raper, 1984). The spores are not actively
dispersed, but are dependent on vectors to transport them to a new location, where they may germinate and begin the cycle anew (Cavender,
1973; Bonner, 2009).
The multicellular phase of the dictyostelid life-cycle has been of particular interest to developmental biologists. As a result of this, Dictyostelium
discoideum is now a well-recognized model organism used to study cell-cell
signaling, differentiation among cells, social altruism and a host of other
processes (reviewed in Muñoz-Braceras et al., 2013). The D. discoideum
genome was the first to be fully sequenced, and now three more dictyostelid
14
genomes have been made publicly available (Eichinger et al., 2005; Heidel
et al., 2011; Sucgang et al., 2011).
Perhaps surprisingly, this striking pattern of aggregative multicellularity with sorocarpic fruiting is not limited to only the dictyostelids, but is
found in some form in at least six of the eukaryotic super-groups, including
Opisthokonts, Amoebozoa, Excavata, Stramenopiles, Alveolata and Rhizaria
(Brown et al., 2012; Brown & Silberman, 2013).
Dictyostelids also are capable of sexual reproduction under certain
conditions (Reviewed in Raper, 1984; Bloomfield, 2013). In the same way
that the asexual cycle begins, the macrocyst forming sexual cycle is initiated
with the production of an acrasin. The signal also initiates aggregation, but
the similarities stop here. The two amoebae that initiated the aggregation
process become a single diploid cell that cannibalizes the other amoebae
responding to the chemical signal. Through this process the diploid macrocyst grows larger. This cycle is poorly understood in comparison to the multicellular asexual cycle, as it is difficult to initiate in the lab and is also dependent on the presence of different mating types within a single strain
(Bloomfield et al., 2010). Macrocysts have only been observed in a handful
of the described dictyostelid species (Raper, 1984).
The third ‘crisis-induced’ stage that dictyostelids exhibit is the microcyst. This is a transient stage, where individual amoebae form thick cellulose-rich walls in response to high osmolarity (Blaskovics & Raper, 1957).
The amoeba will then germinate in response to a subsequent drop in osmolarity (Cotter & Raper, 1968). It is expected that under natural conditions
this phase is a survival tactic used to survive periods of unfavorable environmental conditions (Raper, 1984; Budniak & O’Day, 2012).
Ecology
Presently there are around 150 species of dictyostelids known, but this
is probably a gross under-representation of the true diversity (Adl et al.,
2007). The number of described species has been growing rapidly in recent
years. Since the last taxonomic revision of the dictyostelids by K.B. Raper in
1984 the number of described species has more than doubled (Bonner,
2009). This high diversity has been further supported by preliminary results
from culture independent dictyostelid surveys (Romeralo & Baldauf, unpublished data).
Dictyostelid amoebae occur primarily in the surface layer of forest
soils and feed on bacteria (Cavender, 1973; Raper, 1984; Hagiwara, 1989;
Swanson et al., 1999). However, they have also been regularly recovered
from a variety of other terrestrial habitats including canopy soils, animal
dung and agricultural fields (Brefeld, 1869; Cavender et al., 1993;
Stephenson & Landolt, 1998). Little is known about which bacterial strains
dictyostelids feed on under natural conditions, but it has been suggested that
15
they have preferred strains (Singh, 1947; Raper, 1984). This is corroborated
by the recent findings that some species of dictyostelid ‘pack lunch boxes’
and incorporate their preferred bacterial food source into their fruiting bodies (Brock et al., 2011).
A number of ecological factors have been assessed in relation to dictyostelid species richness (reviewed in Raper, 1984; Cavender, 2013). These
include forest type, moisture availability, shade area, pH and temperature.
Different dictyostelid species are found in dissimilar forest types, indicating
that the species have certain ecological requirements that may be found only
in certain habitats (discussed in Cavender, 2013). Some of these habitat requirements have been further delimited. For example, Romeralo and
colleauges (2011b) showed that dictyostelids in the Iberian Peninsula tend to
be recovered more frequently from soils with a near-neutral pH.
It has been observed many times that dictyostelid species richness is
correlated with of vascular plant diversity in the sampling area (for example,
Cavender & Raper, 1968; Cavender, 1973; Raper, 1984; Vadell et al., 1995;
Swanson et al., 1999; Romeralo et al., 2012). Early studies on dictyostelid
ecology indicated that even within a small soil sample the dictyostelid species richness is variable according to the microhabitat (Eisenberg, 1976). It
is likely that an increased diversity of vascular plants has a knock-on effect,
leading to a higher number of microhabitats for dictyostelids to occupy
(Romeralo et al., 2011b).
Larger scale biogeographic patterns have also been reported for dictyostelids. A number of papers have noted a latitudinal gradient of species
richness (i.e. more species found closer to the equator), but none have tested
this pattern statistically (Cavender, 1973, 2013; Raper, 1984; Hagiwara,
1989; Swanson et al., 1999).
Systematics
The dictyostelids were first described in the late 1800s when Dictyostelium mucoroides was isolated from horse and rabbit dung (Brefeld,
1869). The genus name translates to ‘netted-stalk’, referring to the fruiting
body, and the species epithet refers to the similarity between the sorocarps of
D. mucoroides and the erect sporangiophores of the common soil fungus,
Mucor mucedo. In subsequent years additional ‘slime mold’ genera were
described including Acrasis, Acytostelium, Coenonia, Guttulinopsis, and
Polysphondylium (Cienkowski, 1873; Brefeld, 1884; Van Tieghem, 1884;
Olive, 1901; Raper, 1956).
A phylogenetic analysis based on DNA sequence data has indicated
that only Acytostelium, Dictyostelium and Polysphondylium are dictyostelid
‘slime molds’, and the remaining genera belong to various other sorocarpic
amoebae taxa (Brown & Silberman, 2013), with the exception of Coenonia,
which has not been isolated again since its description in the 1960s.
16
1mm
A
B
C
Figure 3. The three dictyostelid fruiting body (sorocarp) types. A. Acytostelium-type
sorocarps are relatively small, and the sorophore (stalk) is acellular. B. Dictyostelium-type sorocarps have cellular sorophores. These may lack branches, have an irregular branching pattern, bifurcate, or have sessile sori along the sorocarp. C. Polysphondylium-type sorocarps have a cellular sorophore and branches occurring in
whorls (i.e. at least two branches arising from the same node in at least one position
along the sorophore).
The three confirmed genera of dictyostelids are distinguished morphologically by differences in sorophore composition and branching pattern
(Figure 3). Acytostelium has the smallest fruiting bodies of the three genera,
and is easily recognized by its acellular stalk. The genus Dictyostelium has a
cellular stalk made from vacuolated amoebae and has either no branches or
irregular branches. The third genus, Polysphondylium, also has a cellular
stalk, but can be distinguished from Dictyostelium by the presence of
whorled branches (Figure 4). However, this seemingly straightforward classification system based on morphology is not consistent with the dictyostelids’ evolutionary history. Recent phylogenetic analyses have indicated that
none of these three genera are monophyletic (Swanson et al., 2002; Schaap
et al., 2006; Romeralo et al., 2012).
The first multi-region phylogenetic analysis of the dictyostelids indicated four major clades, referred to as Dictyostelid Groups 1-4 (Schaap et
al., 2006). This was followed by further analyses using different DNA regions and more taxa, which supported the earlier phylogeny and further divided the taxon into eight major groups (Romeralo et al., 2011a). These
eight groups include the earlier Dictyostelid Groups 1-4, of which Dictyostelid Group 2 is divided into Group 2A and 2B, along with three species
complexes (the polycarpum-complex, polycephalum-complex and the violaceum-complex). Accurately rooting the dictyostelid phylogeny proved to
be a challenge, but the root has now been confidently placed between Dictyostelid Groups 1+2 and Groups 3+4 using genomic information from different species across the taxon (Glöckner & Noegel, 2013; Romeralo et al.,
2013; Sheikh et al. in prep.).
17
There have been several estimates made about the age of the dictyostelids. Parikh et al. (2010) used the assumption that the rate of protein
evolution in plants and animals is similar to that in the Amoebozoa, and
extrapolated that Dictyostelid Group 4 had its origin about 400 million years
ago. This date was further corroborated by a genome-wide analysis
(Sucgang et al., 2011). Other authors have estimated the age of the dictyostelids as a whole, placing the origin of the group to ca. 600 mya (Heidel et al.,
2011), while a more recent study has estimated the dictyostelid origin to ca.
341-691 mya using multiple protein sequences as well as two fossil calibration points (Fiz-Palacios et al., 2013).
Biogeography
Biogeography is the study of organisms in space and time. It is typically broken into two sub-fields: ecological biogeography and historical
biogeography. Ecological biogeography studies the ecological factors affecting species distribution. Historical biogeography, on the other hand, focuses
on events occurring in the long-term (geological) scale that have shaped
species distributions and the evolutionary relationships among organisms. In
studies of historical biogeography, the biogeographer is usually searching
for either rare dispersal events (population division due to organism movement) or vicariance events (population division due to geologic change) to
explain distributions.
Ecological and historical biogeography may seem clear and easily distinguished from one another, but it is not so easy to tease them apart when
trying to make sense of protist distributions. While macroecologists can
count kangaroos, and tell them from wombats, it is much more ‘blurry’
when working with protist taxa – not only do microbiologists have the issue
of not easily knowing which species occur where (and more importantly,
where they aren’t), but they often cannot tell a kangaroo from a wombat –
or, in this case, an Apusomonas from a Thecomonas.
One of the earliest statements about protist biogeography was the
much-repeated maxim of Baas Becking (1934), who stated that in the case of
microorganisms ‘everything is everywhere, but the environment selects.’
Unfortunately the second part of this quotation was often dropped for the
sake of brevity, changing the statement from indicating that microorganisms
don’t have historical biogeographic patterns, to the indication that microorganisms don’t have any biogeographic patterns at all: historical or ecological. However, even from this early stage it is clear that Baas Becking understood the importance of ecological restrictions on protist distribution.
