Journal of Biogeography (J. Biogeogr.) (2006) 33, 1889–1904
ORIGINAL
ARTICLE
Historical biogeography of lowland
species of toads (Bufo) across the TransMexican Neovolcanic Belt and the
Isthmus of Tehuantepec
Daniel G. Mulcahy*, Benson H. Morrill and Joseph R. Mendelson III Department of Biology, Utah State University,
Logan, UT, USA
ABSTRACT
Aim In this study, we investigate phylogeographic structure in two different
species groups of lowland toads. First, we further investigate strict parapatry of
the Pliocene-vicariant Bufo valliceps/B. nebulifer species pair. Secondly, we test for
similar phylogeographic structure in the distantly related toad B. marinus, a
species we hypothesize will show a Pleistocene dispersal across the same area.
Location The eastern extension of the Trans-Mexican Neovolcanic Belt (TMNB)
contacts the Atlantic Coast in central Veracruz, Mexico. Although it is not a
massive structure at this eastern terminus, the TMNB has nonetheless effected
vicariance and subsequent speciation in several groups of animals. The Isthmus of
Tehuantepec unites the North American continent with Nuclear Central America
and is also known to be a biogeographic barrier for many taxa.
Methods We use sequence data from two mitochondrial DNA genes
(c. 550 base-pairs (bp) of 16S and c. 420 bp of cyt b) from 58 individuals of
the B. valliceps/nebulifer complex, collected from 24 localities. We also present
homologous sequence data from 23 individuals of B. marinus, collected from
12 localities. We conduct maximum-parsimony, maximum-likelihood and
Bayesian analyses to investigate phylogeographic structure. We then use
parsimony- and likelihood-based topology tests to assess alternative
phylogenetic hypotheses and use a previously calibrated molecular rate of
evolution to estimate dates of divergence.
Results Our results further define the parapatric contact zone across the TMNB
between the Pliocene-vicariant sister species B. valliceps and B. nebulifer. In
contrast, phylogenetic structure among populations of B. marinus across the
TMNB is much shallower, suggesting a more recent Pleistocene dispersal in this
species. In addition, we found phylogeographic structure associated with the
Isthmus of Tehuantepec in both species groups.
*Correspondence: Daniel G. Mulcahy,
Department of Herpetology, California
Academy of Sciences, 875 Howard Street, San
Francisco, CA 94103-3009, USA.
E-mail: [email protected]
Main conclusions The existence of a Pliocene–Pleistocene seaway across the
Isthmus of Tehuantepec has been controversial. Our data depict clades on either
side of the isthmus within two distinct species (B. valliceps and B. marinus),
although none of the clades associated with the isthmus, for either species, are
reciprocally monophyletic. In the B. valliceps/B. nebulifer complex, the TMNB
separation appears to predate the isthmian break, whereas in B. marinus dispersal
across the TMNB has occurred subsequent to the presence of a barrier at the
Isthmus of Tehuantepec.
Present address: Department of Herpetology,
Zoo Atlanta, 800 Cherokee Ave SE, Atlanta, GA
30315-1440, USA.
Keywords
Bufo nebulifer, Bufo marinus, Bufo valliceps, Bufonids, Central America, Mexico, mitochondrial DNA, phylogeography.
ª 2006 The Authors
Journal compilation ª 2006 Blackwell Publishing Ltd
www.blackwellpublishing.com/jbi
doi:10.1111/j.1365-2699.2006.01546.x
1889
D. G. Mulcahy, B. H. Morrill and J. R. Mendelson III
INTRODUCTION
The Trans-Mexico Neovolcanic Belt (TMNB) is one of the
predominant geographical features of Mexico, and its geological development has been posited as a primary contributor to
the biogeographic histories of many upland taxa in central
Mexico (e.g. Campbell & Frost, 1993; Darda, 1994; Sullivan
et al., 2000; Castoe et al., 2003). However, a recent series of
papers have independently demonstrated the considerable
influence of this transverse massif on the biogeography and
evolution of the lowland fauna on both the Pacific (Mateos,
2005) and the Atlantic coasts of Mexico (Mulcahy &
Mendelson, 2000; Hulsey et al., 2004; Zaldı́var-Riverón et al.,
2004). These papers generally support earlier hypotheses based
on observations of consistent disjunctions in the distribution
of fishes (Rosen, 1978), and of reptiles and mammals (PérezHigareda & Navarro, 1980), specifically along the Atlantic
Versant of Mexico. Therefore, it is suggested that the TMNB
may form a common geographical barrier to lowland species in
this region.
The concept of a massive volcanic chain such as the TMNB
acting as a vicariant feature to lowland populations is easily
tractable, but the reality is that the TMNB withers to a tiny
string of lava-rock strewn hills at its eastern terminus (Fig. 1).
It makes final contact with the current coastline, as a series of
small fingers of raised lava-rock (the northern-most being just
south of the small town of Palma Sola, the southern-most just
north of the city Cardel, with a small pocket of suitable habitat
occurring in the middle, near the town of El Viejón) all in the
state of Veracruz, Mexico (Fig. 2). The imposing backbone of
the TMNB began activity during the mid-Miocene to Pliocene
(de Cserna, 1989), with its greatest development during the
Pliocene in the eastern portion (Ferrusquia-Villafranca, 1993),
giving rise to the highest peaks of Mexico. However, the
easternmost fingers of the TMNB, where they contact the Gulf
of Mexico, are barely noticeable to the casual observer. During
much of the Pliocene, sea-level maxima caused by a warmer
climate effectively covered the entire coastal plain of eastern
Mexico (Bryant et al., 1991). Later during the Pleistocene, sea
levels fluctuated with corresponding glacial and inter-glacial
cycles (Beard et al., 1982). Glacial-maxima lowered sea levels
exposing large sections of the continental shelf, which greatly
increased the aerial extent of the coastal plain (Fig. 1), whereas
glacial minima raised sea levels, inundating much of the coastal
plain by about 300 m (Ewing & Lopez, 1991). The area of the
Sierra de Los Tuxtlas (Fig. 1) is of volcanic origin from the late
Cenozoic (Ferrusquia-Villafranca, 1993), and may have been
isolated from the mainland during the Pliocene and during
Pleistocene glacial minima. Farther south, debate continues as
to whether a seaway existed at the Isthmus of Tehuantepec,
separating northern Mexico from Nuclear Central America
(Campbell, 1999).
By comparing phylogenetic structure from mtDNA
sequences of lowland toads in this region, Mulcahy &
Mendelson (2000) demonstrated that the prevailing concept
of a single wide-ranging species (Bufo valliceps Wiegmann)
should be replaced by recognition of a species pair showing an
apparent parapatric distribution in the region: B. valliceps
Figure 1 Map of the study area, showing major geographic features discussed in the text. Grey shading from light to dark indicates
elevations from 300–900 m, 900–2100 m and > 2100 (including black) m a.s.l., respectively. Dotted line shows extent of continental shelf,
much of which was exposed during lower sea levels of the Pleistocene (from Bryant & Bryant, 1991).
1890
Journal of Biogeography 33, 1889–1904
ª 2006 The Authors. Journal compilation ª 2006 Blackwell Publishing Ltd
Biogeography of lowland toads (Bufo)
Figure 2 Map of the eastern terminus of the Trans-Mexico
Neovolcanic Belt (TMNB) in central Veracruz. Squares indicate
reference towns used in text, circles indicate collecting localities for
Bufo nebulifer (Mx8) B. valliceps (Mx9–10) and B. marinus (Mx8–
10) in relation to the eastern-most portion of the TMNB (see
Figs 3 & 4 for complete sampling of each taxon). Shaded contours
indicate elevation following Fig. 1. Los Tuxtlas is the Pliocene
volcanic uplift on the coastal plain south of the eastern terminus of
the TMNB (see Discussion).
ranging from central Veracruz, Mexico, southward to Costa
Rica; and B. nebulifer Girard, ranging from central Veracruz
northward to the southern United States of America. Mulcahy
& Mendelson (2000) proposed and tested two historical
hypotheses related to the timing of this speciation event: (1)
Miocene–Pliocene vicariance associated with the orogeny of
the TMNB; and (2) Pleistocene dispersal and vicariance caused
by low sea levels initially exposing the continental margin,
followed by raised sea levels, which obliterated the coastal plain
in this region. Their results supported the Miocene–Pliocene
vicariance hypothesis. However, their sampling was insufficient to demonstrate strict parapatry of these two species on
the narrow coastal plains on either side of the TMNB.
A third species, B. marinus Linnaeus, ranges from the
Amazon Basin of South America to the southern tip of Texas,
USA, in North America. This species is largely sympatric with
B. valliceps, partially sympatric with B. nebulifer, and has an
apparently continuous distribution across the eastern terminus
of the TMNB. Bufo marinus is of a South American origin
(Pauly et al., 2004; Pramuk, 2006), and most likely entered
Central America during the Pliocene (Slade & Moritz, 1998). A
broad-scale phylogeographic study of B. marinus (Slade &
Moritz, 1998) indicated that this complex showed dramatic
historical effects of the orogeny of the Andes in South America,
and lower levels of genetic divergence between samples from
Costa Rica and Mexico. These results suggest that a finer-scale
study may show that the biogeographic history of northern
B. marinus is more consistent with the Pleistocene dispersal
and vicariance hypothesis of Mulcahy & Mendelson (2000).
