Comparative analysis of antibiotic resistance gene markers in

Microbiology (2006), 152, 519–527
DOI 10.1099/mic.0.28287-0
Comparative analysis of antibiotic resistance gene
markers in Mycoplasma genitalium: application to
studies of the minimal gene complement
Oscar Q. Pich,3 Raul Burgos,3 Raquel Planell, Enrique Querol
and Jaume Piñol
Institut de Biotecnologia i Biomedicina and Departament de Bioquı́mica i Biologia Molecular,
Universitat Autònoma de Barcelona, 08193 Bellaterra, Barcelona, Spain
Correspondence
Jaume Piñol
[email protected]
Received 22 June 2005
Revised
6 October 2005
Accepted 2 November 2005
Mycoplasma genitalium has been proposed as a suitable model for an in-depth understanding of
the biology of a free-living organism. This paper reports that the expression of the aminoglycoside
resistance gene aac(69)-aph(20), the only selectable marker hitherto available for M. genitalium
genetic studies, correlates with a growth impairment of the resistant strains. In light of this
finding, a tetM438 construction based on the tetracycline resistance gene tetM was developed;
it can be used efficiently in M. genitalium and confers multiple advantages when compared to
aac(69)-aph(20). The use of tetM438 significantly improves transformation efficiency and generates
visible colonies faster. Finally, the improvements in the pMTnTetM438 construction made it
possible to obtain insertions in genes which have not been previously considered to be
dispensable under laboratory growth conditions.
INTRODUCTION
Mycoplasmas belong to the class Mollicutes, a wide group
of micro-organisms closely related to the Gram-positive
bacteria. Mycoplasmas have small circular genomes, with
Mycoplasma genitalium (517 genes) being the free-living
organism with the smallest gene complement so far described (Fraser et al., 1995). They have the fewest metabolic
pathways described (Pollack et al., 1997) and also exhibit a
very reduced biosynthetic capacity which forces them to
obtain almost all metabolites from the external environment. Therefore, mycoplasmas are parasites of a wide range
of hosts and usually their culture is fastidious in liquid as
well as on solid media.
The genetic manipulation of mycoplasmas is hindered by
the limited number of genetic tools available. The use
of replicative plasmids in mycoplasmas is restricted to
Mycoplasma pulmonis (Cordova et al., 2002), Mycoplasma
capricolum (Lartigue et al., 2003) and Mycoplasma mycoides
(Bergemann et al., 1989; King & Dybvig, 1992). Transposons
have become commonplace in mycoplasma genetics. However, there are several mycoplasmas that remain refractory
to transformation by transposons. Transposons available
for mycoplamas are Tn4001 and Tn916, which were originally isolated from the Gram-positive bacteria Staphylococcus aureus (Lyon et al., 1984) and Enterococcus faecalis
Abbreviations: CDA, colony diameter average; Gm, gentamicin; Tc,
tetracycline.
3These authors contributed equally to this work.
0002-8287 G 2006 SGM
(Franke & Clewell, 1981), respectively. The usefulness of
Tn4001 (4?7 kb) was first demonstrated in Mycoplasma
pneumoniae (Hedreyda et al., 1993) and was then successfully tested in other Mycoplasma species including
Mycoplasma gallisepticum (Cao et al., 1994) and Mycoplasma genitalium (Reddy et al., 1996). In contrast to Tn916
(18 kb), Tn4001 is small enough to be used as a routine
cloning vector. However, one of the problems with the use
of native transposons is their instability and dynamism
once transposed, which makes clear interpretation of the
results difficult. This problem was solved by the construction of a minitransposon based on Tn4001, which places
the tnp gene outside the inverted repeats (Pour-El et al.,
2002).
The tetM and the aac(69)-aph(20) genes from Tn916 and
Tn4001, respectively, have been used as selectable markers
in different Mycoplasma species (Dybvig & Voelker, 1996).
The tetM gene confers tetracycline (Tc) resistance upon all
tested Mycoplasma species. However, in studies focused on
M. genitalium, the aac(69)-aph(20) gene is the only selectable
marker used for transformation (Dhandayuthapani et al.,
1999, 2001). The aac(69)-aph(20) gene confers resistance to
the aminoglycosides gentamicin (Gm), kanamycin and
tobramycin. AAC(69)-APH(20) is a unique bifunctional
enzyme with two different domains: the N-terminal domain
has acetyl-CoA-dependent aminoglycoside acetyltransferase
activity, whereas the C-terminal domain exhibits aminoglycoside kinase activity (Culebras & Martinez, 1999). It has
been suggested that AAC(69)-APH(20) can also phosphorylate several eukaryotic and prokaryotic protein kinase
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 19 Jun 2017 04:46:08
Printed in Great Britain
519
O. Q. Pich and others
substrates, modifying in this way signal transduction or
regulatory pathways (Daigle et al., 1999).