Indeed, the misinterpretation of Baas Becking's 1934 statement has
persisted into recent studies of protist biogeography (discussed in de Wit &
Bouvier, 2006). This has led to heated debates regarding the extent of mi18
croorganismal endemicity, most notably between W. Foissner and B.
Findlay and colleagues (cf Foissner, 1999, 2006; Finlay, 2002; Fenchel &
Finlay, 2004).
If everything is everywhere, where is everybody?
If it is true, as some suggest, that protist are only limited by ecology
and not by historical factors, then we would expect to find protist dispersal
units (spores, cysts, etc.) at a background rate in nearly all environments on
Earth.
One of the strongest lines of evidence for this resting-stage diversity is
the presence of the rare biosphere. The ‘rare biosphere’ refers to the large
number of operational taxonomic units (OTUs) occurring in very low densities in environmental samples, usually as indicated by culture-independent
methods (Sogin et al., 2006). It is possible that the rare biosphere is made up
of an assortment of organisms dispersed from all over the world. These organisms cannot thrive in that particular locality and are waiting in encysted
forms until their surroundings become more favorable. However, if this rare
biosphere diversity in fact represents organisms that are only limited by ecological conditions, one would expect that given the proper conditions in the
lab these dormant stages would become active again.
In an extensive survey of the Arctic myxomycetes (plasmodial slime
molds), Stephenson et al. (2000) noted that not a single tropical endemic was
recovered from any of the samples, despite recovering nearly two thousand
myxomycete isolates. The authors’ survey method was based on recording
both fruiting isolates observed in the field, and also recovering dormant isolates from bark samples under laboratory conditions. They speculated that if
everything was in fact everywhere (and the environment was responsible for
the dormant stage remaining dormant) then in the course of the study at least
one dormant tropical endemic would have been recovered – but none were.
This is an emblematic case of ‘absence of evidence,’ and while not
conclusive in and of itself this does bring up an important question: is ‘everything is everywhere’ falsifiable? Foissner (2006) discusses this and concludes that because the statement is in fact a metaphor, instead of a hypothesis, it cannot be falsified.
To determine which species occur where we must look at species occurrence data alongside niche modeling data (for example Aguilar et al.,
2013). The currency here is the taxon, either in the form of species or OTUs.
Those relying on a morphological species concept will undoubtedly view
protists as being primarily cosmopolitan (for example Fenchel & Finlay,
2006). If species are defined using molecular methods and/or a biological
species concept many more OTUs will generally be recognized, with important implications for microorganismal endemicity (discussed further in
19
Martiny et al., 2006; Caron, 2009; Bass & Boenigk, 2011; Boenigk et al.,
2012).
The taxonomic dilemma
In order to unravel the biogeographic patterns exhibited by protists, it
is helpful to first have well-defined taxa to study. This is logical: before we
can look at where something is, we need to know what that something is.
There are different methods used to define taxa: the morphological species
concept, the biological species concept and the phylogenetic species concept
are among the most frequently used. Protist taxonomy (as with other organism groups) has hinged on morphologic descriptions for centuries. However,
the use of a phylogenetic species concept is now becoming more common –
and the results from this method aren’t always consistent with inferences
based on morphology. Many taxonomists propose methods of delimitation
based on multiple lines of evidence (Mishler & Donoghue, 1982), while
some go even further to promote ‘integrative taxonomy’, based on total evidence (Dayrat, 2005).
With the recent availability of DNA sequence data available to build
increasingly detailed phylogenies it is now becoming clear that in some cases what we once considered to be a ‘species’ is in fact a series of genetically
distinct taxa, or ‘cryptic species’. Cryptic species are defined as two or more
unique taxa that are morphologically indistinguishable from one another.
Furthermore, species may be ‘pseudo-cryptic,’ indicating that they
appear to be cryptic species, but in light of a phylogenetic framework diagnostic morphological characteristics can be identified. It is often the case
that the diagnostic features form a continuum within pseudo-cryptic species
(for example, the morphologically defined organisms may be 1-8 mm long),
but in light of phylogeny this morphological continuum can be divided into
more accurate spectra, which are not evident without the phylogenetic
framework (in this hypothetical example there are actually two species, one
is 1-4 mm long, the other is 5-8 mm long).
Even within well-resolved phylogenies it isn’t always clear where to
draw the ‘species’ line. Because of the vast diversity of protists it is nearly
impossible to formulate an overarching rule that is applicable in all situations and with all taxa. As such, Boenigk et al. (2012) have emphasized that
species are entities created for our own convenience, and we should keep
that in mind. If we insist on defining them (which we must if we want to
describe their distribution patterns) they should be delimited on a case-bycase basis using all available information – phylogenetic, morphological and
ecological – and morphology should only be interpreted in the context of a
robust phylogenetic framework.
20
Here, we adhere to a phylogenetic species concept sensu Cracraft,
1983. In practice, this means that dictyostelid species are delimited as a
monophyletic group with diagnostic apomorphies. In order to diagnose a
dictyostelid isolate there are three steps. First, a tentative morphological
diagnosis is made. This diagnosis may be inconclusive, if the features are
not consistent with any other described species. Next DNA is extracted, one
or more DNA regions are sequenced, and a phylogeny is inferred using the
isolate and a wide selection of other closely related species. Finally, the position of the isolate in the phylogeny is assessed, and the morphology of the
isolate is compared to that of the most closely related species according to
the phylogeny. If the isolate’s morphology is inconsistent with that of its
sister taxon then it is described as a new species.
Aims
In this thesis I aim to investigate several aspects of dictyostelid systematics, ecology and biogeography. Paper I investigates a possible major
vector of dictyostelid dispersal: humans, and discusses the impact that anthropogenic dispersal may have on our understanding of protist biogeography. Paper II looks at the dictyostelid social amoebae in Northern Sweden,
which was previously thought to harbor very low dictyostelid species richness. Paper III continues this assessment of dictyostelids in high-latitude
environments. The work presented in Paper III looks at both the species
richness and ecological trends in Iceland, as well as general species richness
trends in the northern hemisphere, especially in relation to latitude. The final
paper, Paper IV, is a phylogenetic assessment of a species that is common
in high-latitude environments, but also has been found in other localities
around the world: Dictyostelium aureostipes.
21
Materials and Methods
The smallest of slimes have I found.
Collected - right off of the ground!
Spread it onto a plate, and before it's too late,
in extraction fluid it's drowned.
Collections
Over the course of this thesis soil collections were made at a number
of locations around the world. All of the isolates that were analyzed in Papers II and III, as well as some of the isolates examined in Paper IV, were
collected from Iceland and Sweden. The collection and culture protocols
were minimally adapted from the protocols in Cavender & Raper (1965).
Soil samples were taken by collecting 10 to 30 grams of wet-weight
matter from the top 1-3 centimeters of the organic matter soil horizon (the
top soil layer). Typically 2-3 samples were collected at each locality in order
to account for variation in vegetation and microhabitats. Each collection
locality was geo-referenced with GPS and the altitude was noted. Any associated vegetation was also recorded. Samples were placed in Whirl-Pack
plastic bags, and kept cool until they were brought back to UU, where they
were stored at 4°C until processing.
For Paper I, soils were collected from the bottom and sides of footware using a sterile metal scraping rod and were either stored at 4°C for up
to two months, or processed immediately following collection. For logistical reasons these samples were smaller than normal soil samples, varying
from 0.02-12.47 grams.
22
Culture, isolation and DNA extraction
In order to isolate dictyostelids from soil samples a standard soil dilution plating technique was employed (Cavender & Raper, 1965). A two-step
serial dilution was used for a final plating concentration of 50:1 (water:soil),
and 0.50 ml aliquots were plated on hay infusion agar (HI) plates with 0.25
ml of a heavy suspension of Klebsiella aerogenes. Plates were checked daily
starting two days after inoculation and continuing for two weeks thereafter.
Dictyostelids could be observed once they reached the starvation phase of
their asexual cycle and produced fruiting bodies. Spores from these fruiting
bodies were then replated with K. aerogenes on non-nutrient agar (NNA;
adapted from Raper, 1984; Table 1) for identification.
To extract DNA, pure-culture isolates were cultivated on standard
media agar (SM; adapted from Raper, 1984; Table 1) with K. aerogenes.
After several days of growth, amoebae from the periphery of the colony
were taken using a pipette tip and mixed with MasterAmp Buccal Swab
DNA Extraction Solution from Epicentre (Madison, WI, USA) and heated
for 30 min at 60 °C followed by 8 min at 98 °C.
Table 1. Recipes for dictyostelid growth media (HI, NNA and SM agar) and spore
storage solution (HL5). All ingredients are added to glass flasks, shaken to dissolve,
then autoclaved for 20 minutes at 120°C. The agar solutions are then allowed to cool
to 60-80°C and 25 ml is added to each Petri dish and allowed to cool to room temperature. Hay infusion agar is made in a two-step process. The first step combines
6.2 grams of dried hay (Poa sp.) and 800 ml of ddH2O, which is then autoclaved as
described above. This hay-infused water is then used instead of ddH2O when making the agar plates. Plates are stored at 4°C until use, or for up to one month. HL5
media is allowed to cool to room temperature after autoclaving, and is then stored at
4° for up to three months.
Hay infusion
agar (HI)
KH2PO4
0.7 g
Na2HPO4
0.27 g
Peptone
Yeast extract
Glucose
MgSO4
K2HPO4
Bactoagar
7.0 g
ddH2O
400 ml
Non-nutrient Standard media
agar (NNA) agar (SM)
0.48 g
0.76 g
0.192 g
4.0 g
0.4 g
4.0 g
0.4 g
0.24 g
6.0 g
8.0 g
400 ml
400 ml
HL5 media
0.05 g
0.05 g
1.4 g
0.7 g
1.35 g
100 ml
23
Spores of all unique isolates recovered over the course of these studies
were frozen in HL5 media (Cocucci & Sussman, 1970; Table 1) in triplicate
and stored at -80°C at UU. Additionally, any isolates received from other
collectors, or from the Dicty Stock Center were similarly stored for future
reference. Type isolates from Paper II were deposited at the Dicty Stock
Center (Fey et al., 2006).