The three species of toads in our study are ecologically
similar in their general reproductive biology and overall
natural history. All three species are invasive, ‘weedy’ species
that are typically more abundant in secondary, degraded
habitats than in undisturbed primary forests (Zug & Zug,
1979; Mendelson, 1994; Lee, 1996; Campbell, 1998; McCranie
& Wilson, 2002; Savage, 2002). These attributes would
suggest that they are suitably comparable to one another,
in order to test hypotheses of historical biogeography and
that their invasive, dispersal-prone tendencies would make
them a conservative test of the effect of the TMNB on
lowland species.
In this paper, we use c. 970 base-pairs (bp) of sequence data
from two mtDNA genes (cyt b and 16S) from recently collected
samples along a geographic transect across the TMNB to
address the historical biogeography of the Atlantic Versant
lowlands of Mexico. Specifically, we test three main hypotheses
regarding the relationships and distributions concerning
bufonid toads in this region: (1) the hypothesis that B. valliceps
and B. nebulifer are parapatric at the eastern terminus of the
TMNB (i.e. as proposed by Mulcahy & Mendelson, 2000); (2)
the hypothesis that the sympatric toad B. marinus shows a
pattern of more recent dispersal across the TMNB, consistent
with the Pleistocene dispersal, followed by the vicariance
hypothesis of Mulcahy & Mendelson (2000); and (3) the
hypothesis that there is evidence of a phylogeographic signal
within B. valliceps and/or B. marinus, which is consistent with
a historical seaway across the Isthmus of Tehuantepec. We use
both parsimony and likelihood topology tests to compare our
phylogenetic results with alternative hypotheses. We also
discuss genetic variation, in terms of sequence divergence
and the rate of molecular evolution previously calibrated for
the B. valliceps/nebulifer group (Mulcahy & Mendelson, 2000),
between clades associated with either sides of the TMNB and
the Isthmus of Tehuantepec.
MATERIALS AND METHODS
Taxon sampling
We collected sequence data for 19 new B. valliceps and
B. nebulifer specimens along the eastern terminus of the
TMNB (Fig. 3). For consistency, we continued our numbering
system from that of Mulcahy & Mendelson (2000). Ten of the
new specimens represent B. nebulifer (locality Mx8, Figs 2 & 3)
and were collected just north of the town of Palma Sola, seven
represent B. valliceps (locality Mx10, Figs 2 & 3) collected
south of Cardel, and two were collected in the middle of the
eastern-most reaches of the TMNB, near the town of El Viejón,
tentatively assigned to B. valliceps (locality Mx9, Figs 2 & 3).
We compared our new sequences with those of Mulcahy &
Mendelson (2000), and used one representative of each unique
haplotype in the phylogenetic analyses. This resulted in a total
of 28 specimens of B. nebulifer (11 haplotypes) and 30
specimens of B. valliceps (21 haplotypes; see Results). Multiple
specimens from the same locality were individually labelled
Journal of Biogeography 33, 1889–1904
ª 2006 The Authors. Journal compilation ª 2006 Blackwell Publishing Ltd
1891
D. G. Mulcahy, B. H. Morrill and J. R. Mendelson III
Figure 3 Map of the geographic distribution and sampling for the Bufo valliceps and B. nebulifer used in this study. Squares indicate new
sample localities, circles represent those from Mulcahy & Mendelson (2000); grey circles indicate identical haplotypes omitted from
phylogenetic analyses. Box indicates area of the TMNB transect highlighted in Fig. 2.
alphabetically (e.g. Mx8a–Mx8j). We also collected sequence
data from 23 specimens of B. marinus from Central America
and northern Mexico (Fig. 4). Again, for sake of convenience,
we kept the same numbering system as the B. valliceps/
B. nebulifer data because many of our sampling localities were
the same (e.g. Mx8–Mx10). Outgroup taxa were chosen
following phylogenetic hypotheses of Mulcahy & Mendelson
(2000; D.G. Mulcahy & J.R. Mendelson, unpubl. data); Pauly
et al. (2004) and Pramuk (2006). Outgroup taxa for analyses of
B. nebulifer and B. valliceps included B. mazatlanensis,
B. campbelli (AY008253–4 of Mulcahy & Mendelson, 2000),
and B. coccifer (AY927856 and AY927863 of Mendelson et al.,
2005). Outgroup taxa for analyses of B. marinus included
B. crucifer, B. schneideri and a specimen of B. marinus from
South America (Pramuk, 2006). Slade & Moritz (1998) showed
that B. marinus may be paraphyletic with respect to South
American samples and B. schneideri, therefore we considered
the South American individual of B. marnius as an outgroup.
Voucher specimens for this study are deposited at the
following institutions: University of Texas at Arlington
(UTA); Museo de Zoologia, Facultad de Ciencias, Universidad
Autonoma de Mexico (MZFC), and University of Kansas
(KU). Voucher numbers, specific locality information and
GenBank accession numbers for each specimen are listed in
Table 1.
1892
Laboratory protocols
We collected sequence data from c. 550 bp region of the
ribosomal gene 16S and c. 420 bp region of the protein-coding
gene cyt b. The gene-regions have been demonstrated to be
accurate markers for resolving recent divergences (Graybeal,
1993, 1997; Mulcahy & Mendelson, 2000). For all specimens,
tissue was taken from liver, muscle, skin or toe clips and stored
either at )80 C or in 95% ethanol. Extraction of DNA
followed standard phenol/chloroform extraction methods
(Maniatis et al., 1982). Primers used for PCR amplification
and sequence reactions (for cyt b, MVZ43: GAGTCTGCCT[A/
T]AT[T/C]GC[C/T]CA[A/G]AT,
3¢
and
MVZ28:
CGAGGC[G/C]CC[T/C]GCAAT[A/G]ATAA, 3¢; for 16S,
16Sar: CGCCTGTTTATCAAAAACAT, 3¢ and 16Sbr:
CCGGTCTGAACTCAGATCACGT 3¢). Amplifications for
PCR followed that of Mulcahy & Mendelson (2000). Sequence
reactions were done in both directions using the same primers
used for PCR, with BigDyeTM Terminator Cycle Sequencing
Kits (Version 2, ABI Part No. 4303152; Foster City, CA, USA)
in 10–12 mL reactions following recommended protocols.
Sequence-reaction products were cleaned with SephadexTM
(Piscataway, NJ, USA) and run on an ABI 377 automated
sequencer. Individual sequences were aligned with complimentary strands in SequencherTM 4.1.2 (Gene Codes Corp.,
Journal of Biogeography 33, 1889–1904
ª 2006 The Authors. Journal compilation ª 2006 Blackwell Publishing Ltd
Biogeography of lowland toads (Bufo)
Figure 4 Map of the northern distribution and sampling for Bufo marinus (squares) in this study. Sample localities follow the same
numbering system from the B. valliceps and B. nebulifer, with the addition of several new localities for B. marinus only. Grey squares indicate
identical haplotypes omitted from phylogenetic analyses. Box indicates area of the TMNB transect highlighted in Fig. 2.
Ann Arbor, MI, USA). The protein-coding region of cyt b was
translated into amino acid sequence and the G-C content was
inspected to verify that authentic mtDNA sequences were
obtained, using MacClade 4.0 (Maddison & Maddison, 2000).
Phylogenetic analysis
To determine if the two gene regions, 16S and cyt b,
contained similar phylogenetic signals, we conducted partition-homogeneity tests. We ran 100 replicates with 10
random additions at each replicate between 16S and cyt b.
This test determines whether the data sets are giving
significantly different signals. Maximum parsimony (MP)
and Maximum-likelihood (ML) analyses were conducted in
paup* beta version 4.0b10 (Swofford, 1999). All MP analyses
were conducted with Tree-bisection reconnection branchswapping, ACCTRAN optimization, with 100 random stepwise additions. Non-parametric bootstrap analyses under the
MP criterion were conducted in paup* with 1000 replicates,
using random step-wise additions with 25 replicates for each
bootstrap replicate. Nodes with indices of 75% or greater
were considered well supported. The program Modeltest 3.06
(Posada & Crandall, 1998) was used to select appropriate
models of evolution, and was conducted on each gene
separately, as well as both genes combined for each data set
(B. valliceps/B. nebulifer and B. marinus). The combined
genes model parameters were used in paup* for the ML
analyses of both genes combined for 100 step-wise random
addition replicates.
Three Bayesian Inference (BI) analyses were conducted on
combined (gene) data sets for each group using the program
Mr. Bayes version 10.3 (Huelsenbeck & Ronquist, 2001). Each
gene-region was run under its own model using data
partitions. Each analysis was run for 5 · 106 generations, each
using four-heated Markov chains (using program defaults) and
each was sampled every 100 generations. Posterior-probabilities were estimated by conducting a 50% majority-rules
consensus tree after discarding the burn-in trees. Runs were
determined to reach stationarity visually by plotting likelihood
scores against generations. Nodes with 95% or greater
posterior-probabilities were considered significant.
We use the rate of molecular evolution of 0.33% per lineage,
per million years, (Mulcahy & Mendelson, 2000) to estimate
dates of divergence in the B. valliceps/nebulifer complex.