M. genitalium has been proposed as a suitable model to
achieve an in-depth understanding of the biology of a freeliving organism (Roberts, 2004). Fulfilling this goal depends
on the development of new genetic tools and, in particular,
on the identification of new selectable markers for M.
genitalium genetic studies. In this work we describe the
construction of a modified tetM gene (tetM438) that can
be used in M. genitalium. Comparison between the tetM438
and aac(69)-aph(20) genes clearly shows a negative effect of
aac(69)-aph(20) on the growth of M. genitalium. Moreover,
the use of tetM438 increases dramatically the number of
transformants obtained and reduces considerably the time
needed for colonies to become visible. Using tetM438 in
conjunction with a minitransposon derived from Tn4001
(MTn4001), we have been able to obtain insertions in genes
which were previously considered to be necessary for
M. genitalium growth in laboratory conditions (Hutchison
et al., 1999).
METHODS
Culture conditions, plasmids and primers. Escherichia coli strain
XL-1 Blue was used for plasmid amplification. It was grown at 37 uC
in 2YT broth or LB agar plates containing 75 mg ampicillin ml21
with X-Gal (40 mg ml21) and IPTG (24 mg ml21) when needed. All
plasmids and primers used in this work are summarized in Table 1
and Table 2, respectively.
Wild-type M. genitalium strain G37 was grown in SP-4 medium (Tully
et al., 1979) at 37 uC under 5 % CO2 in tissue culture flasks (TPP).
Gm- and Tc-resistant strains were selected on SP-4 agar plates
supplemented with Gm 100 mg ml21 (Invitrogen) or Tc 2 mg ml21
(Roche). We previously determined that growth of strain G37 was
completely abolished at Tc concentrations above 0?5 mg ml21. Efforts
were made to minimize light exposure when Tc-supplemented SP-4
medium was used.
Transformation of M. genitalium. This was performed as described by Reddy et al. (1996), with a few modifications. Briefly,
M. genitalium strain G37 was grown to mid-exponential phase
in 75 cm2 tissue culture flasks. Attached mycoplasmas were scraped
off and passed through a 0?45 mm low protein binding filter
(Millipore). The filtered cells were then recultured for 24 h in 40 ml
SP-4 medium in 150 cm2 tissue culture flasks. Attached mycoplasmas were washed three times with electroporation buffer (8 mM
HEPES pH 7?2, 272 mM sucrose), scraped off and resuspended in
this buffer at a concentration of approximately 109 cells ml21. Then
90 ml mycoplasma cell suspension was mixed with 5 mg plasmid
DNA previously dissolved in 20 ml electroporation buffer. The
mixture was transferred to a 2 mm gapped electroporation Plus
BTX cuvette, kept on ice for 15 min and then electroporated
(2?5 kV, 129 V) using an electro cell manipulator 600 (BTX). After
15 min on ice, 900 ml SP-4 was added and the cells were incubated at 37 uC for 2 h. Aliquots of 200 ml were spread onto
Gm- or Tc-supplemented SP-4 agar plates. Isolated colonies were
picked, propagated in 5 ml cultures and stored at 280 uC. Several
20 ml drops from serial dilutions of the electroporated cells were
spotted on SP-4 agar plates to determine the number of viable
cells. The same procedure was used to determine the number of
transformant cells, except that SP-4 agar plates were supplemented
with Gm or Tc. Colonies from eight spots on each of two different
plates were counted to determine the number of viable or transformant cells.
DNA manipulations. General DNA manipulations were performed
according to Sambrook & Russell (2001). Plasmid DNA was
obtained by using the Fast Plasmid Mini Eppendorf Kit. All PCR
products were previously cloned into EcoRV-digested pBE and then
excised with the corresponding restriction enzyme (Roche). PCR
products and digested fragments were purified from agarose gels
using the EZNA gel extraction Kit (Omega Bio-tek).
Plasmid pBSKII+ was used for the construction of pMTn4001.
First, the tnp gene was amplified from pIVT-1 by PCR using
primers tnp59 and tnp39, which include Bsi WI and SpeI restriction sites at the 59 and 39 ends of the PCR product, respectively.
Then, the 1?3 kb PCR product was digested with Bsi WI/SpeI and
included in a ligation mixture containing Acc65I/ApaI-digested
pBSKII+ and 50 pmol of both IRO-1 and IRO-2 oligonucleotides.
In this way, the annealed oligonucleotides recreate an outer inverted
repeat adapter. The construction obtained (pRP1) was digested
with NotI and SacI and included in a ligation mixture containing
50 pmol of both IRI-1 and IRI-2 oligonucleotides to reconstitute
an inner inverted repeat adapter. One clone with the expected
restriction pattern was sequenced to confirm that no mutations were
Table 1. Plasmids
Plasmid
pBE
pIVT-1
pAM120
pRP1
pMTn4001
pMTnGm
pMTnORFTet
pMTnTetM438
pENT438
520
Description
Source
pBSKII+ with MCS removed and substituted by a single EcoRV site
Contains Tn4001T derivative
Contains Tn916
pBSKII+ containing tnp gene and IRO from Tn4001
pRP1 containing IRI from Tn4001
pMTn4001 containing the aac(69)-aph(20) marker
pMTn4001 containing the tetM coding region
pMTn4001 containing the tetM438 marker
pUC18 containing the region of the M. genitalium genome (NC_000908)
from nt 541621 to nt 545324, which includes the mg438 coding region
and flanking regions
This study
Dybvig et al. (2000)
Gawron-Burke & Clewell (1984)
This study
This study
This study
This study
This study
This study
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 19 Jun 2017 04:46:08
Microbiology 152
Antibiotic resistance gene markers in M. genitalium
Table 2. Primers
Bold indicates the restriction sites introduced at the 59 end of selected primers. Italic indicates the 22 nt from the putative mg438 gene promoter region. Underlining indicates the three stop codons present in the inverted repeats to prevent translation of the disrupted genes
(Byrne et al., 1989).