Morphological diagnoses
Dictyostelids were isolated from HI soil dilution plates (Table 1) by
placing a single sorus (terminal ball of spores, illustrated in Figure 4) onto
an NNA plate with the bacterium Klebsiella aerogenes as a food source
(Cavender & Raper, 1965). The spores from the sorus that was transferred
would then germinate, consume the bacteria, reproduce by binary fission and
eventually starve, triggering the aggregation process again. This aggregation
process leads to the production of asexual, multicellular fruiting bodies that
are genetically identical.
These fruiting bodies were then studied morphologically, using a series of morphological characteristics for diagnosis (reviewed in Raper, 1984;
Hagiwara, 1989). These features, and variations thereof, are illustrated in
Figures 4 and 5. The characters most commonly used in species identification are: aggregation size, shape and division; early sorogen (slug) shape and
migration pattern; coloration at any stage; fruiting body size and shape; fruiting body base and tip size and shape; number, size and pattern of lateral
branches; sorus size and shape; and finally spore size, shape and presence/absence of vesicles or polar granules. In addition, other ecological and
behavioral characters may be used for species identification. Examples of
these are temperature preference, exhibited by species like Dictyostelium
septentrionalis, which grows preferentially at 17°C and is found only in
cooler habitats (Cavender, 1978). Likewise, the act of feeding on other dictyostelid amoebae, as exhibited by the ‘cannibalistic’ species D. caveatum is
a behavioral trait used for identification (Waddell, 1982).
24
elliptical oblong/
oval
Sorus
reniform round
Spores
PG-­
PG+
irregular granules
unconsolidated consolidated
none
Lateral
Branches
irregular (Acytostelium or
Dictyostelium)
Sorophore
whorls
(Polysphondylium)
acellular
cellular
(Acytostelium)
(Dictyostelium or Polysphondylium)
Support Structure
no support support cell(s) basal disk
structure
Figure 4. A dictyostelid sorocarp (fruiting body). Morphological features, and their
respective variations, that are used for species identification are shown.
25
Habit
Aggregation
solitary
without subdivision
mound
gregarious
subdividing along streams
radiate clustered
subdividing centrallly
Slug (Early Sorogen)
not migrating
coremiform
migrating without stalk formation
migrating with stalk formation
Tip Shape
simple
complex
piliform/
fusiform
accuminate
clavate
round
clavate
obtuse
capitate
Base Shape
conical
accuminate
digitate
Figure 5. Morphological features of the asexual, multicellular fruiting stage in the
dictyostelids that are used for species identification. Tip and base shape diagrams
are after Hagiwara (1989).
26
Genetic markers
In total, three genetic markers were used to infer the phylogenies in
Papers I, II and IV. The ribosomal small subunit (SSU) and internal transcribed spacer (ITS) are both nuclear markers that were previously utilized
to infer dictyostelid-wide phylogenies (Schaap et al., 2006; Romeralo et al.,
2007a, 2010). Additionally, primers for a portion of one mitochondrial
marker, the ATPase1 (atp1), were developed for dictyostelids for use in
Paper IV. The SSU was employed in all three papers, and the ITS and atp1
were used along with the SSU in Paper IV. PCR primers and programs are
outlined in Tables 2 and 3.
Table 2. PCR primers used to amplify the three genetic markers used in this thesis.
The primer name, 5’-3’ sequence and reference is given. Primers marked with an
asterisk (*) were used for internal sequencing of longer fragments.
Primer name
SSU
18S-FA
18S-RB
D542F*
D1340R*
ITS
18S-5_8-s1
ITS_2
5_8-s1*
18S-5_8-s2*
atp1
ATP_352F
ATP_897R
5’-3’ Primer sequence
Reference
AACCTGGTTGATCCTGCCAG
Medlin et al. 1988
Medlin et al. 1988
Schaap et al. 2006
Schaap et al. 2006
TGATCCTTCTGCAGGTTCAC
ACAATTGGAGGGCAAGTCTG
TCGAGGTCTCGTCCGTTATC
GAGGAAGGAGAAGTCGTAACAAGGTATC
GCTTACTGATATGCTTAAGTTCAGCGGG
GAAGACCGTAGCAAACTGCG
TTATCGCAGTTTGCTACGGTCTTC
TGTTAGGAMGAGTAGTWGATGTATTAGG
TCTCCTGGRTAYGCTTCTCKTCCTGG
Romeralo et al. 2007
Romeralo et al. 2007
Romeralo et al. 2007
Romeralo et al. 2007
Paper IV
Paper IV
Table 3. PCR programs used to amplify sections of the SSU, ITS and atp1.
Region
PCR Program
Reference
SSU
atp1
ITS
5’-95°, 30x (30”-95°, 1’-56°, 2’-72°), 10’-72°
Same as above
5’-95°, 30x (1’-94°, 1’-50°, 2’-72°), 10’-72°
Medlin et al., 1988
Paper IV
Romeralo et al., 2010
27
Phylogenetic Analyses
All phylogenies presented herein were inferred using both maximum
likelihood and Bayesian inference. Prior to analysis, all datasets were
checked for the most suitable model of evolution using either MrModelTest
(Nylander, 2004) or JModelTest (Posada, 2008).
The Bayesian analyses presented in Paper I, II and IV were run using
MrBayes v.3.2 (Ronquist & Huelsenbeck, 2003). Those in Papers II and IV
were executed remotely using the Cipres Web Portal (Miller et al., 2011).
Maximum likelihood analyses for Papers I, II and IV were run using
RAxML (Stamatakis, 2006), either through the RAxML BlackBox web portal, or the RAxML GUI (Silvestro & Michalak, 2012) with the settings specified in the respective papers.
The resulting phylogenies of all analyses were initially visualized in
FigTree v.1.3.1 (Rambaut, 2009), and subsequently edited for publication in
either Microsoft PowerPoint or Adobe Illustrator.
28
Summary of Papers
Paper I: The boots study
Perrigo, A.L., Romeralo, M., Baldauf, S.L. (2012) What’s on your boots: an
investigation into the role we play in protist dispersal. Journal of Biogeography, 39(5):998–1003
The dictyostelids are small amoebae that form various resistant stages.
These include spores, microcysts and macrocysts – all of which can be dispersed over long distances. Dictyostelids have no active form of dispersal
and are not dispersed by wind. As such, they are dependent on vectors to
move them from place to place. Earlier studies have shown that a variety of
animals transport dictyostelids, either externally (by adhesion to skin surfaces) or internally (by ingestion and excretion). These vectors include cave
crickets, earthworms, salamanders, bats, birds (including long-distance migratory species) and other small invertebrates (Suthers, 1985; Huss, 1989;
Stephenson & Landolt, 1992; Stephenson et al., 2007).
In Paper I, we predicted that while dictyostelids resistant stages may
have evolved to be transported by these smaller organisms, humans could
now be moving them around at an unprecedented rate. To investigate this we
collected soil and debris from the soles of footwear and cultivated it using
standard dictyostelid recovery methods. We found that of the 18 pairs of
shoes that were assessed, four carried dictyostelids that were able to form
viable amoeba populations. Two of the pairs of shoes carried two species,
and the other two carried only a single species. The species that were recovered were identified using both morphological characters and phylogenetic
reconstruction. The species found were Dictyostelium leptosomopsis, D.
minutum, D. sphaerocephalum and Polysphondylium fuscans. P. fuscans
was still undescribed at the time of publication of Paper I, but was later
formally described in Paper II.
In Paper I we suggest that the morphology of the dictyostelid fruiting
bodies may play a major role in the dispersal potential of different species.
During this study D. sphaerocephalum was recovered three times. This spe29
cies has some of the largest sori of any dictyostelids, and also has been previously noted for its high dispersal and colonization potential, as it is often
found in disturbed sites and agricultural fields around the world (Swanson et
al., 1999; Paper III). Undoubtedly, as one of the few taxonomically welldelimited and cosmopolitan species (Swanson et al., 1999; Romeralo et al.,
2007b), this dictyostelid has specialized as one of the ‘weeds’ of the protist
world.
Anthropogenic dispersal of dictyostelids has major implications for
our understanding of these microorganisms’ biogeographical patterns. In
particular, historical biogeographical patterns that depend on rare events
over geologic time may be confounded by human activities that include frequent movement over long distances. To this end it is interesting to note that
the four sets of footwear that were found to be carrying dictyostelids had
four of the five largest amounts of soil adhering to them. This suggests that
the simple act of ‘wiping your feet at the door’ could drastically decrease the
incidence of invasive protist introductions.
30
Paper II: Northern Sweden and new species
Perrigo, A.L., Baldauf, S.L., Romeralo, M. (2013) Diversity of dictyostelid
social amoebae in high latitude habitats of Northern Sweden. Fungal Diversity, 57(1):185–198
Paper II investigates dictyostelids of Northern Sweden in order to assess species richness in high-latitude environments. The only previous study
of dictyostelid social amoebae in Sweden investigated eight localities spanning the length of the country, but only used morphological criteria for species descriptions (Kawabe, 1995). In Paper II we expanded on Kawabe’s
work by including 29 sampling localities. These sites were selected to cover
a large range of vegetation types. All dictyostelid species were initially identified based on morphology and subsequently confirmed with nuclear SSU
sequence data.
Nine dictyostelid species were recovered from Northern Sweden, two
of which were previously undescribed. These are described in Paper II as
Dictyostelium barbibulus and Polysphondylium fuscans. D. barbibulus belongs to Dictyostelid Group 4, and is morphologically most similar to D.
septentrionalis, but differs in key characters such as sorocarp height, clustered growth pattern and the presence of a basal disk. D. barbibulus exhibits
a strongly stoloniferous habit, whereby newly germinated amoebae aggregate directly upon collapse of a sorus. This trait is also shared with D. chordatum and D. implicatum, which together form a clade with D. barbibulus.