However, we could not confidently calibrate a rate in the
B. marinus group because the B. valliceps/nebulifer and B. marinus data are not clock-like when compared with other Middle
American bufonids (D.G. Mulcahy & J.R. Mendelson, unpubl.
data). Therefore, we report average pair-wise sequence
divergence between major clades in both groups to estimate
the relative age of divergences, but acknowledge those in the
B. marinus group may be less accurate.
Journal of Biogeography 33, 1889–1904
ª 2006 The Authors. Journal compilation ª 2006 Blackwell Publishing Ltd
1893
D. G. Mulcahy, B. H. Morrill and J. R. Mendelson III
Table 1 Specimen information for sequence data collected for this study (other specimens used in this study are from Mulcahy &
Mendelson, 2000). The first column list the species and locality number from maps (Figs 2–4), and names in phylogenetic trees (Figs 5 & 6).
The second column gives general locality followed by museum specimen number and GenBank accession numbers for 16S and cyt b
Taxon ID
Locality
Bufo nebulifer
Mx8a
Mx8b
Mx8c
Mx8d
Mx8e
Mx8f
Mx8g
Mx8h
Mx8i
Mx8j
Mexico:
Mexico:
Mexico:
Mexico:
Mexico:
Mexico:
Mexico:
Mexico:
Mexico:
Mexico:
Veracruz:
Veracruz:
Veracruz:
Veracruz:
Veracruz:
Veracruz:
Veracruz:
Veracruz:
Veracruz:
Veracruz:
north
north
north
north
north
north
north
north
north
north
B. valliceps
Mx9a
Mx9b
Mx10a
Mx10b
Mx10c
Mx10d
Mx10e
Mx10f
Mx10g
Mexico:
Mexico:
Mexico:
Mexico:
Mexico:
Mexico:
Mexico:
Mexico:
Mexico:
Veracruz:
Veracruz:
Veracruz:
Veracruz:
Veracruz:
Veracruz:
Veracruz:
Veracruz:
Veracruz:
near El Viejón
near El Viejón
south of Cardel
south of Cardel
south of Cardel
south of Cardel
south of Cardel
south of Cardel
south of Cardel
of
of
of
of
of
of
of
of
of
of
Palma
Palma
Palma
Palma
Palma
Palma
Palma
Palma
Palma
Palma
Sola
Sola
Sola
Sola
Sola
Sola
Sola
Sola
Sola
Sola
Voucher No.
16S
Cyt b
UTA A-54860
UTA A-54861
UTA A-54862
UTA A-54863
UNAM-JRM 4851
UNAM-JRM 4852
UTA A-54864
UTA A-54865
UNAM-JRM 4855
UTA A-54859
DQ415599
DQ415600
DQ415601
DQ415602
DQ415603
DQ415604
DQ415605
DQ415606
DQ415607
DQ415608
DQ415619
DQ415620
DQ415621
DQ415622
DQ415623
DQ415624
DQ415625
DQ415626
DQ415627
DQ415628
UNAM-JRM 4824
UNAM-JRM 4825
UNAM-JRM 4799
UNAM-JRM 4801
UTA A-54855
UTA A-54856
UTA A-54858
UTA A-54854
UTA A-54857
DQ415609
DQ415610
DQ415611
DQ415612
DQ415613
DQ415614
DQ415615
DQ415616
DQ415617
DQ415629
DQ415630
DQ415631
DQ415632
DQ415633
DQ415634
DQ415635
DQ415636
DQ415637
B. mazatlanensis
Mexico: Sinaloa: near Cosala
UNAM-JRM 4491
DQ415618
DQ415638
B. marinus
Mx8a
Mx8b
Mx8c
Mx8d
Mx9a
Mx9b
Mx9c
Mx9d
Mx9e
Mx9f
Mx9g
Mx10a
Mx10b
Mx11a
Mx11b
Mx12
C1
E1
E2
G1
G5
H3
H4
Mexico: Veracruz: north of Palma Sola
Mexico: Veracruz: north of Palma Sola
Mexico: Veracruz: north of Palma Sola
Mexico: Veracruz: north of Palma Sola
Mexico: Veracruz: near El Viejón
Mexico: Veracruz: near El Viejón
Mexico: Veracruz: near El Viejón
Mexico: Veracruz: near El Viejón
Mexico: Veracruz: near El Viejón
Mexico: Veracruz: near El Viejón
Mexico: Veracruz: near El Viejón
Mexico: Veracruz: south of Cardel
Mexico: Veracruz: south of Cardel
Mexico: Guerrero: near Atoyac
Mexico: Guerrero: near Atoyac
Mexico: Sinaloa: near Cosala
Costa Rica: Heredia: at Chilamate
El Salvador: Ahuachapan: El Imposible
El Salvador: Ahuachapan: El Imposible
Guatemala: Huehuetenango: near Nenton
Guatemala: Izabal: Montanas del Mico
Honduras: El Paraiso: Las Manos
Honduras: Colon: Quebrada Machin
UTA A-54875
UNAM-JRM 4846
UNAM-JRM 4848
UNAM-JRM 4844
UTA A-54882
UTA A-54873
UNAM-JRM 4834
UNAM-JRM 4835
UTA A-54881
UTA A-54879
UTA A-54877
UTA A-54878
UTA A-54871
UTA A-54869
UTA A-54870
UTA A-54868
toe-clip only
KU 289750
KU 289772
UTA A-50876
UTA A-50870
UTA A-50638
USNM 534124
DQ415547
DQ415548
DQ415549
DQ415550
DQ415551
DQ415552
DQ415553
DQ415554
DQ415556
DQ415555
DQ415557
DQ415558
DQ415559
DQ415560
DQ415561
DQ415562
DQ415563
DQ415564
DQ415565
DQ415566
DQ415567
DQ415568
DQ415569
DQ415573
DQ415574
DQ415575
DQ415576
DQ415577
DQ415578
DQ415579
DQ415580
DQ415582
DQ415581
DQ415583
DQ415584
DQ415585
DQ415586
DQ415587
DQ415588
DQ415589
DQ415590
DQ415591
DQ415592
DQ415593
DQ415594
DQ415595
B. crucifer
Brazil: Sao Paulo
USNM 303015
DQ415570
DQ415596
B. marinus
Ecuador: Loja NA Vilcabamba
KU 217482
DQ415571
DQ415597
B. schneideri
Paraguay: San Luis de la Sierra
KU 289057
DQ415572
DQ415598
We tested alternative phylogenetic hypotheses to support or
refute particular biogeographic scenarios under both parsimony and likelihood conditions. Constraints were designed to
1894
test putative biogeographic barriers inferred from the unconstrained phylogenetic hypotheses. Alternative topologies were
constructed using MacClade and implemented as constraints
Journal of Biogeography 33, 1889–1904
ª 2006 The Authors. Journal compilation ª 2006 Blackwell Publishing Ltd
Biogeography of lowland toads (Bufo)
in paup* and run for 100 random-addition replicates, in the
same manner as the unconstrained analyses (see Appendix 1
for constraint topologies). Under parsimony conditions,
alternative hypotheses were tested by finding the most
parsimonious trees compatible with the imposed constraints
and comparing them with the unconstrained MP trees using
the Wilcoxon signed-rank tests (Templeton, 1983; Felsenstein,
1985). One- and two-tailed Wilcoxon signed-rank tests were
conducted because one-tailed probabilities are close to the
exact but are not always conservative, whereas two-tailed test
are always conservative (Felsenstein, 1985). We used the S–H
(Shimodaira & Hasegawa, 1999) topology test to compare the
constrained and unconstrained ML trees, with one-tailed
(RELL) distributions and 1000 bootstrap replicates. This test is
preferred over the K–H (Kishino & Hasegawa, 1989) test
(Goldman et al., 2000). However, it may be too conservative in
some cases (Buckley et al., 2001), and borderline results should
be used with caution (Townsend et al., 2004).
RESULTS
Phylogenetic analyses of B. valliceps and B. nebulifer
Of the 19 recently collected individuals included from the
B. valliceps/nebulifer data set, 14 represented unique haplotypes when sampled across both genes (i.e. some individuals
were identical for the 16S sequence, but had different cyt b
sequences, and vice versa). When compared with the data of
Mulcahy & Mendelson (2000) this resulted in a total of 32
unique haplotypes for the B. valliceps/nebulifer data set. Two
individuals from locality Mx8 were identical (Mx8d and h),
two individuals (Mx8i and j) were identical to samples Mx1
to Mx2, and four unique haplotypes were recovered from
locality Mx10 (Mx10d, f, g were identical; Mx10e was
identical to Mx3c from Los Tuxtlas). All phylogenetic
analyses were conducted on a data set consisting of the 32
unique haplotypes and three outgroup taxa (B. coccifer,
B. mazatlanensis and B. campbelli). Analysis of the 16S data
set (562 characters, 73 variable, 26 parsimony-informative)
produced 3767 trees (103 steps each); tree not shown. A strict
consensus of these trees contained one clade, consisting of all
the samples of B. nebulifer, with the remaining samples in an
unresolved polytomy (tree not shown). The cyt b data set
(421 characters, 105 variable, 57 parsimony-informative)
produced six trees (155 steps); tree not shown. A strict
consensus of these trees is generally consistent with the
overall combined MP tree (see below). The partition-homogeneity tests revealed the two data sets were significantly
different (P ¼ 0.04); however, this test may be too conservative at the a ¼ 0.05 level and combining weakly-incongruent data sets generally provides a more accurate estimation
(Cunningham, 1997). Therefore, we combined the two generegions into a single analysis.