Primer
Sequence (5§–3§)
tnp-59
tnp-39
IRO-1
IRO-2
IRI-1
IRI-2
aac-aph-5939
TAGAATet-59
MG438PE
ORFTc-59*
ORFTc-39*
RTMG438-59D
RTMG438-39D
ORFGm-59d
ORFGm-39d
RTMG297-59§
RTMG297-39§
RTMG359-59||
RTMG359-39||
Tc upstream
Tc downstream
*Used
DUsed
dUsed
§Used
||Used
to
to
to
to
to
perform
perform
perform
perform
perform
CGTACGAATTGTGTAAAAGTAAAAAG
ACTAGTCTACTTATCAAAATTGATG
CTAGATAAAGTCCGTATAATTGTGTAAAAGGGCC
CTTTTACACAATTATACGGACTTTAT
GATAAAGTCCGTATAATTGTGTAAAAGC
GGCCGCTTTTACACAATTATACGGACTTTATCAGCT
GGATTCGCGCATCATTGGATGATGGATTCG
GAATTCTAGTATTTAGAATTAATAAAGTATGAAAATTATTAATATTGG
CAGTTCTTCCTGAATTTTTTACACC
GGATCCATGAAAATTATTAATATTGGAGTT
GGATCCCTAAGTTATTTTATTGAACATATA
TTGTTGGTGGATCTTGTGGTTATGT
CAGCTACAAAACCAGTGTTATCAAT
GGATCCATGAATATAGTTGAAAATGAAATATG
GGATCCAATCTTTATAAGTCCTTTTATAAATTTC
TCCACCCTTAGCAGAACCATC
ACAACTACTTTAGCTAAGATAGC
TGGGTAAAACTACTTTAGCCAG
GCTTTCCATAGATACTTACCATC
GGTAGTTTTTCCTGCATCAACATG
CGTCGTCCAAATAGTCGGATAG
tetM RT-PCR.
mg438 RT-PCR.
aac(69)-aph(20) RT-PCR.
mg297 RT-PCR.
mg359 RT-PCR.
introduced by these procedures. Most of the initial restriction sites of
the pBSKII+ multicloning site (from ApaI to NotI) remain in
pMTn4001.
The aac(69)-aph(20) gene was amplified by PCR from pIVT-1 by
using aac-aph-5939 as a single primer. The resulting 2?5 kb fragment
was digested with BamHI, purified and ligated into BamHI-digested
pMTn4001, creating plasmid pMTnGm. For the construction of
pMTnORFTet, the tetM coding region was PCR amplified from
pAM120 by using primers ORFTc-59 and ORFTc-39, which include
BamHI sites at the ends. The 2 kb PCR product was cloned into
BamHI-digested pMTn4001. Finally, to construct pMTnTetM438
the tetM coding region was amplified from pAM120 using primers
TAGAATet-59 and ORFTc-39. The TAGAATet-59 oligonucleotide
creates a fusion of the tetM coding region and the 22 bp region located
upstream of the mg438 translational start codon. The 2 kb PCR
product was cloned into EcoRI/BamHI-digested pMTn4001 to obtain
plasmid pMTnTetM438.
c.f.u. per plate) was spread to make colony size measurements comparable. Thus, while cells electroporated in the presence of pMTnGm
were spread undiluted onto several Gm-supplemented SP-4 agar
plates, a 1022 dilution of the cells electroporated in the presence of
pMTnTetM438 was spread onto Tc-supplemented SP-4 agar plates. To
reduce inter-experiment variability, electroporation of either minitransposon derivative was performed sequentially by using aliquots of the
same batch of cells and the same medium stock. Additionally, duplicate
electroporations were performed to reduce intra-experimental variability. As Tc is readily inactivated in the presence of light, plates were
not returned to the incubator once examined. Thus, the same transformation was spread on different plates and a single plate from each
transformation experiment was removed from the incubator for examination at 10, 12, 14 and 16 days after electroporation. Several pictures
were taken of each plate by using a LeicaMZFLIII microscope and a
LeicaDC500 camera. The diameter of 100 colonies was measured by
using the Scion Image processing and analysis program to obtain the
colony diameter average (CDA).