The second new species, Polysphondylium fuscans, is part of the violaceum-complex, and exhibits characteristics typical of this group including
whorled branches and purple coloration of the sori. In fact, P. fuscans would
fit into the broad morphological description of P. violaceum s.l., but the
phylogeny based on SSU data indicates that P. fuscans is molecularly distinct from P. violaceum. Furthermore, several morphological characteristics
differentiate it from P. violaceum senso Raper (1984), such as the lower
number of whorls and the light coloration of the sori for which it is named.
This species was first recovered in Paper I, and has since been recovered
from several localities in Norway (Romeralo et al., unpublished data).
Of the nine species, seven are new records for Sweden. Only D. mucoroides and D. minutum had been recovered earlier (Palm, 1935; Kawabe,
1995; Paper I). Three other species that had been recovered in Sweden previously, D. purpureum, P. pallidum, and P. violaceum were not recovered in
this study. The reasons for finding different species are discussed in detail in
Paper II, and probably are due in part to the presence of pseudo-cryptic
species, such as P. fuscans, which looks similar to P. violaceum, but is phylogenetically unique and morphologically differentiable in light of the phylogeny.
31
This study emphasized that the species richness of dictyostelids in the
high-latitude regions of the northern hemisphere may be greater than initially expected. More thorough sampling efforts in these regions may still recover previously unknown species, as was demonstrated by the two species
described here. Furthermore, by looking at both morphological differences
along with phylogenetic methods it is possible to delimit species that may
otherwise be identified as belonging to larger species complexes.
32
Paper III: Iceland and the latitudinal gradient
Perrigo, A.L., Moya-Larano, J., Baldauf, S.L., Romeralo, M. (Submitted)
Everything is not everywhere: a latitudinal gradient of protist diversity.
After finding that the species richness of Sweden was much higher
than previously known (Paper II), we moved on to work in an area at a
similar latitude, but much more geographically isolated than Sweden: Iceland. Here we assessed both the dictyostelid species richness of the island
and also conducted statistical analyses to find ecological patterns in habitat
preferences. Additionally, a global analysis of previously published reports
of dictyostelid species occurrence was conducted in order to assess the number of species anticipated at different latitudes. This was used to investigate
if the dictyostelid exhibit a latitudinal gradient of species richness.
Only four dictyostelid species were recovered from Iceland. This was
surprising, considering that much higher numbers of species were recovered
from other high-latitude localities. This may be a result of historical processes similar to those that have contributed to the low vascular plant diversity
on Iceland, such as the island’s distance from other landmasses and the relatively infrequent rate of successful dispersal from the mainland to Iceland.
Here we found that the dictyostelid richness on Iceland was significantly
correlated with both soil pH and with altitude. However, it is possible that
the effect of altitude could be correlated to other untested factors such as
vegetation diversity.
The global analysis of dictyostelid occurrence found a significant
negative correlation with latitude, i.e. more species are expected towards the
equator (P=0.003). This trend, known as the latitudinal gradient of species
richness, is well known in macroorganisms, but very little evidence has been
presented for a similar trend in microorganisms.
Paper III suggests that dictyostelids exhibit similar ecological biogeographic trends as larger organisms. It also presents evidence for the environmental limitations (pH and altitude) of dictyostelid occurrence, which
corroborate earlier findings (Romeralo et al., 2011b).
33
Paper IV: Dictyostelium aureostipes species complex
Perrigo, A.L., Romeralo, M., and Baldauf, S.L. (Submitted).
The yellow slime mold is a red herring: large hidden diversity in a single
protest morphospecies.
Dictyostelium aureostipes is a Group 1 dictyostelid that is notable for
the yellow coloration of its fruiting bodies and its often highly-branching
sorophores. Early dictyostelid phylogenies indicated that D. aureostipes var.
aureostipes and D. aureostipes var. helveticum together may not be monophyletic (Schaap et al., 2006; Romeralo et al., 2011a). In Paper IV we assessed the monophyly of D. aureostipes in order to a) better understand the
species relationships in Dictyostelid Group 1 and b) to determine if D.
aureostipes is in fact a single, cosmopolitan species, or if it is made up of a
number of species.
Fifty-seven isolates of D. aureostipes and closely related species were
collected and the SSU and ITS regions were sequenced, along with the atp1,
a mitochondrial marker designed for this study. These combined sequence
data were used to infer a phylogeny for D. aureostipes and several closely
related species, selected based on earlier molecular phylogenies (Schaap et
al., 2006; Romeralo et al., 2011a).
The resulting phylogeny (Figure 6) indicates that the isolates identified as D. aureostipes do not form a monophyletic group, and in fact make
up at least five genetically distinct clades that are interspersed with other
dictyostelid morphospecies. Furthermore, these five clades each show
unique biogeographical patterns.
Each of the five D. aureostipes clades is well-supported in the phylogeny, and these clades probably represent at least as many species. However, further morphological work will be needed in order to delimit and describe the species in this complex. It is notable that the deeper nodes in this
phylogeny are not well supported (Figure 6). This could be due to the use of
inappropriate markers (too quickly evolving) in regards to this specific issue,
but biological explanations are also possible.
Paper IV concludes that D. aureostipes is one of a number of protist
‘species complexes’ which are delimited by a striking morphological feature
– in this case yellow pigmentation. Species complexes are a leading reason
that protist species richness is routinely underestimated. Furthermore, species delimited by morphology alone often appear to be cosmopolitan, when
in fact they are made up of a series of geographically limited cryptic or
pseudo-cryptic species (Heger et al., 2009). This has important implications
34
for both conservation and invasion biology. For these reasons we emphasize
the need for well-sampled multi-gene phylogenies as a basis for taxonomic
delimitation and biogeographic studies in protists.
D. fasciculatum HM595
D. fasciculatum Nor86D
D. fasciculatum Nor84E
D. fasciculatum Ice238A2
D. fasciculatum SH3
Dictyostelium aureostipes
Got9A1
D. (cf) aureostipes
AKL43C
D. sp
TAS30A
D. aureostipes var. helveticum
D. antarcticum NZ43B
‘FAD’
NZ125B
100/1.0
D. fasciculatum NZ155B1
Clade
D. delicatum TNS226
OH438
GSE7B
NZ40C
KAL7A
OZ17A
Got5B4
61/1.0
Got8A1
D. fasciculatum SmokOW9A
Chile10B1
Thai3A2
Thai2C1
CR6B1
AU7B
TH39A
Myxobasis
B15A
77/1.0
TH18D
Clade
SF2
OH396
-/0.95
TH1A
D. myxobasis NT2A
THC11X
OH111
OH110 BW6
D. aureostipes I3
Aureostipes
KP3
89/1.0
JKS150
-/0.94
Clade
YA6
69/0.99
BP7B
MAQ52B
57/0.71
100/1.0
TH3B
71/0.99
Thailand Clade
TH4B
Got3A2
LR2
D. bifurcatum UK5
Nor90A
HM593
HM592
HM594
Nor83C
Helveticum
100/1.0
Sweden14-1
-/0.94
AKL28B
Clade
D. aureostipes var. helveticum GE1
Nor99A
Sweden11F
Sweden8W
100/1.0
52A1
100/1.0
D. medusoides OH592
93/1.0
D. granulophorum CH11-4
D. mexicanum Mex-TF4B1
D. stellatum SAB7B
93/1.0
D. parvisporum OS126
Outgroups
95/1.0
D. microsporum Hagiwara143
92/1.0
D. amphisporum BM9A
100/1.0
D. macrocarpum
D. exiguum KP94
MGE2
0.4 substitutions per site
Figure 6. Phylogeny of Dictyostelid Group 1A+B including multiple isolates of
Dictyostelium aureostipes and D. fasciculatum morphospecies. The tree was derived
by Bayesian analysis of combined SSU and atp1 sequences. The names indicated on
the phylogeny refer to various isolates identified as D. aureostipes as indicated by
the key in the upper left. Names in bold italics indicate holotypes. Maximum likelihood bootstrap support (BS) over 50% and Bayesian inference posterior probabilities (PP) over 0.70 are shown on the branches to the left and right of the slash mark,
35
respectively. The five well-supported clades including D. aureostipes isolates are
indicated by colored backgrounds with proposed group names specified to the right.
The phylogeny is rooted following Schaap et al. (2006).
36
Conclusions
This thesis consists of four papers that explore the systematics and biogeography of dictyostelid social amoebae. The findings expand on previous
knowledge of global dictyostelid species richness and distribution patterns.
Furthermore, the results have several implications for the possible endemicity of species in the group as well as the limitations of the current taxonomy.
The papers in this thesis highlight some of the ecological biogeographic patterns exhibited by dictyostelids. Building on earlier evidence,
Paper III shows that in Iceland dictyostelid species occurrence peaks in
near neutral pH soils, and also at lower altitudes. Furthermore, a global analysis confirmed that dictyostelids follow a latitudinal gradient of species
richness in the Northern hemisphere – a pattern that had been observed but
never statistically tested. However, though high latitude regions, such as
Sweden, have fewer species than the tropic this does not mean that the relatively low species richness of these areas is fully known. In Paper II two
new species are described, Dictyostelium barbibulus and Polysphondylium
fuscans, and five further species were reported from Sweden for the first
time. Together, the data suggest that dictyostelids show some ecological
patterns that are similar to those seen in macroorganisms, and that continued
work is needed to know how speciose this group is.
In the context of the ‘everything is everywhere debate,’ several points
can be made based on the results of the papers in this thesis. Some species,
which are morphologically defined, appear to be cosmopolitan. This was the
case with Dictyostelium aureostipes in Paper IV. After this morphospecies
was assessed in a phylogenetic context it became clear that it is in fact not
everywhere, and is instead a species complex made up of a series of distinct
clades with varying distributions. This is a case of taxonomic confusion,
which is a major problem when assessing species distributions. Furthermore,
the results from Paper I, where four species of dictyostelid were recovered
from boots, are evidence of anthropogenic dispersal in these microorganisms. If dictyostelids are being frequently transported by humans, as seems
to be the case, this may be rapidly expanding species distributions. This has
consequences for our understanding of historical biogeographic patterns,
which may be obscured before they are detected.