The MP analysis (100 random additions) of 35 operational
taxonomic units (OTUs) resulted in two most-parsimonious
trees (262 steps, RI ¼ 0.88, CI ¼ 0.79). The only difference
between the two trees was the placement of a sub-clade
containing samples of B. nebulifer from Texas. This clade was
placed basal to the remaining samples of B. nebulifer in one
tree, and nested among them in another. A strict consensus of
the two trees was nearly identical to the ML and BI analyses
(see below), and supports two monophyletic clades referable to
B. valliceps and B. nebulifer. These two clades were supported
by bootstrap values of 97 and 100, respectively (Fig. 5). There
was relatively little phylogenetic structure among samples of
B. nebulifer; however, two sub-clades within B. valliceps show
some suggestion of a phylogenetic break that is geographically
consistent with the Isthmus of Tehuantepec. Two of the three
samples from Los Tuxtlas, Veracruz (north of the isthmus,
samples Mx3a and b), were placed in a clade with all other samples found south of the Isthmus of Tehuantepec, while one
(Mx3c) grouped with those north of the isthmus (Fig. 5).
Modeltest selected TrN + G (gamma shape parameter)
model under the hierarchical likelihood ratio test (hLRT)
with base frequencies of A ¼ 0.3016; C ¼ 0.2366; G ¼ 0.1789;
T ¼ 0.2828, six substitution types with a rate-matrix of
A–G ¼ 7.3187; C–T ¼ 11.4953 (all others equal to 1.0), and
a gamma shape parameter: G ¼ 0.0713. The ML analysis run
with these parameters produced one tree with a score of
)ln L ¼ 2723.60976 (Fig. 5). The results of this analysis were
similar to those of the MP analysis, with both B. nebulifer and
B. valliceps being monophyletic, and with some support for an
isthmian break in B. valliceps (again slightly obscured by
samples from Los Tuxtlas, Veracruz). In the Bayesian analyses,
the three searches each appeared to reach stationarity near
15,000 generations, therefore the first 2000 trees representing
conservatively the first 20,000 generations were discarded as
the burn-in process. Average tree scores ()ln L ¼ 2826.1891)
were taken from each of the 48,000 trees. The 50% majorityrules consensus trees were largely consistent with the MP, and
identical to the ML analyses; results for the first BI run are
shown in Fig. 5. The outgroup taxon B. coccifer was removed
in Fig. 5 to focus on branch-lengths within the ingroup.
Uncorrected sequence divergence between B. valliceps and
B. nebulifer ranged from 2.8% to 4.0%; similarly, the corrected
differences ranged from 2.8% to 4.1% (Table 2). Corrected
sequence divergence (HKY85) for the two clades of B. valliceps
on either side of the isthmus ranged from 1.0% to 2.0%
(Table 2). It is worth noting that the model of evolution used
in the ML phylogenetic analyses of Mulcahy & Mendelson
(2000) was the Hasegawa–Kishino–Yano (HKY85; Hasegawa
et al., 1985). That model was chosen to account for among-site
rate variation in the data (Mulcahy & Mendelson, 2000), prior
to the wide use of Modeltest. In the present study, we used the
program Modeltest and a different model of evolution was
selected for the data (TrN + G; see above).
The results from the phylogenetic analyses based on the two
different models are very similar; however, the corrected
sequence divergences between taxa are very different. For
example, the corrected sequence divergence average between
B. valliceps and B. nebulifer is 3.3% using the HKY85 model
(Table 2), whereas the average difference using the TrN + G
Journal of Biogeography 33, 1889–1904
ª 2006 The Authors. Journal compilation ª 2006 Blackwell Publishing Ltd
1895
D. G. Mulcahy, B. H. Morrill and J. R. Mendelson III
Figure 5 Bayesian analysis phylogram for
the Bufo valliceps/nebulifer data set. Topology
was nearly identical to the MP and ML analyses. The outgroup B. coccifer was secondarily removed to focus on branch lengths
within the ingroup. Parsimony bootstrap
values are shown above and Bayesian posterior probabilities (· 100) are shown below
significant clades. Bars on right indicate
geographic distribution of haplotypes relative
to the TMNB and the Isthmus of Tehuantepec.
Table 2 Pair-wise percentage sequence divergence within and between Bufo nebulifer and B. valliceps samples (excluding identical haplotypes); averages followed by ranges in parentheses. Comparisons with HKY85-corrected distances (see text) are shown in italics, others are
uncorrected. Comparisons within B. valliceps are shown within and between those found north and south of the Isthmus of Tehuantepec
(with Mx3a–b in the south)
B. valliceps
B. nebulifer
B. valliceps
North of Isthmus
South of Isthmus
B. nebulifer
B. valliceps
North of Isthmus
South of Isthmus
0.4% (0.1–0.8%)
3.3% (2.8–4.1%)
–
–
3.2% (2.8–4.0%)
1.0% (0.1–2.1%)
–
–
–
–
0.3% (0.1–0.6%)
1.5% (1.0–2.1%)
–
–
1.5% (1.0–2.0%)
0.7% (0.1–1.6%)
model is 5.3% (range ¼ 4.1–7.4%), which changes interpretations using the molecular clock. We used HKY85-corrected
distances to compare sequence data between lineages in this
study (Table 2) to be consistent with our previous study;
however, we present the TrN + G model calculations for a
comparison. Using the rate of molecular evolution (0.33% per
lineage, per million year) from Mulcahy & Mendelson (2000)
1896
and the HKY85-corrected data, we calculate – from Table 2,
3.3% divided by 2 (per lineage), divided by 0.33 (the rate of
evolution) – an average c. 5.0 ma (range ¼ 4.2–6.2 ma using
min.–max., Table 2) separation of B. valliceps and B. nebulifer
and c. 8.0 ma (range ¼ 6.2–11.2 ma) using the TrN + G
corrected data. Using the HKY85 calculations, the divergence
at the Isthmus of Tehuantepec in B. valliceps is estimated to be
Journal of Biogeography 33, 1889–1904
ª 2006 The Authors. Journal compilation ª 2006 Blackwell Publishing Ltd
Biogeography of lowland toads (Bufo)
c. 2.3 ma (range ¼ 1.5–3.2 ma), and c. 2.7 ma (range ¼ 1.7–
4.1 ma) using the TrN + G corrected data (1.8%,
range ¼ 1.1–2.7% sequence divergence).
Phylogenetic analyses of B. marinus
Of the 23 individuals from the B. marinus data set, 19 had
unique haplotypes when sampled across both genes. Analysis
of the 16S data set (548 characters, 50 variable, 30 parsimonyinformative) produced 4 trees (56 steps); tree not shown.
Analysis of the cyt b data set (425 characters, 93 variable,
42 parsimony-informative) produced 70 trees (131 steps), the
strict consensus of which was generally consistent with the
combined MP tree (see below). The partition-homogeneity
tests revealed that the two data sets were not significantly
different (P ¼ 0.90) and the two were combined into a single
analysis. The combined MP analysis (100 random additions) of
22 OTUs resulted in 50 most-parsimonious trees (189 steps,
RI ¼ 0.81, CI ¼ 0.80). Bootstrap values for the major clades
are shown in Fig. 6. We found phylogenetic signal associated
with the break across the TMNB, however the clades were only
weakly supported, and showed very little genetic divergence
across this break (see below). One clade, containing the
samples north of the TMNB (Mx8) had low bootstrap support
(63), and was sister to the clade of samples from the middle
(Mx9; Fig. 6). The remaining samples along the transect
(Mx10) were placed in a polytomy with those from Guerrero
(Mx11) and Sinaloa (Mx12), Mexico. In the MP analysis, we
found support for a break associated with the Isthmus of
Tehuantepec (Fig. 6), with the exception of one sample (G1)
taken from the head of the Grijalva Valley, in Guatemala. This
sample was placed among the westerly samples from Mexico,
and the support for this clade was weak (< 50%; Fig. 6);
however, the clade found southeast of the Isthmus was wellsupported.
For the two genes combined, Modeltest selected TrN + G
(gamma shape parameter) as the best-fit model under the
hierarchical likelihood ratio test (hLRT) criteria, with base
frequencies of A ¼ 0.2855; C ¼ 0.2417; G ¼ 0.1824;
T ¼ 0.2904, six substitution types with a rate-matrix of
A–G ¼ 7.8102; C–T ¼ 14.1003 (all others equal to 1.0), and
a gamma shape parameter: G ¼ 0.1042. The ML analysis run
with these parameters produced a tree a score of
)ln L ¼ 2355.4517. Our ingroup samples all had relatively
short branch lengths, and the results of this analysis were
generally similar to that of the MP analysis. We found similar
support for a phylogenetic break across the TMNB and the
Isthmus of Tehuantepec, with sample G1 placed in the clade of
samples from Mexico (west of the isthmus). In this analysis,
B. schneideri rendered B. marinus paraphyletic with respect to
Figure 6 Bayesian analysis phylogram for
Bufo marinus. Topology was nearly identical
to the MP and ML analyses. Parsimony
bootstrap values are shown above and Bayesian posterior probabilities (· 100) are
shown below for significant clades. Bars on
right indicate geographic distribution of
haplotypes relative to the TMNB and the
Isthmus of Tehuantepec.
Journal of Biogeography 33, 1889–1904
ª 2006 The Authors. Journal compilation ª 2006 Blackwell Publishing Ltd
1897
D. G. Mulcahy, B. H. Morrill and J. R. Mendelson III
our sample from South America and the remaining Mesoamerican samples (not shown).