Assay to compare the growth of MTnGm and MTnTetM438
transformants. To monitor and compare the growth of MTnGm-
Assay to determine the effect of Gm or Tc on the colony size of
MTnGm or MTnTetM438 transformants. M. genitalium cells were
and MTnTetM438-transformed cells, we quantified both colony
number and size at different days after electroporation. Because
colony size is strongly reduced when plates are crowded, a low
number of MTnGm- and MTnTetM438-transformed cells (100–500
electroporated in the presence of pMTnGm or pMTnTetM438
and the resultant transformants were grown in liquid medium
supplemented with Gm or Tc respectively. Then, transformants were
scraped off, passed through a 0?22 mm filter and plated on SP-4 agar
http://mic.sgmjournals.org
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 19 Jun 2017 04:46:08
521
O. Q. Pich and others
with or without antibiotic. The CDA of each sample was obtained
after 14 days of incubation. Wild-type cells were also plated to obtain
a reference CDA.
Southern blots. Eight MTnTetM438 transformants were selected
and cultured in 20 ml Tc-supplemented SP-4 medium. Cells were
then scraped off and genomic DNA was isolated by using the EZNA
Bacterial DNA Kit (Omega Bio-tek). Genomic DNAs were digested
with HindIII and probed by Southern blot hybridization by using
the Dig DNA Labelling and Detection Kit (Roche). A 2 kb BamHI
fragment from pMTnORFTet containing the tetM coding region was
used as a probe.
RNA manipulation. Total RNA was isolated from 20 ml cultures
using TRI Reagent (Invitrogen), following the recommendations of
the manufacturer. For RT-PCR assay, total RNAs were retrotranscribed by using random hexamers and the SuperScript First-Strand
Synthesis system (Invitrogen). PCRs were then performed by using
the primers listed in Table 2.
Primer extension of mg438 was performed by annealing 2 pmol
59-Cy5-labelled MG438PE primer with 5 mg total RNA. First-strand
synthesis was carried out as described above. Eight microlitres of
the preceding reaction were analysed in an ALF DNA sequencer
(Pharmacia Biotech). The product of the standard sequencing
reactions, using the same 59-Cy5-labelled primer and pENT438
plasmid as DNA template, was included in the same sequencing gel.
Genomic DNA sequencing. Genomic DNA from 30 independent
MTnTetM438 transformants was isolated as described above. Sequencing with fluorescent dideoxynucleotides was performed by using the
Big Dye 3.0 Terminator Kit (Applied Biosystems) and Tc upstream
and Tc downstream primers, following the recommendations of
the manufacturer, and analysed in an ABI 3100 Genetic Analyser
(Applied Biosystems).
RESULTS AND DISCUSSION
(a)
2.0 kb
(b)
1
2
3
1.5 kb
4
5
6
1
2
3
0.5 kb
Fig. 1. Transcriptional analysis by RT-PCR of the aac(69)aph(20), tetM and mg438 genes in M. genitalium. (a) Total
RNA was isolated from a Tn4001T transformant culture. Lanes
1 and 4 are the RT-PCR negative controls for aac(69)-aph(20)
and tetM, respectively. Lanes 2 and 5 are the RT-PCRs performed for aac(69)-aph(20) and tetM, respectively. Lanes 3 and
6 are the respective PCR positive controls performed with the
corresponding genomic DNAs. (b) Total RNA was isolated from
a wild-type strain culture. Lanes: 1, mg438RT-PCR negative
control; 2, the RT-PCR performed for mg438; 3, the PCR positive control performed with genomic DNA.
based on the tetM coding region under the control of the
mg438 putative promoter (tetM438) was developed.
Determination of the mg438 transcriptional start
point
To identify the mg438 promoter region, we determined its
transcriptional start point by primer extension (Fig. 2). For
this purpose, the primer MG438PE, which anneals 200 bp
downstream of the mg438 translational start codon, was
used. In accordance with previous transcriptional studies
performed in M. pneumoniae (Weiner et al., 2000) and M.
genitalium (Musatovova et al., 2003), heterogeneous transcriptional start points were observed. Bases at the mRNA 59
end were A, A, T and A, which were located at 3, 5, 6 and
tetM expression analysis in M. genitalium
Since the usefulness of the tetM marker has been demonstrated for several mycoplasma species, we assayed the functionality of this gene in M. genitalium. For this purpose,
several Tn4001T tranformants were obtained by electroporation in the presence of pIVT-1. This plasmid bears both
the aac(69)-aph(20) and the tetM markers (Dybvig et al.,
2000). Transformants were selected in the presence of
Gm. The resulting Tn4001T transformants were then spread
onto SP-4 agar plates supplemented with different concentrations of Tc; no growth was observed even at the lowest Tc
concentration. To test whether the absence of Tc resistance
was due to a defect in transcription of the tetM, total RNA
from several Tn4001T transformants was isolated and RTPCR assays were performed (Fig. 1a). As a RT-PCR positive
control we used a 0?5 kb internal fragment from the mg438
(Fig. 1b), a gene of constitutive expression recently characterized in our laboratory (data not shown). As expected,
amplification of the aac(69)-aph(20) cDNA (1?5 kb) was
clearly detected. However, no amplification was observed
for the tetM cDNA (2 kb), suggesting the absence (or a very
low level) of tetM transcription in M. genitalium. To further
assess the functionality of tetM in M. genitalium, a construct
522
Fig. 2. Determination of the mg438 transcriptional start points.