37
Svensk Sammanfattning
Förundra dig över allt, även det mest alldagliga.
Valspråk av Carl von Linné (1707-1778)
Denna avhandling behandlar systematiken och biogeografin hos dictyostelida sociala amöbor. Dictyostelider är bakterieätande amöbor som
lever i marken och kan hittas över hela världen. Det finns runt 150 kända
arter, men troligtvis är den verkliga artrikedom betydligt högre. Dictyostelider är medlemmar av Amoebozoa, och kan mer allmänt betraktas som
"protister." Protister är en generellt benämning för alla eukaryota organismer
som inte är växter, djur eller svampar.
Dictyosteliderna är ett intressant protistiskt taxon då de också har ett
äkta multicellulärt stadium under deras livscykel. När amöborna svälter
skickar de ut en kemisk signal, ett så kallat akrasin, vilket initierar en aggregering med alla närliggande amöbor. Tillsammans bildar de en snigelliknande organism som kan migrera korta sträckor innan den slutligen formar en fruktkropp. Fruktkroppen består av en stjälk på upp till cirka en centimeter, med ett sorus (”kula”) av sporer i slutänden, och ibland också med
ytterligare sori på eventuella sidogrenar. Det är denna multicellulära
fruktkropp, den såkallade sorocarpen, som oftast används när en dictyostelid
ska artbestämmas.
Dictyosteliderna är indelade i tre släkten: Acytostelium (med acellulära stjälkar), Dictyostelium (med cellulära stjälkar och antingen oregelbundna
eller inga grenar), samt Polysphondylium (med cellulära stjälkar och vridna
grenar). Trots de morfologiska likheterna inom de olika släktena så har genetiska studier visat att alla tre släkten är polyfyletiska. Baserat på dictyostelidernas fylogeni kan istället åtta större grupper urskiljas: Dictyostelid
Grupp 1, 2A, 2B, 3 och 4, samt violaceum-komplexet, polycarpumkomplexet och polycephalum-komplexet.
En av de viktigaste biogeografiska frågorna när det gäller såväl dictyostelider som andra eukaryota mikroorganismer är huruvida dessa organismer har en begränsad utbredning och vad detta i så fall beror på. Om en art
har en sådan utbredning så kan man vidare ställa sig frågan: Är detta ett
resultat av ekologiska eller historiska processer, eller en kombination av
båda?
38
Artikel I behandlade en möjlig spridningsväg för dictyostelider:
Människor. Det har tidigare visats att en mängd små djur, så som syrsor,
maskar och fåglar, kan transportera dictyostelider till nya platser, men att
också människan kan ha en inverkan på dess spridning hade hittills inte varit
känt. I denna artikel hade smuts från 18 par skor analyserats. Det visade sig
att åtminstone fyra av paren hade levande dictyostelider under skosulorna.
Dessa fyra par bar på totalt tre olika arter av dictyostelider, inklusive en ny
art som vid artikelns publicering ännu inte beskrivits. I artikel II beskrevs
denna nya art som Polysphondylium fuscans (sp.nov.).
Artikel II undersökte artrikedomen av dictyotelider i norra Sverige.
Nio arter återfanns i denna studie, varav två nya arter: Dictyostelium barbibulus (sp.nov.) samt P. fuscans (sp.nov.). Denna artikel belyste även fördelen
med att använda gensekvensering för identifiering av dictyostelider. Vidare
diskuterade artikeln även svårigheten med att identifiera vissa arter som
liknar varandra morfologiskt men är distinkta enligt molekylära fylogenetiska analyser. Även förekomsten av artkomplex inom flera av de stora
fylogenetiskt definierade grupperna av dictyostelider behandlades.
Artikel III fokuserade på de ekologiska mönstren av dictyostelidernas
biogeografi. Här undersöktes hur olika miljöförhållanden relaterar till
förekomsten av dictyostelider. Det visades att antalet arter av dictyostelider
på Island korrelerar negativt med höjden (dvs. fler arter vid lägre latituder).
Det visades också att majoriteten av alla dictyostelider påträffas vid nära
neutrala pH-värden, även om ytterligare en topp i förekomst kunde ses runt
pH=5. I artikel III gjordes dessutom en global analys, baserat på tidigare
publicerade artiklar i ämnet, av de dictyostelider som beskrivits från norra
halvklotet med syftet att kunna förutsäga hur gruppens artrikedom förändras
beroende på latituden. Resultatet av detta visade att dictyostelidernas mångfald minskar signifikant med ökande latitud, ett mönster som också kan ses
hos de flesta makroorganismer och som kommit att kallas den ”latitudinella
gradienten av arternas diversitet”.
I den sista artikeln, artikel IV, behandlades den möjliga polyfylin inom Grupp 1 dictyosteliden Dictyostelium aureostipes. Ett protokoll för att
amplifiera den mitokondriella atp1-region i dictyostelider utvecklades för
denna studie. Denna region användes vidare som supplement till de mer
allmänt använda SSU och ITS för att härleda fylogenin hos D. aureostipes
och andra närbesläktade dictyostelider. Dessa tre genetiska markörer amplifierades utifrån 57 isolat bestående av D. aureostipes och närbesläktade arter. Den resulterande fylogenin visade att de isolat som tidigare identifierats
som D. aureostipes inte är en enhetlig monofyletisk grupp, utan snarare utgörs av ett antal olika arter.
Artiklarna i denna avhandling belyser tillsammans svårigheterna med
att identifiera och avgränsa olika dictyostelida arter, vilket tydligt framgår i
artikel II och IV. De ekologiska faktorer som bidrar till dictyostelidernas
39
naturliga utbredning utreds i artikel III, där en latitudinell förändring av
deras mångfald förutsägs och bekräftas, vilket tyder på att dessa eukaryota
mikroorganismer uppvisar liknande biogeografiska mönster som observerats
hos makroorganismer. I artikel I identifieras slutligen människan som en
viktig bidragande faktor till spridningen av dictyostelider – något som
avsevärt kan försvåra analysen av dessa organismers historiska utbredning.
40
Acknowledgements
I would like to start by thanking my supervisors, Sandie and Maria,
for all of the energy and time you have committed to me over the last five
years. Nothing here would have been possible without you.
Sandie, you have taught me so much about science. Especially in my
writing, you have shown me the power of brevity and clarity. I have also
enjoyed all of our time chatting about cats, gardens and stateside visits.
Maria R, your patience with me during the endless hours I spent on
the microscope asking questions was amazing. The amount that you taught
me about these awesome little amoebae is so much more than I ever expected. Your support and encouragement really got me through much more
than I ever could have handled on my own. You are one of the strong, women researchers that I aspire to be like.
To my fellow PhD students at SystBio: Anders L, Anders R, Anja,
Anneleen, Astrid, Chanda, Ding, Hugo, John, Maria L, Ping, Sanea, Sarina,
Stina W, Sunniva and Vichith. Every one of you has, at some point, supported me by hashing out ideas, providing moral support or (most importantly?)
by sharing delicious fika. The PhD students of SystBio seem to work on an
unspoken open-door policy, and I am grateful to have been able to take advantage of that. We’re all in this together.
I would especially like to thank my colleagues that read this thesis and
provided me with valuable feedback: Magnus, Maria, Martin, Mats, Mikael,
Petra and Åsa. They caught many errors and provided interesting discussion
on numerous topics. Any remaining oversights in the thesis are mine alone.
Emma Arvestål transformed my Swedish summary from a Googletranslate mess into something coherent and readable. John did the final
touch-ups. Thank you both.
Afsaneh and Nahid, thank you for your help in the lab, Swedish practice, and hints on integrating into Swedish life and culture.
Anneleen: you, unlike Hugo, are a pretty good acknowledgement
writer (see de Boer, 2012; Kool, 2012). I’m not sure what exactly it was that
41
you and Cajsa saw in me during the VEM course in 2007, but I suspect you
picked up on my fika ability early on – leading to my recruitment as your
student, ice-cream-on-the-lawn partner, floating-in-the-pool-in-Marrakech
companion and donkey stealer (sorry, Floris). You are the only other person
insane enough to agree to take off to Jordan for a week with the goals of a)
writing manuscripts and b) riding camels in the desert wearing lab jackets
(not necessarily in that order). I hope there are many more efficiency excursions and synchronized tomatoes in our future. Mora, mora.
Hugo, you’re OK too. Thanks for teaching me the art of applying for
external money and how to be shamelessly confident and self-promoting. I
think you out-American me at times. Also, thanks for helping me tow my
car half way across Uppsala by a dodgy rope attached to the engine (and
various other car fiascos). Good judgment should never get in the way of
getting things done.
Karin L, you have shown impressive patience with me. One would
think that after five years I could operate Tur-Retur on my own, but alas: no.
It was always a pleasure to bother you for admin help.
Marianne, you saved me from more teaching disasters than I could
probably count. Thanks for being so on top of it.
Mikael, the bad cop: thank you for explaining the difference between
maximum likelihood and Bayesian analysis. After three glasses of wine it
made perfect sense. You always know when I need to be taken down a notch
and as much as you try not to be, you are an excellent support. And now I
know that yes, it is attached.
Petra, the good cop, and the first person I got to know at SystBio: you
are an inspiration. Not only your ability to juggle kids, work, teaching and
some PhD students, but also your capacity to keep a positive attitude
throughout it all. You always have time for my questions, musings and rants
– and I don’t know how you do it.
I have shared an office with some pretty fantastic people over the last
five years: Anja, Henrik L, Anneleen, Stina B, Crystal, Stephanie, Henrik S,
Sanea, Sarina and Yan. I also shared it with some pretty gross stick bugs.
Sorry about that, Anja. But thanks Ralf and Michi for taking some of them
off my hands.
(A selection of) the SystBio kids: Floris, Bente, Dirk, Julius, Raphael.
The hours you spent playing in my office may not have been the most productive for me, but they were among the most fun. You all know that I keep
the most important items in the bottom drawer.
All of my students: you have probably taught me much more than I
ever managed to teach you. I am happy that so many of you are now among
my peers: Glib, Sanea, Stina B and Stina W, and others.