For each gene-region tested separately, Modeltest selected
the HKY + G (gamma shape parameter) model under the
hierarchical likelihood ratio test (hLRT) criteria. Therefore, the
three Bayesian analyses were run, each with a 2-substitutiontype (transition/transversion) plus gamma model, and searches
appeared to reach stationarity near 10,000–12,000 generations.
The first 2000 trees representing conservatively the first 20,000
generations were discarded as the burn-in process. Average tree
scores ()ln L ¼ 2400.1138) were taken from the 48,000 trees
of each run. The 50% majority-rules consensus tree and
posterior-probabilities for the first run are shown in Fig. 6.
The results were largely consistent with those of the MP and
ML analyses, with strong support for a monophyletic Mesoamerican clade of B. marinus low support for a break across
the TMNB, and strong support for an isthmian break, again
with the exception of the position of G1.
Sequence divergence for B. marinus across the TMNB ranged
from 0.4% to 0.7% (Table 3). Using the difference between
north and south of the TMNB, we estimated a date of divergence
of c. 0.9 ma (range ¼ 0.6–1.1). Sequence divergence between
samples of B. marinus on either side of the Isthmus of
Tehuantepec were slightly larger, ranging from 0.8% to 2.2%
(Table 3), estimated as c. 2.7 ma (range ¼ 1.2–3.3). Sequence
variation was much greater among samples southeast of the
Isthmus of Tehuantepec (0.1–2.2%) as compared to variation
found north-west of the isthmus (0.1–1.3%), where the greatest
variation was found between sample Mx12 and Mx8–10 (0.8–
1.3%); Mx12 differed from Mx11 by 0.8%. The sample from
South America was very different from the Mesoamerican
samples (6.3–7.4%; Table 3), with an estimated date of divergence ranging from c. 10.9 ma (range ¼ 9.5–11.2).
Topology tests for both species groups
Although clades associated with two major geographic features
(putative barriers) were recovered in both species groups, the
overall structure among those clades was strikingly different.
The timing of divergence associated with each of the respective
geographic barriers was different for each species group. The
North of TMNB
Middle
South of TMNB
North of Isthmus
South of Isthmus
Central America
South America
1898
B. valliceps/nebulifer group showed divergence across the
TMNB prior to separation across the Isthmus of Tehuantepec,
while the B. marinus group showed the opposite (Fig. 7).
However, in both groups, clades associated with either side of
the isthmus were not reciprocally monophyletic.
We tested alternative phylogenies in order to validate the
strength of the effect of these barriers on our data. First, in
order to test the effect of the TMNB on the B. valliceps/
nebulifer group, we constrained two B. valliceps haplotypes
(Mx9a–b) to be in the B. nebulifer clade and conducted the
same analyses that were performed on the unconstrained data.
This resulted in six equally-parsimonious trees, each of which
were significantly different from either of the unconstrained
trees and the ML constrained topology was also significantly
different (‘TMNB’, Table 4). Therefore we could reject paraphyly of B. valliceps with respect to the samples at locality
Mx9. Secondly, to test the affect of an isthmian break in
B. valliceps, we constrained haplotypes Mx3a–c to be in the
clade north-west of the isthmus, but south of the TMNB (with
Mx9–10). This resulted in 12 trees that were each significantly
different from the unconstrained trees. However, the ML
constrained tree had an )ln L score difference of 21.740,
which was not significantly different (‘Isthmus’, Table 4).
Here, we reject reciprocally monophyly of B. valliceps haplotypes on either side of the Isthmus of Tehuantepec, but with
caution. Thirdly, to test for the alternative scenario recovered
in the B. marinus group, we constrained the B. valliceps/
nebulifer group to have the divergence associated with the
isthmus to precede that of the TMNB; i.e., enforcing the
topology of Fig. 7b on the B. valliceps/nebulifer group, consequently rendering B. valliceps paraphyletic: (B. valliceps S. of
Isthmus (B. valliceps N of Isthmus + B. nebulifer)). This
analysis resulted in four MP trees that were significantly
different from either of the unconstrained trees based on the
parsimony analysis (‘MNB vs. Isthmus’, Table 4). However,
the constrained ML topology had a likelihood score that
differed by 27.37, which was not significantly different based
on the S–H topology test (Table 4). Based on these results, we
tentatively reject the hypothesis that the B. valliceps/nebulifer
group shows structure similar to that of B. marinus associated
with the TMNB and the Isthmus of Tehuantepec, because the
North of TMNB
Middle
South of TMNB
0.1% (0.1–0.2%)
0.4% (0.3–0.5%)
0.6% (0.4–0.7%)
0.4% (0.3–0.5%)
0.2% (0.1–0.3%)
0.7% (0.5–0.8%)
0.6% (0.4–0.7%)
0.7% (0.5–0.8%)
0.62%
North of Isthmus
South of Isthmus
0.6% (0.1–1.3%)
1.8% (0.8–2.2%)
1.7% (0.8–2.2%)
1.1% (0.1–2.2%)
Central America
South America
1.2% (0.1–2.2%)
7.2% (6.7–7.9%)
6.8% (6.3–7.4%)
–
Table 3 Pair-wise percentage sequence
divergence within and between Bufo marinus
samples (excluding identical haplotypes);
averages followed by ranges in parentheses.
Comparisons with HKY85-corrected distances are shown in italics, others are uncorrected. Samples from north and south of the
TMNB represent localities Mx8 and Mx10,
respectively, whereas those in the middle are
from locality Mx9. There is only one withincomparison of those south of the TMNB.
Comparisons made with those north and
south of the Isthmus of Tehuantepec include
Mx11–12 as north of the Isthmus
Journal of Biogeography 33, 1889–1904
ª 2006 The Authors. Journal compilation ª 2006 Blackwell Publishing Ltd
Biogeography of lowland toads (Bufo)
Figure 7 Area cladograms recovered for the two species groups
in this study. (a) Area-cladogram for the Bufo valliceps/nebulifer
species group, showing that the TMNB divergence occurred prior
to the separation of B. valliceps haplotypes at the Isthmus of
Tehuantepec. (b) Area-cladogram for B. marinus, showing the
opposite pattern of the B. valliceps/nebulifer species group.
ML test was marginally non-significant (Buckley et al., 2001;
Townsend et al., 2004).
Likewise, we conducted similar topology tests for the
B. marinus group. Here, we constrained samples north of the
TMNB (Mx8–9) to be monophyletic, and those south of
the TMNB and north of the isthmus (Mx10–12, and G1) to be
monophyletic and obtained 25 trees, none of which were
significantly different from the 50 unconstrained MP trees. The
ML constrained topology was also not significantly different
(‘TMNB’, Table 4). Therefore we could not reject a separation
of haplotypes across the TMNB; however, we note that the
level of divergence across the TMNB in B. marinus haplotypes
is much less than that observed in the B. valliceps/nebulifer
group (0.6% vs. 3.3%, respectively; Tables 2 & 3). Secondly, we
constrained clades on either side of the Isthmus of Tehuantepec to be monophyletic by forcing G1 with the samples
originally recovered in the clade south of the isthmus (G3, E1–
2, H3–4, C1). This resulted in 35 MP trees and an ML tree with
a likelihood score that had a difference of 7.08; none of these
trees was significantly different from the unconstrained trees
(‘Isthmus’, Table 4). Therefore, we could not reject an effect of
the Isthmus of Tehuantepec on B. marinus haplotypes. Lastly,
we constrained the B. marinus group to show the same overall
topological structure as the B. valliceps/nebulifer group (i.e.
enforcing the topology of Fig. 7a on B. marinus: (Mx8 (Mx9–
12, G1) + (G3, E1–2, H3–4, C1)). The results of both the MP
and ML tests were significantly different from the unconstrained trees (‘TMNB vs. Isthmus’, Table 4). Therefore we
could reject the hypothesis that B. marinus shows an overall
pattern similar to that of the B. valliceps/nebulifer group.
Table 4 Results of the topology tests. Tree scores and number of equally parsimonious trees recovered in the unconstrained phylogenies are
shown for both groups in the left column. Columns to the right show results for the constrained phylogenies, with the range of summary
statistics (see text for explanation of constraint topologies and Appendix 1 for actual constraints enforced).
Unconstrained phylogenies
Constrained phylogenies
Bufo valliceps/nebulifer
TMNB
Isthmus
TMNB vs. Isthmus
(6 trees, 274 steps)
(12 trees, 271 steps)
(4 trees, 280 steps)
Parsimony
n Zà
P§
n
Z
P
n
Z
P
(2 trees, 262 steps)
11
12
3.21
3.46
0.0007**
0.0003**
11
2.18
0.0147**
17
19
4.02
3.38
0.0001**
0.0007**
Likelihood
Constrain
Diff.
P
Constrain
Diff.
P
Constrain
Diff.
P
)ln L ¼ 2723.6098
2744.3887
20.78
0.035*
2745.3506
21.740
0.085
2750.9784
27.37
0.057
Bufo marinus
(25 trees, 190 steps)
(35 trees, 192 steps)
(20 trees, 194 steps)
Parsimony
n
Z
P
n
Z
P
n
Z
P
(50 trees, 189 steps)
1
3
5
1.00
0.58
0.45
0.1587
0.2819
0.3274
5
7
1.34
1.13
0.0899
0.1284
5
7
2.24
1.89
0.0127**
0.0294*
Likelihood
Constrain
Diff.