(a) Standard ALF output corresponding to the sequencing reaction. The sequence shown is the reverse and complementary to
the mg438 coding sequence. (b) Chromatogram obtained with
the primer extension sample. The two profiles are aligned
according to their respective running time. The two putative
”10 regions found are boxed and the translational start codon
is underlined.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 19 Jun 2017 04:46:08
Microbiology 152
Antibiotic resistance gene markers in M. genitalium
7 bp upstream from the translational start codon, respectively. Analysis of the region located immediately upstream
of the determined transcriptional start points allowed us to
identify two putative 210 boxes: TAGTAT and TAGAAT.
These 210 boxes are in agreement with the consensus
previously described for M. pneumoniae (Weiner et al.,
2000). Neither a 235 box nor a canonical RBS could be
identified. The lack of a 235 box seems a major feature of
mycoplasma promoters (Weiner et al., 2000). Transcription
of genes lacking a 235 box has been reported in other
bacteria (Sabelnikov et al., 1995). However, these genes
have an extended 210 region that can not be found in the
region immediately upstream of the mg438 coding region.
The presence in M. genitalium of regulatory elements other
than 210 boxes remains to be investigated.
Construction and functionality of the tetM438
marker in M. genitalium
To avoid the genomic instability of Tn4001, we constructed
a minitransposon named pMTn4001 (Fig. 3) with a structure very similar to that described by Pour-El et al. (2002).
First, we developed a pMTn4001 derivative (pMTnGm)
harbouring the aac(69)-aph(20) marker to test the functionality of MTn4001. A second construction (pMTnTetM438),
harbouring the tetM438 marker, was also developed. The
tetM438 marker is a fusion between the 22 bp region located
immediately upstream of the mg438 translational start codon
(including the two putative promoters identified) and the
tetM coding region. A third construction (pMTnORFTet)
based on pMTn4001 harbouring only the tetM coding region
was designed to exclude the presence in pMTn4001 of any
sequence able to promote transcription of the tetM coding
region in M. genitalium. Initial electroporation studies were
performed using the three plasmids described above. Transformation efficiencies obtained with pMTnGm and pMTn
TetM438 were 561025 and 161023 per viable cell, respectively. As expected, no transformants were obtained when
M. genitalium cells were electroporated in the presence of
pMTnORFTet. This result confirms that the 22 bp selected
region promotes transcription of the tetM438 marker in the
MTnTetM438 minitransposon and also the effective translation of the resulting transcript. Thus, this result suggests
the presence in this 22 bp region of a RBS different from
the canonical one complementary to 16S RNA or alternatively the possibility that mycoplasma ribosomes could
initiate translation through a 59 mRNA end in a way similar
to eukaryotes, as has been already proposed (Weiner et al.,
2000).
In addition to the surprisingly higher transformation efficiency of MTnTetM438, colonies derived from this minitransposon were also noticeably larger than those derived
from MTnGm. To monitor these differences, a new set of
electroporation experiments was devised to carefully quantify both colony number and size at different days after
electroporation. The transformation efficiency obtained for
each plasmid in such a set of experiments is shown in
Table 3. The earliest colonies derived from MTnTetM438
transformants were observed 10 days after plating, while no
colonies derived from MTnGm transformants were detected
until day 12 (Fig. 4). The number of MTnTetM438 transformants obtained at days 12, 14 and 16 was 50-, 35- and 25fold higher, respectively, than for MTnGm transformants.
Fig. 3. Schematic representation of plasmid pMTn4001, showing the multicloning site with the available restriction enzyme
sites. The plasmid skeleton is based on the pBSKII+ (bla, b-lactamase; f1(+) ori, single-stranded replication origin; ColE1
ori, vegetative replication origin; tnp, transposase from Tn4001). The boxes show the marker genes cloned in the multicloning
site to obtain pMTnGm, pMTnTetM438 and pMTnORFTet respectively.
http://mic.sgmjournals.org
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 19 Jun 2017 04:46:08
523
O. Q. Pich and others
Table 3. Transformation efficiencies obtained for pMTnTetM438 and pMTnGm
Values represent the mean of multiple platings (see Methods) of one representative transformation assay.
Assay
1
2
3
4
Plasmid
Viable cells (c.f.u.)
Transformation efficiency*
pMTnTetM438
pMTnTetM438
pMTnGm
pMTnGm
9?756107
1?056108
9?756107
1?056108
1?4861023
1?0761023
4?0761025
5?1761025
*Transformants per viable cell.
This result confirms that the number of transformants
obtained with pMTnTetM438 is significantly higher than
that obtained with pMTnGm.
The average diameter of colonies derived from each minitransposon at different days after electroporation was
determined. The CDA of MTnTetM438 transformants
was always higher than that of MTnGm transformants
and increased from day 10 to day 16 (Fig. 4). The CDA of
MTnGm transformants also clearly increased between
days 12 and 16 (Fig. 4). These results show that although
the aac(69)-aph(20) gene can be used as an effective
selectable marker, undesired effects are also evident on
the growth of MTnGm-transformed M. genitalium cells.