42
A special thanks to the project students I had the privilege to supervise: Karin S and Albert. The energy you bring to your projects is a fun reminder that this is pretty cool stuff we get to do.
The professors at the department: Inga, Leif, Magnus, Mats, Mikael,
Petra, Sandie and Thomas. You are such a wealth of knowledge and I am
happy to have learned from all of you.
The SystBio young researchers: Baset, Maria R, Martin, Omar, Paco,
Sanja and Åsa. For a PhD student, you guys are one of the best resources
and (hopefully) a glimpse into what comes after the defense.
The other members of the Baldauf Lab: CJ, Ding, Gemma, Johanna,
Maria R, Omar, Ping and Sanea. It has been a pleasure to work with all of
you.
Many more colleagues and co-workers who have made it fun to come
to work every day: Agneta, Elisabeth B, Elisabeth L, Henrik V and Katarina.
Johanna and Maria L: life can be unfair and unjustly short. You both
showed so much strength and unbelievable positive attitudes. You are
missed.
Everyone at Palaeo: Aodhán, Emma, Graham, Heda, Illiam, Jenny,
Linda, Luka, Michi, Oskar, Ralf and Steve - thank you for the many beers,
TGIFs and a little outside perspective.
Birgitta, Elisabet and Lars-Göran, my Swedish family, thank you for
many lovely visits at Hunnebostrand. You make me feel at home here.
My friends in Kirkland, Vancouver, Uppsala and those spread around
the rest of the world: I am happy to be associated with such a diverse and
remarkable group of people. The world feels a bit smaller knowing that
wherever I go I am likely to meet up with an old friend.
Over the course of my studies I received funding, grants and stipends
from a number of groups. These allowed me to attend conferences and
courses, do field work, meet with collaborators, and buy laboratory and field
equipment. I am grateful to: Anna Maria Lundins Stipendiefond, Colorado
State University: Summer Soil Institute, EBC Graduaue School on Genomes
and Phenotypes, ForBio Research School in Biosystematics, Gertrud Thelins
Resestipendium, Helge Ax:son Johnsons Stiftelse, Liljewalchs Resestipendium, National Geographic Global Exploration Fund, Sernanders Stiftelse,
Signhild Engqvists Stiftelse, Stiftelsen Lars Hiertas Minne and Tullbergs för
Biologisk Forskning.
Many people back home have influenced me and helped me get here:
Sharon Winter, my high school biology teacher, and the first person to
introduce me to PCR (done by hand). I didn’t know it at the time, but you set
me on the right path. Thank you.
43
Dr. Bowerman, and everyone at the Cat & Dog Clinic: thanks for
keeping me around. My years there were the most comprehensive animal
biology course I’ve had to date. More importantly you guys taught me about
responsibility, dealing with people and how to have plenty of fun while getting lots done.
The first PhD students I ever met, Andrew and Louise at Earth and
Ocean Sciences, UBC: you guys showed me what a life in research was, and
that it is where I belong.
Wayne Goodey at UBC: thank you for loaning me books and making
a 300-person ecology course feel a little smaller.
Susan: I am now aware that you are not my grandmother, but you are
family. I’m looking forward to my next Medford visit.
Laurent, the only person with as much energy as Lia: it is always an
adventure to visit you guys (in France or LA) and to join your boisterous
French family for a few days.
Cousin Megan: very few people visited me here in Sweden, and the
number of times you have taken the initiative to come and visit has meant so
much to me… and not only because we have epic adventures… although
that doesn’t hurt.
The rest of the Perrigos, Babbs, Wilsons and Gandees: Grandma Honey & Grandpa Jim, Grandma Mary & Grandpa George, Susie, Rick, Mary
Kay, Tom, Christine, Paul, Mary Sue, Megan, Orion, Kevin, Tracy, Elliott,
Julie, Robbie, Tami, Tommy & all the kids. Thanks for being a fantastic
family. I’m lucky.
Chris: you have been an unwavering source of support over the last
five years. You have always known when I needed a glass of wine after
work and when to encourage a lazy Sunday. You have managed to make my
research sound exciting when I shy away from talking about it. Thank you
for encouraging me to undertake a PhD in the first place and for joining me
in Sweden.
And finally, thank you to my family. Thank you dad for teaching me
to do long division to keep me quiet on road trips, for building me a circuit
board to play with, showing me how to chart the temperature to see when it
would start to snow, taking me fossil hunting and taking me to your amateur
astronomy lectures. Mom: thank you for putting up with a clone of dad. It
couldn’t be easy to have two of us in the house (the same thank you also
goes to Lia). Thank you for never forcing me to go to school when I didn’t
feel like it, for never pushing me to do my homework and for always letting
me just be myself. Somehow this all backfired and I turned into a motivated
person. Thank you guys for sending me to Space Camp, and for letting me
take off to other countries to pursue my education and my life. Thank you
Lia for trying to keep me from being too serious, for reminding me that
sometimes it isn’t all about being cheap, and for sneakily morphing from an
44
annoying little sister into a good friend and someone I can always count on.
Also thank you for your dramatic readings of early versions of this thesis in
your best David Attenborough voice. I love you guys.
I am sure I have forgotten to include some people. I’m sorry for any oversights, please add yourself here:
____________ thank you for ____________, but Allison you are a _______
(your name)
(happy memory we have together)
(insult)
for forgetting to include me in your acknowledgements.
45
References
Adl S.M., Leander B.S., Simpson A.G.B., Archibald J.M., Anderson O.R.,
Bass D., Bowser S.S., Brugerolle G., Farmer M.A., Karpov S.,
Kolisko M., Lane C.E., Lodge D.J., Mann D.G., Meisterfeld R.,
Mendoza L., Moestrup Ø., Mozley-Standridge S.E., Smirnov A.V.,
& Spiegel F. (2007) Diversity, Nomenclature, and Taxonomy of
Protists. Systematic Biology, 56, 684–689.
Adl S.M., Simpson A.G.B., Farmer M.A., Andersen R.A., Anderson O.R.,
Barta J.R., Bowser S.S., Brugerolle G., Fensome R.A., Fredericq S.,
James T.Y., Karpov S., Kugrens P., Krug J., Lane C.E., Lewis L.A.,
Lodge J., Lynn D.H., Mann D.G., Mccourt R.M., Mendoza L.,
Moestrup O., Mozley-Standridge S.E., Nerad T.A., Shearer C.A.,
Smirnov A.V., Spiegel F.W., & Taylor M.F.J.R. (2005) The new
higher level classification of eukaryotes with emphasis on the taxonomy of protists. The Journal of Eukaryotic Microbiology, 52,
399–451.
Adl S.M., Simpson A.G.B., Lane C.E., Lukeš J., Bass D., Bowser S.S.,
Brown M.W., Burki F., Dunthorn M., Hampl V., Heiss A., Hoppenrath M., Lara E., le Gall L., Lynn D.H., McManus H., Mitchell
E.A.D., Mozley-Stanridge S.E., Parfrey L.W., Pawlowski J., Rueckert S., Shadwick L., Schoch C.L., Smirnov A., & Spiegel F.W.
(2012) The revised classification of eukaryotes. Journal of Eukaryotic Microbiology, 59, 429–514.
Aguilar M., Fiore-Donno A.-M., Lado C., & Cavalier-Smith T. (2013) Using
environmental niche models to test the “everything is everywhere”
hypothesis for Badhamia. The ISME Journal.
Baas Becking L. (1934) Geobiologie of inleiding tot de milieukunde. WP
Van Stockum & Zoon, The Hague.
Baldauf S.L. (2003) The Deep Roots of Eukaryotes. Science, 300, 1703–
1706.
46
Baldauf S.L. & Doolittle W. (1997) Origin and evolution of the slime molds
(Mycetozoa). Proceedings of the National Academy of Sciences of
the United States of America, 94, 12007–12012.
Bass D. & Boenigk J. (2011) Everything is everywhere: a twenty-first century de-/reconstruction with respect to protists. Biogeography of Microscopic Organisms pp. 88–110. Cambridge University Press,
Cambridge, UK.
Blaskovics J. & Raper K.B. (1957) Encystment stages of Dictyostelium. The
Biological Bulletin, 113, 58–88.
Bloomfield G. (2013) Sex in Dictyostelia. Dictyostelids (ed. by M. Romeralo, S. Baldauf, and R. Escalante), pp. 129–148. Springer Berlin Heidelberg, Berlin, Heidelberg.
Bloomfield G., Skelton J., Ivens A., Tanaka Y., & Kay R.R. (2010) Sex
Determination in the Social Amoeba Dictyostelium discoideum.
Science, 330, 1533–1536.
Boenigk J., Ereshefsky M., Hoef-Emden K., Mallet J., & Bass D. (2012)
Concepts in protistology: Species definitions and boundaries. European Journal of Protistology, 48, 96–102.
De Boer H. (2012) Snake Gourds, Parasites and Mother Roasting: Medicinal plants, plant repellents, and Trichosanthes (Cucurbitaceae) in
Lao PDR. Uppsala University, Uppsala, Sweden.
Bonner J.T. (2009) The social amoebae the biology of cellular slime molds.
Princeton University Press, Princeton.
Brefeld O. (1869) Dictyostelium mucoroides. Ein neuer Organismus aus der
Verwandtschaft der Myxomyceten. Abhandl Senckenb Naturforsch
Ges, 85–107.
Brefeld O. (1884) Polysphondylium violaceum und Dictyostelium mucoroides nebst Bemerkungen zur Systematik der Schleimpilze. Unters Gesammtgeb Mykol, 6, 1–34.
Brock D.A., Douglas T.E., Queller D.C., & Strassmann J.E. (2011) Primitive agriculture in a social amoeba. Nature, 469, 393–396.
Brown M.W., Kolisko M., Silberman J.D., & Roger A.J. (2012) Aggregative
Multicellularity Evolved Independently in the Eukaryotic Supergroup Rhizaria. Current Biology, 22, 1123–1127.