P
Constrain
Diff.
P
Constrain
Diff.
P
)ln L ¼ 2355.4517
2359.5382
4.08
0.303
2362.5321
7.08
0.143
2374.5949
19.14
0.045*
Number of characters differing in minimum number of changes on paired topologies.
àNormal approximation for Wilcoxon signed-ranks tests.
§Asterisks indicate a significant difference between the overall shortest tree and the constrained topologies. One asterisk denotes significance using the
one-tailed probability and two asterisks denote significance using the two-tailed probability. One-tailed probabilities are shown, two-tailed are twice
the values.
Journal of Biogeography 33, 1889–1904
ª 2006 The Authors. Journal compilation ª 2006 Blackwell Publishing Ltd
1899
D. G. Mulcahy, B. H. Morrill and J. R. Mendelson III
DISCUSSION
Our data support a role for two major geographic features in
shaping the historical biogeography in two independent
lineages of lowland toads. However, the sequence of events
appears different for each group (Fig. 7). The TMNB has been
shown to represent a barrier to gene flow in other lowland taxa
(Hulsey et al., 2004; Zaldı́var-Riverón et al., 2004), while the
Isthmus of Tehuantepec has been more typically invoked as a
barrier for upland taxa (Marshall & Liebherr, 2000; Sullivan
et al., 2000). In our study, we confirmed that the B. valliceps/
nebulifer species boundary lies along the eastern terminus of
the TMNB, consistent with the Pliocene-vicariance hypothesis
of Mulcahy & Mendelson (2000) and identified subsequent
phylogeographic structure in B. valliceps associated with the
Isthmus of Tehuantepec. In contrast, B. marinus showed
phylogeographic structure along either side of the Isthmus of
Tehuantepec, prior to that of the TMNB. At the TMNB, the
signal in the B. marinus data is more consistent with the
‘Pleistocene-dispersal, followed by vicariance hypothesis’ of
Mulcahy & Mendelson (2000). We evaluated the veracity of
these contrasting patterns between the B. valliceps/nebulifer
and B. marinus groups by using alternative topology tests. We
imposed the B. marinus phylogenetic structure (Fig. 7b) on
the B. valliceps/nebulifer group, and vice versa, and the
resulting topologies were significantly different, based on the
MP analyses, from the shortest trees recovered in each group
(Table 4). The ML topology test recovered marginally nonsignificant results for the B. valliceps/nebulifer group with
respect to the isthmus (Table 4). However, this result is in
conflict with a well-supported node based on the MP and
Bayesian analyses (97 and 96 respectively; Fig. 5), which
suggests that the ML-based (S–H) topology test may be more
conservative than the MP topology test (Wilcoxon signedrank). Therefore, we reject the hypothesis that these sympatric
species groups, with similar natural histories, show the same
phylogeographic structure.
Previous molecular studies invoking vicariance for related
taxa distributed on either side of the TMNB consisted of data
sampling far to the north and south, and inferred clade
boundaries to be at the eastern terminus of the TMNB
(Mulcahy & Mendelson, 2000; Hulsey et al., 2004; Zaldı́varRiverón et al., 2004). Our additional samples of B. valliceps
and B. nebulifer across the TMNB (Figs 2 & 3) demonstrate
the strict parapatry on either side of this now seemingly minor
geographic barrier. Our sample size in the middle of the
TMNB is relatively small (n ¼ 2), such that future work may
reveal these two species to be sympatric in the small area of
suitable habitat near the town of El Viejón (Mx9, Fig. 2). Based
on the fact that species of Bufo are frequently interfertile (Blair,
1963; Masta et al., 2002), it would not be surprising to us if
these species were found to hybridize in this area. If this were
the case, we may not be able to detect the presence of both
species with mtDNA as our only genetic marker. Nonetheless,
our data strongly indicate that these northern and southern
clades represent distinct evolutionary species, showing a
1900
precisely parapatric distribution across this ancient geographic
barrier.
Our increased sampling south of the TMNB greatly improved
the phylogenetic support for the monophyly of B. valliceps,
which was previously lacking (Mulcahy & Mendelson, 2000).
We attribute this difference to the increased sampling between
the TMNB and the Isthmus of Tehuantepec, and the
phylogenetic signal associated with the isthmus. The sampling
of Mulcahy & Mendelson (2000) contained only three samples
of B. valliceps north of the isthmus (Mx3a–c), all from Los
Tuxtlas. These three haplotypes were scattered across the
distribution of other haplotypes of B. valliceps, with Mx3c
recovered in the most basal position (Mulcahy & Mendelson,
2000). With increased sampling (this study), Mx3c was placed in
a clade of haplotypes found north of the Isthmus of Tehuantepec
(Fig. 5), a clade estimated to be of late Pliocene–Pleistocene
origin. However, samples Mx3a–b remain nested among
haplotypes in the clade south of the isthmus. We were able to
reject the alternative hypothesis that samples north of the
isthmus formed a monophyletic clade (Table 4). At this time,
we can not discriminate between incomplete lineage sorting vs. a
recent dispersal for the occurrence of haplotypes Mxa–b at Los
Tuxtlas. However, because the Los Tuxtlas landscape is of late
Pliocene volcanic origin (Ferrusquia-Villafranca, 1993) – the
approximate divergence time for the B. valliceps isthmian clades
– we favour a more recent dispersal explanation for the
occurrence of haplotypes from both clades at Los Tuxtlas.
Our analyses of the B. marinus data do not support a
hypothesis that the Pliocene uprising of the TMNB caused a
major vicariant event among populations of this species, as it
did in the B. valliceps/nebulifer group. The data from B. marinus do contain phylogeographic structure associated with the
TMNB; however, the branch lengths are very shallow (Fig. 6)
and the sequence divergences are low (Table 3). Based on these
results, we suggest that B. marinus dispersed across this barrier
during lower sea levels associated with glacial maxima during
the Pleistocene. Our rate of evolution estimated from the
B. valliceps/nebulifer group corroborates this hypothesis. If we
calibrate a rate for B. marinus based on a Pliocene (5.4 ma)
divergence across the TMNB, consistent with that of the
B. valliceps/nebulifer group (Mulcahy & Mendelson, 2000; this
study), we obtain a rate of c. 1.6%, per lineage, per million
years, which is twice the expected rate for ectotherms (Tan &
Wake, 1995), and far beyond that estimated for other bufonid
mtDNA (Graybeal, 1993; Macey et al., 1998). Bufo marinus is
known to be of South American origin (i.e. all of its closest
relatives are included in clades restricted to South America;
Slade & Moritz, 1998; Pauly et al., 2004; Pramuk, 2006). Our
results are consistent with a model in which B. marinus
dispersed into Central America during the early Pliocene, and
later into southern Mexico, subsequent to the uplift of the
TMNB. A fossil record referred to B. marinus from the
Miocene of Kansas, USA, (Wilson, 1968) refutes this scenario.
However, recent concern has questioned the reliability of
precise taxonomic assignment based on fragmentary fossil data
in anurans (Bever, 2005; see also Pauly et al., 2004), and the
Journal of Biogeography 33, 1889–1904
ª 2006 The Authors. Journal compilation ª 2006 Blackwell Publishing Ltd
Biogeography of lowland toads (Bufo)
specific designation of this record remains questionable
(Holman, 2003).
Data from both B. valliceps and B. marinus show phylogenetic structure associated with the Isthmus of Tehuantepec.
While our sampling is not fully adequate to test for an effect of
a Pliocene seaway across the Isthmus of Tehuantepec, our data
do provide two independent lines of evidence to suggest that it
may have been present. Our estimated dates of divergence
from clades on either side of the isthmus were approximately
2–3 ma, in both species groups. This suggests a common
barrier of some type existed for lowland taxa at the Isthmus of
Tehuantepec during the mid-Pliocene. Beard et al. (1982)
suggest sea-level fluctuations associated with continental
glaciation began approximately 3 ma, indicating high sea
levels prior to the first glacial cycle beginning c. 2.8 ma. This
corresponds to our timing of divergence in both B. valliceps
and B. marinus at the isthmus. Sullivan et al. (2000) also found
sequence divergence, in harvest mice (Reithrodontomys),
consistent with a late Pliocene trans-isthmus marine barrier.
We were able to reject monophyletic lineages on either side of
the isthmus for B. valliceps; however, we were not able to reject
this alternative in B. marinus. Bufo marinus is abundant in the
lowlands of the isthmus and indeed in all adjacent lowland
areas (Duellman, 1960; J.R. Mendelson, pers. obs.). Bufo
valliceps however, is common along the Atlantic lowlands
northeast of the isthmus, absent along the Pacific Coast of
Oaxaca and Guerrero to the southwest of the isthmus, and is
inexplicably uncommon along the Pacific Coastal Plain of
Chiapas and Guatemala to the southeast of the isthmus
(Mendelson, 2001). This biogeographical contrast between the
two species suggests that B. marinus may disperse more readily
into new regions than does B. valliceps. The exception to the
isthmian clades in our B. marinus data (sample G1) may be an
artifact of poor sampling in this area, or may represent a recent
dispersal from the northwest into the Grijalva Valley, similar to
that observed in B. valliceps (cf. Fig. 3). Further sampling of
multiple taxa, including B. valliceps and B. marinus should be
conducted across this region, in order specifically to test
hypotheses associated with a Pliocene seaway across the
Isthmus of Tehuantepec, and subsequent dispersal routes
across this barrier.