The slower growth of MTnGm transformants could possibly be due to a residual negative effect of Gm on mycoplasma cell growth. However, when MTnGm transformants
were plated without antibiotic, the CDA was as low as
that obtained when Gm was present (Table 4), and the
CDA of MTnTetM438 transformants was very similar to
that exhibited by the wild-type colonies. These data suggest
that the negative effects described above do not result
from an inefficient Gm inactivation by AAC(69)-APH(20)
but are a direct consequence of aac(69)-aph(20) expression
in M. genitalium. These results also show that the use of
tetM438 marker has no detrimental effect on growth of
M. genitalium.
Day 10
524
Day 12
Day 14
Table 4. CDA of wild-type strain and MTnTetM438 or
MTnGm transformants
CDAs were obtained after 14 days incubation in presence or
absence of antibiotic. Values are means±SE of diameters of 100
colonies from two separate experiments.
CDA (mm)
MTnGm
MTnTetM438
Wild-type
NA
With antibiotic
0?139±0?006 0?367±0?022
Without antibiotic 0?148±0?007 0?380±0?028 0?393±0?045
Aminoglycoside antibiotics such as Gm are readily inactivated by AAC(69)-APH(20) phosphorylation (Boehr et al.,
2004). It has been reported that aminoglycoside phosphotransferase enzymes are also serine protein kinases (Daigle
et al., 1999). Since there is evidence of protein modification by phosphorylation in mycoplasmas (Dirksen et al.,
1994; Platt et al., 1988), we hypothesize that AAC(69)APH(20) may phosphorylate some M. genitalium proteins,
probably thereby modifying the intracellular signalling.
The relationship between the possible phosphorylation of
mycoplasma proteins by AAC(69)-APH(20) and the reduction of colony size remains to be investigated. However, the
negative effect of aac(69)-aph(20) gene expression has to be
Day 16
Fig. 4. Colonies derived from MTnTetM438
(top row) or MTnGm transformants (bottom
row) after 10–16 days of growth. Bar, 1 mm.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 19 Jun 2017 04:46:08
Microbiology 152
Antibiotic resistance gene markers in M. genitalium
considered when designing gene knock-out experiments by
either transposition or homologous recombination.
Random insertion and stability of MTnTetM438
in the M. genitalium chromosome
Genomic DNA isolated from eight independent clones
selected from the MTnTetM438 transformants obtained
was analysed by Southern blotting (data not shown). As
expected, the presence of a single band of different size in
each clone showed that MTnTetM438 is randomly inserted
in the M. genitalium genome. Since no additional band was
Table 5. Transposon insertion sites of 30 randomly selected
MTnTetM438 transformants
Clone
no.
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
Insertion site
Coding
region*
Intergenic
region
mg032-ND
mg358-DD
Annotated
function
Hypothetical protein
RuvA
detected, we conclude that MTnTetM438 inserts as a single
copy and remains stable once transposed.
We also addressed the question of whether insertions in
genomic locations not previously described when using
aac(69)-aph(20) could be obtained with pMTnTetM438. We
determined the transposon insertion site of 30 randomly
selected MTnTetM438 transformants (Table 5). We found
28 different transposon insertion sites and two transposon
insertions in the same location of the mg269 and mg281
coding regions. Four transposon insertions located in
the intergenic regions were in sequences belonging to a
family of repetitive DNA elements known as MgPa islands
(Peterson et al., 1995). Surprisingly, transposon insertions
were detected in two coding regions, mg298 and mg358, in
which no transposon insertions were previously reported in
the global transposon mutagenesis analysis (Hutchison et al.,
1999). Moreover, both transposon insertions are expected
to disrupt the gene function (Fig. 5a, b). The mg298 gene
encodes P115, a protein with unknown function, and
the mg358 gene is currently annotated as ruvA, which is
involved in the resolution of Holliday intermediates. The
ruvA gene has been previously shown to be dispensable in
MgPa (mgp-r7)
mg269-D
Hypothetical protein
mg288m-mg289
mg357-mg358
mg294-D
mg385-D
Hypothetical protein
Hypothetical protein
mg041-mg042
mg317-D
Hmw3 homologue
mg061-mg062
mg199-mg200
mg272-mg273
mg269-D
mg278-D
mg285-D
Hypothetical protein
SpoT
Hypothetical protein
MgPa (mgp-r2)
mg438-D
Hypothetical protein
mg381-mg382
mg226-D
mg281-ND
mg298-DD
Hypothetical protein
Hypothetical protein
P115 protein
MgPa (mgp-r2)
mg191-D
mg110-D
mg363.1-ND
MgpB
Hypothetical protein
RpsT
mg024-mg025
mg281-ND
mg200-ND
Hypothetical protein
DnaJ-like protein
MgPa (mgp-r4)
*D, disruptive insertion; ND, non-disruptive insertion. Only insertion
points within the 59-most 80 % of the gene but downstream of nt 9
of the protein-coding region were considered to be disruptive of the
gene function (Hutchison et al., 1999).