47
Brown M.W. & Silberman J.D. (2013) The Non-dictyostelid Sorocarpic
Amoebae. Dictyostelids (ed. by M. Romeralo, S. Baldauf, and R.
Escalante), pp. 219–242. Springer Berlin Heidelberg, Berlin, Heidelberg.
Budniak A.A. & O’Day D.H. (2012) Microcysts: The Third Developmental
Pathway of Social Amoebozoans. Protist, 163, 2–14.
Caron D.A. (2009) Past President’s Address: Protistan Biogeography: Why
All The Fuss? Journal of Eukaryotic Microbiology, 56, 105–112.
Cavalier-Smith T. (1998) A revised six-kingdom system of life. Biological
Reviews of the Cambridge Philosophical Society, 73, 203–266.
Cavalier-Smith T. (2003) Protist phylogeny and the high-level classification
of Protozoa. European Journal of Protistology, 39, 338–348.
Cavalier-Smith T., Chao E.E.-Y., & Oates B. (2004) Molecular phylogeny
of Amoebozoa and the evolutionary significance of the unikont
Phalansterium. European Journal of Protistology, 40, 21–48.
Cavender J.C. (1973) Geographical distribution of the Acrasiae. Mycologia,
65, 1044–1054.
Cavender J.C. (1978) Cellular slime molds in tundra and forest soils of
Alaska including a new species, Dictyostelium septentrionalis. Canadian Journal of Botany, 56, 1326–1332.
Cavender J.C. (2013) A Global Overview of Dictyostelid Ecology with Special Emphasis in North American Forest. Dictyostelids (ed. by M.
Romeralo, S. Baldauf, and R. Escalante), pp. 149–166. Springer
Berlin Heidelberg, Berlin, Heidelberg.
Cavender J.C., Bradshaw R.A., Regner J.P., & Damio T. (1993) Response of
soil dictyostelid slime molds to agricultural disturbance in a tropical
environment. Biotropica, 25, 245–248.
Cavender J.C. & Raper K.B. (1965) The Acrasieae in nature. III. Occurrence
and distribution in forests of eastern North America. American
Journal of Botany, 52, 302–308.
Cavender J.C. & Raper K.B. (1968) The ocurrence and distribution of Acrasieae in forests of subtropical and tropical America. American Journal of Botany, 55, 504–513.
48
Cienkowski L. (1873) Guttulina rosea. Trans. Bot. Sect. 4th Meeting Russian
Naturalists at Kazan.
Cocucci S.M. & Sussman M. (1970) RNA in cytoplasmic and nuclear fractions of cellular slime mold amebas. The Journal of Cell Biology,
45, 399–407.
Corliss J.O. (1984) The kingdom PROTISTA and its 45 phyla. Biosystems,
17, 87–126.
Cotter D. & Raper K.B. (1968) Spore germination in strains of Dictyostelium discoideum and other members of the Dictyosteliaceae. Journal
of Bacteriology, 96, 1690–1695.
Cracraft J. (1983) Species concepts and speciation analysis. Current Ornithology Plenum Press.
Dayrat B. (2005) Towards integrative taxonomy. Biological Journal of the
Linnean Society, 85, 407–415.
Eichinger L., Pachebat J.A., Glöckner G., Rajandream M.-A., Sucgang R., et
al. (2005) The genome of the social amoeba Dictyostelium discoideum. Nature, 435, 43–57.
Eisenberg R. (1976) Two-dimensional microdistribution of cellular slime
molds in forest soil. Ecology, 57, 380–384.
Fenchel T. & Finlay B.J. (2004) The Ubiquity of Small Species: Patterns of
Local and Global Diversity. BioScience, 54, 777.
Fenchel T. & Finlay B.J. (2006) The diversity of microbes: resurgence of the
phenotype. Philosophical Transactions of the Royal Society B: Biological Sciences, 361, 1965–1973.
Fey P., Gaudet P., Pilcher K.E., Franke J., & Chisholm R.L. (2006) dictyBase and the Dicty Stock Center. Dictyostelium discoideum Protocols pp. 51–74. Humana Press, New Jersey.
Finlay B.J. (2002) Global Dispersal of Free-Living Microbial Eukaryote
Species. Science, 296, 1061–1063.
Fiore-Donno A.M., Clissmann F., Meyer M., Schnittler M., & CavalierSmith T. (2013) Two-Gene Phylogeny of Bright-Spored Myxomycetes (Slime Moulds, Superorder Lucisporidia). PLoS ONE, 8,
e62586.
49
Fiore-Donno A.M., Nikolaev S.I., Nelson M., Pawlowski J., Cavalier-Smith
T., & Baldauf S.L. (2010) Deep Phylogeny and Evolution of Slime
Moulds (Mycetozoa). Protist, 161, 55–70.
Fiz-Palacios O., Romeralo M., Ahmadzadeh A., Weststrand S., Ahlberg
P.E., & Baldauf S. (2013) Did Terrestrial Diversification of Amoebas (Amoebozoa) Occur in Synchrony with Land Plants? PLoS
ONE, 8, e74374.
Foissner W. (1999) Protist diversity: estimates of the near-imponderable.
Protist, 150, 363–368.
Foissner W. (2006) Biogeography and dispersal of micro-organisms: a review emphasizing protists. Acta Protozoologica, 45, 111–136.
Glöckner G. & Noegel A.A. (2013) Comparative genomics in the Amoebozoa clade: Comparative genomics in the Amoebozoa clade. Biological Reviews, 88, 215–225.
Haastert P.J.M.V. (1982) Identification of a Pterin as the Acrasin of the Cellular Slime Mold Dictyostelium lacteum. Proceedings of the National Academy of Sciences, 79, 6270–6274.
Haeckel E. (1866) Generelle Morphologie der Organismen: allgemeine
Grundzüge der organischen Formen-Wissenschaft, mechanisch begründet durch die von Charles Darwin reformirte DescendenzTheorie. G. Reimer, Berlin.
Hagiwara H. (1989) The taxonomic study of Japanese dictyostelid cellular
slime molds. National Science Museum, Tokyo.
Heger T.J., Mitchell E.A.D., Ledeganck P., Vincke S., Van de Vijver B., &
Beyens L. (2009) The curse of taxonomic uncertainty in biogeographical studies of free-living terrestrial protists: a case study of
testate amoebae from Amsterdam Island. Journal of Biogeography,
36, 1551–1560.
Heidel A.J., Lawal H.M., Felder M., Schilde C., Helps N.R., Tunggal B.,
Rivero F., John U., Schleicher M., Eichinger L., Platzer M., Noegel
A.A., Schaap P., & Glockner G. (2011) Phylogeny-wide analysis of
social amoeba genomes highlights ancient origins for complex intercellular communication. Genome Research, 21, 1882–1891.
50
Hogg J. (1860) On the distinctions of a plant and an animal and on a Fourth
Kingdom of Nature. Edinburgh New Philosophical Journal, 12,
216–225.
Huss M. (1989) Dispersal of cellular slime molds by two soil invertebrates.
Mycologia, 81, 677–682.
Kawabe K. (1995) Distribution of Dictyostelid Cellular Slime Molds in Forest Soils of Sweden. Bulletin of Japanese Society of Microbial Ecology, 10, 115–118.
Konijn T., Barkley D., & Bonner J. (1968) Cyclic AMP: A naturally occurring acrasin in the cellular slime molds. The American Naturalist,
102, 225–233.
Kool A. (2012) Desert Plants and Deserted Islands: Systematics and Ethnobotany in Caryophyllaceae. Uppsala University, Uppsala, Sweden.
Kudryavtsev A. (2005) 18S Ribosomal RNA Gene Sequences of (Himatismenida) and the Phylogeny of Amoebozoa. Protist, 156, 215–
224.
Larson G. (2003) The complete Far side. Andrews McMeel Pub, Kansas
City, Mo.
Levine N.D., Corliss J.O., Cox F.E.G., Deroux G., Grain J., Honigberg
B.M., Leedale G.F., Loeblich A.R., Lom I.J., Lynn D., Merinfeld
E.G., Page F.C., Poljansky G., Sprague V., Vavra J., & Wallace F.G.
(1980) A Newly Revised Classification of the Protozoa. The Journal
of Protozoology, 27, 37–58.
Martiny J.B.H., Bohannan B.J.M., Brown J.H., Colwell R.K., Fuhrman J.A.,
Green J.L., Horner-Devine M.C., Kane M., Krumins J.A., Kuske
C.R., Morin P.J., Naeem S., Øvreås L., Reysenbach A.-L., Smith
V.H., & Staley J.T. (2006) Microbial biogeography: putting microorganisms on the map. Nature Reviews Microbiology, 4, 102–112.
Medlin L., Elwood H.J., Stickel S., & Sogin M.L. (1988) The characterization of enzymatically amplified eukaryotic 16S-like rRNA-coding
regions. Gene, 71, 491–499.
Miller M.A., Pfeiffer W., & Schwartz T. (2011) The CIPRES science gateway: a community resource for phylogenetic analyses. 1.
51
Mishler B.D. & Donoghue M.J. (1982) Species Concepts: A Case for Pluralism. Systematic Biology, 31, 491–503.
Muñoz-Braceras S., Mesquita A., & Escalante R. (2013) Dictyostelium discoideum as a Model in Biomedical Research. Dictyostelids (ed. by
M. Romeralo, S. Baldauf, and R. Escalante), pp. 1–34. Springer Berlin Heidelberg, Berlin, Heidelberg.
Nylander J. (2004) MrModeltest. Evolutionary Biology Center, Uppsala
University., Uppsala, Sweden.
Olive E. (1901) A preliminary enumeration of the Sorophoreæ. Proceedings
of the American Academy of Arts and Sciences, 37, 333–344.
Olive L. (1970) The Mycetozoa: A revised classification. The Botanical
Review, 36, 59–89.
Olive L.S. (1975) The mycetozoans. Academic Press, New York.
Owen R. (1860) Palaeontology. Adam and Charles Black, Edinburgh, Scotland.
Palm B. (1935) Ett fynd av Dictyostelium mucoroides i Sydsverige. Svensk
Botanisk Tidskrift, 29, 365–366.