The three species of toads in our study are similar in having
widespread, lowland distributions, and by having great
tendencies to disperse into a variety of habitats. Despite these
evident similarities in their natural histories, our data indicate
that they have experienced quite different histories with
respect to the formation of the TMNB and the possible
inundation of the Isthmus of Tehuantepec. These differences
are most likely attributable to matters of timing – the ancestor
of B. nebulifer + B. valliceps predates the major orogeny of the
TMNB in this area, while B. marinus is likely to have arrived
long after it represented a significant barrier to dispersal. Most
taxa examined to date show species-level divergence across the
TMNB (Hulsey et al., 2004; Zaldı́var-Riverón et al., 2004).
Here, we have shown low levels of sequence divergence across
this barrier within a single species–B. marinus. Pérez-Higareda
& Navarro (1980) point out some 16 species of reptiles that
straddle this barrier and many others that show subspecific
delineations on either side, yet these remain to be tested with
molecular data. Both B. valliceps and B. marinus show low
levels of intraspecific variation, possibly associated with a midPliocene barrier across the Isthmus of Tehuantepec. The
question remains as to why neither B. nebulifer nor B. valliceps
have secondarily dispersed over the TMNB, concurrent with
B. marinus. Perhaps our limited sampling of the area in the
middle (or our choice of molecular marker) was not sufficient
to detect sympatry in these species. Nevertheless, we were able
to pin-point a putative area of contact between these two
species for future investigation. In a logical sequence then, our
results demonstrate an ancient vicariant event, a more recent
dispersal event, and the area of possible ongoing biological
influences maintaining species boundaries (viz., between
B. nebulifer and B. valliceps).
ACKNOWLEDGEMENTS
We would like to thank the following people, institutions and
curators for providing tissue samples and locality data for this
study: Jonathan A. Campbell, Kevin de Queiroz, Oscar FloresVillela, Carl J. Franklin, Eli B. Greenbaum, John H. Malone,
Jenny B. Pramuk, Mahmood Sasa M., John E. Simmons, Eric
N. Smith, Larry D. Wilson, UTACV, KUNHM, USNM and
UNAM. We thank Paul Wolf, Mike Pfrender, Eric O’Neill, and
Chris Feldman for assistance in the lab, and Chris Feldman
and Bob Macey for assistance in data analysis, Karen R. Lips
and Ron M. Bonett for field assistance, and Ted Papenfuss for
use of his Mac (G5) for phylogenetic analyses. USU Department of Biology and an Undergraduate Research and Creative
Opportunities Grant (URCO), awarded to B. H. Morrill,
provided funding the data collection. Fieldwork along the
transect of the TMNB was funded by a Theodore Roosevelt
Memorial Grant from the American Museum of Natural
History awarded to D. G. Mulcahy and a National Geographic
grant to J. R. Mendelson and K. R. Lips.
REFERENCES
Beard, J.H., Sangree, J.B. & Smith, L.A. (1982) Quaternary
chronology, paleoclimate, depositional sequences, and eustatic cycles. American Association of Petroleum Geologists
Bulletin, 66, 158–169.
Bever, G.S. (2005) Variation in the ilium of North American
Bufo (Lissamphibia; Anura) and its implications for specieslevel identification of fragmentary anuran fossils. Journal of
Vertebrate Paleontology, 25, 548–560.
Blair, W.F. (1963) Evolutionary relationships of North
American toads of the genus Bufo: a progress report. Evolution, 17, 1–16.
Bryant, W.R. & Bryant, J.R. (1991) Bathymetric Chart:
Gulf of Mexico Region. The Gulf of Mexico Basin: the
geology of North America (ed. by A. Salvador), Vol. J,
Plate 1. Geological Society of America, Boulder, CO.
Journal of Biogeography 33, 1889–1904
ª 2006 The Authors. Journal compilation ª 2006 Blackwell Publishing Ltd
1901
D. G. Mulcahy, B. H. Morrill and J. R. Mendelson III
Bryant, W.R., Lugo, J., Cordova, C. & Salvador, A. (1991)
Physiography and bathymetry. The Gulf of Mexico Basin: the
geology of North America (ed. by A. Salvador), Vol. J, pp. 13–
30. Geological Society of America, Boulder, CO.
Buckley, T.R., Simon, C., Shimodaira, H. & Chambers, G.K.
(2001) Evaluating hypotheses on the origin and evolution of
the New Zealand alpine cicadas (Maoricicada) using multiple-comparison tests of tree topology. Molecular Biology
and Evolution, 18, 223–234.
Campbell, J.A. (1998) Amphibians and reptiles of northern
Guatemala, the Yucatan and Belize. University of Oklahoma
Press, Norman.
Campbell, J.A. (1999) Distribution patterns of amphibians in
Middle America. Distribution patterns of amphibians: a global perspective (ed. by W.W. Duellman), pp. 111–209. John
Hopkins University Press, Baltimore.
Campbell, J.A. & Frost, D.R. (1993) Anguid lizards of the
genus Abronia: revisionary notes on the species of Nuclear
Central America and adjacent Mexico, descriptions of four
additional species, with a phylogenetic hypothesis for the
genus and an identification key. Bulletin of the American
Museum of Natural History, 216, 1–121.
Castoe, T.A., Chippindale, P., Campbell, J.A., Ammerman,
L.K. & Parkinson, C.L. (2003) Evolutionary relationships of
the Middle American Jumping Pitvipers (Genus Atropoides)
and phylogeography of the Atropoides nummifer complex.
Herpetologica, 49, 421–432.
de Cserna, Z. (1989) An outline of the geology of Mexico. The
geology of North America (ed. by A. Salvador), Vol. A, pp.
223–264. Geological Society of America, Boulder, CO.
Cunningham, C.W. (1997) Can three incongruence tests predict when data should be combined? Molecular Biology and
Evolution, 14, 733–740.
Darda, D.M. (1994) Allozyme variation and morphological
evolution among Mexican salamanders of the genus Chiropterotriton (Caudata: Plethodontidae). Herpetologica, 50,
164–187.
Duellman, W.E. (1960) A distributional study of amphibians
of the Isthmus of Tehuantepec, Mexico. University of Kansas
Publication, Museum of Natural History, 13, 19–72.
Ewing, T.E. & Lopez, R.F. (1991) Principle structural features.
The Gulf of Mexico Basin: the geology of North America (ed.
by A. Salvador), Vol. J, Plate 2. Geological Society of
America, Boulder, CO.
Felsenstein, J. (1985) Confidence limits on phylogenies with a
molecular clock. Systematic Zoology, 34, 152–161.
Ferrusquia-Villafranca, I. (1993) Geology of Mexico: a synopsis. Biological diversity of Mexico: origins and distribution
(ed. by T.P. Ramamoorthy, R. Bye and A. Lot), pp. 3–107.
Oxford Press, New York.
Goldman, N., Anderson, J.P. & Rodrigo, A.G. (2000) Likelihood-based tests of topologies in phylogenetics. Systematic
Biology, 49, 652–670.
Graybeal, A. (1993) The phylogenetic utility of cytochrome b:
lessons from bufonid frogs. Molecular Phylogenetics and
Evolution, 2, 256–269.
1902
Graybeal, A. (1997) Phylogenetic relationships of bufonid frogs
and tests of alternate macroevolutionary hypotheses characterizing their radiation. Zoological Journal of the Linnaean
Society, 119, 297–338.
Hasegawa, M,, Kishino, H. & Yano, T. (1985) Dating of the
human-ape splitting by a molecular clock of mitochondrial
DNA. Journal of Molecular Evolution, 21, 160–174.
Holman, J.A. (2003) Fossil frogs and toads of North America.
Indiana University Press, Bloomington, IN.
Huelsenbeck, J.P. & Ronquist, F. (2001) MRBAYES: Bayesian
inference of phylogenetic trees. Bioinformatics, 17, 754–755.
Hulsey, C.D., Garcia de Leon, F.J., Johnson, Y.S., Hendrickson,
D.A. & Near, T.J. (2004) Temporal diversification of Mesoamerican cichlid fishes across a major biogeographic boundary. Molecular Phylogenetics and Evolution, 31, 754–764.
Kishino, H. & Hasegawa, M. (1989) Evaluation of the maximum likelihood estimate of the evolutionary tree topologies
from DNA sequence data, and the branching order in Hominoidea. Journal of Molecular Evolution, 29, 170–179.
Lee, J.C. (1996) The amphibians and reptiles of the Yucatán
Peninsula. Comstock Publishing Co., Ithaca, New York.
Macey, R.J., Schulte, J.A., II, Larson, A., Fang, Z., Wang, Y.,
Tuniyev, B.S. & Papenfuss, T.J. (1998) Phylogenetic
relationships of toads in the Bufo bufo species group from
the eastern escarpment of the Tibetan Plateau: A case of
vicariance and dispersal. Molecular Phylogenetics and
Evolution, 9, 80–87.
Maddison, W.P. & Maddison, D.R. (2000) MacClade, analysis
of phylogeny and character evolution, Version 4.0. Sinauer,
Sunderland, MA.