DNo transposon insertions were previously reported for these coding
regions in the global transposon mutagenesis analysis.
http://mic.sgmjournals.org
Fig. 5. (a, b) Schematic representation showing the precise
insertion points of MTnTetM438 in the mg298 (a) and mg358
(b) genes. Both transposon insertions are centred in the target
gene and are expected to disrupt the gene function. (c)
Transcriptional analysis by RT-PCR of the mg297 and mg359
genes in the MTnTetM438 transformant clones 2 and 22,
respectively. Total RNA was isolated from cultures of these
clones and the wild-type strain. Lanes 2 and 4 correspond to
the mg359 RT-PCR products obtained from total RNA isolated
from the wild-type and clone 2, respectively. Lanes 6 and 8 are
the mg297 RT-PCR products obtained from total RNA isolated
from the wild-type and clone 22, respectively. Lanes 1, 3, 5
and 7 correspond to the respective RT-PCR negative controls.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 19 Jun 2017 04:46:08
525
O. Q. Pich and others
E. coli (Sharples et al., 1990). No transcriptional defects
derived from the transposon insertions were detected by
RT-PCR in the downstream genes mg297 and mg359
(Fig. 5c), which have also been considered as essential.
However, disruptive insertions in the mg298 and mg358
coding regions show that M. genitalium genes which have
not been previously considered as dispensable under laboratory growth conditions could be knocked out by our
pMTnTetM438 construction; thus the list of non-essential
M. genitalium genes could be longer than previously
described.
Dirksen, L. B., Krebes, K. A. & Krause, D. C. (1994). Phosphorylation
of cytadherence-accessory proteins in Mycoplasma pneumoniae.
J Bacteriol 176, 7499–7505.
Dybvig, K. & Voelker, L. L. (1996). Molecular biology of
mycoplasmas. Annu Rev Microbiol 50, 25–57.
Dybvig, K., French, C. T. & Voelker, L. L. (2000). Construction
and use of derivatives of transposon Tn4001 that function in
Mycoplasma pulmonis and Mycoplasma arthritidis. J Bacteriol 182,
4343–4347.
Franke, A. E. & Clewell, D. B. (1981). Evidence for a chromosomeborne resistance transposon (Tn916) in Streptococcus faecalis that is
capable of "conjugal" transfer in the absence of a conjugative
plasmid. J Bacteriol 145, 494–502.
Fraser, C. M., Gocayne, J. D., White, O. & 26 other authors (1995).
ACKNOWLEDGEMENTS
The minimal gene complement of Mycoplasma genitalium. Science
270, 397–403.
This work was supported by grant BFU2004-06377-C02-01 to E. Q.
R. B. acknowledges an FPU predoctoral fellowship from the Ministerio
de Educación y Ciencia. O. Q. and R. P. acknowledge a predoctoral
fellowship from CeRBa (Centre de Referència en Biotecnologia).
Plasmids pIVT-1 and pAM120 were the kind gifts of Dr K. Dybvig and
Dr D. B. Clewell, respectively. We thank Dra Oxana Musatovova
(UTHSCSA) for her valuable advice on performing primer extension
and Joan Ruiz (UAB) for performing primer extension ALF analysis.
We also thank Anna Barceló (Servei de Seqüenciació UAB) for DNA
sequencing.
Gawron-Burke, C. & Clewell, D. B. (1984). Regeneration of
insertionally inactivated streptococcal DNA fragments after excision
of transposon Tn916 in Escherichia coli: strategy for targeting
and cloning of genes from gram-positive bacteria. J Bacteriol 159,
214–221.
Hedreyda, C. T., Lee, K. K. & Krause, D. C. (1993). Transformation
of Mycoplasma pneumoniae with Tn4001 by electroporation. Plasmid
30, 170–175.
Hutchison, C. A., Peterson, S. N., Gill, S. R., Cline, R. T., White, O.,
Fraser, C. M., Smith, H. O. & Venter, J. C. (1999). Global trans-
poson mutagenesis and a minimal Mycoplasma genome. Science 286,
2165–2169.
REFERENCES
King, K. W. & Dybvig, K. (1992). Nucleotide sequence of Mycoplasma
Bergemann, A. D., Whitley, J. C. & Finch, L. R. (1989). Homology of
Lartigue, C., Blanchard, A., Renaudin, J., Thiaucourt, F. & SirandPugnet, P. (2003). Host specificity of mollicutes oriC plas-
mycoides subspecies mycoides plasmid pKMK1. Plasmid 28, 86–91.
mycoplasma plasmid pADB201 and staphylococcal plasmid pE194.
J Bacteriol 171, 593–595.
Boehr, D. D., Daigle, D. M. & Wright, G. D. (2004). Domain-domain
interactions in the aminoglycoside antibiotic resistance enzyme
AAC(69)-APH(20). Biochemistry 43, 9846–9855.
Byrne, M. E., Rouch, D. A. & Skurray, R. A. (1989). Nucleotide
mids: functional analysis of replication origin. Nucleic Acids Res
31, 6610–6618.