Parfrey L.W., Barbero E., Lasser E., Dunthorn M., Bhattacharya D., Patterson D.J., & Katz L.A. (2006) Evaluating Support for the Current
Classification of Eukaryotic Diversity. PLoS Genetics, 2, e220.
Parfrey L.W., Grant J., Tekle Y.I., Lasek-Nesselquist E., Morrison H.G.,
Sogin M.L., Patterson D.J., & Katz L.A. (2010) Broadly Sampled
Multigene Analyses Yield a Well-Resolved Eukaryotic Tree of Life.
Systematic Biology, 59, 518–533.
Parikh A., Miranda E.R., Katoh-Kurasawa M., Fuller D., Rot G., Zagar L.,
Curk T., Sucgang R., Chen R., Zupan B., Loomis W.F., Kuspa A.,
& Shaulsky G. (2010) Conserved developmental transcriptomes in
evolutionarily divergent species. Genome Biology, 11, R35.
Pawlowski J. & Burki F. (2009) Untangling the Phylogeny of Amoeboid
Protists. Journal of Eukaryotic Microbiology, 56, 16–25.
Posada D. (2008) jModelTest: Phylogenetic Model Averaging. Molecular
Biology and Evolution, 25, 1253–1256.
52
Rambaut A. (2009) FigTree v.1.3.1. Computer program distributed by the
author, University of Oxford.
Raper K.B. (1956) Factors affecting growth and differentiation in simple
slime molds. Mycologia, 48, 169–205.
Raper K.B. (1984) The dictyostelids. Princeton University Press, Princeton,
N.J.
Romeralo M., Cavender J.C., Landolt J.C., Stephenson S.L., & Baldauf S.L.
(2011a) An expanded phylogeny of social amoebas (Dictyostelia)
shows increasing diversity and new morphological patterns. BMC
Evolutionary Biology, 11, 84.
Romeralo M., Escalante R., & Baldauf S.L. (2012) Evolution and Diversity
of Dictyostelid Social Amoebae. Protist, 163, 327–343.
Romeralo M., Escalante R., Sastre L., & Lado C. (2007a) Molecular Systematics of Dictyostelids: 5.8S Ribosomal DNA and Internal Transcribed Spacer Region Analyses. Eukaryotic Cell, 6, 110–116.
Romeralo M., Fiz-Palacios O., Lado C., & Cavender J.C. (2007b) A new
concept for Dictyostelium sphaerocephalum based on morphology
and phylogenetic analysis of nuclear ribosomal internal transcribed
spacer region sequences. Canadian Journal of Botany, 85, 104–110.
Romeralo M., Moya-Laraño J., & Lado C. (2011b) Social Amoebae: Environmental Factors Influencing Their Distribution and Diversity
Across South-Western Europe. Microbial Ecology, 61, 154–165.
Romeralo M., Skiba A., Gonzalez-Voyer A., Schilde C., Lawal H., Kedziora
S., Cavender J.C., Glockner G., Urushihara H., & Schaap P. (2013)
Analysis of phenotypic evolution in Dictyostelia highlights developmental plasticity as a likely consequence of colonial multicellularity. Proceedings of the Royal Society B: Biological Sciences, 280,
20130976–20130976.
Romeralo M., Spiegel F.W., & Baldauf S.L. (2010) A Fully Resolved Phylogeny of the Social Amoebas (Dictyostelia) Based on Combined
SSU and ITS rDNA Sequences. Protist, 161, 539–548.
Ronquist F. & Huelsenbeck J.P. (2003) MrBayes 3: Bayesian phylogenetic
inference under mixed models. Bioinformatics, 19, 1572–1574.
53
Scamardella J. (1999) Not plants or animals: a brief history of the origin of
Kingdoms Protozoa, Protista and Protoctista. International Microbiology, 2, 207–216.
Schaap P., Winckler T., Nelson M., Alvarez-Curto E., Elgie B., Hagiwara
H., Cavender J., Milano-Curto A., Rozen D.E., Dingermann T.,
Mutzel R., & Baldauf S.L. (2006) Molecular Phylogeny and Evolution of Morphology in the Social Amoebas. Science, 314, 661–663.
Schlegel M. (1991) Protist evolution and phylogeny as discerned from small
subunit ribosomal RNA sequence comparisons. European Journal
of Protistology, 27, 207–219.
Shadwick L.L., Spiegel F.W., Shadwick J.D.L., Brown M.W., & Silberman
J.D. (2009) Eumycetozoa = Amoebozoa?: SSUrDNA Phylogeny of
Protosteloid Slime Molds and Its Significance for the Amoebozoan
Supergroup. PLoS ONE, 4, e6754.
Shimomura O. (1982) Chemical Identity of the Acrasin of the Cellular Slime
Mold Polysphondylium violaceum. Proceedings of the National
Academy of Sciences, 79, 7376–7379.
Silvestro D. & Michalak I. (2012) raxmlGUI: a graphical front-end for
RAxML. Organisms Diversity & Evolution, 12, 335–337.
Singh B.N. (1947) Studies on Soil Acrasieae: 2. The Active Life of Species
of Dictyostelium in Soil and the Influence thereon of Soil Moisture
and Bacterial Food. Journal of General Microbiology, 1, 361–367.
Smirnov A.V., Chao E., Nassonova E.S., & Cavalier-Smith T. (2011) A
Revised Classification of Naked Lobose Amoebae (Amoebozoa:
Lobosa). Protist, 162, 545–570.
Sogin M.L., Morrison H.G., Huber J.A., Welch D.M., Huse S.M., Neal P.R.,
Arrieta J.M., & Herndl G.J. (2006) Microbial diversity in the deep
sea and the underexplored “rare biosphere.” Proceedings of the National Academy of Sciences, 103, 12115–12120.
Stamatakis A. (2006) RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics, 22, 2688–2690.
Stephenson S.L. & Landolt J.C. (1992) Vertebrates as vectors of cellular
slime moulds in temperate forests. Mycological Research, 96, 670–
672.
54
Stephenson S.L. & Landolt J.C. (1998) Dictyostelid Cellular Slime Molds in
Canopy Soils of Tropical Forests. Biotropica, 30, 657–661.
Stephenson S.L., Novozhilov Y.K., & Schnittler M. (2000) Distribution and
ecology of myxomycetes in high-latitude regions of the Northern
Hemisphere. Journal of Biogeography, 27, 741–754.
Stephenson S.L., Slay M.E., Slay C.A., & Tuggle A.E. (2007) Cave crickets
(Orthoptera: Rhaphidophoridae) as vectors of dictyostelids (Protista:
Dictyosteliida). Entomological News, 118, 292–295.
Sucgang R., Kuo A., Tian X., Salerno W., Parikh A., Feasley C.L., Dalin E.,
Tu H., Huang E., Barry K., Lindquist E., Shapiro H., Bruce D.,
Schmutz J., Salamov A., Fey P., Gaudet P., Anjard C., Babu M.M.,
Basu S., Bushmanova Y., van der Wel H., Katoh-Kurasawa M.,
Dinh C., Coutinho P.M., Saito T., Elias M., Schaap P., Kay R.R.,
Henrissat B., Eichinger L., Rivero F., Putnam N.H., West C.M.,
Loomis W.F., Chisholm R.L., Shaulsky G., Strassmann J.E., Queller
D.C., Kuspa A., & Grigoriev I.V. (2011) Comparative genomics of
the social amoebae Dictyostelium discoideum and Dictyostelium
purpureum. Genome Biology, 12, R20.
Suthers H.B. (1985) Ground-feeding migratory songbirds as cellular slime
mold distribution vectors. Oecologia, 65, 526–530.
Swanson A.R., Spiegel F.W., & Cavender J.C. (2002) Taxonomy, slime
molds, and the questions we ask. Mycologia, 94, 968–979.
Swanson A.R., Vadell E.M., & Cavender J.C. (1999) Global distribution of
forest soil dictyostelids. Journal of Biogeography, 26, 133–148.
Tekle Y.I., Grant J., Anderson O.R., Nerad T.A., Cole J.C., Patterson D.J.,
& Katz L.A. (2008) Phylogenetic placement of diverse amoebae inferred from multigene analyses and assessment of clade stability
within “Amoebozoa” upon removal of varying rate classes of SSUrDNA. Molecular Phylogenetics and Evolution, 47, 339–352.
Van Tieghem P. (1884) Coenonia, genre nouveau de Myxomycètes à plasmode agrégé. Bulletin de la Société botanique de France, 34, 303–
306.
Vadell E.M., Holmes M., & Cavender J.C. (1995) Dictyostelium citrinum,
D. medusoides and D. granulophorum: Three new members of the
Dictyosteliaceae from forest soils of Tikal, Guatemala. Mycologia,
87, 551–559.
55
Waddell D.R. (1982) A predatory slime mould. Nature, 298, 464–466.
Whittaker R.H. (1969) New Concepts of Kingdoms of Organisms. Science,
163, 150–160.
De Wit R. & Bouvier T. (2006) “Everything is everywhere, but, the environment selects”; what did Baas Becking and Beijerinck really say?
Environmental Microbiology, 8, 755–758.
De Wit R.W. & Konijn T.M. (1983) Identification of the acrasin of Dictyostelium minutum as a derivative of folic acid. Cell Differentiation,
12, 205–210.
56
Acta Universitatis Upsaliensis
Digital Comprehensive Summaries of Uppsala Dissertations
from the Faculty of Science and Technology 1097
Editor: The Dean of the Faculty of Science and Technology
A doctoral dissertation from the Faculty of Science and
Technology, Uppsala University, is usually a summary of a
number of papers. A few copies of the complete dissertation
are kept at major Swedish research libraries, while the
summary alone is distributed internationally through
the series Digital Comprehensive Summaries of Uppsala
Dissertations from the Faculty of Science and Technology.
Distribution: publications.uu.se
urn:nbn:se:uu:diva-210074
ACTA
UNIVERSITATIS
UPSALIENSIS
UPPSALA
2013