Maniatis, T., Fristch, E.F. & Sambrook, J. (1982) Molecular
cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
Marshall, C.J. & Liebherr, J.K. (2000) Cladistic biogeography
of the Mexican transition zone. Journal of Biogeography, 27,
203–216.
Masta, S.E., Sullivan, B.K., Lamb, T. & Routman, E.J. (2002)
Molecular systematics, hybridization, and phylogeography
of the Bufo americanus complex in Eastern North America.
Molecular Phylogenetics and Evolution, 24, 302–314.
Mateos, M. (2005) Comparative phylogeography of livebearing
fishes in the genera Poeciliopsis and Poecilia (Poeciliidae:
Cyprinodontiformes) in central Mexico. Journal of Biogeography, 32, 775–780.
McCranie, J.R. & Wilson, L.D. (2002) The amphibians of
Honduras. Society for the Study of Amphibians and Reptiles,
Ithaca, New York.
Mendelson, J.R., III (1994) A new species of toad (Anura:
Bufonidae) from the lowlands of eastern Guatemala. Occasional Papers of the Museum of Natural History, University of
Kansas, 166, 1–21.
Mendelson, J.R., III (2001) A review of the Guatemalan toad
Bufo ibarrai (Anura: Bufonidae), with distributional and
taxonomic comments of Bufo valliceps and Bufo coccifer.
Mesoamerican herpetology: systematics, natural history, and
conservation (ed. by J.D. Johnson, R.G. Webb and O. Flores-
Journal of Biogeography 33, 1889–1904
ª 2006 The Authors. Journal compilation ª 2006 Blackwell Publishing Ltd
Biogeography of lowland toads (Bufo)
Villela), pp. 10–19. The University of Texas at El Paso, El
Paso, TX.
Mendelson, J.R., III, Williams, B.L., Sheil, C.A. & Mulcahy,
D.G. (2005) Systematics of the Bufo coccifer complex (Anura: Bufonidae) of Mesoamerica. Scientific Papers, University
of Kansas Natural History Museum, 38, 1–27.
Mulcahy, D.G. & Mendelson, J.R., III (2000) Phylogeography and speciation of the morphologically variable,
widespread species Bufo valliceps, based on molecular
evidence from mtDNA. Molecular Phylogenetics and Evolution, 17, 173–189.
Pauly, G.B., Hillis, D.M. & Cannatella, D.C. (2004) The history
of a nearctic colonization: molecular phylogenetics and
biogeography of the nearctic toads (Bufo). Evolution, 58,
2517–2535.
Pérez-Higareda, G. & Navarro, L.D. (1980) The faunistic districts of the low plains of Veracruz, Mexico, based on reptilian and mammalian data. Bulletin of Maryland
Herpetological Society, 16, 54–69.
Posada, D. & Crandall, K.A. (1998) Modeltest: testing the
model of DNA substitution. Bioinformatics, 14, 817–818.
Pramuk, J.B. (2006) Phylogeny of South American Bufo (Anura: Bufonidae) inferred from combined evidence. Zoological Journal of the Linnaean Society, 146, 407–452.
Rosen, D.E. (1978) Vicariant patterns and historical explanation in biogeography. Systematic Zoology, 27, 159–188.
Savage, J.M. (2002) The amphibians and reptiles of Costa Rica.
The University Chicago Press, Chicago, IL.
Shimodaira, H. & Hasegawa, M. (1999) Multiple comparisons
of log-likelihoods with applications to phylogenetic inference. Molecular Biology and Evolution, 16, 1114–1116.
Slade, R.W. & Moritz, C. (1998) Phylogeography of Bufo
marinus from its natural and introduced ranges. Proceedings
of the Royal Society of London Series B, Biological Sciences,
265, 769–777.
Sullivan, J., Arellano, E. & Rogers, D.S. (2000) Comparative
phylogeography of Mesoamerican Highland Rodents: concerted versus independent response to past climatic fluctuations. The American Naturalist, 155, 755–768.
Swofford, D.L. (1999) PAUP*: Phylogenetic Analysis Using Parsimony (*and other methods), Beta Version 4.0b10. Sinauer,
Sunderland, MA.
Tan, A.-M. & Wake, D.B. (1995) MtDNA phylogeography
of the California newt Taricha torosa (Caudata, Salamandridae). Molecular Phylogenetics and Evolution, 4, 383–
394.
Templeton, A.R. (1983) Phylogenetic inference from restriction endonuclease cleavage site maps with particular reference to the evolution of humans and the apes. Evolution, 37,
221–244.
Townsend, T.M., Larson, A., Louis, E. & Macey, R. (2004)
Molecular phylogenetics of Squamata: the position of
snakes, amphisbaenians, and dibamids, and the root of the
squamate tree. Systematic Biology, 53, 735–757.
Wilson, R.L. (1968) Systematic and faunal analysis of a Lower
Pliocene vertebrate assemblage from Trego County, Kansas.
Contributions from the Museum of Paleontology, University of
Michigan, 2, 75–126.
Zaldı́var-Riverón, A., Leon-Regagnon, V. & Nieto-Montes
de Oca, A. (2004) Phylogeny of the Mexican coastal
leopard frogs of the Rana berlandieri group based on
mtDNA sequences. Molecular Phylogenetics and Evolution,
30, 38–49.
Zug, G.R. & Zug, P.B. (1979) The marine toad, Bufo marinus: a
natural history resume of native populations. Smithsonian
Contributions to Zoology, 284, 1–58.
BIOSKETCHES
Daniel G. Mulcahy is a PhD candidate in the Department of
Biology, at Utah State University (USU). His graduate research
involves biogeography and systematics of Neotropical and
western North American amphibians and reptiles.
Joseph R. Mendelson III received his PhD in 1997 from The
University of Kansas, and has been conducting research and
conservation studies on Neotropical amphibians and reptiles
for 16 years. He is now Curator of Herpetology at Zoo Atlanta,
and Adjunct Associate Professor of Biology at Utah State
University.
Benson H. Morrill is a PhD student in L. Rickords’ molecular
biology laboratory at Utah State University. He was an
undergraduate at USU and completed his honours thesis as
part of this study. His academic interests are herpetology and
genetics.
Editor: Brett Riddle
APPENDIX 1 TOPOLOGIES USED IN
CONSTRAINT TEST.
Constrained topologies are labelled following Table 4 for the
three tests for each group: TMNB, Isthmus, and TMNB vs.
Isthmus. For the Bufo valliceps/nebulifer data, the following
translation is used: 1 B. coccifer, 2 B. mazatlanensis, 3 B. campbelli, 4 Bneb Lou1, 5 Bneb Tx2, 6 Bneb Tx4, 7 Bneb Mx1, 8
Bneb Mx8b, 9 Bneb Mx8c, 10 Bneb Mx8d, 11 Bneb Mx8e, 12
Bneb Mx8a, 13 Bneb Mx8f, 14 Bneb Mx8g, 15 Bval Mx3a, 16
Bval Mx3b, 17 Bval Mx3c, 18 Bval Mx5, 19 Bval Mx6, 20 Bval
Mx7, 21 Bval B1, 22 Bval B2, 23 Bval H1, 24 Bval H2, 25
Bval G1, 26 Bval G2, 27 Bval G3, 28 Bval G4a, 29 Bval G4b, 30
Bval Mx10a, 31 Bval Mx10b, 32 Bval Mx10c, 33 Bval Mx10d,
34 Bval Mx9a, 35 Bval Mx9b, with the following topologies
were used for the constrained phylogenetic analyses: TMNB ¼
(1, ((2, ((4–14, 34–35), (15– 33))), 3)); Isthmus ¼ (1, ((2, ((4–
14), ((18–29,), (15–17, 30–35)))), 3)); TMNB vs. Isthmus ¼ (1, ((2, ((18–29), ((15–35), (4–14)))), 3)); For the
B. marinus data, the following translation is used: 1 B. crucifer,
2 B. schneideri, 3 B. marinus S. A., 4 Bmar Mx11b, 5 Bmar
Journal of Biogeography 33, 1889–1904
ª 2006 The Authors. Journal compilation ª 2006 Blackwell Publishing Ltd
1903
D. G. Mulcahy, B. H. Morrill and J. R. Mendelson III
Mx9f, 6 Bmar Mx9a, 7 Bmar Mx9d, 8 Bmar G3, 9 Bmar Mx9b,
10 Bmar Mx11a, 11 Bmar C1, 12 Bmar Mx12, 13 Bmar Mx8a,
14 Bmar H3, 15 Bmar E1, 16 Bmar Mx9c, 17 Bmar H4, 18
Bmar G1, 19 Bmar Mx8b, 20 Bmar Mx8c, 21 Bmar Mx10b, 22
Bmar Mx10a, with the following topologies were used for the
1904
constrained phylogenetic analyses: TMNB ¼ (1, (2, (3, (((5–7,
9, 13, 16, 19, 20), (4, 10, 12, 18, 21, 22)), (8, 11, 14, 15, 17)))));
Isthmus ¼ (1, (2, (3, ((4–7, 9, 10, 13, 16, 19, 20, 22, 12, 21), (8,
11, 14, 15, 17, 18))))); TMNB vs. Isthmus ¼ (1, (2, (3, ((13,
19, 20), ((4–7, 9, 10, 12, 16, 22, 18, 21), (8, 11, 14, 15, 17)))))).
Journal of Biogeography 33, 1889–1904
ª 2006 The Authors. Journal compilation ª 2006 Blackwell Publishing Ltd