Lyon, B. R., May, J. W. & Skurray, R. A. (1984). Tn4001: a gentamicin
and kanamycin resistance transposon in Staphylococcus aureus. Mol
Gen Genet 193, 554–556.
sequence analysis of IS256 from the Staphylococcus aureus gentamicintobramycin-kanamycin-resistance transposon Tn4001. Gene 81, 361–
367.
Musatovova, O., Dhandayuthapani, S. & Baseman, J. B. (2003).
Cao, J., Kapke, P. A. & Minion, F. C. (1994). Transformation of
Peterson, S. N., Bailey, C. C., Jensen, J. S., Borre, M. B., King, E. S.,
Bott, K. F. & Hutchison, C. A., 3rd (1995). Characterization of
Mycoplasma gallisepticum with Tn916, Tn4001, and integrative
plasmid vectors. J Bacteriol 176, 4459–4462.
Transcriptional starts for cytadherence-related operons of Mycoplasma genitalium. FEMS Microbiol Lett 229, 73–81.
Cordova, C. M., Lartigue, C., Sirand-Pugnet, P., Renaudin, J., Cunha,
R. A. & Blanchard, A. (2002). Identification of the origin of
repetitive DNA in the Mycoplasma genitalium genome: possible role
in the generation of antigenic variation. Proc Natl Acad Sci U S A 92,
11829–11833.
replication of the Mycoplasma pulmonis chromosome and its use in
oriC replicative plasmids. J Bacteriol 184, 5426–5435.
Platt, M. W., Rottem, S., Milner, Y., Barile, M. F., Peterkofsky, A. &
Reizer, J. (1988). Protein phosphorylation in Mycoplasma gallisepti-
Culebras, E. & Martinez, J. L. (1999). Aminoglycoside resistance
cum. Eur J Biochem 176, 61–67.
mediated by the bifunctional enzyme 69-N-aminoglycoside acetyltransferase-20-O-aminoglycoside phosphotransferase. Front Biosci 4,
D1–D8.
Pollack, J. D., Williams, M. V. & McElhaney, R. N. (1997). The
Daigle, D. M., McKay, G. A., Thompson, P. R. & Wright, G. D. (1999).
Aminoglycoside antibiotic phosphotransferases are also serine
protein kinases. Chem Biol 6, 11–18.
Dhandayuthapani, S., Rasmussen, W. G. & Baseman, J. B. (1999).
Disruption of gene mg218 of Mycoplasma genitalium through
homologous recombination leads to an adherence-deficient phenotype. Proc Natl Acad Sci U S A 96, 5227–5232.
Dhandayuthapani, S., Blaylock, M. W., Bebear, C. M., Rasmussen,
W. G. & Baseman, J. B. (2001). Peptide methionine sulfoxide reduc-
tase (MsrA) is a virulence determinant in Mycoplasma genitalium.
J Bacteriol 183, 5645–5650.
526
comparative metabolism of the mollicutes (mycoplasmas): the utility
for taxonomic classification and the relationship of putative gene
annotation and phylogeny to enzymatic function in the smallest freeliving cells. Crit Rev Microbiol 23, 269–354.
Pour-El, I., Adams, C. & Minion, F. C. (2002). Construction of
mini-Tn4001tet and its use in Mycoplasma gallisepticum. Plasmid 47,
129–137.
Reddy, S. P., Rasmussen, W. G. & Baseman, J. B. (1996). Isolation
and characterization of transposon Tn4001-generated, cytadherencedeficient transformants of Mycoplasma pneumoniae and Mycoplasma
genitalium. FEMS Immunol Med Microbiol 15, 199–211.
Roberts, R. J. (2004). Identifying protein function – a call for com-
munity action. PLoS Biol 2, E42.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 19 Jun 2017 04:46:08
Microbiology 152
Antibiotic resistance gene markers in M. genitalium
Sabelnikov, A. G., Greenberg, B. & Lacks, S. A. (1995). An extended
210 promoter alone directs transcription of the DpnII operon of
Streptococcus pneumoniae. J Mol Biol 250, 144–155.
Sambrook, J. & Russell, D. W. (2001). Molecular Cloning: a
Laboratory Manual, 3rd edn. Cold Spring Harbor, NY: Cold
Spring Harbor Laboratory.
Sharples, G. J., Benson, F. E., Illing, G. T. & Lloyd, R. G. (1990).
Molecular and functional analysis of the ruv region of Escherichia coli
http://mic.sgmjournals.org
K-12 reveals three genes involved in DNA repair and recombination.
Mol Gen Genet 221, 219–226.
Tully, J. G., Rose, D. L., Whitcomb, R. F. & Wenzel, R. P. (1979).
Enhanced isolation of Mycoplasma pneumoniae from throat washings
with a newly-modified culture medium. J Infect Dis 139, 478–482.
Weiner, J., 3rd, Herrmann, R. & Browning, G. F. (2000).
Transcription in Mycoplasma pneumoniae. Nucleic Acids Res 28,
4488–4496.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 19 Jun 2017 04:46:08
527